Journal of Medical and Biological Engineering, 27(1): 7-14

7

Genipin Cross-linking of Type II Collagen-chondroitin

Sulfate-hyaluronan Scaffold for Articular Cartilage Therapy

Chih-Shen Ko Chun-Hsien Wu Hsin-Ho Huang1 I-Ming Chu*

Department of Chemical Engineering, National Tsing Hua University, Hsinchu Taiwan 300, R O C 1Bioengineering Research Center, National Tsing Hua University, Hsinchu Taiwan 300, R O C

Received 20 Dec 2006; Accepted 20 Mar 2007

Abstract

Articular cartilage extracellular matrixes are composed of type II collagen, chondroitin sulfate (CS) and

hyaluronan (HA). Type II collagen is the major structural protein in hyaline cartilage. Modification of the collagen

scaffold which mimics articular cartilage biochemically by glycosaminoglycans (GAGs) hyaluronan (HA) and

chondroitin sulfate (CS) may enhance chondrocyte differentiation into more functional forms or promote preservation

of the differentiated state of the cells. In the investigation, we prepared, characterized, and evaluated type II collagen

scaffold with and without HA and CS. In order to fabricate porous scaffold containing collagen, HA and CS the mixture

was freeze dried at –20 °C, -80 °C and -196 °C. The porous scaffold was cross-linked by genipin to enhance mechanical

stability. Scanning electron microscope (SEM) observation of the scaffold demonstrated that the scaffold had

interconnected pores after cross-linking process with mean diameters of 80~300 µm and porosity of 90-95% depending

on freezing temperature. In cytotoxicity test using human articular primary cells, the cross-linked scaffold showed no

significant cytotoxicity. The data of GAG and DNA content of cultivated cartilage on scaffolds demonstrated that high

molecular mass HA and long chain CS have potential to up-regulate biochemical synthesis rate of chondrocytes.

Keywords: Type II collagen, Genipin, Chondroitin sulfate, Hyaluronan, Hyaline cartilage

Introduction

An ideal tissue-engineered cartilage should be able to

produce extracellular matrix (ECM) that mimics the natural

ECM in composition and properties. Articular cartilage

extracellular matrixes are composed of type II collagen (COL

II), chondroitin sulfate (CS) and hyaluronan (HA). CS and HA

may offer the binding and modulation growth factors and

cytokines and involvement in adhesion, proliferation [1-3],

differentiation and migration of cells. HA assists in the

development and integration of cartilage tissue and is in higher

quantities during embryonic cartilage development [4-6]. COL

II is the major structural protein in hyaline cartilage and

contains the Arg–Gly–Asp sequence, which facilitates cell

attachment [6]. Various biodegradable and biocompatible

materials have been employed in scaffolds for engineering

cartilage, and these biomaterials include COL I or II and CS [4,

5, 7-9] polylactic and polyglycolic acid [10, 11],

polysaccharides, chitosan /collagen/GAGs, beta-chitin sponge

[12-15], COL II and hyaluronic acid [16], gelatin / CS / HA [6],

alginate, demineralized bone and hydroxyapatite composites.

As mentioned above, the physico-chemical characteristics of

the biomaterials can affect greatly the phenotype of the

* Corresponding author: I-Ming Chu

Tel: +886-3-5713704; Fax: +886-3-5715408

E-mail: imchu@che.nthu.edu.tw

chondrocyte. Therefore scaffolds that are similar to natural

ECM may be able to create a microenvironment that can

induce chondrocytes into appropriate differentiation and

functional state under in vitro conditions. Consequently,

modification of the collagen scaffolds by CS and HA may

enhance chondrocyte differentiation into better cartilage and

provide the necessary molecules for cell attachment. In this

study, a novel cross-linking agent, genipin, was used to

construct biodegradable porous composite COL II scaffolds

with different amounts of CS and HA. Genipin derived from

plant substances affords versatile cross-linking reactivity

between amino groups, while having very low toxicity toward

cells (17).

We prepared, characterized, and evaluated COL II

scaffold with and without HA and CS in the investigation. The

performances of the scaffolds for cartilage growth from

chondrocytes were assessed by morphology, H&E stain, alcian

blue stain, and ECM production and gene expression.

We expected that porous scaffold which mimicked

articular cartilage biochemically might induce appropriate

differentiation of cells and synthesis of extracellular matrix.

Preliminary results showed that the porous scaffold could be

used as a support matrix for cartilage reconstruction.

Materials and Methods

J. Med. Biol. Eng., Vol. 27. No. 1 2007

8

Collagen type II isolation and scaffold fabrication

Collagen type II was treated with pepsin to produce

atelocollagen, which could be purified, and we modified the

final washing procedure in order to increase purity. Briefly,

collagen II was purified from bovine trachea by the following

steps (7): Bovine tracheae removed of all adhering tissues and

fat were cut into parts of 0.5 cm sizes and immersed in D.I.

water for 2 h. They were then washed by (i) 8 times of volume

of 50 mM Tris-HCl (pH 7.2) buffer containing 25 mM

EDTA-Na2 and 2 mM N-ethylmaleimide (NEM) for 16 h, (ii) 4

M guanidine-HCl for 24 h (4 times), (iii) 0.5 M acetic acid for

96 h (8 vol, 4 times × 24 times) and (iv) 0.5 M acetic acid plus

8×106 units pepsin / L (Sigma) for 16 h. After centrifugation at

12,000 rpm for 20 min, the collagen was precipitated by 0.86

M NaCl and resuspended in 0.5 M acetic acid at 0.5 % w/v.

This precipitation-resuspension step was repeated 3 times. The

final collagen solution was dialyzed against 0.02 M phosphate

buffer (pH 7.4). After centrifugation (12000 rpm, 20 min),

collagen was then washed twice and lyophilized. Afterwards,

COL II matrix was made by lyophilization under different

conditions to render it porous, namely, 100 mg lyophilized

collagen were homogenized in acetic acid at 4 °C at 1.2 % w/v.

The solution was poured into molds and then was frozen and

lyophilized. The pore size of the scaffold was controlled by the

freezing temperatures and the acetic acid concentration present

in the solution.

The pure COL II matrices were left in 70% alcohol

overnight before cross-linking. The COL II matrices were

cross-linked using 0.25% w/v genipin to enhance mechanical

stability of the composite matrix and reduce antigenicity and

prevent rapid digestion in vivo. For cross-linking condition,

the porous matrices with or without CS (bovine trachea

chondroitin sulphate, Sigma C-9819) and HA (Fluka) were

immersed in genipin solution in 70% ethanol (pH 7.4) at 37 °C

for 48 h. Furthermore, collagen I matrices were cross-linked

by genipin and 1-ethyl-3- (3- dimethyl-amino- propyl)

carbodiimide hydrochloride (EDC) (18) (Sigma Chemical Co.,

St. Louis, MO) compared with cross-linked COL II biologic

effect after cultivating human articular chondrocytes.

Matrix porosity was analyzed using multivolume

pycnometer 1305, and purity of atelocollagen was evaluated

using SDS-PAGE, immunostaining, hematoxylin and eosin

(H&E) and alcian blue stains. Matrix morphology was

observed using scanning electron microscopy (SEM).

The Td of matrices was measured using differential

scanning calorimetry (DSC). The degree of matrix

cross-linking was analyzed spectrophotometrically after

reaction with ninhydrin. The CS and HA amounts in matrices

were determined by using p-dimethylaminobenzaldehyde (19).

Cross-linked porous matrix degradation: Matrices were

degraded by 200 U/ml of collagenase in PBS for 7 weeks (7).

Water-binding capacity (swelling test): Matrices were

incubated in 2 ml PBS (pH 7.4) at room temperature for 2

h.Water-binding capacity = (wet weight – dry weight) / (dry

weight) × 100% (5).

Cultivation of chondrocytes

Normal human articular chondrocytes (N-HACs) were

obtained from Cambrex Bio Science Walkersville

(Walkersville, MD). Frozen-preserved N-HACs were thawed,

suspended with N-HAC growth medium (CGM, Cambrex Bio

Science Walkersville), and plated in a 75-cm2 culture flask for

culturing 10 days. After trypsinization, suitable cells were

seeded onto cross-linked matrices as follows.

Cross-linked matrices (collagen type II＋CS＋HA) were

immersed in 70% v/v ethanol (4 times × 30 min), followed by

washing with PBS (pH 7.4, 5 times × 20 min). The

cross-linked matrices were placed in 24-wells plates, followed

by seeding chondrocyte suspension into porous matrices via

syringe injection containing 1.5 × 106 cells. Chondrocytes

were incubated at 37 °C, in 5% CO2 for extended period of

time. After one day, cell-seeded matrices were transferred to

new 24-well plates to eliminate cells attached to the culture

plates. Culture medium was changed at three-day intervals.

Biochemical analyses

Total DNA and glycosaminoglycan analysis. Porous

matrix was digested by the papain in 1 ml 0.1 M NaAc, 0.01 M

L-cysteine-HCl, 0.05M EDTA-Na2 (pH 6.0), 0.2 M NaCl

including 64 U/ml papain (Sigma p-3125, USA) for 16 h at 65

°C. The DNA content, namely cells number of chondrocytes,

of cell-seeded matrix was determined by 1.5 ml Hoechst

solution (0.2 µg Hoechst 33528 /ml) (Fluka 14530, USA)

containing 100 µl papain digestion solution and fluorometric

quantification (20). The matrices’ DNA contents were obtained

from a standard curve of calf thymus DNA (ICN Biomedicals,

Inc., 195129, USA).

Total GAG content of cultivated matrices was assayed

employing 2.5 ml 1, 9-dimethyl methylene blue solution and

aliquots of 100 µl papain digest solution. The optical density

was determined at 525 nm (21). Standard curve was

established by CS of serial concentrations.

Histology and immuno-histochemistry. After cultivation

cross-linked COL II constructs were placed in 4% neutral

formaldehyde buffer, embedded in paraffin, and sectioned at 5

µm. For histology, we used H&E and alcian blue histochemical

reaction to estimate morphology and cellular

glycosaminoglycan deposition, respectively. In regard to

collagen immuno-histochemistry, after deparaffinizing with

xylene, sections were dehydrated in alcohol (a gradient alcohol:

100%, 90%, 70%, 50%, and PBS). Primary antibody, mouse

anti-human COL II, and a biotinylated secondary antibody

(goat anti-rabbit/mouse, DAKO) were applied to slides as

described previously (22). Calf skin and articular cartilage

tissue for antibody were included in the process as negative

and positive controls, respectively.

Mechanical testing

Non-cross-linked and cross-linked collagen matrices were

mechanically tested with an Instron Mini 44 (Canton,

Massachusetts) and Merlin software. Testing was completed

with the tensile grip compression rate at 4.00 mm/min, and

matrices’ compressional thickness was 5 mm. The matrices’

thickness was measured by an electronic digital caliper.

RNA extraction and RT-PCR

The matrices containing N-HACs were washed twice

with PBS. The matrices were cut into fragments, and total

Type II Collagen Scaffold for Articular Cartilage

9

Table 1. RT-PCR primers sequence used

Gene Primer 5’→ 3’ PCR Product (bp)

GAPDH F:AGCCTCAAGATCATCAGCAATG

R:TTTTCTAGACGGCAGGTCAGG 321

Collagen I

F:GAGACTTCTACAGGGCTGA

R:AGTTCTTGGCTGGGATGTTTT 306

Collagen II F:ACTTGCGTCTACCCCAATCC

R:ACAGTCTTGCCCACTTACC 383

Aggrecan F:TGAGGAGGGCTGGAACAAGTACC

R:GGAGGTGGTAATTGCAGGGAACA 350

Figure 1. SDS-PAGE of collagen II matrix.

(a)

(b)

Figure 2. Immunostaining with type II collagen.(a) Type I collagen

(negative control); (b) Type II collagen from this work

cellular RNA was extracted then with 1 ml TRIzol reagent

(Invitrogen). The TRIzol mixtures were centrifuged at 1400

rpm for10mins and the suspension solution was precipitated by

chloroform, isopropanol and alcohol.

After isolating the RNA, a total RNA sample of 0.5 µg

was used for a reverse-transcriptase reaction to synthesize the

first strand of cDNA using BD PowerScript™ Reverse

Transcriptase (Clontech). The RNA mixture, consisting of

random hexamers and oligo-dT (1 µg/µl, Amersham

Biosciences), was heated at 65 °C for 10 min and quenched on

ice. A mixture of 5X first-strand buffer, dNTP (10 mM,

Promega), DTT, ribonuclease inhibitor (40 units/µl, Promega)

and reverse transcriptase was added, and incubated at 42 °C

for 90 min, followed by inactivation of the reaction by heating

at 70 °C for 15 min. The total reaction volume was 20 µl.

For the amplification in PCR, 1 µl of the synthesized cDNA

was used as a template. The PCR reaction mixture consisted of

sense and antisense primer, dNTP mixture (2.5 mM, Promega),

MgCl2 (25 mM, Promega), 10X PCR buffer and Taq DNA

polymerase (5 units/µl, Promega) in DW water in total 20 µl.

Table 1 shows the oligonucleotides used as PCR primers. The

PCR reaction was initiated at 94 °C for 5 min, which was

followed by 35 cycles of denaturation at 94 °C for 30 s,

annealing at 55 °C for 30 s, extension at 72 °C for 70 s, and

additional extension at 72 °C for 10 min. The amplified

products were separated by electrophoresis on a 2.0% agarose

gel and visualized with ethidium bromide (EtBr) staining.

Results and Discussion

The purity of atelocollagen was analysed using

SDS-PAGE, which indicated that the isolated atelocollagen

was essentially free of other proteins and purified relative to

commercial standard (Sigma) (Figure 1). The molecular

weight was approximately 135 kDa, a value identical to the

literature. Alcian blue stain was performed to ensure the

removal of cellular composition and proteoglycans (PGs) on

the matrix slice. From the staining results, there were no cells

or GAGs remaining in the purified collagen. The denaturation

temperature, Td, measured by DSC of the cross-linked matrix

to be 96 °C, increased from 56 °C for non-cross-linked matrix.

Immunostaining with type II collagen antibody further

validated the identity of the protein (see Figure 2).

The porous COL II matrices were fabricated by

lyophilization of 0.5 M acetic acid dispersion of COL II.

Figure 3a shows the matrix without cross-linking and Figure

3b the matrix after cross-linking. However, the pore size was

not altered in the interior of the matrices. The porous structure

of COL II scaffold is similar to that of type I collagen matrix,

J. Med. Biol. Eng., Vol. 27. No. 1 2007

10

(a) (b)

Figure 3. COL II matrix before cross-linking (a) and after being cross-linked by genipin (b).

(a) (b)

Figure 4. Internal structures of type I (a) and type II (b) collagen matrices.

(a) (b) (c)

Figure 5. Porous structures of COL II matrices fabricated at various freezing temperatures (a) –20 °C, (b) –80 °C, (c) –196 °C

as shown in Figure 4. Highly porous and inter-connected

structure was observed by SEM, formed by lamellae structures

of proteins. The freeze-dried COL II matrices had the same

porous structures, since we used acetic acid as porogen in both

cases; also the sizes of the pores were also influenced by the

temperature of freezing. Figure 5 shows the different types of

sectional morphology of porous matrices that were prepared by

freeze-drying at various freezing temperatures. The COL II

matrices fabricated at –20 °C, –80 °C, –196 °C had pore sizes

in the interior, ranging from 80-300, 50-250 and 20-150 µm,

respectively, and porosity measurement showed around 96%

before cross-linking, but was about 90-95% after cross-linking.

Matrices prepared at –20 °C, which gave the largest pores of

50-100 µm at the surface and 80-300 µm in the interior that

were more suitable for cells to migrate.

Mechanical evaluation of matrices non-cross-linked and

cross-linked by genipin (GP COL I or II) or EDC (EDC COL I)

revealed the typical nonlinear stress-strain behavior of

biological tissues. The GP COL II matrices had a maximum

compression loading of 180 mN that was determined at a 0.9

compression strain ratio, similar to GP COL I, and the

non-cross-linked COL II matrices had a maximum

compression loading of only 60 mN at the same compression

strain ratio (Figure 6). As a result of mechanical testing, the

non-cross-linked COL II matrices were broken, but the

cross-linked COL matrices (GP COL I or II) returned to

original shape like a sponge. As to the EDC COL I, it had

broken at a 0.8 compression ratio similar to EDC COL II (data

not shown). Hence, the GP COL II possessed better

mechanical strength, suitable for bioreactor culture. We

selected three different types of matrices, GP COL I, II and

EDC COL I, for further study by individually seeding normal

human chondrocytes.

Cellular proliferation was determined based on DNA

assay. In the GP COL II matrix culture, total cell number

increased 26.3-fold during 2 weeks’ culture period, whereas

the cell number decreased after 5 weeks. However, total cell

number increased 27-fold during 2 weeks’ cultivation onto the

Type II Collagen Scaffold for Articular Cartilage

11

Compression loading (mN)

Compression loading (mN)

Compression strain ratio

(a)

Compression strain ratio

(b)

Figure 6. Mechanical test of non-cross-linked (a) and cross-linked

COL II by GP (b). Testing was completed using an Instron

Mini 44 machine with the tensile grip compression rate

at 4.00 mm/min, and matrices’ compressional thickness

was 5 mm.

Figure7. Cell number of seeded collagen I and II matrices for

cultivation time. EDC COL I: COL I matrices cross-linked

by EDC agent; GP COL II: COL II matrices cross-linked

by genipin (GP) solution; GP COL I: COL I matrices

cross-linked by GP. Error bars represent the standard error

of the mean, and n=3.

EDC COL I matrices, but also decreased after 5 weeks. The

EDC COL II matrices had less increase in total cell number

than others (Figure 7).

The level of GAG synthesis in GP COL II culture was

two-fold higher than that in EDC COL I during 14 days of

Figure 8. GAG content of seeded collagen I and II matrices for

cultivation time. EDC COL I: COL I matrices

cross-linked by EDC agent; GP COL II: COL II

matrices cross-linked by GP; GP COL I: COL I matrices

cross-linked by GP. Error bars represent the standard

error of the mean, and n=3.

1 2 3

GAPDH

AGN

COL I

COL II

Figure 9. Expression of N-HACs specific genes in 14 days EDC

COL I (lane 1), GP COL II (lane 2) and I (lane 3) matrices

(n=3) cultures analyzed by RT-PCR. Total RNA analyzed

for collagen type I (COL I), collagen type II (COL II),

aggrecan (AGN) and with the housekeeping gene

glyceraldehyde-3- phosphate dehydrogenase (GAPDH) as

internal control.

culturing and was also 1.5-fold higher than GP COL I matrices

(Figure 8). However, There was not much difference in GAG

levels between different matrices after 5 weeks of culturing.

Regarding gene expression, we analyzed the mRNA

expression of cartilage-specific genes from chondrocytes

cultured in EDC COL I, GP COL II and GP COL I matrices at

the end of 14th day using RT-PCR. Collagen I was expressed

in all cultures, but its expression was up-regulated in GP COL

I, showing a mostly prechondrocyte pattern. Cells produced

aggrecan mRNA in all cultures, but its expression was

down-regulated in EDC COL I as was COL II mRNA. In the

GP COL II matrices, the mRNA expressions of

cartilage-specific genes (i.e.: COL II, aggrecan) were markedly

enhanced at day 14 (Figure 9). For this reason, GP COL II

matrices seems to be the best one for chondrocytes to maintain

right phenotype during the early culturing stage, and

cross-linking CS and HA onto COL II matrix may provide

cartilage cells with the correct extracellular signals.

J. Med. Biol. Eng., Vol. 27. No. 1 2007

12

Table 2. Characteristics of the matrices after cross-linking

Matrix Relative water absorption (%) Porosity (%)

COL II 100.0 96

*COL II 150.5 95

COL II + HA + CS 116.2 90

The porous matrices with or without CS were immersed in genipin

solution(0.25 %) in 70% ethanol (pH 7.4) at 37 °C for 48 h. COL II:

non-cross-linked COL II matrix, *COL II: cross-linked COL II matrix.

Table 3. Chemical properties of the matrices after cross-linking

Matrix Degree

of cross-linking

CS

(µg/matrix )

HA

(µg/matrix)

COL II

*COL II 65%

COL II+ HA + CS 56% 18.6 18.55

The porous matrices with or without CS were immersed in genipin

solution(0.25 %) in 70% ethanol (pH 7.4) at 37 °C for 48 h. COL II:

non-crosslinked COL II matrix, *COL II: cross-linked COL II matrix.

The porosity of the matrix was affected by cross-linking

reaction conditions and the secondary formation of large

crystals of ice, which influenced the structure of cross-linking

matrix in the freeze-drying process. After cross-linking with

genipin, the porous structure remained mostly intact, except at

the surface where pores collapsed to a certain extent. This

damage to the structure can be prevented by cross-linking at

the presence of 70% v/v ethanol. Porosity decreased after COL

II was cross-linking with HA and CS (see Table 2).

The swelling capacity generally decreased as the degree

of cross-linking increased. In our investigation, the

water-binding capacity of cross-linking matrices changed

significantly after cross-linking, as shown in Table 2. The high

water-binding capacity property of sponge-like matrices

appeared to be dependent on the highly porous interconnecting

network of the matrices, which had a good absorbent feature

with hydrophilic materials in the interior of matrices.

Comparing to the cross-linked matrices, untreated matrices

showed lower water uptake ability. Untreated matrices

collapsed and lost their porous structure partially when

immersed in PBS. COL II matrices cross-linking by genipin, in

the presence of CS and HA, not only resulted in the formation

of bio-mimicking ECM, but also forms covalent binding of CS

and HA. The COL / HA / CS matrices contained CS and HA

amounts of approximately 18.60 and 18.55 mg per matrix,

respectively. Figure 10 shows a COL II / HA / CS matrix

stained for CS, after treatment with alcian blue. Incorporated

CS were seen distributed throughout the matrix.

Higher degree of cross-linking gave higher mechanical

strength (Table 3). Susceptibility of these matrices to

degradation by proteolytic enzyme was decreased. To measure

the biodegradability of the matrix, 200 U/ml collagenase was

added to the buffer solution in which the matrices were

incubated. After 45 days, COL II cross-linked matrices

retained 65% of their original weight. The enzymatic

degradation rate of the genipin cross-linked matrices was

slower than those by

Figure 10. Alcian blue stain of COL II/HA/CS matrix

(a)

(b)

Figure 11. The cultivation of chondrocyte in COL II/HA/CS matrix

for 2 weeks: (a) H&E stain and (b) alcian blue stain for

PGs.

cross-linked by EDC. As for the stability of matrices during

the in vitro cultures, the cross-linked matrices maintained their

structural integrity during culture, but non-cross-inked sponge

showed slight contraction due to the cells proliferation.

Chondrocytes grown on the matrices were analyzed for

their morphology and biochemical properties using

histochemistry. After 14 days of culturing, cells on the COL II

/HA/CS matrices showed a round morphology by H&E

staining. The spherically shaped appearance was indicative of

the chondrocytic phenotype (Figure 11 a). The result indicated

the matrices could maintain the differentiation state of the

chondrocytes or induce re-differentiation of the chondrocytes,

but some elongated cells were found in the periphery of the

matrices. This represented dedifferentiation of chondrocytes

into fibrocartilagenous-like cells. Pericellular metachromatical

staining was observed in cell-dense areas of the matrices using

Type II Collagen Scaffold for Articular Cartilage

13

Figure 12. Cells number of cross-linked COL II matrices seeded

with chondrocytes as a function of different culturing

time. Pure: COL II matrices; BTCS: COL II / CS/HA.

Values are mean ± SD (n=3).

Figure 13. GAG content of cross-linked COL II matrices seeded

with chondrocytes as a function of different culturing times. Pure: COL II matrices; BTCS: COL II / CS/HA.

Values are mean ± SD (n=3).

alcian blue, indicating large quantity of PGs was being

synthesized and secreted to the ECM (Figure 11b). Matrix

secretion and proliferation of chondroctes were evaluated by

determination of the DNA and GAG content. All cross-linked

matrices showed a great deal of increase in the DNA content

after 6 weeks of culture, indicating proliferation of

chondrocytes The DNA content showed an increase of 5.5- and

4-fold for pure and CS matrices, respectively, from day 1 to six

weeks (Figure 12). Total GAG content also showed an increase,

ranging from 20 ~ 60 µg/matrix, for all matrices. The COL II /

HA / CS matrices produced the strongest simulative effect on

chondrocytes biosynthesis (Figure 13). This could be due to

the synergism of HA and CS that may have switched on the

CD 44 receptor, which was essential for cartilage homeostasis

[3, 23]. The extracellular matrix not only regulates cellular

behavior, but also plays a role in binding, release, storage and

presentation of soluble mediators within articular the cartilage

tissues. Some studies have evaluated the effects of growth

factors supplemented into serum-free medium [13, 24] in

addition to scaffold engineering. Further improvement of

cartilage regeneration can be explored in supplying appropriate

growth factors and physical stimulation [25, 26] to the cells

grown on the matrices.

Conclusions

Genipin cross-linking and a freeze-drying technology

successfully fabricated the cross-linked matrices retaining

interconnecting porous structure. The cross-linking matrices

had porosity of 90-95% and pore size of 80-300 µm. These

cross-linked matrices were non-cytotoxic, flexible and

mimicked ECM of natural hyaline cartilage better than other

biomaterials seen in the literature. Moreover, the COL II / HA /

CS matrices could provide better dynamic microenvironment

for chondrocytes. The results indicated that the matrices could

promote appropriate chondrocytic phenotype in vitro. Further

study on the mechanism of HA/CS effects by glycosidase

digestion and their possible therapeutic effects on osteoarthritis

will be pursued in the future.

Acknowledgements

This research was funded by the Technology Development

Program for Academia Grant 91-EC-17-A-17-S1-0009,

Ministry of Economic Affairs, Taiwan.

References

[1] K. Kawasaki, Y. Uchio, N. Adachi and M. Matsusaki,

“Hyaluronic acid enhances proliferation and chondroitin sulfate

synthesis in cultured chondrocytes embedded in collagen gels,”

J. Cell. Physiol., 179: 142-148, 1999.

[2] S. Maniwa, M. Ochi, T. Motomura, T. Nishikori, J. Chen and H.

Naora, “Effect of hyaluronic acid and basic fibroblast growth

factor on motility of chondrocytes and synovial cells in culture,”

Acta Orthop. Scand. 72: 299-303, 2001.

[3] S. Ohno, H. J. Im, C. B. Knudson and W. Knudson, “Hyaluronan

oligosaccharide -induced activation of transcription factors in

bovine articular chondrocytes,” Arthrit. Rheum., 52: 800-809,

2005.

[4] J. S. Pieper, A. Oosterhof, P. J. Dijkstra, J. H. Veerkamp and T. H.

van Kuppevelt, “Preparation and characterization of porous

cross-linked collagenous matrices containing bioavailable

chondroitin sulphate,” Biomaterials, 20: 847-858, 1999.

[5] S. N. Park, J. C. Park, H. O. Kim, M. J. Song and H. Suh,

“Characterization of porous collagen /hyaluronic acid scaffold

modified by 1-ethyl-3- (3-dimethyl- aminopropyl) carbodiimide

cross-linking,” Biomaterials, 23: 1205-1212, 2002.

[6] C. H. Chang, H. C. Liu, C. C. Lin, C. H. Chou and F. H. Lin,

“Gelatin-chondroitin- hyaluronan tri-copolymer scaffold for

cartilage tissue engineering,” Biomaterials, 24: 4853-4858,

2003.

[7] N. F. Pieper, P. M. van der Kraan. T. Hafmans, J. Kamp, P. Buma,

J. L. C. van Susante, W. B. van den Berg, J. H. Veerkamp and T.

H. van Kuppevelt, “Crosslinked type II collagen matrices:

preparation, characterization, and potential for cartilage

engineering,” Biomaterials, 23: 3183-3192, 2002.

[8] J. L. C. van Susante, J. Pieper, P. Buma, T. H. van Kuppevelt, H.

van Beuningen,; van der Kraan, J. H. Veerkamp, W. B van den

Berg, R. P. H., Veth, “Linkage of chondroitin-sulfate to type I

collagen scaffolds stimulated the bioactivity of seeded

chondrocytes in vitro,” Biomaterials, 22: 2359-2369, 2001.

[9] K. J. Shields, M. J. Beckman, G. L.Bowlin, J. S., Wayne,

“Mechanical properties and cellular proliferation of electrospun

collagen type II,” Tissue Eng., 10: 1510-1517, 2004.

[10] Z Ma, C. Gao, Y. Gong and J. Shen, “Cartilage tissue engineering

PLLA scaffold with surface immobilized collagen and basic

J. Med. Biol. Eng., Vol. 27. No. 1 2007

14

fibroblast growth factor,” Biomaterials, 26: 1253-1259, 2005.

[11] L. E. Freed, A. P. Hollander, I. Martin, J. R.Barry, R. Langer and

G. Vunjak- Novakovic, “Chondrogenesis in a

Cell-Polymer-Bioreactor System,” Exp. Cell Res., 240: 58-65,

1998.

[12] Q. Li, C. G. Williams, D. Sun. J. Wang, K. Leong and J. H.

Elisseeff, “Photo-crosslinkable polysaccharides based on

chondroitin sulfate,” J. Biomed. Mater. Res., 68A: 28-33, 2004.

[13] J. E. Lee, K. E. Kim, I. C. Kwon, H. J. Ahn, S. H. Lee, H. C.

Cho, H. J. Kim, S. C. Seong and M. C. Lee, ”Effect of the

controlled-released TGF-beta 1 from chitosan microspheres on

chondrocytes cultured in a collagen/chitosan

/glycosaminoglycan scaffold,” Biomaterials, 25: 4163-4173,

2004.

[14] M. Abe, M. Takahashi, S. Tokura, H. Tamura and A.

Nagano, ”Cartilage-scaffold composites produced by

bioresorbable beta-chitin sponge with cultured rabbit

chondrocytes,” Tissue Eng., 10: 585-594, 2004.

[15] Y. Dausse, L. Grossin, G. Miralles, S. Pelletier, D. Mainard, P.

Gillet, E. Dellacherie, P. Netter and E. Payan, “Cartilage repair

using new polysaccharidic biomaterials: macroscopic,

histological and biochemical approaches in a rat model of

cartilage defect,” Osteoarthrit. Cartilage, 11: 16-28, 2003.

[16] T. Taguchi, T. Ikoma and J. Tanaka, “An improved method to

prepare hyaluronic acid and type II collagen composite

matrices,” J. Biomed. Mater. Res., 61: 330-336, 2002.

[17] H. W. Sung, C. N. Chen, R. N. Huang, J. C. Hsu and W. H.

Chang, “In vitro surface characterization of a biological patch

fixed with a naturally occurring cross-linking agent,”

Biomaterials, 21: 1353-1362, 2000.

[18] J. S. Pieper, T. Hafmans, J. H. Veerkamp and T. H. van

Kuppevelt, “ Development of tailor-made collagen-

glycosaminglycan matrices: EDC/NHS crosslinking, and

ultra-structural aspects,” Biomaterials, 21: 581-593, 2000.

[19] I. V. Yannas, P. L. Gordon, J. F. Burke, C. Huang and R. H.

Rubenstein, “Design of an artificial skin. II. Control of chemical

composition,” J. Biomed. Mater. Res., 14: 107-131, 1980.

[20] Y. J. Kim, R. L. Y. Sah, J. Y. H. Doong and A. J. Grodzinsky,

“Fluorometric assay of DNA in cartilage explants using Hoechst

33258,” Anal. Biochem., 174: 168-176, 1988.

[21] R. W. Farndale, D. J. Buttle and A. J. Barrett, ”Improved

quantitation and discrimination of sulphated

glycosaminoglycans by use dimethylmethylene blue,” Biochim.

Biophy. Acta., 883: 173-177, 1986.

[22] H. C. Chen, H. P. Lee, M. L. Sung, C. J. Liao and Y. C. Hu, “A

novel rotating-shaft bioreactor for two phase cultivation of tissue

engineered cartilage,” Biotechnol. Prog., 20: 1802-1809, 2004.

[23] P. M. Van der Kraan, P. Buma, T. van Kuppevelt and W. B. van

den Berg, “Interaction of chondrocytes, extracellular matrix and

growth factors: relevance for articular cartilage tissue

engineering,” Osteoarthrit., Cartilage 10: 631-637, 2002.

[24] N. Veilleux and M. Spector, “Effects of FGF-2 and IGF-1 on

adult canine articular chondrocytes in type II

collagen-glycosaminoglycan scaffolds in vitro,” Osteoarthrit.

Cartilage, 13: 278-286, 2005.

[25] S. Mizuno, F. Allemann and J. Glowacki, “Effects of medium

perfusion on matrix production by bovine chondrocytes in

three-dimensional collagen sponges,” J. Biomed. Mater. Res., 56:

368-375, 2001.

[26] T. Ikenoue, M. C. Trindade, M. S. Lee, E. Y. Lin, D. J.

Schurman, S. B. Goodman and R. L. Smith,

“Mechanoregulation of human articular chondrocyte aggrecan

and type II collagen expression by intermittent hydrostatic

pressure in vitro,” J. Orthop. Res., 21: 110-116, 2003.