genetically encoded calcium indicator illuminates … · ii abstract the primary cilium is an...
TRANSCRIPT
GENETICALLY ENCODED CALCIUM INDICATOR ILLUMINATES
CALCIUM DYNAMICS IN PRIMARY CILIA
by
Steven Hankong Su
A thesis submitted to Johns Hopkins University in conformity with the requirements for
the degree of Master of Science
Baltimore, Maryland
April, 2014
© 2013 Steven Su
All Rights Reserved
ii
Abstract
The primary cilium is an extraordinary, hair-like structure that extends outward
from the plasma membrane of cells. Ubiquitous to almost every cell type in the human
body, this singular, immotile structure, serves as an antenna for a cell, capable of
transducing extracellular chemical and mechanical stimuli into intracellular signals.
Primary cilia can facilitate signal transduction through an assortment of signaling
pathways including Hedgehog, Wnt, and Calcium signaling, depending on the cell type.
Despite the primary cilium’s role as a central signaling hub, direct visualization of real-
time signaling within this organelle has never been achieved mainly due to the
organelle’s minute physical dimensions and the inability to segregate primary cilia-
specific signals from that of the vast cell body. Here, we directly address this challenge
by developing a primary cilia-specific, genetically encoded calcium indicator, with high
specificity, sensitivity, and dynamic range. Using our novel calcium indicator we
visualized previously unobservable ATP-generated ciliary calcium spikes in mouse
fibroblasts and shear-force-generated ciliary calcium fluxes in mouse kidney cells. The
methodology employed in this study is generalizable and can be easily adapted to study
small molecules of other primary cilia signaling pathways, and as such this work
represents an important first step towards the elucidation and dissection of the intricacies
in primary cilia signal transduction.
Advisor: Takanari Inoue, PhD
Readers: Takanari Inoue, PhD; Alexander Spector, PhD; Randall Reed, PhD;
iii
Acknowledgements
I would first like to thank my advisor, Dr. Takanari Inoue for serving as an
invaluable mentor to me, starting as an undergraduate and continuing through my
Master’s studies. The instruction and guidance I have received from him has been
instrumental in cultivating not only my scientific ability but also my scientific curiosity.
I would also like to thank Drs. Alexander Spector and Randall Reed for serving as
readers and providing insightful comments and suggestions on this thesis, as well as my
collaborators, Drs. Shuhei Chiba, Keishi Narita, Toshiaki Katada, Kenji Kontani, and Sen
Takeda for their contributions to this work.
I have thoroughly enjoyed my time in the Inoue lab and would like to
acknowledge all members of the Inoue lab, past and present, for their support and
guidance. I would especially like to thank Siew Cheng for her enormous efforts in this
work, as well as Bob and Peter for their contributions. Furthermore, I would like to thank
Frank and Fumi for patiently answering all of the questions I have asked them in the past
few years.
Finally, I would like to thank my friends and especially my family. My parents,
Tzongan and Judy, and both of my sisters, Wailen and Emily, have always been there to
support me throughout my time at Hopkins.
iv
Table of Contents
Abstract .............................................................................................................................. ii
Acknowledgements ........................................................................................................... iii
Table of Contents ............................................................................................................... iv iii
List of Tables ..................................................................................................................... vi
List of Figures ................................................................................................................... vii
Chapter 1. Introduction and Background .............................................................................1
1.1 The Structure of Primary Cilia ...........................................................................1
1.2 The Primary Cilium as a Sensory Organelle......................................................3
1.3 The Role of Primary Cilia in Human Disease ...................................................3
Chapter 2. Development of Primary Cilia-Specific Genetically Encoded Calcium
Indicator ...............................................................................................................................6
2.1 Intracellular Calcium Measurement Techniques ...............................................6
2.1.1 Electrophysiological Patch Clamp ......................................................6
2.1.2 Microscopy Based Fluorescent Calcium Indicators ...........................7
2.2 Cilia Targeting Sequences .................................................................................9
2.2.1 Characterization of Cilia Targeting Sequences .................................10
2.3 Evaluation of CTS-tagged GECI .....................................................................17
2.4 5HT6-G-GECO1.0 as a Primary Cilia Ca2+
Indicator ......................................18
Chapter 3: 5HT6-G-GECO1.0 detects ciliary Ca2+
fluxes induced by ATP ......................20
3.1 Introduction ......................................................................................................20
v
3.2 Simultaneous measurement of cytosolic and ciliary Ca2+
levels .....................20
Chapter 4: 5HT6-mCherry-G-GECO1.0 detects ciliary Ca2+
fluxes induced by shear
force. ..................................................................................................................................25
4.1 Introduction ......................................................................................................25
4.2 Measurement of ciliary Ca2+
fluxes generated by laminar fluid flow..............25
Chapter 5: Conclusions ......................................................................................................28
5.1 Summary of Results and Discussion................................................................28
5.2 Future Directions .............................................................................................28
Chapter 6: Methods ...........................................................................................................30
6.1 DNA Constructs ...............................................................................................30
6.2 Cell Culture and Transfection ..........................................................................32
6.3 Immunofluorescence ........................................................................................33
6.4 Transmission Electron Microscopy .................................................................34
6.5 Epi-fluorescence Microscopy ..........................................................................35
6.6 Ciliary and Cytoplasmic pH Determination ....................................................36
6.7 Flow system coupled with epi-fluorescence time-lapse imaging ....................36
Bibliography ......................................................................................................................38
Curriculum Vitae ..............................................................................................................42
vi
List of Tables
Table 2.1: Complete list of all CTS-tagged GECI and characterization of their cilia
targeting ability and dynamic range in NIH-3T3 cells ......................................................17
vii
List of Figures
Figure 1.1: The structure of a primary cilium ....................................................................2
Figure 2.1: Design of single fluorescent protein and fluorescence resonance energy
transfer (FRET) GECI .........................................................................................................8
Figure 2.2: The inability of small molecule dyes to detect increases in ciliary Ca2+
.........9
Figure 2.3: Representative images of NIH-3T3 cells transfected with various GFP CTS-
tagged constructs ................................................................................................................12
Figure 2.4: Targeting efficiency of different CTSs and their effects on ciliation
efficiency, cilia length, and cilia morphology in NIH-3T3 cells .......................................13
Figure 2.5: Elongated primary cilia are correlated with irregular morphology ................14
Figure 2.6: Representative TEM images of primary cilia and basal bodies in NIH-3T3
cells expressing GFP and 5HT6-GFP .................................................................................15
Figure 2.7: Representative images of mIMCD3 cilia expressing 5HT6-YFP
immunostained to reveal the location of various ciliary proteins ......................................16
Figure 2.8: 5HT6-G-GECO1.0 targets primary cilia and detects changes in ciliary Ca2+
19
Figure 3.1: 5HT6-G-GECO1.0 detects ciliary Ca2+
influxes in response to ATP ............21
Figure 3.2: High speed imaging reveals oscillation and propagation patterns of Ca2+
in
NIH-3T3 primary cilia following ATP stimulation ...........................................................23
viii
Figure 3.3: 5HT6-CFP-Venus(H148G) detects no change in ciliary pH in response to
ATP ....................................................................................................................................24
Figure 4.1: Imaging primary cilia under laminar fluid flow .............................................26
Figure 4.2: 5HT6-mCherry-G-GECO1.0 detects ciliary Ca2+
fluxes in response to
laminar flow in mIMCD3 cells ..........................................................................................27
1
Chapter 1: Introduction and Background
1.1 The Structure of Primary Cilia
Once thought to be a vestigial organelle, the primary cilium is a remarkable, hair-
like structure that protrudes from the plasma membrane of nearly all types of mammalian
cells. Unlike motile cilia, primary cilia are immotile and instead act as an extracellular
antenna, sensitive to an array of chemical (1-7) and mechanical stimuli (7-10). Most cells
possess only one primary cilium, typically four to five micrometers in length and less
than 0.5 micrometers in diameter. Volume-wise, a primary cilium represents less than
1/10000th
of the total volume of a cell.
Primary cilia are generated during interphase of the cell cycle from the basal body
of cells. During interphase, the centriole of the basal body localizes to the plasma
membrane of a cell and produces an axoneme, a cylindrical barrel-shaped structure of
nine doublet microtubules that originate from the basal body and extend the length of a
cilium (Fig 1.1) (1). Generation of an axoneme requires intraflagellar transport (IFT), a
bidirectional transport system that moves the structural components needed to form cilia
into and out of the cilium (Fig 1.1) (1, 11). At the base of a primary cilium are transition
fibers and the transition zone, which together with IFT regulate the protein composition
of the cilium (Fig 1.1) (11). Surrounding the axoneme and contiguous with the plasma
membrane is the ciliary membrane. The composition of receptors and channels embedded
along the ciliary membrane determines what types of environmental cues a primary
cilium can sense.
2
Fig 1.1: The structure of a primary cilium. A schematic of key structural
components of a primary cilium and a detailed overview of the IFT process. (Image
courtesy of Yu-Chun Lin.)
3
1.2 The Primary Cilium as a Sensory Organelle
Primary cilia allow cells to monitor and transduce environmental stimuli into
intracellular signals. Several key characteristics make primary cilia ideal sensory
organelles. Firstly, the extension of a primary cilium away from the cell body into the
extracellular space provides it with access to environmental signals such as chemical
ligands and extracellular mechanical flow (1). Additionally, a primary cilium’s elongated
cylindrical shape affords it with a high surface area to volume ratio, ideal for promoting
the interaction of receptor mediated secondary messengers with downstream effectors
(1).
Primary cilia can be sensitive to a variety of chemical ligands, including growth
factors (2), odorant molecules (1, 3), and various neurotransmitters (4-6), depending on
the cell type from which a primary cilium originates. In the case of chemical ligands, the
binding of ligands to specific receptors on a primary cilium can initiate specific signal
transduction pathways within the cell. In addition to chemical ligands, primary cilia of
certain cell types, including kidney tubule cells and bone cells, have been found to be
mechano-sensitive to external forces such as fluid flow (7-10). In these types of cells, the
bending of the primary cilium by external mechanical forces serves as another
environmental cue that can initiate intracellular signal transduction.
1.3 The Role of Primary Cilia in Human Disease
The near ubiquitous nature of primary cilia is evidenced by their existence in a
diverse medley of mammalian cells including cardiomyocytes (12), neurons (3, 5, 13,
4
14), osteocytes (9, 15), and kidney epithelial cells (1, 6, 10). As such, primary cilia play
an important role in many diverse physiological processes including left-right patterning
in embryo development (6, 16), vision (1), and olfaction (3, 13). Because primary cilia
are fundamental in so many basic human processes, a variety of diseases, known as
“ciliopathies,” can arise from structural or functional defects in primary cilia (1, 11).
Human diseases associated with faulty primary cilia include Polycystic Kidney Disease
(1, 6, 10), Bardet Beidl Syndrome (1, 17), and even cancer (18-20). Common phenotypes
of these ciliopathies include cyst formation (on kidneys in the case of Polycystic Kidney
Disease), blindness, obesity, and nervous system irregularities (1, 11).
Importantly, numerous cellular signal transduction pathways, such as Hedgehog
(1, 20, 21), Wnt (1, 22), and Calcium (Ca2+
) (1, 7) signaling are initiated or at least
partially regulated by the primary cilium of certain cell types. Many of these signaling
pathways have been implicated with ciliopathies. For example, mis-regulation of
Hedgehog and Wnt signaling has been linked to various cancers (20, 23, 24) while faulty
Ca2+
entry into primary cilia has been suggested to play a role in the pathogenesis of
Polycystic Kidney Disease (1, 6, 10). Additionally, emerging evidence supports the role
of Ca2+
as a principal secondary messenger of ciliary signaling pathways. Ca2+
permeable
transient receptor potential (TRP) channels have been found to localize to primary cilia of
various cell types, and these ion channels have been proposed to have major roles in
signal transduction induced by mechanical and thermal stimuli as well as G protein-
coupled receptor signaling (7, 10, 25, 26).
Despite the significance of primary cilia in cellular signaling, real-time signal
transduction within a single primary cilium has never been directly visualized or
5
quantified due to the technical challenges presented by the organelle’s minute dimensions
and the inability to segregate cilia-specific signals from that of the vast cell body. In the
remainder of this thesis, we will introduce and discuss a novel methodology we
developed that directly addresses this challenge with regard to ciliary Ca2+
signals. In
particular, we have engineered a primary cilia-specific, genetically encoded calcium
indicator (GECI) that monitors ciliary Ca2+
levels with high specificity, sensitivity, and
dynamic range.
6
Chapter 2: Development of a Primary Cilia-
Specific Genetically Encoded Calcium Indicator
2.1 Intracellular Calcium Measurement Techniques
Many methodologies exist to measure intracellular Ca2+
signals. Two commonly
employed techniques are electrophysiological patch clamp and microscopy based
fluorescent indicators (27). Below we will briefly introduce both methodologies and
discuss their applications towards measuring ciliary Ca2+
.
2.1.1 Electrophysiological Patch Clamp
The general patch clamp technique involves applying suction to a cellular
membrane through a solution-filled micropipette fitted with a wire electrode. By
connecting the micropipette to an amplifier, current generated by ion channel opening
can be measured (27). Recently two groups developed methods for patch clamping whole
primary cilia. In one method an inside-out patch clamp technique was employed: the
entire length of a primary cilium was suctioned up a micropipette and then measurements
were made after the cilium had been gently excised from the cell body and placed in
solution (28). In the other reported method, the tip of the cilia was suctioned and then
ruptured, allowing the interior of the cilia to be perfused by the patch pipette. Recordings
were then made with either the cilia excised or intact with the cell body (29). Despite the
ability these methods to resolve single and multi-channel currents in primary cilia, the
placement of a micropipette greatly hinders the free motion of a cilium, preventing
7
measurements from being made under certain experimental conditions, such as the
bending of a primary cilium by fluid flow. As we will demonstrate in a later section, this
experimental setup constraint is not a limitation for our primary cilia-specific Ca2+
indicator.
2.1.2 Microscopy Based Fluorescent Calcium Indicators
There are two major classes of fluorescent Ca2+
indicators: synthetic small
molecule fluorescent dyes and genetically encoded Ca2+
indicators (GECI). Common
small molecule dyes include Fura2 and Rhodamine based indicators (27). These dyes can
be microinjected into cells or can be made membrane permeable by chemical addition of
an acetoxymethyl ester to the molecule. Once inside a cell, these dyes exhibit an increase
in fluorescence upon binding free intracellular Ca2+
.
GECI class calcium indicators can be further divided into two categories:
fluorescence resonance energy transfer (FRET) GECI and single fluorescent protein
GECI. At the heart of both types of GECI are two proteins: calmodulin (CaM) and the
CaM binding domain of myosin light chain kinase (M13) (30-32). CaM is a dumbbell
shaped protein with four EF hand motifs that upon binding Ca2+
is able to bind M13 (Fig
2.1). In FRET GECIs, this conformational change decreases the intra-molecular distance
between the CFP and YFP molecules that are typically found at opposite ends of the
CaM-M13 structure, allowing FRET to occur between the fluorescent protein pair (Fig
2.1a) (30). Single fluorescent protein GECI typically utilize a single circularly permuted
fluorescent protein placed between CaM and M13 (Fig 2.1b). The circularly permuted
protein reorganizes and subsequently increases its fluorescence when the CaM-M13
8
structure undergoes conformational changes caused by the binding of free Ca2+
(Fig
2.1b) (31, 32).
Despite the wide usage of synthetic small molecule Ca2+
dyes and GECI to
monitor intracellular Ca2+
levels, both types of indicators are expressed throughout the
cytoplasm and non-specific to particular cellular compartments. Their ability to resolve
small, transient Ca2+
fluxes in smaller calcium compartments, such as primary cilia, is
limited. Use of synthetic small molecule Ca2+
dyes or non-specific GECI often results in
signal saturation of the entire cytosol of a cell that overwhelms smaller, local Ca2+
fluxes
in smaller subcellular compartments, such as the primary cilium (Fig 2.2) (7).
Fig 2.1: Design of single fluorescent protein and fluorescence resonance
energy transfer (FRET) GECI. Schematic of (a) FRET and (b) single
fluorescent protein type GECIs in both Ca2+
bound and unbound configurations.
Abbreviations: CaM (calmodulin), M13 (CaM binding domain of myosin light
chain kinase), cpGFP (circularly permuted GFP).
9
2.2 Cilia Targeting Sequences
Clearly, the ability to distinguish primary cilia-specific Ca2+
signals from that of
the main cell body is dependent upon the ability of a Ca2+
indicator to enrich its
expression within a primary cilium. Because the targeting of small molecule Ca2+
dyes to
subcellular compartments is difficult to accomplish, we developed a strategy to
genetically enhance the expression of GECIs in primary cilia by targeting GECIs into
cilia through the use of Cilia Targeting Sequences (CTSs) (33).
Fig 2.2: The inability of small molecule dyes to detect increases in ciliary
Ca2+
. X-rhod-1-AM, a synthetic small molecule Ca2+
dye fails to detect
increase in ciliary Ca2+
in mouse inner medullary collecting duct (mIMCD3)
cells after the addition of 1 µM ionomycin, an ionophore. Primary cilia are
indicated using 5HT6-GFP, a primary cilia marker. Scale bar, 5 µm. (From
S. Su and S.C. Phua et al, Nat Methods, 2013)
10
CTSs are short sequence elements or entire proteins that are able to traffic
unrelated proteins into primary cilia (33). A variety of CTSs exist but careful
characterization and a direct comparison between different CTSs has yet to be performed.
As such, we first evaluated a collection of CTSs on their cilia targeting ability as well as
their effects on cilia morphology.
2.2.1 Characterization of Cilia Targeting Sequences
The CTSs we characterized included two truncated peptides derived from the
cytoplasmic tail of fibrocystin (CTS20 and CTS68), full-length 5-hydroxytryptamine
(serotonin) receptor isoform 6 (5HT6), a fusion peptide comprising the transmembrane
domain of integrin β1 and the C-terminal domain of Arl13b (integrin-Arl1b; IA for short)
as well as a 5HT6-CTS20 combination. Each of these CTSs was tagged to GFP and their
cilia targeting ability and effects on cilia morphology were characterized (Fig 2.3 and Fig
2.4). GFP and Lyn-GFP (a plasma membrane marker) served as negative controls. Cilia
targeting efficiency was defined as the number of cells in which GFP is targeted in the
cilia (as determined by antibody against acetylated α-tubulin, a primary cilia marker)
divided by the number of GFP expressing cells with cilia.
5HT6-GFP and IA-GFP demonstrated considerably higher cilia-targeting
efficiencies (87% and 85%, respectively) than any other CTS tested (Fig 2.3e,g and Fig
2.4a). None of the CTSs had any noticeable effect on ciliation efficiency (Fig 2.4b),
suggesting that overexpression of CTSs does not have adverse effects on ciliogenesis.
Overexpression of 5HT6-GFP and IA-GFP did however cause the average length of
primary cilia to approximately double (Fig 2.4c) which correlated with an increased rate
11
of morphological deformations in primary cilia (Fig 2.4d and Fig 2.5). Nevertheless, the
majority of primary cilia expressing these two constructs exhibited regular morphology.
We further investigated the effects of overexpression of 5HT6 on cilia
morphology through transmission electron microscopy (TEM) and immunofluorescence
assays. Transmission electron microscopy demonstrated no obvious defects in cilia
ultrastructure and no significant increases in cilia diameter for cilia overexpressing 5HT6-
GFP when compared with wild type cilia (Fig 2.6). Furthermore, immunofluorescence
studies indicated no observable differences in localization of key ciliary proteins between
wild type cilia and cilia overexpressing 5HT6-YFP (Fig 2.7). As such, elongation appears
to be the only observable alteration of primary cilia from overexpression of the 5HT6
CTS.
12
Fig 2.3: Representative images of NIH-3T3 cells transfected with
various GFP CTS-tagged constructs. Dotted lines indicate cell
boundary. Scale bar, 10 µm. (From S. Su and S.C. Phua et al, Nat
Methods, 2013)
13
Fig 2.4: Targeting efficiency of different CTSs and their effects on ciliation efficiency, cilia
length, and cilia morphology in NIH-3T3 cells. Columns for (a-c) correspond to the columns in
(d) and represent the same construct. (a) Targeting efficiency for each construct. (n=101, n=19,
n= 68, n=57, n=150, n=27, n=172, and n=102, respectively for GFP, Lyn‐GFP, GFP‐CTS20,
GFP‐CTS68, 5HT6‐GFP, 5HT6‐GFP‐CTS20, IA‐GFP, and 5HT6‐G‐GECO1.0.) (b) Ciliation
efficiency for each construct. Data represent the number of GFP-expressing cells which possess
a cilium (as determined by staining for acetylated α-tubulin) divided by the total number of GFP-
expressing cells. (n=259, n=278,n=185, n=119, n=567, n=179, and n=401, respectively for GFP,
Lyn‐GFP, GFP‐CTS20, GFP‐CTS68, 5HT6‐GFP, 5HT6‐GFP‐CTS20, IA‐GFP, and
5HT6‐G‐GECO1.0.) (c) Average cilia length for each construct normalized to average cilia length
in GFP expressing cells. Constructs with statistically significant differences as compared to GFP
are indicated with an asterisk. N.S. indicates no statistically significant difference as compared to
GFP. Error bars are standard deviation. (Student's t‐test, P=0.49, P=0.0018, P=0.18, P=1.5E‐73,
P=0.0012, P=2.8E‐34, and P=0.055 respectively for Lyn‐GFP, GFP‐CTS20, GFP‐CTS68,
5HT6‐GFP, 5HT6‐GFP‐CTS20, IA‐GFP, and 5HT6‐G‐GECO1.0; n=147, n=133, n=10, n=400,
n=35, n=288, and n=81, respectively for GFP, Lyn‐GFP, GFP‐CTS20, GFP‐CTS68, 5HT6‐GFP,
5HT6‐GFP‐CTS20, IA‐GFP, and 5HT6‐G‐GECO1.0.) (d) Cilia morphology associated with each
construct. Cilia were classified in five categories: normal morphology, doubled, branched,
proximal bulge, and distal bulge. (n=147, n=131, n=10, n=9, n=401, n=35, n=284, and n=81,
respectively for GFP, Lyn‐GFP, GFP‐CTS20, GFP‐CTS68, 5HT6‐GFP, 5HT6‐GFP-CTS20,
IA‐GFP, and 5HT6‐G‐GECO1.0.) (From S. Su and S.C. Phua et al, Nat Methods, 2013)
14
Fig 2.5: Elongated primary cilia are correlated with irregular
morphology. Cilia displaying doubled, branched, proximal bulge, or
distal bulge morphologies were categorized as irregular. Statistically
significant differences, as determined by a two sample Student’s t-test, are
indicated with a star. Error bars are standard deviation. (For 5HT6-GFP,
n=270 and n=129, for regular and irregular, respectively, with P=4.1x10-5
.
For IA-GFP, n=156 and n=127, for regular and irregular, respectively,
with P=0.0008. For 5HT6-G-GECO1.0, n=81 and n=22, for regular and
irregular, respectively, with P=0.012) (From S. Su and S.C. Phua et al, Nat
Methods 2013)
15
Fig 2.6: Representative TEM images of primary cilia and basal bodies in NIH-3T3
cells expressing GFP and 5HT6-GFP. The ultrastructure of primary cilia in NIH-3T3
cells expressing 5HT6-GFP did not show any particular changes when compared with that
of control cells expressing GFP. Both of them displayed a typical 9 + 0 axonemal
configuration, and their diameters were 266 ± 10 nm (n = 10) versus 276 ± 15 nm (n =
10) for GFP expressing and 5HT6-GFP expressing cells, respectively (Student’s t-test, p
= 0.083). Moreover, the ultrastructure of basal bodies in 5HT6-GFP expressing cells took
on a normal pattern being comparable to that of control cells. Collectively, these sets of
data suggest that expression of 5HT6-GFP did not bring about morphological changes in
ciliary ultrastructure. Scale bars, 100 nm (cilia); 200 nm (basal bodies). (From S. Su and
S.C. Phua et al, Nat Methods 2013)
16
Fig 2.7: Representative images of mIMCD3 primary cilia expressing 5HT6-YFP
immunostained to reveal the location of various ciliary proteins. mIMCD3 cells
expressing 5HT6-YFP were immunostained against various ciliary proteins. Compared
with control cells, no difference in protein localization was observed. Abbreviations:
Nephrocystin-3 (NPHP3), Gamma-tubulin (γ-tubulin), Acetylated α-tubulin (Ac-tubulin),
Intraflagellar Transport Protein 88 (IFT88), Poly-Glutamylated-tubulin (GF335), ADP-
ribosylation factor-like protein 13B (Arl13b), Centrosomal Protein of 164 kDa (Cep164),
and Centrosomal Protein of 290 kDa (Cep290). Scale bars, 2 µm. (From S. Su and S.C.
Phua et al, Nat Methods 2013)
17
2.3 Evaluation of CTS-tagged GECI
We next fused our collection of CTSs to currently available GECIs, including
intramolecular CFP/YFP FRET indicators TNXXL (34) and YC3.60 (35) as well as
single fluorescence GFP indicators G-CaMP5G (36) and G-GECO1.0 (31) (Table 2.1).
We characterized the cilia targeting ability and dynamic range for each of the GECI-CTS
fusion constructs (Table 2.1).
Table 2.1: Complete list of all CTS-tagged GECI and characterization of their cilia
targeting ability and dynamic range in NIH-3T3 cells. Targeting efficiency was
computed as the percentage of primary cilia (as determined by antibody against
acetylated α-tubulin, a primary cilia marker) expressing co-localization of the listed
construct (n≥20 for all constructs). Cytosolic signal dynamic range was measured in non-
ciliated cells following the addition of 1 μM ionomycin. (n=7, n=2, n=6, n=6, n=6, and
n=4 cells for 5HT6-YC3.60, 5HT6-GCaMP, 5HT6-G-GECO1.0, IA-G-GECO1.0,
TNXXL-CTS20, and TNXXL-CTS68, respectively.) Ciliary signal dynamic range was
measured in was measured in primary cilia expressing each construct following the
addition of 2 μM Ionomycin. (n=10, n=13, and n=9, respectively for 5HT6-YC3.60, 5HT6
–G-GECO1.0, and IA-G-GECO1.0.) (From S. Su and S.C. Phua et al, Nat Methods 2013)
18
2.4 5HT6-G-GECO1.0 as a Primary Cilia Ca2+
Indicator
Of the CTS-tagged GECI, 5HT6-G-GECO1.0 (Fig. 2.8a) demonstrated the
greatest potential as a primary cilia Ca2+
indicator as it possessed the highest targeting
efficiency of all CTS-tagged GECI (Table 2.1 and Fig. 2.8b), a large ciliary signal
dynamic range (Table 2.1), and was comparable with 5HT6-GFP in cilia targeting
efficiency, ciliation efficiency, and effects on cilia morphology (Fig 2.4). 5HT6-G-
GECO1.0 exhibited weak GFP fluorescence in primary cilia at basal state, but
demonstrated a robust increase in GFP fluorescence of 360.0% ± 62.1% (± s.e.m, n=13
cells) upon stimulation with 2 µM ionomycin (Fig 2.8c,d). While both 5HT6-G-GECO1.0
and IA-G-GECO1.0 exhibited similar ciliary dynamic range, 5HT6-G-GECO1.0
demonstrated greater cilia targeting efficiency (Table 2.1). As such, we selected 5HT6-G-
GECO1.0 for use in all subsequent experiments.
19
Fig 2.8: 5HT6-G-GECO1.0 targets primary cilia and detects changes in ciliary Ca2+
. (a) Schematic of 5HT6-G-GECO1.0, containing M13 (a skeletal muscle light-chain
kinase), a circularly permuted GFP (cpGFP) and calmodulin (CaM). (b) A primary cilium
from a NIH-3T3 cell expressing 5HT6-G-GECO1.0 stained with antibody against
acetylated α-tubulin, a primary cilia marker. Scale bar, 3 µm. Insets show magnified cilia.
(c) Time-lapse imaging of a representative NIH-3T3 primary cilium expressing 5HT6-G-
GECO1.0 at indicated times relative to addition of 2 µM ionomycin (+Iono). AFU,
arbitrary fluorescence unit. Scale bar, 5 µm. (d). Quantification of the average response
of 5HT6-G-GECO1.0 in primary cilia to 2 µM ionomycin. Black bar indicates addition of
ionomycin. Error bars are s.e.m, n=13. (Adapted from S. Su and S.C. Phua et al, Nat
Methods 2013)
20
Chapter 3: 5HT6-G-GECO1.0 detects ciliary Ca2+
fluxes induced by ATP
3.1 Introduction
ATP induces increases in cellular Ca2+
levels through the activation of ATP-
gated, Ca2+
permeable P2X channels and/or P2Y G-protein coupled receptors, which
induce the release of Ca2+
from inositol 1.4,5-triphosphate-sensitive stores (7).
Interestingly, mechanical forces such as compression, in the case of chondrocytes (37),
and shear force, in the case of renal and other types of epithelial cells (38, 39), have been
shown to induce extracellular release of ATP. This release of ATP is dependent on
primary cilia and has been proposed to mediate intracellular Ca2+
signaling (37-39). We
therefore investigated whether changes in ciliary Ca2+
could be detected in response to
extracellular ATP stimulation.
3.2 Simultaneous measurement of cytosolic and ciliary Ca2+
levels
Through co-expression of diffuse, cytosolic R-GECO1 (a single red fluorescent
protein GECI) (31) and primary cilia-targeted 5HT6-G-GECO1.0 in NIH-3T3 cells, we
were able to detect pronounced increases in both cytosolic and ciliary Ca2+
in 52.2%
(12/23) of cells stimulated by 10 µM ATP (Fig. 3.1a). We detected an average maximum
increase of 53.9% ± 20.4% (± s.e.m., n=11) and 54.3% ± 10.0% (± s.e.m., n=11) in
ciliary and cytosolic fluorescence intensity, respectively, post ATP-stimulation (Fig.
21
3.1b). Addition of vehicle control (DMSO) failed to generate any response in the cytosol
or primary cilia (Fig. 3.1c,d).
Fig 3.1: 5HT6-G-GECO1.0 detects ciliary Ca2+
fluxes in response to ATP. (a,c)
Representative fluorescence microscopy images of NIH-3T3 cells expressing indicated
sensors, showing response to (a) 10 µM ATP or (c) DMSO. Scale bars, 5 µm. Time-
lapse imaging was initiated at 0 s, and images were captured at 0.067 Hz. Dotted lines
indicate cell boundaries. AFU, arbitrary fluorescence units. (b,d) Quantification of the
average (b) ATP and (d) DMSO responses. Gray bar indicates addition of 10 µM ATP.
Black bar indicates addition of 1 µM Ionomycin. Error bars are s.e.m; n=11 for (b) and
n=15 for (d). (Adapted from S. Su and S.C. Phua et al, Nat Methods 2013)
To investigate the source of the ciliary Ca2+
fluxes, we increased our imaging
frequency from 0.067 Hz to 0.63 Hz. With the improved temporal resolution, we
observed that spikes in cytosolic Ca2+
clearly preceded those in the primary cilium in
100% (14/14) of cells. (Fig 3.2a,b). On average, the initial elevation in cytosolic Ca2+
preceded the initial elevation in ciliary Ca2+
by 6.04 s ± 0.98 s (± s.e.m., n=14 cells).
Furthermore, whenever we observed oscillations in cytosolic Ca2+
, we also observed
22
correlated but delayed Ca2+
oscillations in cilia (Fig. 3.2a,b). Additionally, ciliary Ca2+
fluxes were observed to propagate in a base-to-tip direction in 100% (14/14) of cells
when an ATP induced response was observed (Fig. 3.2c). Collectively, these
observations suggest that the Ca2+
stores in the cytosol are the source of the ciliary Ca2+
spikes observed following ATP stimulation. However, we cannot exclude other
possibilities such as an enrichment of ATP-gated P2X Ca2+
channels at the base of NIH-
3T3 primary cilia.
By further increasing our imaging frequency to 1.5 Hz, we calculated the rate of
Ca2+
propagation along the length of a primary cilia to be 0.83 ± 0.22 µm/s (± s.d., n=11).
Note that this rate could be at least partially affected by chemical buffering from
overexpression of 5HT6-G-GECO1.0. Additionally, because GFP-based GECI are
sensitive to changes in pH (40), we confirmed that ciliary pH did not change with ATP
stimulation by using a newly developed ciliary pH biosensor, 5HT6-CFP-Venus(H148G)
(Fig. 3.3), indicating that the observed increase in GFP fluorescence of 5HT6-G-
GECO1.0 following ATP stimulation was indeed induced by increases in ciliary Ca2+
.
23
Fig 3.2: High speed imaging reveals oscillation and propagation patterns of Ca2+
in
NIH-3T3 primary cilia following ATP stimulation. (a) Representative time-lapse
images of primary cilia showing oscillations in cytosolic and ciliary Ca2+
in response to
10 µM ATP. Scale bar, 10 µm. Dotted lines indicate cell boundary. (b) Representative
single cell measurements of cytosolic (R-GECO1) and primary cilia (5HT6-G-GECO1.0)
Ca2+
levels showing oscillations following addition of 10 µM ATP (gray bar). Black lines
indicate normalized fluorescence equaling 1.05. Average delay time between cytosolic
and ciliary Ca2+
increases was computed as the average difference in time between
cytosolic and ciliary Ca2+
signals exceeding 1.05. Plot (i) in (b) corresponds to (a). (c)
Representative primary cilia showing base-to-tip direction of Ca2+
propagation. AFU,
arbitrary fluorescence unit. Images and data for (a,b) captured at 0.63 Hz. Images for (c)
captured at 1.5 Hz. (Adapted from S. Su and S.C. Phua et al, Nat Methods 2013)
24
Fig 3.3: 5HT6-CFP-Venus(H148G) detects no change in ciliary pH in
response to ATP. (a) Schematic of 5HT6-CFP-Venus(H148G) showing an
increase in VenusH148G (Venus HG) fluorescence in response to an decrease in
[H+]. The fluorescence ratio of Venus(H148G):CFP serves as a readout for ciliary
pH. (b) Representative NIH-3T3 primary cilium imaged at different pHs. (c) A
calibration curve of the VenusH148G:CFP fluorescence (normalized to pH
7.4=ratio of 1.0). Red and blue points indicate fluorescence ratios of native
primary cilia and cytoplasm, respectively. Error bars, s.d; n=8 to 10 cilia per point.
(d) pH changes in response to DMSO, ATP, and Ionomycin. Error bars, s.d; n=8
to 10 cilia per point. (From S. Su and S.C. Phua et al, Nat Methods 2013)
25
Chapter 4: 5HT6-mCherry-G-GECO1.0 detects
ciliary Ca2+
fluxes induced by shear force
4.1 Introduction
Fluid flow across the apical membrane of epithelial cells generates shear forces
that can be sensed by primary cilia of many cell types. In particular, urine flow has long
been hypothesized to bend the primary cilia of renal tubule cells and activate cilia-
localized Ca2+
-permeable TRPP2 channels (10). However, the crucial step involving the
entry of extracellular Ca2+
into the lumen of the primary cilium has not yet been
demonstrated. We therefore set up a chambered-fluid flow system to subject ciliated
mouse inner medullary collecting duct (mIMCD3) cells with controlled, laminar flow.
4.2 Measurement of ciliary Ca2+
fluxes generated by laminar
fluid flow
To normalize for the anticipated flow-induced bending of cilia, we generated
5HT6-mCherry-G-GECO1.0 (Fig. 4.1a) and expressed it in the primary cilia of mIMCD3
cells. With the addition of mCherry, we were able to normalize for spatial movement of
cilia by taking the ratio of the GFP signal from G-GECO1.0 to the mCherry signal as a
readout for ciliary Ca2+
levels. As such, increases in ciliary Ca2+
correspond to increases
in the ratio of GFP to mCherry fluorescent signals. To visualize the bending of primary
cilia, we captured 1 µm z-stack sections of a primary cilium and reconstructed the cilium
at each time point using xy-projections (Fig. 4.1b).
26
Fig 4.1: Imaging primary cilia under laminar fluid flow. (a) Schematic of 5HT6-
mCherry-G-GECO1.0. In this case only the Ca2+
bound conformation is represented. (b)
Schematic of imaging methodology. An upright primary cilium is bent by laminar fluid
flow. Each primary cilium was imaged in the xy-plane with nine, 1 µm z-stacks such that
xy-projections could be reconstructed. (Adapted from S. Su and S.C. Phua et al, Nat
Methods 2013)
Upon applying laminar fluid flow equating to 1 dyne/cm2 of shear force (a
realistic physiological value for kidney tubules) we immediately observed the bending of
primary cilia (Fig 4.2a). The bending of primary cilia corresponded with a pronounced
increase in ciliary Ca2+
that on average occurred 15 s following flow initiation (Fig
4.2a,b). Peak ciliary Ca2+
levels were on average observed 1 minute following flow
initiation (Fig 4.2b). As a negative control primary cilia expressing 5HT6-mCherry-GFP
were also subjected to laminar flow. Flow initiation failed to generate a significant
change in GFP signal in cilia expressing 5HT6-mCherry-GFP (P = 0.9545) whereas a
1.46-fold average increase in GFP fluorescence was observed in cilia expressing 5HT6-
mCherry-G-GECO1.0 following flow initiation (Fig 4.2b,c). These results indicate that
the observed increase in GFP fluorescence is not an artifact of ciliary movement. Further
work is required to elucidate the source of the ciliary Ca2+
fluxes and what role ATP may
play in these observed Ca2+
dynamics.
27
Fig 4.2: 5HT6-mCherry-G-GECO1.0 detects ciliary Ca2+
fluxes in response to
laminar flow in mIMCD3 cells. (a) Time lapse imaging of a representative mIMCD3
primary cilia subjected with laminar flow. The mCherry marker (left column) illustrates
spatial movement of the cilium. Changes in GFP fluorescence (middle column)
correspond with changes in ciliary Ca2+
. GFP/mCherry images (right column) are
indicative of ciliary Ca2+
levels after normalization for spatial movement of cilia. Scale
bar, 5 µm. AFU, arbitrary fluorescence unit. (b) Fluorescence intensity of GFP divided
by that of mCherry before and after flow for primary cilia expressing 5HT6-mCherry-G-
GECO1.0 and 5HT6-mCherry-GFP (control). Error bars, s.e.m. (n = 18 for 5HT6-
mCherry-G-GECO1.0 and n = 9 for 5HT6-mCherry-GFP.) (c) Comparison of relative
GFP intensities of 5HT6-mCherry-G-GECO1.0 and 5HT6-mCherry-GFP before and after
1 min of flow induction. Error bars, s.e.m. (n = 18 for 5HT6-mCherry-G-GECO1.0 and n
= 9 for 5HT6-mCherry-GFP.) P-values obtained with Student’s t-test. (Adapted from S.
Su and S.C. Phua et al, Nat Methods 2013)
28
Chapter 5: Conclusions
5.1 Summary of Results and Discussion
Overall, we have developed a primary cilia-specific GECI and demonstrated it to
be sensitive to ciliary Ca2+
fluxes generated by both chemical and mechanical stimuli.
Using our cilia biosensor we have visualized previously unresolved, ATP-induced ciliary
Ca2+
oscillations in mouse fibroblasts and flow-induced, ciliary Ca2+
fluxes in mouse
renal epithelial cells. Prior to this, Ca2+
dynamics have also been visualized in other small
cellular compartments or organelles, including secretory granules (41), dendritic spines in
neurons (42), and stereocilia of inner hair cells (43). Even though some of these
compartments are smaller in size than primary cilia, the multiplicity of these structures
within each cell compensates for their size by increasing their total relative volume in a
cell, thereby facilitating the visualization of overall compartment dynamics. Importantly,
we note that G-GECO1.0 has an intermediate affinity for Ca2+
(Kd value of 748 nM) (31),
which we have shown is sufficient to measure Ca2+
fluxes in primary cilia induced by
ATP and laminar flow. However, other signaling stimuli may induce smaller changes in
ciliary Ca2+
concentration that may not be detectable using G-GECO1.0. To measure
these finer changes in ciliary Ca2+
, it may be necessary to target GECIs with lower Kd
values into primary cilia.
5.2 Future Directions
The ability of our primary cilia-specific biosensor to finely illuminate previously
imperceptible Ca2+
signaling dynamics represents a large step forward in elucidating the
29
role of Ca2+
in primary cilia. We believe that the general methodology of targeting a
biosensor to primary cilia can be easily extended and applied to visualize other signaling
molecules in primary cilia. With further advancements in microscopy technologies, we
believe that this general methodology has the potential to reveal new and unidentified
signaling functions unique to primary cilia, and as such, this work is an important stride
towards unraveling the complex signaling events mediated by primary cilia.
30
Chapter 6: Methods
(All Methods from S. Su and S.C Phua et al, Nat Methods 2013)
6.1 DNA Constructs
Note: All DNA plasmids are available through Addgene.
Construction of the β1Int-HaloTag-Arl13b–C-GFP (IA-GFP) expression vector.
DNA encoding the human Arl13b C-terminal region (amino acids 355–428 of Arl13b)
(44) was amplified using PCR primers (5′-cccaagcttaggaaccaccgggtagaacc and 5′-
aggtcgactgagatcacatcatgagcatca) and subcloned into pEGFP-C-CMV5 (a modified
pCMV5 mammalian expression vector encoding C-terminal GFP-fusion protein). DNA
encoding β1Int-HaloTag (45) was then subcloned into pEGFP-C-CMV5/Arl13b(355–
428) to make the β1Int-HaloTag-Arl13b–C-GFP expression vector.
Construction of the Lyn-GFP expression vector. GFP was subcloned into sequence
encoding Lyn-YFP (Clontech pYFP-N1 vector; gift from M. Fivaz) using AgeI and
BsrGI to replace YFP.
Construction of the 5HT6-GFP-CTS20 expression vector. DNA encoding 5HT6
flanked by AgeI was amplified by PCR primers (5′-
ctactgaccggtcgccaccatggttccagagcccggccctgtcaacag and 5′-
gctgacaccggtcctcctgcgctaccaccagcactgttcatgggggaaccaagtgg) from sequence encoding
5HT6-GFP (4) (Clontech pEGFP-N3 vector; gift from A. Seki and T. Meyer), and then
subcloned into the 5′ AgeI site of sequence encoding GFP-CTS20 (46) (Clontech pEGFP-
31
C2 vector; gift from G. Pazour). CTS20 sequence encodes residues 1–20 of the N-
terminal cytoplasmic tail of fibrocystin.
Construction of the 5HT6-YC3.60 expression vector. DNA encoding 5HT6 flanked by
HindIII was amplified by PCR primers (5′-catccgaagcttgccaccatggttccagagc and 5′-
gcacctaagctttcctcctgcgcttcctcctgcgctctttgagattcgtcggaacacatgataatag) from sequence
encoding 5HT6-GFP (4) (Clontech pEGFP-N3 vector) and then subcloned into a YC3.60
vector (gift from A. Miyawaki).
Construction of the 5HT6-G-GECO1.0 expression vector. DNA encoding 5HT6
flanked by BamHI was amplified by PCR primers (5′-cattcaggatccgccaccatggttccagagc
and 5′-gcatctggatcctcctcctgcgctaccacca) from sequence encoding 5HT6-GFP (4)
(Clontech pEGFP-N3 vector) and then subcloned into CMV-G-GECO1.0 vector
(obtained from Addgene).
Construction of the 5HT6-G-CaMP expression vector. DNA encoding G-CaMP5G
(gift from L. Looger) flanked with BamHI and HindIII was amplified by PCR primers
(5′-ctactgggatccagtgctggtggtagcgcaggaggaatgggttctcatcatcatcatcatcatgg and 5′-
gcaacatagttaagaataccagtcaatctttcac) and then subcloned into a 5HT6-CFP-FKBP vector
(47) in replacement of CFP-FKBP.
Construction of the TNXXL-CTS20 expression vector. First, the stop codon was
removed from the 3′ end of the TNXXL sequence (gift from O. Griesbeck) by site-
directed mutagenesis (Stratagene) using PCR primers (5′-
cgaggactacgaattctgcagatatccatcacactggcggcc and 5′-
32
ggccgccagtgtgatggatatctgcagaattcgtagtcctcg). The resulting vector was digested with
EcoRI and ligated to CTS20 digested with EcoRI from a GFP-CTS20 vector.
Construction of the TNXXL-CTS68 expression vector. The TNXXL vector with no
stop codon was digested with EcoRI and then ligated to CTS68 digested with EcoRI from
a GFP-CTS20 vector. CTS68 encodes residues 1–68 of the N-terminal cytoplasmic tail of
fibrocystin.
Construction of the 5HT6–mCherry–G-GECO1.0. DNA encoding G-GECO1.0 was
digested from CMV-G-GECO1.0 vector using BamHI and EcoRI and subcloned into a
sequence encoding 5HT6-mCherry (pmCherry-C1, Clontech) that had been digested with
BglII and EcoRI.
Construction of the 5HT6-mCherry-GFP expression vector. GFP was digested from
sequence encoding 5HT6-GFP (pEGFP-N3, Clontech) using Acc65I and BsrGI and
subcloned into a sequence encoding 5HT6-mCherry (pmCherry-C1, Clontech) that had
been digested with Acc65I.
Construction of the 5HT6-CFP-Venus(H148G) expression vector. Sequence encoding
5HT6-CFP was first constructed by subcloning sequence encoding 5HT6 into a CFP
vector using NheI and AgeI. Sequence encoding Venus(H148G) flanked with EcoRI and
BamHI was then amplified by PCR primers (5′-catccggaattcgatggtgagcaagggcgagg and
5′-gcagtgggatccttacttgtacagctcgtccatgcc) and subcloned into the 5HT6-CFP vector.
6.2 Cell Culture and Transfection
NIH-3T3 cells and mIMCD3 cells containing an integrated FRT site in the genome (gift
from R. Reed) were cultured in DMEM (Gibco) supplemented with 10% FBS. For all
33
transient transfections, cells were transfected with the respective DNA constructs by
plating them directly in a transfection solution containing DNA plasmid and FuGENE
HD (Roche). Cells were plated on poly(d-lysine)-coated borosilicate glass Lab-Tek 8-
well chambers (Thermo Scientific). Ciliogenesis was induced by serum starvation for 24
h. For flow experiments, transfected cells were seeded into Microslide VI0.4
channels
(ibidi) at a cell suspension density of approximately 1.3 × 106 cells/ml to achieve
confluence.
6.3 Immunofluorescence
To mark primary cilia, NIH-3T3 cells were fixed with 4% (w/v) paraformaldehyde,
permeabilized with 0.1% (v/v) Triton X-100 and immunostained with mouse monoclonal
anti–acetylated tubulin antibody (Sigma, T7451, 1:2,000 dilution) and secondary anti-
mouse antibody conjugated to Alexa Fluor 568 (Invitrogen, 1:1,000 dilution). For
immunostaining of mIMCD3 cells, cells were grown on cover slips, transfected with
vector encoding 5HT6-YFP, cultured for 72 h, washed with phosphate-buffered saline
(PBS) and fixed with ice-cold methanol at −20 °C for 7 min. Fluorescence images were
obtained using a LSM710 confocal microscope (Carl Zeiss) equipped with a Plan
Apochromat ×100 oil-immersion objective lens (NA 1.4) and processed using ImageJ
software. The antibodies used include rabbit polyclonal antibodies against pericentrin
(Babco, PRB-432C, 1:250 dilution), NPHP3 (Proteintech, 22026-1-AP, 1:1,000 dilution),
IFT88 (Proteintech, 13967-1-AP, 1:750 dilution), Arl13b (Proteintech, 17711-1-AP,
1:1,000 dilution), Cep164 (Novus, 45330002, 1:4,000 dilution), Cep290 (Bethyl
Laboratories, A301-659A, 1:1,000 dilution), and mouse monoclonal antibodies against
34
acetylated α-tubulin (Sigma; 6-11B-1, T7451, 1:1000 dilution), γ-tubulin (Sigma; GTU-
88, T-6557, 1:1000 dilution) and poly(Glu-tubulin) (Enzo; GT335, ALX-804-885-C100,
1:1,000 dilution). The secondary antibodies used in this study were Alexa Fluor 568–
labeled anti-mouse IgG (Molecular Probes, 1:1,500 dilution) and Alexa Fluor 633–
labeled anti-rabbit IgG (Molecular Probes, 1:2,000 dilution).
6.4 Transmission Electron Microscopy
For the ultrastructural analysis of cilia overexpressing 5HT6-GFP or GFP alone, the genes
encoding these proteins were introduced into NIH-3T3 cells using a lentiviral expression
system developed by H. Miyoshi at the RIKEN BioResource Center (48). For the
expression of 5HT6-GFP, the cDNA was amplified with KOD DNA polymerase and
ligated into the Eco47III site of CSII-CMV-MCS-IRES2-Bsd. For the expression of GFP
alone, the CS-CDF-CG-PRE was used. These expression constructs were packaged into
infectious viral particles (48) and added to the NIH-3T3 culture medium at the
multiplicity of infection of >20. After the viral transduction, cells expressing 5HT6-GFP
were selected with 30 μM blasticidin. Expression of 5HT6-GFP or GFP alone in most if
not all cells was confirmed by fluorescence microscopy. Preparations of the cells and
observation of cilia by transmission electron microscopy were carried out principally
according to the previous study (49) with slight modifications. Briefly, cultured cells
were fixed with a half Karnovsky’s solution (2% paraformaldehyde and 2.5%
glutaraldehyde in 0.1 M cacodylate buffer, pH 7.5) supplemented with 1% tannic acid for
30 min at room temperature, followed by rinse with 10% sucrose in cacodylate buffer
(pH 7.5) three times. The cells were post-fixed with 1% osmium tetroxide for 30 min on
35
ice, followed by extensive irrigation with ice-cold distilled water. Subsequently, the cells
were stained en bloc with 1% uranyl acetate in 50% ethanol for 2 h, dehydrated with a
series of graded concentration of ethanol and embedded in epoxy resin. The cells in the
epoxy block were cut by the LKB2088 ultramicrotome (Stockholm), mounted onto
formvar-reinforced single slot grids, and stained with uranyl acetate and lead citrate. The
samples were observed under the Hitachi H-7500 transmission electron microscope
(Tokyo). Images of ciliary cross-sections were analyzed with ImageJ to measure the
ciliary diameter.
6.5 Epi-fluorescence Microscopy
Most of the imaging experiments were performed on an Axiovert135TV epi-fluorescence
microscope (Zeiss) with 63× oil objective (Zeiss), and images were collected by a
QIClick charge-coupled device (CCD) camera (QImaging). For the dual-color epi-
fluorescence imaging under flow conditions, IX-71 (Olympus) microscope was used
together with a 40× oil objective (Olympus) and a CoolSNAP HQ CCD camera
(Photometrics). Imaging was driven by Metamorph 7.5 imaging software (Molecular
Devices). All calcium imaging experiments were performed in Dulbecco’s Phosphate-
Buffered Saline (Gibco) containing 0.9 mM [Ca2+], except for the characterization of the
cytosolic dynamic range of each CTS-GECI, which was performed in DMEM with 25
mM HEPES (Gibco). All pH imaging experiments were performed in DMEM with 25
mM HEPES (Gibco). All imaging experiments were completed at room temperature (21–
23 °C). FRET images were thresholded to remove background before any contrast
adjustments.
36
6.6 Ciliary and Cytoplasmic pH Determination
NIH-3T3 cells were transfected with either vector encoding 5HT6-CFP-Venus(H148G)
for cilia measurements, or vector encoding CFP plus vector encoding Venus(H148G) for
cytoplasmic measurements. For measurements of fluorescence ratios at known pH, cells
were washed once with DMEM plus HEPES at the chosen pH, then allowed to sit in
DMEM plus HEPES at the known pH containing 5 μM each of the H+ ionophores
nigericin and monensin (both Sigma) for 5 min to equilibrate. Approximately 8–10 cilia
were analyzed at each chosen pH point. All fluorescence ratios are normalized to an
initial measurement at pH 7.4. For determination of pH in cilia and cytoplasm, cells were
placed in DMEM plus HEPES at the standard pH of 7.4 with no H+ ionophores and
imaged.
6.7 Flow system coupled with epi-fluorescence time-lapse
imaging.
A syringe pump (Model 230, KD Scientific) was used to provide unidirectional laminar
flow when connected with cell-seeded microchannel slides. DPBS (Gibco) was used as
flow perfusate. Using the Poiseuille equation for rectangular channels, τ = 6μQ/bh2
(where τ is shear stress, μ is medium viscosity, Q is the flow rate, b is channel width and
h is channel height), a flow rate of 0.6 ml/min was provided by the syringe pump to
provide a shear stress of approximately 1 dyne/cm2 within the microchannel. Actual shear
stress acting on a cilium may vary due to the presence of the cilium obstructing the flow.
In these experiments, only upright-positioned cilia were imaged. Each cilium was imaged
at 0.067 Hz for 2 min before flow was initiated for a period of ~7.5 min. Imaging was
37
continued for an additional 4 min after flow was stopped. At each time point, each
primary cilium was imaged in the x-y plane with nine z-stacks (separated by 1 μm). A
total of 18 cells from seven independent experiments were imaged and quantified for
5HT6–mCherry–G-GECO1.0, and a total of nine cells from three independent
experiments were imaged and quantified for 5HT6-mCherry-GFP. Notably, the flow-
induced calcium response was found to be sensitive to environmental changes. Each
imaging experiment was performed at room temperature (21–23 °C), and was completed
within 1 h after cells were taken out from an incubator 37 °C. Fluorescence images
shown in Figure 4.2a are z-projections of nine consecutive x-y planes. GFP and
corresponding mCherry cilia images have been normalized against background signal
variation. GFP divided by mCherry fluorescence ratio cilia images were obtained by tak-
ing the fluorescence ratio of background-normalized GFP and background-normalized
mCherry signal intensities and represented in pseudocolor scale. These values have been
further subjected to two other steps of normalization, (i) normalization against signal area
variation and (ii) normalization against basal signal intensities (before flow), and
presented in graph plots in Figure 4.2b as normalized measurements of GFP divided by
mCherry fluorescence ratios in response to flow stimulation.
38
Bibliography
1. V. Singla, J. F. Reiter, The primary cilium as the cell's antenna: signaling at a
sensory organelle. Science 313, 629-633 (2006).
2. S. T. Christensen, C. A. Clement, P. Satir, L. B. Pedersen, Primary cilia and
coordination of receptor tyrosine kinase (RTK) signalling. J Pathol 226, 172-184
(2012).
3. L. Buck, R. Axel, A Novel Multigene Family May Encode Odorant Receptors - a
Molecular-Basis for Odor Recognition. Cell 65, 175-187 (1991).
4. N. F. Berbari, A. D. Johnson, J. S. Lewis, C. C. Askwith, K. Mykytyn,
Identification of ciliary localization sequences within the third intracellular loop
of G protein-coupled receptors. Mol Biol Cell 19, 1540-1547 (2008).
5. M. Handel, S. Schulz, A. Stanarius, M. Schreff, M. Erdtmann-Vourliotis, H.
Schmidt, G. Wolf, V. Hollt, Selective targeting of somatostatin receptor 3 to
neuronal cilia. Neuroscience 89, 909-926 (1999).
6. G. J. Pazour, G. B. Witman, The vertebrate primary cilium is a sensory organelle.
Curr Opin Cell Biol 15, 105-110 (2003).
7. S. Su, S. C. Phua, R. DeRose, S. Chiba, K. Narita, P. N. Kalugin, T. Katada, K.
Kontani, S. Takeda, T. Inoue, Genetically encoded calcium indicator illuminates
calcium dynamics in primary cilia. Nat Methods 10, 1105-1107 (2013).
8. H. A. Praetorius, K. R. Spring, Bending the MDCK cell primary cilium increases
intracellular calcium. J Membr Biol 184, 71-79 (2001).
9. J. F. Whitfield, The solitary (primary) cilium--a mechanosensory toggle switch in
bone and cartilage cells. Cell Signal 20, 1019-1024 (2008).
10. S. M. Nauli, F. J. Alenghat, Y. Luo, E. Williams, P. Vassilev, X. Li, A. E. Elia,
W. Lu, E. M. Brown, S. J. Quinn, D. E. Ingber, J. Zhou, Polycystins 1 and 2
mediate mechanosensation in the primary cilium of kidney cells. Nat Genet 33,
129-137 (2003).
11. J. F. Reiter, O. E. Blacque, M. R. Leroux, The base of the cilium: roles for
transition fibres and the transition zone in ciliary formation, maintenance and
compartmentalization. EMBO Rep 13, 608-618 (2012).
12. R. Myklebust, H. Engedal, T. S. Saetersdal, M. Ulstein, Primary 9 + 0 cilia in the
embryonic and the adult human heart. Anat Embryol (Berl) 151, 127-139 (1977).
13. H. M. Kulaga, C. C. Leitch, E. R. Eichers, J. L. Badano, A. Lesemann, B. E.
Hoskins, J. R. Lupski, P. L. Beales, R. R. Reed, N. Katsanis, Loss of BBS
proteins causes anosmia in humans and defects in olfactory cilia structure and
function in the mouse. Nat Genet 36, 994-998 (2004).
14. J. F. Whitfield, The neuronal primary cilium--an extrasynaptic signaling device.
Cell Signal 16, 763-767 (2004).
15. A. M. D. Malone, C. T. Anderson, P. Tummala, R. Y. Kwon, T. R. Johnston, T.
Stearns, C. R. Jacobs, Primary cilia mediate mechanosensing in bone cells by a
calcium-independent mechanism. Proc Natl Acad Sci U S A 104, 13325-13330
(2007).
39
16. S. Yoshiba, H. Shiratori, I. Y. Kuo, A. Kawasumi, K. Shinohara, S. Nonaka, Y.
Asai, G. Sasaki, J. A. Belo, H. Sasaki, J. Nakai, B. Dworniczak, B. E. Ehrlich, P.
Pennekamp, H. Hamada, Cilia at the Node of Mouse Embryos Sense Fluid Flow
for Left-Right Determination via Pkd2. Science 338, 226-231 (2012).
17. N. A. Zaghloul, N. Katsanis, Mechanistic insights into Bardet-Biedl syndrome, a
model ciliopathy. J Clin Invest 119, 428-437 (2009).
18. S. G. Basten, S. Willekers, J. S. Vermaat, G. G. Slaats, E. E. Voest, P. J. van
Diest, R. H. Giles, Reduced cilia frequencies in human renal cell carcinomas
versus neighboring parenchymal tissue. Cilia 2, 2 (2013).
19. N. B. Hassounah, R. Nagle, K. Saboda, D. J. Roe, B. L. Dalkin, K. M.
McDermott, Primary cilia are lost in preinvasive and invasive prostate cancer.
PLoS One 8, e68521 (2013).
20. S. Y. Wong, A. D. Seol, P. L. So, A. N. Ermilov, C. K. Bichakjian, E. H. Epstein,
Jr., A. A. Dlugosz, J. F. Reiter, Primary cilia can both mediate and suppress
Hedgehog pathway-dependent tumorigenesis. Nat Med 15, 1055-1061 (2009).
21. S. Y. Wong, J. F. Reiter, The Primary Cilium: At the Crossroads of Mammalian
Hedgehog Signaling. Curr Top Dev Biol 85, 225-260 (2008).
22. M. Simons, J. Gloy, A. Ganner, A. Bullerkotte, M. Bashkurov, C. Kronig, B.
Schermer, T. Benzing, O. A. Cabello, A. Jenny, M. Mlodzik, B. Polok, W.
Driever, T. Obara, G. Walz, Inversin, the gene product mutated in
nephronophthisis type II, functions as a molecular switch between Wnt signaling
pathways. Nat Genet 37, 537-543 (2005).
23. P. Polakis, Wnt signaling and cancer. Genes Dev 14, 1837-1851 (2000).
24. J. Jiang, C. C. Hui, Hedgehog signaling in development and cancer. Dev Cell 15,
801-812 (2008).
25. M. Kottgen, B. Buchholz, M. A. Garcia-Gonzalez, F. Kotsis, X. Fu, M. Doerken,
C. Boehlke, D. Steffl, R. Tauber, T. Wegierski, R. Nitschke, M. Suzuki, A.
Kramer-Zucker, G. G. Germino, T. Watnick, J. Prenen, B. Nilius, E. W. Kuehn,
G. Walz, TRPP2 and TRPV4 form a polymodal sensory channel complex. J Cell
Biol 182, 437-447 (2008).
26. Y. H. Belgacem, L. N. Borodinsky, Sonic hedgehog signaling is decoded by
calcium spike activity in the developing spinal cord. Proc Natl Acad Sci U S A
108, 4482-4487 (2011).
27. A. Takahashi, P. Camacho, J. D. Lechleiter, B. Herman, Measurement of
intracellular calcium. Physiol Rev 79, 1089-1125 (1999).
28. N. K. Kleene, S. J. Kleene, A method for measuring electrical signals in a primary
cilium. Cilia 1, (2012).
29. P. G. DeCaen, M. Delling, T. N. Vien, D. E. Clapham, Direct recording and
molecular identification of the calcium channel of primary cilia. Nature 504, 315-
318 (2013).
30. A. Miyawaki, J. Llopis, R. Heim, J. M. McCaffery, J. A. Adams, M. Ikura, R. Y.
Tsien, Fluorescent indicators for Ca2+ based on green fluorescent proteins and
calmodulin. Nature 388, 882-887 (1997).
31. Y. Zhao, S. Araki, J. Wu, T. Teramoto, Y. F. Chang, M. Nakano, A. S.
Abdelfattah, M. Fujiwara, T. Ishihara, T. Nagai, R. E. Campbell, An expanded
40
palette of genetically encoded Ca(2)(+) indicators. Science 333, 1888-1891
(2011).
32. J. Nakai, M. Ohkura, K. Imoto, A high signal-to-noise Ca(2+) probe composed of
a single green fluorescent protein. Nat Biotechnol 19, 137-141 (2001).
33. M. V. Nachury, E. S. Seeley, H. Jin, Trafficking to the ciliary membrane: how to
get across the periciliary diffusion barrier? Annu Rev Cell Dev Biol 26, 59-87
(2010).
34. M. Mank, A. F. Santos, S. Direnberger, T. D. Mrsic-Flogel, S. B. Hofer, V. Stein,
T. Hendel, D. F. Reiff, C. Levelt, A. Borst, T. Bonhoeffer, M. Hubener, O.
Griesbeck, A genetically encoded calcium indicator for chronic in vivo two-
photon imaging. Nat Methods 5, 805-811 (2008).
35. K. Horikawa, Y. Yamada, T. Matsuda, K. Kobayashi, M. Hashimoto, T. Matsu-
ura, A. Miyawaki, T. Michikawa, K. Mikoshiba, T. Nagai, Spontaneous network
activity visualized by ultrasensitive Ca(2+) indicators, yellow Cameleon-Nano.
Nat Methods 7, 729-732 (2010).
36. J. Akerboom, T. W. Chen, T. J. Wardill, L. Tian, J. S. Marvin, S. Mutlu, N. C.
Calderon, F. Esposti, B. G. Borghuis, X. R. Sun, A. Gordus, M. B. Orger, R.
Portugues, F. Engert, J. J. Macklin, A. Filosa, A. Aggarwal, R. A. Kerr, R.
Takagi, S. Kracun, E. Shigetomi, B. S. Khakh, H. Baier, L. Lagnado, S. S. Wang,
C. I. Bargmann, B. E. Kimmel, V. Jayaraman, K. Svoboda, D. S. Kim, E. R.
Schreiter, L. L. Looger, Optimization of a GCaMP calcium indicator for neural
activity imaging. J Neurosci 32, 13819-13840 (2012).
37. A. K. Wann, N. Zuo, C. J. Haycraft, C. G. Jensen, C. A. Poole, S. R. McGlashan,
M. M. Knight, Primary cilia mediate mechanotransduction through control of
ATP-induced Ca2+ signaling in compressed chondrocytes. Faseb J 26, 1663-
1671 (2012).
38. M. E. Jensen, E. Odgaard, M. H. Christensen, H. A. Praetorius, J. Leipziger,
Flow-induced [Ca2+]i increase depends on nucleotide release and subsequent
purinergic signaling in the intact nephron. J Am Soc Nephrol 18, 2062-2070
(2007).
39. H. A. Praetorius, J. Leipziger, Primary cilium-dependent sensing of urinary flow
and paracrine purinergic signaling. Semin Cell Dev Biol 24, 3-10 (2013).
40. M. Mank, O. Griesbeck, Genetically encoded calcium indicators. Chem Rev 108,
1550-1564 (2008).
41. E. J. Dickson, J. G. Duman, M. W. Moody, L. Chen, B. Hille, Orai-STIM-
mediated Ca2+ release from secretory granules revealed by a targeted Ca2+ and
pH probe. Proc Natl Acad Sci U S A 109, E3539-3548 (2012).
42. B. L. Sabatini, T. G. Oertner, K. Svoboda, The Life Cycle of Ca2+ Ions in
Dendritic Spines. Neuron 33, 439-452 (2002).
43. M. Beurg, R. Fettiplace, J.-H. Nam, A. J. Ricci, Localization of inner hair cell
mechanotransducer channels using high-speed calcium imaging. Nat Neurosci 12,
553-558 (2009).
44. Y. Hori, T. Kobayashi, Y. Kikko, K. Kontani, T. Katada, Domain architecture of
the atypical Arf-family GTPase Arl13b involved in cilia formation. Biochem
Biophys Res Commun 373, 119-124 (2008).
41
45. S. Svendsen, C. Zimprich, M. G. McDougall, D. H. Klaubert, G. V. Los, Spatial
separation and bidirectional trafficking of proteins using a multi-functional
reporter. BMC Cell Biol 9, 17 (2008).
46. J. A. Follit, L. Li, Y. Vucica, G. J. Pazour, The cytoplasmic tail of fibrocystin
contains a ciliary targeting sequence. J Cell Biol 188, 21-28 (2010).
47. Y. C. Lin, P. Niewiadomski, B. Lin, H. Nakamura, S. C. Phua, J. Jiao, A.
Levchenko, T. Inoue, R. Rohatgi, Chemically inducible diffusion trap at cilia
reveals molecular sieve-like barrier. Nat Chem Biol 9, 437-443 (2013).
48. A. Honda, M. Hirose, M. Hatori, S. Matoba, H. Miyoshi, K. Inoue, A. Ogura,
Generation of induced pluripotent stem cells in rabbits: potential experimental
models for human regenerative medicine. J Biol Chem 285, 31362-31369 (2010).
49. K. Narita, T. Kawate, N. Kakinuma, S. Takeda, Multiple primary cilia modulate
the fluid transcytosis in choroid plexus epithelium. Traffic 11, 287-301 (2010).
42
Curriculum Vitae
Education
M.S.E. Johns Hopkins University, Baltimore, MD 2014
Department of Biomedical Engineering
Advisor: Dr. Takanari Inoue
B.S. Johns Hopkins University, Baltimore, MD 2012
Department of Biomedical Engineering
Department of Applied Mathematics and Statistics
Other Experience
Research Assistant 2010 - 2012
Advisor-Dr. Takanari Inoue
Department of Cell Biology,
Johns Hopkins School of Medicine, Baltimore, MD
Awards and Honors
Provost Undergraduate Research Award (PURA) 2011
Robert C. Byrd Honors Scholarship 2008 - 2012
Tau Beta Pi Honor Society Initiated 2010
Alpha Epsilon Delta Honor Society Initiated 2009
Peer Reviewed Publications
Su, S.*, Phua, S.C.*, DeRose, R., Chiba, S., Narita, K., Kalugin, P.N., Katada, T.,
Kontani, K., Takeda, S., and Inoue, T. “Genetically encoded calcium indicator
illuminates calcium dynamics in primary cilia.” Nat Methods 10, 1105-1107
(2013); doi:10.1038/nmeth.2647
Conference Publications
Vyas, S., Su, S., Kim, R., Kuo, N., Taylor, R.H., Kang J.U., and Boctor, E.M.
“Intraoperative ultrasound to stereocamera registration using interventional
photoacoustic imaging.” Proc. SPIE 8316, Medical Imaging 2012: Image-Guided
Procedures, Robotic Interventions, and Modeling, 83160S, (February 23, 2012);
San Diego, CA; doi:10.1117/12.912341 (Conference Paper)
43
Rubashkin, M., Badrinath, R., Thorpe, M., Su, S., Spedden, R., Jia, X., and
Schon, L. “Development and In-vitro analysis of novel human mesenchymal stem
cell delivery textile scaffolds for achilles tendon repair.” 2009 World Stem Cell
Summit, (September 21-23, 2009); Baltimore, MD
Teaching Experience
Johns Hopkins University, Baltimore, MD
Teaching Assistant/Grader
EN.580.424 Systems Bioengineering Lab Spring 2014
EN.580.429 Systems Bioengineering III Fall 2012, Fall 2013
EN.580.223 Models and Simulations Spring 2013