Genetics of Psoriasis and Psoriatic Arthritis

James T. Elder

Department of Dermatology

University of Michigan

PsA Working Group Meeting

New York, NY

April 14, 2003

Genetic Epidemiology: Summary

• Most data supports polygenic inheritance

• Low penetrance of disease alleles (low GRR)

• “Many genes means common genes”

• Low penetrance and high frequency cause problems for linkage

• Common genes founder effect LD methods

Published Psoriasis Loci

15 1716 18 19 20 21 22 Y X

1211

1413

1 2 3 4 5 6 7 8 9 10

Chromosome 16q--the Crohn’s Disease Connection?

• Psoriasis is 7 times more common in Crohn’s disease patients than in controls

• Our 16q linkage peak mapped very close to a confirmed linkage peak for Crohn’s disease

• NOD2 maps to the 16q peak and has been confirmed as a Crohn’s susceptibility gene

• NOD2 recognizes pathogens and activates NF-B (innate immunity)

• But--little or no evidence for association with major Crohn’s disease alleles (3 studies)

Confirmation of Linkage to 17q

Originally reported by Bowcock et al. (Science 1994)

Also found by us in two separate groups of families, and in Swedish families

Possible gene reported 6/03 by Bowcock--needs confirmation

• 62 microsatellites spanning the MHC (more around HLA-C)

• Haplotypes deduced from pedigrees and clustered to identify ancestral chromosomes

• Clusters tested for risk using TDT

• Find shortest region common to risk

• Sequence risk region in risk vs. non-risk chromosomes

Strategy for Identification of PSORS1(Nair et al, AJHG 66:1833-44,2000)

Physical Map of PSORS1 Region

RH20 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 kb

RH1

CDSN

SEEK1

SPR1

5 2 8 13 3 2 3 6 1 3 1 1 9 2 4 3 8 3 10 4 16 -

16 3 6 9 3 2 3 6 1 3 1 1 9 3 4 3 1 2 2 2 4 8

16 3 6 15 3 2 3 6 1 3 1 1 9 2 4 3 1 2 2 2 4 16

16 3 6 15 3 2 3 6 1 3 1 1 9 2 4 3 1 2 2 2 4 16

15 3 6 13 3 2 3 6 1 3 1 1 8 2 4 3 1 2 2 2 4 26

15 3 6 13 3 2 3 6 1 3 1 1 8 2 4 3 1 2 2 2 4 20

19

17

21

22

23

25

26 7 3 7 15 3 5 3 6 1 3 1 1 10 2 4 3 6 2 1 2 4 1

• RH1 is repeat-rich, encodes no known genes• 7 known genes found in RH2• RH1 and RH2 are separated by two closely spaced

markers (M6S111 and M6S169)

Refined PSORS1 Risk Region

• Refined risk interval includes OTF3, TCF19, HCR, SPR1, and SEEK1, but not CDSN

• Risk interval could be larger depending on risk status of Cluster 17 (T:NT = 21:10, TDT p value = 0.048)

Cluster 17 Collaboration: Methods

• Objective: to determine whether Cluster 17 is a risk chromosome

• Type marker M6S161, whose allele 3 is specific for cluster 17--frequency only 1.5%, so many subjects needed

• 10 psoriasis genetics centers [Finland, Germany, Iceland, Italy, Sweden (2), UK (2), France, Ann Arbor/Kiel]

• Analysis by transmission disequilibrium test (TDT)

Refined PSORS1 Risk Region

• Based on conclusion that Cluster 17 is non-risk• Redefined risk interval includes HLA-C, OTF3, TCF19,

HCR, SPR1, SEEK1, CDSN, and STG• Region is still small enough to analyze by DNA

sequencing

Sequencing Strategy

Shear fosmid DNA (~1 kb)

Clone into plasmid

Seq 1000 clones Assemble

Genomic fosmid library (~40 kb inserts)

Screen with region-specific probes

Fosmid clones for each allele

GATCGATCGATCGATCGATCCATC

Testing of Candidate Genes

• HLA-Cw6 is specific for risk chromosomes• If cluster 17 is non-risk, then one combination of 3 variants

in CDSN is specific for risk (“Allele 5”, T619-T1236-C1243) • No significant association of any coding CDSN variants

with psoriasis in Japan (Tissue Antigens 60:77, 2002) or in Taiwan (Br J Dermatol 148:418, 2003), despite significant associations with HLA-Cw6

Is HLA-Cw6 the PSORS1 Disease Allele?

• HLA-Cw1-B46 in Oriental psoriasis

• HLA-B38/39 in psoriatic arthritis

HLA Associations with PsV in Thailand(Choonhakarn et al., Int J Dermatol 41:330, 2002)

• HLA-B46-Cw1 haplotype is strongly associated with psoriasis in Thailand and Japan (odds ratio 4)

• B46-Cw1 is common in Asians (HF = 14% in controls), rare in Caucasians (HF <<1%)

• HLA-Cw6 is common in Thai psoriatics, rare in Thai controls (odds ratio 10)

• B46-Cw1 is equally prevalent in early- and late-onset Thai psoriatics (HF = 24.7 vs 26.7)

• HLA-Cw6 is more common in early-onset Thai psoriatics (HF = 17.4 vs. 8.9)

• Thus, Cw6 and B46-Cw1risk alleles do not appear to be identical by descent, and differ in phenotype

HLA-B38/39 in PsV and PsA: Compilation of 15 Studies

Disease HLAAllele

Population totalcases

allele (+)cases

% totalcontrols

allele (+)controls

% Relative Risk

PsV Cw7 All 859 257 29.9 % 2953 572 19.4 % 1.78

Cw7 J apanese 358 105 29.3 % 1607 165 10.3 % 3.63

Cw7 Others 501 152 30.3 % 1346 407 30.2 % 1.00

PsA Cw7 All 339 90 26.5 % 792 162 20.5 % 1.41

Cw7 J apanese 28 12 42.9 % 120 22 18.3 % 3.34Cw7 Others 311 78 25.1 % 672 140 20.8 % 1.27

PsV B38/ 39 All 441 79 17.9 % 1300 66 5.1 % 4.08

B38/ 39 J apanese 192 41 21.4 % 572 41 7.2 % 3.52B38/ 39 Others 249 38 15.3 % 728 25 3.4 % 4.81

PsA B38/ 39 Alla 706 138 19.5 % 2046 69 3.4 % 6.96B38/ 39 B38 606 96 17.7 % 1724 42 2.4 % 7.54B38/ 39 B39 706 42 5.9 % 2046 27 1.3% 4.73

PsA Cw6 All 649 228 35.1 % 1201 171 14.2 % 3.26

Cw6 J apanese 62 3 4.8 % 120 1 0.8 % 6.05Cw6 Others 587 225 38.3 % 1081 170 15.7 % 3.33

PsVb Cw6 Caucasians 1097 557 54.4% 4010 424 10.6% 8.72a there were no publications detailing the prevalence of B38/ 39 in Japanese subjects with PsAb from Mallon et al, J ID 113:693, 1999

Haplotype Frequencies (HLA 1991)

• Note high prevalence of Cw7-B39 haplotype in Japan, low prevalence in Caucasian populations

• Cw7 associations generally limited to Japan/Orient

• Primary association may be with B38/B39, rather than Cw7

Haplotype J apan Canada Spain French USAB39-Cw7 4.2 0.0 0.0 1.2 0.9B8-Cw7 0.0 9.2 6.0 5.4 6.5B7-Cw7 4.9 10.4 6.7 6.2 7.5

B38-CBLa 0.0 1.5 2.0 2.8 3.2B39-CBLa 0.0 1.4 0.0 1.2 0.0

a CBL indicates that the serologic tests used to obtain these data yielded no result; Cw12 cannot be typed serologically

Psoriasis Genes: 2003• Evidence for PSORS1 very strong, but cannot

account for all genetic effects in psoriasis (s = 5-10, s,MHC = 1.6)

• Coding variants of all RH2 genes except CDSN have been ruled out

• B46-Cw1 haplotype genetically and functionally distinct--further study needed

• HLA-B38/B39 may confer risk for PsA--better ascertainment of PsA needed

• Association studies on large case-control cohorts and linkage studies on large (>10 affected) pedigrees will be needed to identify multiple non-MHC genes

• Ann Arbor– Rajan Nair– Phil Stuart– John Voorhees

• Detroit– Henry Lim (HFH)

• Psoriasis Genetics Consortium– Jonathan Barker (London)– Richard Trembath (Leicester)– Anne Bowcock (Wash Univ)

• Kiel– Michael Wiechenthal– Stefan Jenisch– Tilo Henseler– Enno Christophers

• San Diego– Nik Schork– Caroline Nievergelt

• Cluster 17 Collaboration

• International Psoriasis Genetics Committee

Supported by NIAMS and NPF

Collaborators

How Might Specific HLA Class I Alleles Cause Disease?

• Clonal TCR rearrangements suggest response to specific antigen(s)

• Class I molecules should be presenting intracellular proteins of the APC

• They may be very good a presenting certain self-antigens

• They may be very poor at presenting certain self-antigens, leading to failure of thymic elimination of anti-self T-cells

• Alternatively, they may mis-regulate NK cells, leading to overproduction of IFN-

Finding the Non-MHC Genes

• Genome-wide association studies– Haplotype block mapping– Coding sequence variation– Case-control design OK

• Identifying heterogeneous loci– Large families essential for initial identification– Create dense marker maps, build haplotypes– Search for these haplotypes in case-control or

TDT studies

• Incorporate MHC data into analyses