genetic transformation for drought resistance in cotton

GENETIC TRANSFORMATION FOR DROUGHT RESISTANCE IN COTTON

Thesis submitted to the University of Agricultural Sciences, Dharwad

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

IN

GENETICS AND PLANT BREEDING

By

PRASHANTH SANGANNAVAR

DEPARTMENT OF GENETICS AND PLANT BREEDING COLLEGE OF AGRICULTURE, DHARWAD

UNIVERSITY OF AGRICULTURAL SCIENCES, DHARWAD - 580 005

NOVEMBER, 2012

ADVISORY COMMITTEE

DHARWAD (I. S. KATAGERI) NOVEMBER, 2012 CHAIRMAN

Approved by :

Chairman : ____________________________ (I. S. KATAGERI)

Members : 1. __________________________ (B. M. KHADI)

2. __________________________ (H. M. VAMADEVAIAH)

3. __________________________ (H. L. NADAF)

4. __________________________ (B. C. PATIL)

C O N T E N T S

Sl. No. Chapter Particulars

CERTIFICATE

ACKNOWLEDGEMENT

LIST OF ABBREVATIONS

LIST OF TABLES

LIST OF FIGURES

LIST OF PLATES

LIST OF APPENDICES

1. INTRODUCTION

2. REVIEW OF LITERATURE

2.1 In vitro regeneration studies in cotton

2.2 Agrobacterium mediated transformation

2.3 Genetic transformation for abiotic moisture stress

3. MATERIAL AND METHODS

3.1 Materials

3.2 Methodology

3.3 Genetic transformation studies in Coker-312

3.4 In Planta genetic transformation studies in Sahana

3.5 Confirmation of gene integration

3.6 Statistical analysis

4. EXPERIMENTAL RESULTS

4.1 Regeneration via callus cultures in Coker-312



4.4 Gene integration and expression analysis

5. DISCUSSION




5.4 Gene integration and expression analysis

5.5 Future line of work

6. SUMMARY AND CONCLUSIONS




REFERENCES

APPENDICES

LIST OF ABBREVIATIONS

2, 4-D = 2, 4-dichlorophenoxy-acetic acid

BcZF = Brassica caranita Zinc Finger

Bt = Bacillus thuringiensis

CaMV 35S = Cauliflower mosaic virus 35S promoter

CTAB = Cetyl Trimethyl Ammonium Bromide

DNA = Deoxyribonucleic acid

DREB = Drought Responsive Element Binding

EDTA = Ethylene Diamine Tetra Acetic acid

MS = Murashige and Skoog’s medium (1962)

NOS = Nopaline synthase promoter

npt-II = Neomycin phospo transferase-II

OCS = Octopine synthase

PCR = Polymerase Chain Reaction

PGRs = Plant Growth Regulators

RNA = Ribonucleic acid

SAM = Shoot apical meristem

SDDW = Sterile Double Distilled Water

SDS = Sodium Dodeacyl Sulfate

T-DNA = Transfer-DNA

TDZ = Thidiazuron

YEMA = Yeast Extract Mannitol Agar

LIST OF TABLES

Table No.

Title

1. Days to callus initiation in primary culture of cotyledon and hypocotyl explant of Coker-312 at different combinations of growth regulators in MS medium

2. Per cent callus induction from cotyledon and hypocotyl explants on MS media supplemented with various levels of growth regulators in Coker-312

3. Fresh callus weight (g) from cotyledon and hypocotyl explants on MS media supplemented with various levels of growth regulators in Coker-312

4. Effect of carbon sources on callus induction in Coker-312

5. Nature of callus in primary culture of cotyledon and hypocotyl explants at different combinations of growth regulators in MS medium in Coker-312

6. Effect of MS media supplemented with various combinations of growth regulators on somatic embryogenesis in Coker-312

7. Effect of MS media supplemented with organic compounds/PGRs on embryo maturation in Coker-312

8. Effect of duration of in vitro incubation of plantlets in hardening and establishment of plants in Coker-312

9. Effect of colonization and co-cultivation period on establishment of cultures free of Agrobacterium contamination in Coker-312

10. Effect of cefotaxime on controlling Agrobacterium growth in cultures of Coker-312 after colonization and co-cultivation

11. Effect of kanamycin on non transformed hypocotyls with calli

12. Effect of pre-culture on callus induction after colonization/co-cultivation in Coker-312

13. Effect of vacuum infiltration on establishment of kanamycin resistant calli free of Agrobacterium in Coker-312

14. Large scale genetic transformation studies in Coker-312

15. In planta genetic transformation studies of AtDREB1a transcriptional factor in Sahana

16. In planta genetic transformation studies of BcZAF12 transcriptional factor in Sahana

LIST OF FIGURES

Figure No.

Title

1a. Map of AtDREB1a gene Construction

1b. Map of BcZAF12 gene Construction

2. Days to callus initiation in primary culture of cotyledon and hypocotyl explant of Coker-312 at different combinations of growth regulators in MS medium

3. Per cent callus induction from cotyledon and hypocotyl explants on MS media supplemented with various levels of growth regulators in Coker-312

4. Fresh callus weight (g) from cotyledon and hypocotyl explants on MS media supplemented with various levels of growth regulators in Coker-312

5. Effect of carbon sources on callus induction in Coker-312

6. Effect of MS media supplemented with various combinations of growth regulators on somatic embryogenesis in Coker-312

7. Effect of MS media supplemented with organic compounds/ PGRs on embryo maturation in Coker-312

8. Effect of duration of in vitro incubation of plantlets in hardening and establishment of plants in Coker-312

9. Effect of colonization and co-cultivation period on establishment of cultures free of Agrobacterium contamination in Coker-312

10. Effect of cefotaxime on controlling Agrobacterium growth in cultures of Coker-312 after colonization and co-cultivation

11. Effect of kanamycin on non transformed hypocotyls with calli

12. Effect of pre-culture on callus induction after colonization/ co-cultivation in Coker-312

13. Effect of vacuum infiltration on establishment of kanamycin resistant calli free of Agrobacterium in Coker-312

LIST OF PLATES

Plate No. Title

1. Hypocotyl explants cultured on MS + 0.1 mg/l 2, 4-D + 0.5 mg/l Kinetin in Coker-312

2. Callus induction in cotyledon and hypocotyl explants cultured on MS + 0.1 mg/l 2, 4-D + 0.5 mg/l Kinetin in Coker-312

3. Callus induction in different carbon sources cultured on MS + 0.1 mg/l 2, 4-D + 0.5 mg/l Kinetin in Coker-312

4. Nature of callus in Coker-312

5. Somatic embryogenesis in Coker-312

6. In vitro and ex vitro plant hardening and establishment in Coker-312

7. Excess Agrobacterium growth on explants after co-cultivation followed by washing in cefotaxime antibiotics and 4-5 days after culturing on cefotaxime supplemented media

8. Kanamycin selection of untransformed calli in Coker-312

9. Kanamycin selection of colonized and co-cultivated explants in Coker-312

10. Somatic embryogenesis in Kanamycin supplemented medium and plant establishment in Coker-312

11. T0 putative transgenic plants for AtDREB1a and BcZAF12 gene in Coker-312

12. In planta genetic transformation in Sahana

13. Quantity and quality of DNA

14. Confirmation of gene integration through PCR for npt-II gene

15. Confirmation of gene integration through PCR for gene specific primers

16. RNA from Putative transgenic plants

17. Confirmation of gene integration through RT-PCR for gene specific primers

18. Dot blot analysis in AtDREB1a putative transgenic plants

19. Dot blot analysis in BcZAF12 putative transgenic plants

LIST OF APPENDICES

Appendix No.

Title

I. Loading dye and TAE

II. Yeast extract Mannitol medium

III. DNA extraction buffer

IV. Extraction solutions

INTRODUCTION

Cotton, Gossypium spp., is an economically important crop that is grown throughout the world. Cotton is grown as a source of fiber, food and feed. Lint, the most economically important product from the cotton plant, provides a source of high quality fiber for the textile industry. Cotton seeds are an important source of oil, and cotton seed meal is a high protein product used as livestock feed. Other products include seed hulls and linters useful in pharmaceuticals.

India has a pride place in the global cotton scenario due to several distinct features such as the largest cotton growing area, cultivation of all the four cultivated species, large area under tetraploid cotton, one of the largest producers of long and extra-long staple cotton, possibly the only country to grow hybrid cotton, native home of old world cultivated cotton and had a wide diversity in agro-climatic conditions under which cotton is grown.

Karnataka produces 13.10 lakh bales of cotton lint from an area of 5.49 lakh hectares with a productivity of 405.70 kg per hectare. India is the largest cotton growing country with an area of 121.90 lakh hectares and production of 371.20 lakh bales of cotton lint with 481.20 kg per hectare productivity (Anon., 2012). The reasons for this high yield and increased productivity are mainly cultivation of Bt cottons, favorable seasons and good agronomic practices.

Taxonomically cotton is described under the order Malvales, family Malvaceae, series Hibiscae and the genus Gossypium. The genus Gossypium includes 49 species (Percival and Kohel, 1990). Four of these are cultivated, 43 are wild diploid and two wild tetraploid species. Of the four cultivated species, G. hirsutum and G. barbadense are tetraploids (2n=4x=52), commonly known as new world cotton, whereas, G. arboreum and G. herbaceum are diploids (2n=2x=26), commonly known as old world or Asiatic cotton. Cotton, as a tropical crop, originated from several locations (Southern Africa, South-east Asia and Peru).

Cotton was among the first species to which the Mendelian principles of segregation and independent assortment of genes were applied (Balls, 1906). The traditional breeding methods use hybridization, wide-crosses, backcross, mutation etc. techniques to introduce desirable agronomic traits, such as high yield, good quality and disease resistance into new breeding lines which may be released after several years of field testing.

Basically cotton is a drought tolerant crop because of its very deep root system. Drought may occur at any time of the growth period, but the timing and intensity of drought play an important role in cotton production.

A moderate drought in the early season may some times be beneficial. Drought at pre-flowering stage has been some times observed to increase subsequent rate of flowering and yield. Drought during the early stages reduces the vegetative growth and finally the yield. Drought at reproductive stage results in square and boll drop because it decreases the rate of photosynthesis and stimulates the ABA and ethylene production in young bolls.

Each season, cotton uses approximately 21 to 38 acre-inches of moisture. The three key periods of cotton growth that should be supplemented with moisture occur at stand establishment, pre-bloom and shortly after boll set. Establishment and pre-bloom irrigations affect total yield, but water deprivation following bloom and into boll development also affects lint quality. Drought is an important environmental factor that reduces the crop productivity around the globe.

It is well known that water stress profoundly affects plants (Hsiao, 1973). Water deficit is the single most important factor limiting crop yield (Begg and Turner 1976) and it has been suggested that the world-wide losses in yield from water stress exceed the losses from all other sources combined (Kramer, 1980). Among the more prominent effects of water stress on plants are the reductions of plant growth, leaf expansion, photosynthesis, carbon fixation, photosynthate translocation, transpiration, cell growth (especially cell enlargement), wall synthesis, protein synthesis, etc. (Hsiao, 1973).

Various physiological and biochemical changes have been investigated at the molecular level (Zhu, 2002; Seki et al., 2003) during stress in plants. Different signal pathways are involved in plant responses to various abiotic stresses (Knight and Knight, 2001). Understanding of detail molecular basis of such pathways followed by developing drought resistant breeding in crops via transgenic technology at a precise and faster rate has becoming very common method now.

The expression of functional proteins is largely regulated by specific transcription factors. Gene regulation by Transcription Factors (TFs) is an important facet of stress responsive signal transduction cascades. Transcription factors are regulatory proteins that implement their functions by binding directly to the promoters of target genes in a sequence-specific manner to either activate or repress the transcription of downstream target genes, and finally enhance the tolerance to various abiotic adversities in plants (Liu et al., 1998; Kasuga et al., 1999; Jaglo et al., 2001; Zhu 2002; Lee et al., 2006; Agarwal et al., 2006; Ito et al., 2006).

The promoters of the downstream genes always contain a conserved cis-element, PyCCGACAT, named as dehydration responsive element (DRE/CRT), which is involved in the transcriptional regulation of a dynamic network of genes controlling various biological processes, including abiotic and biotic stress responses (Yamaguchi-Shinozaki and Shinozaki 1994; Yamaguchi-Shinozaki and Shinozaki 2005; Agarwal et al., 2006). These stress-related TFs are classified into several large families, such as AP2/EREBP, bZIP, NAC, MYB, MYC, Cys2His2 zinc-finger and WRKY (Umezawa et al., 2006).

With the advent of recombinant DNA technology in the 1970s, the genetic manipulation of plants entered a new age. Genes and traits previously unavailable through traditional breeding became available through DNA recombination and with greater specificity than ever before. This modern genetic technology allows the transfer of genetic material across wide evolutionary lineages and has removed the traditional limits of crossbreeding. Genes from sexually incompatible plants or from animals, bacteria or insects can now be introduced into plants. Modern plant genetic engineering involves the transfer of desired genes into the plant genome, and then regeneration of a whole plant from the transformed tissue/cell.

Currently, the most widely used method for transferring genes into plants is Agrobacterium-mediated transformation (Chilton et al., 1977; Finer and Mcmullen et al., 1990; Srivastav et al., 1991; Pannetier et al., 1997; Dillen et al., 1997; Saeed et al., 1997; Cervera et al., 1998; Wang et al., 1998; Sunilkumar and Rathore 2001; Veluthambi et al., 2003; Ikram, 2004; Leelavathi et al., 2004; Wilkins et al., 2004; Katageri et al., 2007; Wu et al., 2008; Sumithra et al., 2010a; Sumithra et al., 2010b; Sangannavar et al., 2011a; Sangannavar et al., 2011b) and particle bombardment method (Klein et al., 1987). Other methods, such as polyethylene glycol (PEG) mediated transformation (Datta et al., 1990), and electroporation (Fromm et al., 1985) have also been used to transfer genes into plants.

Agrobacterium tumefaciens is a soil phytopathogen that genetically transforms host cells, causing crown gall tumors. Three genetic components of Agrobacterium are requiring for plant cell transformation. The first component is the T-DNA, which actually is transported from the bacteria to plant cell. T-DNA flanked by two 25bp imperfect direct repeats knows as the borders. The second component is the 35bp virulence region also located on the Ti plasmid, which is composed of seven major loci (vir A, vir B, vir C, vir D, vir G, vir E and vir H). The protein products of these genes, termed as virulence (vir) protein. Thus, Agrobacterium is often used to produce transgenic plants expressing genes of interest, and use of selectable marker for testing gene of interest whether transferred into the plant genome or not.

The bacterium is attracted to wounded plants presumably of following signal molecules

released by the plant cell. Wounded cells exude phenolic compounds such as acetosyringone and ∝- hydroxy acetosyringone that activate vir genes that are responsible for the transfer of T-DNA from Agrobacterium tumefaciens to the wounded host cell utilized seven phenolic compounds to induce vir-gene activity. These phenols are important for Agrobacterium tumefaciens to recognize suitable hosts and activate the vir loci on the Ti Plasmid. The vir loci mediate the T-DNA processing and delivery steps.

Cotton is a recalcitrant crop to regenerate from in vitro tissue cultures. Compared with many other crops, it is more difficult to obtain somatic embryogenesis, shoot multiplication and plant regeneration in cotton.

The nature of tissue explants, genetic make up of the crop plant and presence of different growth hormones have direct effect over regeneration potential.

Introduction of foreign genes in elite genotypes is limited by the genotype specific nature of gene transfer in cotton. Genotype dependent genetic transformation is well studied and used commercially in cotton.

Coker genotypes, which are amenable for regeneration in vitro by somatic embryogenesis, are widely used in genetic transformation experiments (Finer and Mcmullen et al., 1990; Srivastav et al., 1991; Pannetier et al., 1997; Dillen et al., 1997; Saeed et al., 1997; Cervera et al., 1998; Wang et al., 1998; Sunilkumar and Rathore 2001; Veluthambi et al., 2003; Ikram, 2004; Leelavathi et al., 2004; Wilkins et al., 2004; Wu et al., 2008). Cotton transformation via Agrobacterium was first reported by Firoozabady et al., 1987; Umbeck et al., 1987.

Regeneration via somatic embryogenesis is limited only to Coker 312 and Coker 310 (Trolinder and Xhixian 1989; Firoozabady and DeBoer, 1993; Sakhanoko et al., 1998; Kumar et al., 1998; Sakhanoko et al., 2000; Nobre et al., 2001; Nagaraj et al., 2012) in the world. Regeneration of many cotton Indian genotypes was tried without any success to conclude genotypic specificity for regeneration (Trolinder and Xhixian 1989; Suresh kumar et al., 2003). So it has now become compulsory that gene has to be transferred first to Coker 312/Coker 310 followed by its transfer from these genotypes to required genotypes through backcross breeding method. Genotype independent genetic transformation techniques although have been developed (Gould and Maria Magallenes-Cedeno, 1998; Zapata et al., 1999; Chinchane et al., 2004; Katageri et al., 2007; Sumithra et al., 2010a; Sumithra et al., 2010b; Sangannavar et al., 2011a; Sangannavar et al., 2011b), the frequency of heritable gene incorporation is too low. With few modifications, genetic transformation studies for drought resistance were planned with the following objectives.

1. Standardization of the protocol for efficient somatic embryogenesis and plant regeneration in Coker-312.

2. Genetic transformation studies using transcriptional factors, AtDREB1a and BcZAF12 genes for drought resistance.

REVIEW OF LITERATURE

Genetic engineering offers a directed method of plant breeding that selectively targets one or a few traits for introduction into the crop plant. In vitro regeneration and genetic transformation in cotton and gene resource and status of drought resistance developed through genetic modification technology is reviewed and mentioned in this chapter.

2.1 IN VITRO REGENERATION STUDIES IN COTTON

Plant tissue culture or the aseptic culture of cells, tissues and organs, is an important tool in both basic and applied studies. It is founded upon the research of Haberlandt, a German plant physiologist, who in 1902 introduced the concept of totipotency: that all living cells containing a normal complement of chromosomes should be capable of regenerating the entire plant. Considerable research work was undertaken in plant tissue culture in the 1950s and 1960s. The focus of research in plant cell culture for many crop species was to be able to put a species into tissue culture, develop callus, and ultimately regenerate a normal plant. For many crops, an efficient tissue culture procedure has been developed, e.g. tobacco, rice and some horticultural crops. In comparison with other crops, successes in cotton tissue culture are laying behind.

In vitro plant regeneration is an important step in the success of any crop improvement programme through biotechnology, particularly transgenic research. A well defined, reproducible and highly efficient plant regeneration scheme is a pre-requisite for transformation of crop plants.

In vitro culture can involve intact tissues and organs where the structural integrity of the tissue is maintained or dedifferentiated to cells and callus with unorganized proliferation. In the first instance, the objective is usually to induce the structures that develop as good as it would be on the plant. In order to achive this, individual cells or cell culture or small pecies of tissues are cultured. Tissue is grown on nutrient media, containing growth regulators.

The undifferentiated mass of cells is called callus. A piece of callus is submerged in a liquid medium, the cells dissociates from each other and a ‘suspension’ which can be used for somatic embryogenesis and plant regeneration. Not only have these developments enabled for desirable ends, but they have also allowed the use of cells and organ cultures for undertaking basic studies on cotton genetics and physiology. Tissue culture work in cotton has started nearly three decades back. Since then several scientists carried out number of experiments on different aspects of cotton tissue culture.

Cotton somatic embryogenesis was first observed by Price and Smith (1979) in Gossypium koltzchianum, but no plantlet regeneration was reported. Davidonis and

Hamilton (1983) first described plant regeneration from two-year old callus of Gossypium hirsutum L. CV Coker 310 via somatic embryogenesis. The procedure, however, involved a lengthy culture period, was not successful with other cultivars, and was difficult to repeat. Other researchers (Shoemaker et al., 1986; Gawel et al., 1986) also reported the successful initiation of somatic embryos and regeneration of cotton plants. A common feature of those reports is that the procedure is restricted to only a few genotypes. In their research, they found that only slow-growing, gray, opaque calli were embryogenic, while pale yellow, or light to dark green and fast growing calli was not embryogenic. The critical examination of callus cultures under a stereomicroscope was important in successfully establishing cotton cultures that could regenerate.

In vitro cultured cotton cells have been induced to undergo somatic embryogenesis in numerous laboratories using varied strategies (Shoemaker et al., 1986; Cheng et al., 1987; Trolinder and Goodin, 1987; Kolganova et al., 1992; Zhang, 1994; Zhang et al., 1996, 1999). Regenerated plants have been obtained from explants such as hypocotyls, cotyledon, root (Zhang, 1994) and anther (Zhang et al., 1996), and from various cotton species (Zhang et al., 1994). In 1987, Trolinder and Goodin reported cotton regeneration from suspension cultures. Eight cotton cultivars were screened for their ability to form embryogenic callus from hypocotyl sections and Coker 312 was described as having a high embryogenic response. A system that is simple, easy to manipulate, and can provide large numbers of somatic embryos for study in a short time was described. A limitation, however, was that among the 78 flowering plants obtained, only 15.4% set seeds. Finer (1988) reported high-frequency embryogenic suspension culture of Coker 310.

Although the efficiency of regeneration via somatic embryogenesis has been improved significantly in recent years, some difficulties still remain. Only a limited number of cultivars can be induced to produce somatic embryos and regenerative plants, and the most responsive lines are Coker varieties, which are no longer under cultivation (Feng et al., 1998). This genotype-dependent response restricts the application of cotton biotechnology in cotton breeding and production. Therefore, before plant tissue culture techniques are widely applied to cotton improvement programs, plant regeneration must be possible for a broad range of genotypes.

2.1.1 Callus induction

Establishment of callus cultures is a preliminary step in tissue culture. Beginning with second half of the 70's the reports on tissue cultures of cotton included studies on the standardization of media for several species. Virtually any part can be included to form callus including embryos, root or stem sections, hypocotyls and cotyledons of immature seeds, germinating seedlings and leaves. Hypocotyls, cotyledons, ovules, anthers, matured leaf and stem segments have been used for callus induction in cotton.

Although several standard media were tested for optimum cell growth and callus morphology, there is no standard medium which can support the growth of callus of all the crop species. While certain media supported good growth of callus in some species, which could be ineffective for others. Several studies on the above aspects have been carried out in cotton (Gossypium spp.).

2.1.2 Callus proliferation

Once callus is induced in any part of the explant, it should be able to proliferate further and be amenable for subsequent growth and maintenance for a reasonable period of time. This is very important for a variety of application involving the cell phase. Callus induction medium itself may or may not help its further proliferation. For callus cultures of large number of monocot and dicot plants several standard media (Gamborg et al., 1966; Gautheret 1955, Hilderbrandt, 1962; Lin and Staba, 1961; Murashige and Skoog, 1962; White, 1942) were tested for optimum cell growth and colony morphology. Some of the standard media supported the good growth of callus of some species, but little or no growth of callus of other species. Many media that have been developed for growth of isolated plant cells, tissues and organs show a wide difference in the concentrations of mineral and other components. A medium which would support the growth of both monocotyledons and dicotyledons plant tissues was desired. After testing of a wide range of concentrations of the components, a medium called SH was developed by Sehenk and Hilderbrandt (1972). The SH medium produced excellent callus which was soft, friable and it was amenable for single cell modifications and enzymatic cell wall removal. Low level of cytokinins was found essential for cell cultures of many, but not all dicotyledonous plants. Some dicotyledonous plants (eg. Soybean) rapidly adapted to a cytokinin free medium.

On the other hand, a few monocotyledonous tissues were inhibited on media with as little as 0.1 mg/l of kinetin. Casein hydrolysate initially induced growth stimulation for some monocot cultures, but subsequent cultures showed no benefits. Glucose did not improve the growth of monocot tissues as sucrose did. When myo-inositol was used in higher concentrations it was found slightly stimulatory and it was finally used at 1.0 gm/l. Anitarani and Bhojwani (1976) by testing various growth substances and plant extracts individually and in combinations showed that the best medium for the growth of cotton callus was MS supplemented with auxin, cytokinin and adenine. Of the various auxins tested, 1 mg/l NAA proved to be the best for callus growth. Among cytokinins, kinetin and BAP were equally good. On MS medium with 1 mg/l NAA, 1 mg/l kinetin and 40 mg/l Adenine the callus was maintained in an active state of growth for about 18 months. During the period, the callus was cultured through 15 passages of 4 weeks each. Repeated sub-culturing did not show hormone autonomous callus growth, unlike in tobacco (Bedner and Bedner, 1971). Auxin protectors like phenolic compounds are known to inhibit the peroxidase catalyzed oxidation of auxins (Stonier, 1971). Oxidation of auxin protectors by polyphenol oxidase and other oxidising agents cause a noticeable appearance of brown colour, characteristic of quinone formation which then enhances auxin destruction. Such agents are known to be present in cotton (Morgan and Hall 1963). In order to prevent browning of callus, Katterman et al. (1977) used DTT (Dithiothritol), Ascorbic acid and PVP (Poly vinyl pyrrolidone) during callus maintenance. During the initial stages of isolation and subculture, the hard compact cotyledonary callus exhibited new growth in the form of proliferating white cells, some of which turned green subsequently.

They observed that explants on DTT free medium released greater amount of a brown substance in the surrounding agar than on media containing DTT. They finally concluded that a critical combination of strong reducing agent and auxin protectors helped to maintain callus. Compared to ascorbic acid (Davis et al., 1974) and polyvinyl pyrolidone (Loomis and Battaile, 1966), DTT was more effective for inhibition of brown colouration.

Price et al. (1977) were able to induce callus and maintain it in five species. In G. hirsutum VaT, TM-1, cultures were maintained on MS medium with 1M, NAA and 2ip. Callus was very dark green and granular in appearance on 1M and light green and smooth in appearance on NAA. Callus was successfully maintained through subcultures for over seven months. G. anomalum callus was found relatively non specific as far as hormone requirements were concerned. Callus was green in colour. G. raimondii and G. klotzschianum were sub cultured for 3 months on MS medium with 1.0 mg/l 2ip and 0.1 mg/l NAA. Both produced friable dark green callus. G. aromourianum could also be repeatedly subcultured on MS medium with 0.5 mg/l NAA and 1.0 mg/l 2ip. Davidonis and Hamilton (1983) maintained the cotyledonary callus of Coker 310 on LS medium containing 30 gm/l glucose, 2 mg/l NAA and 0.5 mg/l Kinetin under continuous low light conditions (0.5-1.0 E/m2/s) at 25°C. The slow growing callus tissue was subcultured every 6- 7 weeks. They observed that if interval between transfers was greater than 15 weeks, subsequent callus growth and embryogenic potential were reduced.

Shoemaker et al. (1986) studied the maintenance of callus of 17 cultivars of G. hirsutum on three media. Calli placed on Medium-3 (LS- salts, lacking NH4NO3 but containing 3.8 gm/l KNO3 with 1 mg/l NAA and 0.5 mg/l kinetin), generally showed the least vigorous growth. Medium 1 (MS salts with 10 mg/l 2ip and 1 mg/l NAA) more often produced an exceptionally vigorous and healthy callus than either of the two maintenance media. Medium 2 (MS salts with 10 mM glutamine, 1.0 mg/l NAA and 0.5 mg/l Kin) produced callus of consistently average growth and vigour in all the genotype.

Trolinder and Goodin (1987) subcultured callus of Coker 312 for maintenance on callus initiation media (MS salts + 100 mg/l inositol + B5 vitamin + 30 gm/l glucose + 0.1 mg/l, 2, 4-D + 0.5 mg/l kinetin) for upto one year prior to liquid culture.

Li et al. (1989) studied the callus maintenance of 15 G. hirsutum cultivars. Morphology of callus during maintenance depended on the cultivars and hormones added to the medium. Callus of cv. ASI-2 multiplied more rapidly than Zhong 13, Stoneville 213 and Coker 312 on medium supplemented with 0.1 mg/ kinetin.

While proliferating and maintaining the initiated callus, Firoozabady and Deboer (1993) used different concentrations and combinations of NAA and 2ip. They observed a range of gross morphology of callus varied from hard (non friable) to extremely friable. They noticed that the degree of friability was highly dependent on the hormones used. Less friable calli were obtained with higher cytokinin (2ip): auxin (NAA) ratio. Friability increased with higher NAA concentration. They obtained mid-friable tissue when subcultured to medium containing no hormones. Maintenance media for callus used by Dongre et al. (2004) was same as that they initially used for callus initiation. They concluded that callus growth rate, colour and quantity varied depending on the genotypes, hormone combination and cultural conditions. They observed some degree of browning in all the cultures and extensive root proliferation in many of the genotypes.

2.1.3 Somatic embryogenesis

Recent research on the culture and totipotency of plant cell cultures and the ability to manipulate them in vitro has generated much interest in the potential application of somatic cell genetics to crop improvement. Regeneration of plants from tissue culture after a variety of manipulations is a must before tissue culture techniques can be employed as a practical tool in crop improvement. Factors involved in the regeneration of plants in Gossypium species from callus have been investigated by number of workers. However, there are only a few successful reports available on plant regeneration.

The regeneration of plants from cotton callus (Gossypium hirsutum cv. Coker-310) was described by Davidonis and Hamilton (1983). Somatic pro-embryoids developed spontaneously after two years in culture on a modified LS medium. The percentage of calli forming pro-embryoids increased to about 30 by prolonged culture without NAA and kinetin. Development of proembryoids was also enhanced by transferring pro-embryoids to media lacking NH4NO3 but containing double the quantity of KNO3 and gibberellic acid. Root initiation and growth was promoted by lowering the glucose concentration to 5 gm/l.

Gawel et al. (1986) observed embryogenesis from leaf discs and petiole derived callus. They observed two types of calli. The callus which was formed from edges of the leaf discs was bright green and white and very hard; which was not favourable for embryogenesis, but, the midrib callus was brown to green and friable which was embryogenic. Out of several media and genotype combinations tried only the combination of Coker 312 on medium MS + 0.5mg/1 NAA + 1 mg/l kin + 0.1mg/1 GA3 + 0.4 mg/l Thiamine HCI produced somatic embryos.

Out of 17 G. hirsutum strains studied by Shoemaker et al. (1986) the embryogenic response was restricted to cultivars Coker-201 and 315. They observed embryogenic callus as small, compact, pale grey, sectors containing densely cytoplasmic cells which emerged from a soft yellowish to brown friable callus. They concluded that the emergence of embryogenic callus was not due to any specific medium composition. Repeated experimentation showed that subculturing on a separate maintenance medium was not necessary for the induction of embryogenic callus. They obtained the embryogenic callus within 4-6 weeks of plating the initial explant on the callus initiation medium (MS salts + 3 per cent glucose + 2 mg/l NAA + 1 mg/l kinetin). Embryogenesity was lost when such callus was subcultured on the same medium, but only occasionally lost on the same medium with sucrose. Germination of mature embryos was achieved by transferring them to auxin free MS medium with 1 mg/l kinetin and 1.5 per cent sucrose.

Trolinder and Goodin (1987) studied the embryogenic potential of eight G. hirsutum strains. Only Coker 312 responded much better than other genotypes. They obtained globular embryos after six weeks of culturing of the explant. Calli were subcultured on growth regulator free liquid suspension medium. Globular and heart stage embryos were collected 3-4 weeks after subculturing on suspension liquid medium. Heart stage embryos were plated on semisolid medium for further development. To induce germination and plantlet growth, mature embryoids were placed on sterile vermiculite saturated medium. Protoplasts were derived from callus suspension cultures of cultivar 3118, Coker 312 and Jinman 4 by She et al. (1989) in K-3 medium supplemented with 2, 4-D and kinetin. Protoplast division was noticed 3-4 days after their culture and friable white callus was obtained 3 weeks after culture. It was subcultured on harmone free MS medium and obtained somatic embryoids which developed into plants in Coker 312 genotype which took totally 5 months.

Trolinder and Xhixian (1989) screened 38 races of Gossypium for somatic embryogenesis with the protocols developed as a model for G. hirsutum cv. Coker 312. They used the same growth regulator regimes that were described by Trolinder and Goodin (1988a). An index of embryogenesis (IE), a new concept of comparison was developed and used to compare genotype response. The cultivars under their study were grouped into four responsive types viz., highly embryogenic, moderately embryogenic, low embryogenic and non embryogenic by their screening.

Gawel and Robacker (1990) studied genetic control of somatic embryogenesis in cotton petiole callus cultures. The regeneration media used in their study was MS salts and vitamins plus 4.0 mg NAA, 1.0 mg kinetin, 30 g glucose, 100 mg myo-inositol, 2.0 gm Gelrite and 0.75g MgCl2 per liter and then subcultured to hormone free media. They concluded that somatic embryogenesis in cotton acts as a heritable trait. Although a concise genetic model cannot be drawn from their results, the variability in both occurrence and magnitude of embryogenesis suggests somatic embryogenesis in cotton to be a multigenic trait. Wang et al. (1992) reported that brassinolide along with IAA promoted embryogenesis in Coker 312, 201 but with 2, 4-D, only callus proliferation was promoted. Guo and Yuan (1994) studied the plant regeneration from callus. They observed the production of embryogenic callus in cv Coker 201, 312, Lumbin 1024, Henan 79 and Jine 3016. Some embryoids germinated 20 days after transfer to medium. Maturation and germination was greatest at 50-55 days but some embryoids germinated after 70 days. Embryoids produced plantlets with 8-10 leaves after 2 months on SH medium. Katageri and Khadi (1998) conducted regeneration studies from callus cultures of Abadhita (G. hirsutum), SM-88 (G. herbaceum) and A-82- 1-1 (G. arboreum) on MS, BT and modified MS and BT media with different growth regulators. There was no response for embryogenesis in cultures on solid media, but they obtained embryoids under suspension cultures. They observed somatic embryoids in liquid MS and BT media supplemented with 0.1 mg/l, 2, 4-D and 0.1 mg/l TDZ. However, somatic proembryos did not further develop into plant.

Khushwinder et al. (1998) reported the best media for callus initiation, proliferation and maintenance in diploids, was MS medium containing 0.1 mg/L each 2, 4-D and kinetin while in G. hirsutum, it was MS medium having 5.0 mg/l NAA and 0.1 mg/l kinetin. Among the explants cultured immature embryos and hypocotyl segments gave maximum calli in all the species tested.

Baottong et al. (2000) developed in vitro plant regeneration system charecterised by rapid and continuous production of somatic embryos, using leaf and stem explants of abnormal seedlings in Coker 201 and CRI 12. They reported that optimal medium for direct somatic embryogenesis was modified MS medium supplemented with 0.1 mg/L Zeatin and 2.0g/l of activated carbon. Yuqiang et al. (2003) reported that MSB medium containing 0.045 muM 2, 4-D and 0.93 muM kinetin, 2-46 uM IBA promoted embryogenic culture proliferation and embryo development. Hypocotyls were better cotyledons for callus induction and plant regeneration.

Muthuswamy et al. (2004) developed protocol for in vitro regeneration from shoot tip explants of MCU-5 and MCU-11 in G. hirsutum cultivars. They reported that shoot development was observed on media supplemented with 0.1 mg/l kinetin and alternate with hormone free medium. Root development was observed on hormone free media with 0.3 per cent activated charcoal and alternate with charcoal free medium.

Wu et al. (2004) developed the highly efficient somatic embryogenesis and plant regeneration of 10 recalcitrant Chinese cotton cultivars. Calluses and embryogenic calluses were induced on MSB1 medium containing the optimal combination of indolebutyric acid (IBA; 2.46 mM) and kinetin (KT; 2.32mM). Up to 86.7% of embryogenic calluses differentiated into globular somatic embryos 2 mo. after culture on MSB2 medium containing double KNO3 and free of growth regulators. Up to 38.3% of the somatic embryos were converted into complete plants in 8 wk on MSB3 medium with L-asparagine (Asn)/L-glutamine (Gln) (7.6/13.6mM). The plants were successfully transferred to soil and grew to maturity. With the protocol described here, we have obtained hundreds of regenerating plantlets from 10 recalcitrant cultivars, which is important for the application of tissue culture to cotton breeding and biotechnology.

Ouma et al. (2004) developed A direct shoot regeneration protocol was optimized for cotton (Gossypium hirsutum). Two cultivars of cotton, Delta pine 50 (DP50) and Stoneville 474 (STV474) were used to study the effects of thidiazuron (TDZ), naphthalene acetic acid and silver nitrate (AgNO3) on shoot regeneration from hypocotyl explants excised from 14 day-old seedlings cultured in vitro. The best treatment for formation of adventitious shoots in DP50 was the treatment containing 0.175 mg/l TDZ, 0.01 mg/l NAA and 5.1 mg/l AgNO3, while treatment containing 0.08 mg/l TDZ, 0.01 mg/l NAA and 10.2 mg/l AgNO3 was optimum for the formation of adventitious shoots for STV474.

Ikram and Yusuf (2004) took cotton (Gossypium hirsutum L.) cv Coker-312 callus culture was assessed in terms of its usefulness as a system for investigating the effect of nitrates from different chemical compounds of nitrogen on embryo induction percentage in calli as the plant growth and cell differentiation mainly based on nitrogen. Both sources and amount of nitrogen in in vitro medium have significant effects mainly on cell growth, embryogenesis and the production of anthocyanin. Anthocyanin production is the best indication of inhibition of cell growth in in vitro culture of cotton. Embryo induction rate was high when NH4NO3 was eliminated from the medium but in the presence of KNO3. The dicotyledenary embryos were developed with in 5 weeks, these embryos developed into normal plantlets immediately when they were cultured on a simple MS basal medium supplemented with 3% glucose.

Ikram (2005) reported Somatic embryogenesis and plant regeneration are fundamental to tissue culture biotechnology in cotton (Gossypium hirsutum L.) cv. Coker 312. Callus proliferation was considered best on MS1a (2.0 mg/l NAA; 0.1 mg/l ZT; 0.1 mg/l KIN) when 6 weeks old callus was cultured from MS1b (0.1 mg/l 2, 4-D; 0.5 mg/l KIN) medium, there is no need to select embryogenic calli for somatic embryogenesis, as all of them were converted to somatic embryos. NH4NO3 play an important role in differentiation of callus into somatic embryos but is lethal for embryos just after two weeks. However, KNO3 is less efficient for somatic embryo induction but is best for embryo maturation. By this procedure 56.51% cotyledenary embryos were developed within 5 weeks. Of that, 82.05% cotyledenary embryos were developed not only into normal plantlets, but rooted simultaneously when cultured on MS (with 0.05 mg/L GA3) medium. A complete plant of Cocker-312 could be regenerated through somatic embryogenesis within 4 to 5 months.

Michel et al. (2008) reported Callus initiation was genotype dependent, and R405-2000 has the best callogenesis response. Callus was induced from three media, the percentage of callus induction and dry weight of callus varied, but MS was the best callogenesis medium. It appeared that it was much easier to induce callus from hypocotyl than cotyledon or root explants. Induction callus of cotton was varied with hormone regimes. In effect, a proper combination of 2, 4-dichlorophenoxyacetic acid (2, 4-D) and kinetin (KIN) promoted the callus initiation. Glucose was the best sugar to promote the production of callus.

However, the concentrations of glucose were critical to the induction of callus. The optimum glucose concentration for callus induction was 40 g/l. The best medium for the proliferation of callus was MS medium with 0.1 mg/l 2, 4-D, 0.5 mg/l KIN and 4% glucose. An efficient protocol for the production of high frequency callus of cotton has been developed.

Abdellatef and Khalafallah (2008), developed protocol for callus induction of elite Sudanese cotton. Callus cultures were initiated from hypocotyl explants of elite Sudanese medium staple cotton (Gossypium hirsutum L.) cultivar Barac B-67 on Gamborg's B5 basal media. Different types and concentrations of growth regulators were tested in order to obtain the best callus formation. Four auxin types, indole -3- acetic acid (IAA), α-naphthalene acetic acid (NAA), indole-3- butyric acid (IBA), 2, 4-dichloro-phenoxyacetic acid (2, 4-D) at five concentrations(0.1, 0.2, 0.5, 1.0 and 1.5 mg/l) and two cytokinines, benzyl adenine (BA) and 6-furfuryl amino purine (Kin) at four levels (0.1, 0.5,1.0 and 1.5 mg/l) in combination with NAA at (1.0 and 1.5 mg/l) were used in this study. It was found that growth regulator type and concentration had a significant effect on the callus induction, the increment of callus index and callus physical appearance. The highest frequencies of callus growth index (8.13 and 8.0) were observed on hypocotyl explants cultured on B5 basal medium supplemented with 1.0 mg/l NAA in combination with 0.1 mg/l of Kin or BA, respectively. Medium containing Kin resulted in the formation of compact callus with large numbers of roots emerging from it. There was no callus formation on B5 basal medium. The callus induced on B5 medium containing 2, 4-D was brown in color and of low quality compared to that produced on B5 media containing NAA.

Lashari et al. (2008) optimized zeatin concentration and explant type for high frequency embryogenic callus and plant regeneration of a diploid cotton variety Faisalabad Hybrid-228 (FDH-228). Callus was induced from three types of explants on MSB (MS salts with B5 vitamins) supplemented with zeatin (ZT) only. The concentrations of ZT and explant type were found critical to the induction and proliferation of embryogenic callus. Optimum ZT concentration for callus induction was 0.5-25 µM. Two kinds of callus were found after 70 days of culture; embryogenic and non-embryogenic callus. Embryogenic callus developed into somatic embryos at various stages after 20 days of subculture. The capability of embryogenesis depended on explant types. The root was the most responsive explant to produce somatic embryos from callus produced at 0.5µM zeatin, the hypocotyl was the next and cotyledon was the last. Moreover, a low concentration of ZT was advantageous to induce embryogenic callus, 2, 4 dichlorophenoxy acetic acid (2, 4-D) promoted the proliferation of embryogenic callus, but had a negative effect on differentiation and germination of somatic embryos. The best medium for proliferation of embryogenic callus was MSB medium with 5.0 µM 2, 4-D, 2.5 µM kinetin and 2.5 µM ZT. The best medium for differentiation and germination of somatic embryos was MSB with 0.5 µM ZT, 2.5µM kinetin, 1.0 µM glutamine, 0.5 µM asparagine.

Han et al. (2009) reported many restrictive factors still remain in cotton tissue culture such as long duration, unpredictability and a high degree of genotype dependence. The main objective of this study was to develop a protocol allowing consistent somatic embryogenesis and plant regeneration from five recalcitrant cotton cultivars. Results showed that the best medium for calli induction is MSB (MS medium + vitamine B5) supplemented with indolebutyric acid (IBA, 0.1 mg/l), kinetin (KIN, 0.1 mg/l) and 2, 4-dichlorophenoxyacetic acid (2, 4-D, 0.1 mg/l). Embryogenic calli of all the five genotypes used were successfully from MSB medium supplemented with IBA (0.3 mg/l) and KIN (0.05 mg/l). Somatic embryos and transformation of somatic embryos into plants were successfully induced on MSB medium supplemented with ½×NH4NO3 (825 mg/l), 2×KNO3 (3800 mg/l), glutamine (2.0 g/l) and asparagines (0.5 g/l). The protocol developed in this study for cotton plant regeneration could be shortened to 4 - 5 months. Furthermore, the firstly-obtained regenerated plants of above five cultivars will broaden the range of genotypes for in vitro manipulation for cotton improvement.

Nagaraj et al. (2012) reported in vitro regeneration was noticed in Coker-312 but presence of variability for regeneration from plant to plant. For callus induction, hypocotyls showed higher and faster response compared to cotyledons on M-I (MS+0.1 mg/l 2, 4-D+0.5 mg/l KIN) medium. On M-IV (Basal MS medium), hypocotyls and cotyledons showed higher embryogenesis and regeneration as compared to M-III (MS + 0.5 mg/l KIN) medium and also these two explants took less number of days for initiation of pro-embryos on M-IV (Basal MS) as compared to M-III (MS + 0.5 mg/l KIN). Calli of hypocotyls from 64 plants and cotyledons of 52 plants showed embryogenesis in M-III medium, 45 of them were common for both the explants. Complete regeneration was observed in all the calli, however there were only 3 to 4 plants obtained. Calli of hypocotyls from 70 plants and cotyledons of 61 plants showed embryogenesis in M-IV medium, 58 of them were common for both the explants. Complete regeneration was observed in all the calli, however there were only 6 to 7 plants obtained.

2.1.4 HARDENING

Acclimatization or habituation of in vitro grown plantlets to the external condition is a gradual process. It is recommended that removal of nutrient media from the plantlets to be hardened, pre-conditioning to low relative humidity, high light intensity and high temperature can ensure higher survival during transfer of plantlets to natural conditions. The gradual removal of sugar is known to stimulate photosynthetic ability.

A mixture of soil: sand: peat in 2:1:1 ratio can be used for successful hardening of plants. Sand provides better aeration, while soil gives good anchorage, nutrients and water holding capacity and peat along with soil adds to these properties.

Iradparah and Khosh (1989) reported hardening of in vitro rooted plants in pasteurised 1/3 loam soil, 1/3 sand and 1/3 peat moss (v/v) medium for two weeks and then transplanting them to pots with the same mix in green house.

2.2 AGROBACTERIUM MEDIATED TRANSFORMATION

2.2.1 Genetic transformation studies in Coker cotton via somatic embryogenesis

Plant transformation mediated by the soil plant pathogen Agrobacterium tumefaciens is simple method for plant transformation. There are two tumorgenic species i.e. Agrobacterium tumefaciens and Agrobacterium rhizogene. Agrobacterium tumefaciens is a gram negative soil bacterium, causes crown gall tumors (neoplastic disease) on many dicotyledonous and some monocotyledonous plants (Broer et al., 1995). During plant infection A. tumefaciens, transformed plants by transferring a part of its DNA called transferred DNA (T-DNA) from its tumour inducing (Ti) plasmid to the plant genome.

The virulence (Vir) region of the Ti plasmid codes for the function required for processing and transfer of T-DNA (Lyer et al., 1982; Stachel and Nester, 1986). The discoveries that T-DNA codes for oncogene which is only transferred to plant cell genome (Bevan et al., 1983a) and non virulent or disarmed strains i.e. containing T-DNA from which oncogenes have been removed and replaced by any other gene of interest, behave in the same way as virulent strain do, that opened a new avenue in transformation of interested gene to higher plants.

Zhou et al. (1983) reported cotton transformation through injection of DNA directly into embryos in immature cotton bolls. Since the injected DNA was obtained from Sea Island cotton (G. barbadense L.) plants with different morphological characteristic in the recipient upland cotton (G. hirsutum L.) plants were obtained. The putative transformed plants were identified by phenotypes such as boll size and fibre length. The absence of any discrete foreign gene precluded analysis by DNA hybridization to genomic southern blots.

Horsch et al. (1985) described a protocol of co-cultivating Agrobacterium with leaf discs instead of protoplasts to overcome problems of regeneration of plants through protoplasts.

Gynheung (1985) reported that tobacco calli were transformed at levels up to 50 per cent by co-cultivation of tobacco cultured cells with Agrobacterium tumefaciens harbouring the binary transfer DNA vector, PGA-472, containing a Kanamycin resistance marker. Transformation frequency was dependent on the physiological state of the tobacco cells, the nature of Agrobacterium strain and, less so on the expression of vir genes of the tumour inducing plasmid. Maximum transformation frequency was obtained with exponentially growing plant cells, suggesting that rapid growth of plant cells is an essential factor for efficient transformation of higher plants.

Firoozabady et al. (1987) found that cotton cotyledon tissues are efficiently transformed and regenerated. Cotyledon pieces from 12 day old aseptically germinated seedling were inoculated with Agrobacterium tumefaciens strains containing avirulent Ti plasmids with a chimeric gene encoding kanamycin resistance. After three days co-cultivation, the cotyledon pieces were placed on a callus initiation medium containing kanamycin for selection. High frequencies of transformed kanamycin resistant calli were produced. 80 % of which were induced to form somatic embryos. Somatic embryos were germinated and plants were regenerated and transferred to soil. This process for producing transgenic cotton plants facilitates transfer of genes of economic importance to cotton.

Umbeck et al. (1987) reported preliminary results on cotton (G. hirsutum L.) transformation via Agrobacterium using hypocotyls as explants. Selection and regeneration were not thoroughly characterized.

Chee et al. (1989) have confirmed that about 0.01 per cent of the total seeds infected with Agrobacterium tumefaciens harbouring npt-II gene have shown transformation in case of germinating seeds of Glycine max.

Fredrick et al. (1990) reported the expression of insecticidal proteins HD-73 cry 1Ac and cry 1Ab in cotton. Coker 312 was transformed by Agrobacterium mediated transformation. Total protection from insect damage of leaf tissue for these plants was observed in laboratory assays when tested with Lepidopteran insects.

Srivastav et al. (1991) used disarmed Agrobacterium tumefaciens vector to transform G. hirsutum. Three days old inoculated hypocotyls were selected on kanamycin medium. Different phytohormones were used for the induction of calli. The calli obtained were selected for continuous proliferation on kanamycin medium. They observed that calli were resistant to the antibiotic and expressed the npt-II enzyme.

Pannetier et al. (1997) reported that regeneration of somatic embryos is relatively low and not fully mastered. The expression level of native Bacillus thuringiensis genes in plants is very low. It will protect the cotton from S. littoralis and development of insect resistance varieties.

Dillen et al. (1997) indicated that temperature plays an important role in transformation with A. tumefaciens. In their results, the best transformation efficiency was obtained at 22

0C in both

Phaseolus acutifolius callus and tobacco leaves, irrespective of the type of helper plasmids. Although in vitro co-cultivation is normally done at 25

0C, they showed that a lower temperature (19-22

0C) was

more optimal because in planta tumour formation occurred more frequently at 22 0C.

Saeed et al. (1997) reported that in order to develop transgenic plants via the biolistic gun method, regenerable embryogenic tissues are required. Meristem shoot tips of 19 cultivars of cotton were cultured on several media formulations and assessed for shoot and root development. The best shoot development was observed on media containing 0.46 mM kinetin while rooting was observed on media containing 2.68 mM NAA and 0.46 mM kinetin. No intervarietal variability was observed. A complete protocol was developed from meristem tip culture to field transfer. This methodology was simple and replaces the prevailing existing protocols for meristem tip culture of cotton so far.

Mahalaxmi and Khurana (1997) have studied the age and physiological status of the plant and reported that the meristematic tissues, explants from the young plants and cells undergoing dedifferentiation are the choicest material for Agrobacterium mediated transformation. The age and physiological status of the plant plays an important role during plant-microbial interactions. Usually, 3-4 days old seedlings were used for agro-infection in maize, wheat and other cereals than dry dissected seeds with exposed apical meristems. Immature embryos of maize were differentially susceptible to Agrobacterium; the best stage corresponded to 12-22 days after pollination when the two leaf initials were formed, indicating a specific window of competence in the host plant. It was also observed that leaves were more competent than roots, scutellum or seed remnants in maize, rice and in wheat and barley.

Cervera et al. (1998) have suggested that low efficiency of transformation was due to an insufficient length of co-cultivation, however they have also reported that it was more difficult to eliminate Agrobacterium after longer periods of co-cultivation. Further they have also reported that the 5 day culture period resulted in over growth of Agrobacterium and a subsequent decrease in the regeneration frequency of transformed shoots, although 5 day co-cultivation was the most effective for increasing the frequency of transient GUS-expression in citrange explants. Therefore, the period of co-cultivation should be optimized.

Wang et al. (1998) have successfully done transformation of four upland cotton cultivars via Agrobacterium mediated transformation. Hypocotyl segments from asceptic seedling were screened and somatic embryos and regenerated plants were obtained on various media. Transgenic cotton plants were confirmed by ELISA, PCR and southern analysis, and bioassays demonstrated that the transgenic plants had significant resistant to larva of cotton bollworm.

Moralejo et al. (1998) have described a procedure for genetic transformation of Eucalyptus globulus (Labill) and they have studied the influence of explant pre-cultivation and reported that when seedlings were pre-cultivated for 4-6 days, the level of GUS transient expression was significantly greater than that of control (i.e. without pre-culture) and that the seedlings pre-cultured for 6 days seemed to be more suitable for stable integration of transgenes.

They further reported that the improvement of DNA uptake could be due to stimulation of cell division by the hormones in the pre-cultivation medium, since mitotic cells would be more susceptible to Agrobacterium or would have a higher level of transcription. However, they also opine that the physiological status optimal for DNA uptake (transient expression) is not necessarily optimal for integration of foreign DNA in the host genome. Infact, division of cells would not be sufficient for transformation, and integration may primarily depend on the availability of DNA repair enzymes. These proteins, although not yet identified are thought to play a key role in the last steps of T-DNA integration (Tinland 1996).

Donaldson and Simmonds (2000) have reported the overall rate of in vitro transformation for co-cultural explants placed on selection media ranged from 27-92 per cent depending on the cultivar. However transformation was predominantly confined to non-regenerable hypocotyl callus or other non-regenerable tissue, in regeneration, competent tissue of the cotyledonary node or in differentiated tissue was rare.

Sunilkumar and Rathore (2001) reported green fluorescent protein (GFP) proved to be a valuable tool in elucidating the timing and localization of transient gene expression and in visualizing conversion of transient events to stable transformation events. Strain LBA-4404 proved to be significantly better than EHA-105. Acetosyringone significantly increased the stable transformation efficiency in cotton at 21

0C compared to 25

0C.

Veluthambi et al. (2003) reported that the naturally evolved unique ability of Agrobacterium tumefaciens, to precisely transfer defined DNA sequences to plant cells, has been very effectively utilized in the design of a range of Ti plasmid-based vectors. Agrobacterium chromosomal virulence genes (chv), T-DNA delimited by a right border and a left border and Ti plasmid virulence genes (vir) constitute the T-DNA transfer machinery. The inability of Agrobacterium to transfer DNA to monocotyledonous plants was considered its major limitation. Agrobacterium T-DNA transfer is now viewed as ‘universal’ based on successful transformation of yeast, Aspergillus and human cells.

Mishra et al. (2003) reported callus induction medium (MCIM) empirically determined for the cultivar ‘Maxxa’ paved the way for RG selection among individual genotypic variants within a cultivar. MCIM consists of a basal Murashige–Skoog medium, supplemented with a unique combination of two synthetic auxins. Hypocotyl explants of ‘Coker 312’, ‘Maxxa’ and ‘Riata’ seedlings cultured on MCIM successfully produced a high quality, friable callus as defined by its color, texture, size, and organization. Based on the number of fertile plants regenerated on a per seedling basis, RG was estimated as 17.4%, 44.4% and 80% in Acala cotton cultivars ‘Maxxa’, ‘Ultima’, and ‘Riata’, respectively. The high RG of the cultivar Riata, a Round-up Ready transgenic cultivar in a Maxxa genetic background, is likely due to additional RG alleles introgressed from the transgenic parent. Genotypic differences between cultivars for RG was reflected by the need for supplemental kinetin to efficiently regenerate ‘Ultima’ plantlets via somatic embryogenesis. RG selection pressure through two cycles of selection resulted in development of advanced highly regenerable ‘Max-R’ lines in an elite genetic background with immediate potential as suitable germplasm for breeding and biotechnology applications. Based on the results presented here, strategies for genotype-independent transformation and regeneration of cotton are proposed that integrate selection and introgression of regeneration potential in improvement programs.

Ouma et al. (2004) reported in two cultivars of cotton, Delta pine 50 (DP50) and Stoneville 474 (STV474) the effects of thidiazuron (TDZ), naphthalene acetic acid and silver nitrate (AgNO3) on shoot regeneration from hypocotyl explants which was cultured in vitro excised from 14 day-old seedlings. The best treatment for formation of adventitious shoots in DP50 was the treatment containing 0.175 mg/l TDZ, 0.01 mg/l NAA and 5.1 mg/l AgNO3, while treatment containing 0.08 mg/l TDZ, 0.01 mg/l NAA and 10.2 mg/l AgNO3 was optimum for the formation of adventitious shoots for STV474.

Ikram (2004) successfully transferred gene through Agrobacterium mediated gene delivery system via vacuum infiltration for 2 month old embryogenic calli of cotton cv. Cocker –312 and with optimized selective transformed callus growth and somatic embryogenesis by the use of kanamycin antibiotic.

Leelavathi et al. (2004) presented a protocol for efficient transformation and regeneration of cotton. Embryogenic calli co-cultivated with Agrobacterium carrying Cry IIa5 gene were cultivated under dehydration stress and antibiotic selection for 3-6 weeks to generate several transgenic embryos.

Seventy five globular embryo clusters were observed on selection plates and these embryo clusters were cultured on multiplication medium followed by development of cotyledonary embryos on embryo maturation medium to obtain an average of 12 plants per petri plate of co-cultivated callus. Eight three per cent of these plants have been confirmed to be transgenic by southern blot analysis and ten kanamycin resistant plants per plate was obtained.

Wilkins et al. (2004) reported that the development of transgenic cotton requires an efficient means for the transformation and regeneration of fertile plants. Despite the commercial success of genetically modified cotton, the transformation and regeneration of cotton is still challenging relative to other crop species. The efficiency of somatic embryogenesis and somaclonal variation are among the most often cited problems encountered in the regeneration of cotton. In the last decade, numerous innovations have been incorporated to improve the recovery and germination of high quality somatic embryos, increase transformation efficiency by reducing regeneration time, and that virtually eliminates somaclonal variation. These improvements and modifications are reported here for the first time in detail in a step-by-step procedure for cotton transformation and regeneration that includes commentary for trouble-shooting problems.

Tohidfar et al. (2005) reported that the cotton (Gossypium hirsutum L., var. Coker 312) hypocotyl explants were transformed with three strains of Agrobacterium tumefaciens, LBA4404, EHA101 and C58, each harboring the recombinant binary vector pBI121 containing the chi gene insert and neomycin phosphotransferase (nptII) gene, as selectable marker. Inoculated tissue sections were placed onto cotton co-cultivation medium. Transformed calli were selected on MS medium containing 50 mg/1 kanamycin and 200 mg/1 cefotaxime. Putative calli were subsequently regenerated into cotton plantlets expressing both the kanamycin resistance gene and Beta-glucuronidase (gus) as a reporter gene. Polymerase chain reaction was used to confirm the integration of chi and nptII transgenes in the T1 plants genome. Integration of chi gene into the genome of putative transgenic was further confirmed by Southern blot analysis. ‘Western’ immunoblot analysis of leaves isolated from T0 transformants and progeny plants (T1) revealed the presence of an immunoreactive band with MW of approximately 31 kDa in transgenic cotton lines using anti-chitinase-I polyclonal anti-serum. Untransformed control and one transgenic line did not show such an immunoreactive band. Chitinase specific activity in leaf tissues of transgenic lines was several folds greater than that of untransformed cotton. Crude leaf extracts from transgenic lines showed in vitro inhibitory activity against Verticillium dahliae.

Wu et al. (2005) reported high frequency of transformation have via Agrobacterium mediation, coupled with the use of embryogenic calli as explants. Agrobacterium tumefaciens strain LBA-4404 harbouring binary vector pBin438 carrying a synthetic Bacillus thuringiensis active cry 1Ac and API-B chimeric gene. The transgenic plants were highly resistant to cotton bollworm (Heliothis armigera) larvae, with mortality ranging from 95.8 to 100 per cent.

Shuangxia et al. (2005) reported transforming embryogenic callus mediated by Agrobacterium tumefaciens in cotton. Agrobacterium concentration and physiological status of embryogenic callus on transformation efficiency were superior strain LBA-4404 and proved significantly better than C58C3. Relatively low co-cultivation temperature (19

0C) and short co-cultivation duration (48h) were optimal

for developing a highly efficient method of transforming embryogenic callus. Concentration of Acetosyringone at 50 mg/1 during co-cultivation significantly increased transformation efficiency. Embryogenic callus growing 15 days after subculture was the best physiological status for transformation.

Jin et al. (2006) took hypocotyls of cotton (Gossypium hirsutum L.) cultivars cv. YZ-1, Coker 312 and Coker 201 were inoculated on Murashige and Skoog callus induction medium. YZ-1 exhibited a very high regeneration potential, with 81.9 % of the explants inoculated differentiated into embryogenic callus within 8 - 10 weeks. During the process of callus maintenance (subculture for 1 to 3 years), the total embryo numbers in Coker 312 and Coker 201 calli dropped sharply, and the percentage of embryo germination decreased. On the contrary, the callus of YZ-1 consistently maintains a high frequency of plant regeneration after long-time subculture. Transgenic kanamycin-resistant calli of Coker 201 partially lost the ability of somatic embryogenesis and plant regeneration. The stress produced by the transformation procedure slightly affected somatic embryogenesis and plant regeneration of YZ-1, which showed minimum loss of plant regeneration ability.

Zhu et al. (2006) reported an Agrobacterium-mediated transformation of green-colored cotton (Gossypium hirsutum L.). A tissue culture procedure was optimized to induce callus formation from hypocotyl explants and subsequent differentiation into the embryogenic type.

Callus formation could be induced by growing explants on Murashige and Skoog medium containing 2, 4-D and kinetin. Among the four genotypes studied, embryogenic calli and plant regeneration were observed only in var. G9803. Agrobacterium-mediated transformation of G9803 with the fiber-specific expansin gene GhExp1 was achieved based on the establishment of these tissue culture methods. A total of 32 individual regenerants resistant to kanamycin were generated within 7 mo., with a transformation frequency of 17.8%. Transformation was confirmed by Southern blot analysis and RT-PCR. These results represent the first step towards genetic manipulation of the colors and fiber quality of green-colored cottons by biotechnology.

Guo et al. (2007) transferred three constructs harbouring novel Bacillus thuringiensis genes cry 1C, cry 2A, cry 9C and bar gene into four upland cotton cultivars via Agrobacterium mediated transformation. As high as 84.8 per cent resistant calli were confirmed positive by PCR tests and total 50 transgenic plants were regenerated. Bioassay showed 80 % of the transgenic plantlets showed resistance to both insect and herbicide. This result showed that bar gene can replace antibiotic marker genes.

Meng et al. (2007) evaluated the effects of the antibiotic hygromycin B on cotton (Gossypium hirsutum L.) callus induction, callus proliferation, and seed germination. Nontransgenic cotyledon and hypocotyl showed obvious variance in tolerance to hygromycin. Cotyledons were more sensitive to hygromycin than hypocotyls. Hygromycin at 7.5 and 20 mg/1 completely inhibited callus initiation from cotyledon and hypocotyl explants, respectively. Nontransformed calli did not grow on media supplemented with 10 mg/1 hygromycin and were killed at 15 mg/1. In seed germination assay, the presence of 20 mg/1 hygromycin significantly suppressed shoot and root elongation of seedlings. This hygromycin concentration was applied to select regenerated transgenic plantlets and their progenies. Based on these results, we developed an efficient hygromycin selection protocol for Agrobacterium-mediated cotton transformation and regeneration.

Wu et al. (2008) reported Agrobacterium-tumefaciens-mediated transformation of cotton embryogenic calli (EC) was enhanced by choosing appropriate EC and improving efficiency of co-culture, selection cultivation, and plant regeneration. After 48-h co-cultivation, the number of β-glucuronidase (GUS)-positive calli characterized by yellow, loose, and fine-grained EC was twofold greater than that of gray, brown, and coarse granule EC. It indicated that efficiency of transient transformation was affected by EC morphology. And transient transformation efficiency was also improved by co-cultivation on the medium adding 50 mg/1 acetosyringone at 19°C for 48 h. Sub-culturing EC on the selection medium with low cell density was beneficial to production of more kanamycin-resistant calli lines. From an original 0.3-g EC, an average of 20 Km-R calli lines were obtained from a selection dish and the GUS-positive rate of Km-R clones was 81.97%. A large number of normal plants were rapidly regenerated on the differentiation medium with dehydration treatments and the GUS-positive rate of regeneration plants was about 72.60%. Polymerase chain reaction analysis of GUS-positive plantlets revealed a 100% positive detection rate for neomycin phosphotransferase II gene and uidA. Southern blot of transgenic plants regenerated from different Km-R calli lines demonstrated that the target gene, mostly with the low copy number, has been integrated into the cotton genome.

Tohidfar et al. (2008) reported in order to produce transgenic cotton resistance to insects, hypocotyl explants were transformed with Agrobacterium tumefaciens strain LBA4404 harboring the recombinant binary vector pBI121 containing the cry1Ab gene under the control of CaMV 35S promoter. Neomycin phosphotransferase (nptII) gene was used as a selectable marker. Inoculated tissue sections were placed onto co-cultivation medium. Transformed calli were selected on MS medium containing 50 mg/l of kanamycin and 200 mg/l of cefotaxime. Plantlets were subsequently regenerated from putative transgenic calli. Polymerase chain reaction (PCR) and southern blot analysis were used to confirm the integration of cry1Ab and nptII transgenes into the plant genome. Western immunoblot analysis of proteins extracted from leaves of transgenic plants revealed the presence of an immunoreactive band with a molecular weight (MW) of approximately 67kDa in transgenic cotton lines using the anti-Cry1Ab polyclonal anti-serum. Homozygous T2 plants (Line 61) for the cry1Ab gene showed significantly higher levels of insect resistance against Heliothis armigera larvae compared with the control plants.

Li et al. (2009) reported two cotton genotypes, Simian 3 (SM 3) and WC, were co-transformed using a mixture of four Agrobacterium tumefaciens cultures of strain LBA-4404, each carrying a plasmid harboring the following genes, Bt + sck (for Bacillus thuringenesis protein and modified Cowpea trypsin inhibitor), bar (for glufosinate), keratin, and fibroin.

The frequency of callus induction, embryogenesis, and plant regeneration were notably different between the two genotypes. However, there were no differences between the two genotypes for number of plantlets carrying multiple gene copies of different gene combinations as well as transformation frequency for different gene combinations. PCR analysis indicated that more than 80% of plantlets carried the nptII gene for kanamycin resistance.

Overall, the co-transformation frequency of two or more genes was about 35%. Southern blot analysis confirmed integration of target genes into the cotton genome, and the number of copies of the transgene(s) varied from one to four. Multiple transgene expression was confirmed by RT-PCR analysis in some transgenic lines. Further analysis of T1 plants demonstrated that multiple transgenes were inherited and expressed in progenies.

2.2.2 Genotype independent genetic transformation

Gould et al. (1991a) reported method of regenerating cotton plants from the shoot apical meristem of seedling for use with particle gun and Agrobacterium mediated transformation. This method was developed to circumvent the problems of genotype restriction and chromosomal damage frequently encountered in cotton regeneration in tissue culture through somatic embryogenesis. The normal and fertile plants of G. barbadense Pima S-6 and S-19 cultivar of G. hirsutum were regenerated using Agrobacterium mediated transformation method. Shoot regeneration from these tissues was direct and rapid.

Cousins et al. (1992) have succeeded in producing transgenic plants from Australian cultivar Siokra 1-3 through Agrobacterium mediated transformation system. Transgenic plants expressed novel genes i.e. npt-II (Neomycin Phospotransferase) or the GUS (β-glucoronidase) gene. The critical factors in transformation were the use of a super virulent disarmed Ti plasmid with binary transformation vector and a highly regenerable Australian genotype of cotton.

Medford (1992) reported that meristem is often confused with the complete shoot apex, which also contains the leaf primordia and the young leaves. Further more, the meristem as a tissue may represent a complicated pattern of cells. Each of these cells may differ physiologically due to its unique position in the meristem.

Sautter et al. (1995) reported that shoot apical meristems provide a tissue, which regenerates in situ a fertile plant for most of the given genotypes. Transformation of meristem cells may lead to transgenic sectors in chimeras. These sectors may contribute to the gametes and, thus, to transgenic offspring, which then should be homohistonts and not sectorial chimeras like their parents.

Agarwal et al. (1997) reported induction of multiple shoots in cotton with cotyledonary nodes devoid of cotyledons and apical meristems. Explants from 35-day-old seedlings yielded the maximum number of shoots (4.7 shoots/explant) using Murashige and Skoog (MS) basal medium supplemented with 6-benzylaminopurine and kinetin (2.5 mg/1 each). Explants from 35-day-old seedlings raised in glass bottles produced a higher number of multiple shoots (8.3 shoots/ explant) than those grown in glass tubes and cultured on the same shoot induction medium.

Elongation of multiple shoots was obtained on liquid or agar MS basal medium without phytohormones. In vitro shoots were rooted on half-strength agar-solidified MS basal medium or with 0.05 or 0.1 mg/1 naphthaleneacetic acid. Hardening and survival of tissue culture plantlets was 95% under greenhouse conditions.

Gould and Maria Magallenes-Cedeno (1998) presented a protocol for rapid genotype independent transformation and regeneration of cotton (Gossypium spp.) from shoots isolated from germinating seedling. They inoculated the isolated shoots with a super virulent strain of Agrobacterium tumefaciens, subjected them to a mid antibiotic selection, and directly regenerated as shoots in vitro. By this method, the shoots did not dedifferentiate and mutation rates were low. Rooted shoots could be obtained within 6-10 weeks of isolation and inoculation depending on the cotton cultivar.

Hemphill et al. (1998) reported a clonal propagation system to regenerate mature cotton (G. hirsutum L.) plants from in vitro grown tissues. Shoot apices, lateral nodes and cotyledonary nodes were co-cultivated with Agrobacterium tumefaciens and grew to a two leaf stage by this in vitro culture system. They further reported that this procedure resulted in 121 kanamycin selected shoots and 40 mature viable plants, which produced viable T1 seeds. Mature T1 plants expressed GUS activity in pollen grains that suggested that the transgene was inherited by progeny.

Jorge et al. (1998) reported that cytokinins are involved in shoot development of plants. Events of multiple bud formation and shoot development in apical embryonic axes of cotton treated for 2 or 20 days with the cytokinin benzyladenine (BA) were compared with the development of untreated control axes. Meristematic regions (supernumerary vegetative buds) were observed in axes treated for 20 days with BA. An average of 3.4 shoots per embryonary axis was obtained when explants were cultured on medium supplemented with 3 mg/l BA. Higher and lower concentrations of the growth regulator yielded fewer shoots per explant. Result shows that BA is directly responsible for re-programming the embryonic apical meristem axes of cotton toward the production of multiple buds and subsequent shoot development.

Zapata et al. (1999) reported that transgenic cotton (G. hirsutum) plants of Texas cultivar were obtained using Agrobacterium mediated transformation coupled with the use of shoots apex explants. Regeneration of primary plants was carried out in a medium containing 100 mg/1 of kanamycin and the progeny obtained by selfing T0 plants were subjected to kanamycin screening. Surviving plants showed more than one copy of T-DNA. The use of shoots apex circumvents the problem of genotype dependent regeneration of cotton.

Maqbool et al. (2002) reported that three oat (Avena sativa L.) cultivars have been successfully transformed using an efficient and reproducible in vitro culture system for differentiation of multiple shoots from shoot apical meristems. The transformation was performed using microprojectile bombardment with two plasmids (pBY520 and pAct1-D) containing linked (hva1-bar) and non-linked (gus) genes. The hva1 and bar genes cointegrated with a frequency of 100% as expected and 61.6% of the transgenic plants carried all three genes. Molecular and biochemical analyses in R0, R1 and R2 progenies confirmed stable integration and expression of all transgenes. Localization of the GUS protein in R0 and R1 plants revealed that high expression of gus occurred in vascular tissues and in the pollen grains of mature flowers.

Satyavathi et al. (2002) have given a protocol for consistent production of transgenic cotton plants in three Indian varieties established utilizing Agrobacterium mediated transformation. Shoot tip explants were transformed by co-cultivation with Agrobacterium tumefaciens strain LBA-4404. The

strain harbors a binary vector pBAL2 carrying the reporter gene β-glucuronidase intron (GUS-INT) and the marker gene-neomycin phosphotransferase (npt-II). Regeneration potential of explants or different hormones was studied in detail. Among the different combinations of BAP and NAA tested, 0.1 mg per ml of BAP and NAA in the medium influenced efficient regeneration of shoots by organogenesis. Shoot bud proliferation and elongation was achieved in 3-4 weeks time on medium supplemented with GA3. The putatively transformed shoots were harvested and placed for rooting on medium containing IBA and 75 mg/l kanamycin. Transgenic plants were recovered in 12-16 weeks from the time of gene transfer to establishment in pots. Molecular analysis of the field established plantlets was carried to confirm the transgenic nature. The presence of gus and npt-II genes in the transgenic plants was verified by histochemical GUS assay and polymerase chain reaction (PCR) analysis, respectively. Integration of T-DNA into the genome of putative transgenics was further confirmed by southern blot analysis. A total of 70-75 transgenic plants were raised in pots. Progeny analysis of these plants showed a classical mendelian pattern of inheritance.

Chinchane et al. (2004) carried out a transformation work on diploid cotton (G. arboreum) cultivar PA 255 (Parbhani Turab) using Agrobacterium tumefaciens strain LBA4404 containing npt-II gene and cry 1A(c) gene. The combination of MS medium containing BAP (2 mg/l) and kinetin (1 mg/l) concentration was found to be the best for induction of multiple shoots and later shoots were tested for gene expression by ELISA and southern blot hybridization. Some of the shoots tested positive.

Saeed et al. (2004) reported that cotyledonary nodes obtained from aseptically raised seedling were cultured on modified Murashige and Skoog medium (MS) supplemented with different doses of Kinetin. Cotyledonary nodes produced the maximum number of shoots (3.43 shoots/ explant) when cultured on MS medium supplemented with 0.25 mg/l Kinetin. The highest percentage (93.3 %) of root development and root length (5.85 cm) was obtained when shoots were cultured on MS medium supplemented with 0.5 mg/l napthalene acetic acid (NAA) and 0.1 mg/l Kinetin.

Zhao et al. (2006) reported the most economically significant Chinese cotton cultivar (Gossypium hirsutum L. cv. Zhongmian 35) was transformed via Agrobacterium tumefaciens-mediated DNA transfer. The aroA-M1 gene that confers resistance to the glyphosate was fused with a chloroplast-transit peptide of Arabidopsis thaliana 5-enolpyruvyl-3-phosphoshikimate synthase (ASP) and expressed in cotton plants under the control of a CaMV35S promoter.

Transgenic plants were directly selected on medium containing glyphosate. Thirty-four independent transgenic lines were obtained after selection, giving a maximal 1.9% transformation frequency. The integration and expression of the aroA-M1 gene in T0 plants and T1 progeny were confirmed using DNA hybridization, Western blot and PCR techniques. An increased resistance of T0 and T1 transgenic plants towards glyphosate was also observed.

Katageri et al. (2007) reported Agrobacterium-mediated genetic transformation of an elite Indian genotype (Bikaneri Nerma) of cotton (Gossypium hirsutum L.) was achieved using shoot apical meristems isolated from seedlings as explants and a synthetic gene encoding Cry1Ac δ-endotoxin of Bacillus thuringiensis. Regeneration of shoots was carried out in selection medium containing kanamycin (100 mg/l) after co-cultivation of the explants with Agrobacterium tumefaciens (strain EHA 105). Rooting was accomplished on a medium containing naphthaleneacetic acid and kanamycin. Progeny obtained by selfing T0 plants was grown in the greenhouse and screened for the presence of neomycin phosphotransferase (nptII), and cry1Ac genes by polymerase chain reaction (PCR) and Southern hybridization. Expression of Cry1Ac in the leaves of the transgenic plants was detected by Xpress strips and quantified by Quan-T ELISA kits (DesiGen). Insect bioassays were performed with the larvae of cotton bollworm (Helicoverpa armigera). Field tests of the most promising lines (T2 and T3 generations) were performed under contained conditions. Results of the field tests showed considerable potential of the transgenic cotton for resistance against cotton bollworm.

Nandeshwar et al. (2009) developed an Agrobacterium-mediated gene transfer protocol for the diploid cotton Gossypium arboreum using meristematic cells of shoot tips, followed by direct shoot organogenesis or multiple shoot induction of putative transformants. Seven-day- old shoot tips of in vitro-germinated seedlings of G. arboreum cv. RG8 were excised by removing cotyledonary leaves and providing “V”-shaped oblique cuts on either side of explants. Excised explants were inoculated with an overnight-grown culture of Agrobacterium tumefaciens carrying a plant cloning vector harboring the cry1Ac gene. The explants were co-cultivated in Murashige and Skoog (MS) medium supplemented with 30 mg/l acetosyringone, 100 mg/l myoinositol, 10 mg/l thiamine, and 30 g/l glucose for three days in the dark. Following co-cultivation, explants were incubated on the same medium supplemented with 20 mg/l kanamycin, for first three passages of 10–12 days each and subsequently on 50 mg/l kanamycin to facilitate stable expression of transgene. Explants were then transferred to a fresh MS medium supplemented with either kinetin (0.1 mg/l), myoinositol (100 mg/l), thiamine (10 mg/l) and glucose (30 g/l) or benzyl adenine, BA (2 mg/l), kinetin (1 mg/l), myoinositol (100 mg/l), thiamine (10 mg/l), and glucose (30 g/l) to induce either single or multiple putative transformant shoots, respectively. Following 6 weeks, shoots were transferred to a rooting medium consisting of liquid MS supplemented with 0.05–0.1 mg/l NAA and glucose (15 g/l). Rooted plantlets were first acclimatized in liquid MS with 0.05 mg/l NAA and 15 g/l glucose, transferred to plastic pots containing soilrite Mix-TC (a mixture of Irish peat moss and horticultural grade expanded perlite, 75:25), and grown under controlled temperature and humidity conditions in a growth chamber. Acclimatized plants were then transferred to clay pots and grown in the greenhouse. These plants were confirmed as transgenic for cry1Ac gene using polymerase chain reaction, enzyme linked imunosorbent assay, and Southern blot analyses.

Sumithra et al. (2010a) reported factors influencing efficiency of regeneration and transformation of cotton plants from the shoot apex of aseptically germinated seedlings were optimized for the Agrobacterium mediated transformation in Gossypium herbaceaum and Gossypium hirsutum by using the Agrobacterium strain EHA-105 harbouring binary vector pBINAR, carrying cry2Aa gene. This investigation was carried out to develop genotype independent Agrobacterium mediated transformation method explants precultured at 1 mg/l of BAP was found effective for shoot induction in both Jayadhar (G. herbaceaum) and Surabhi (G. hirsutum) cotton genotypes. Attempts to standardize co-cultivation duration revealed that co-cultivation duration of 10 min was optimum for maximum regeneration. Co-cultivation duration of 48 hours was found to be optimal and co-cultivation beyond this resulted in softening, browning and death of explants in both the genotypes.

Sumithra et al. (2010b) reported the efficiency of transformation can be enhanced by the supplementing the wounding methods. Several experiments were conducted to find out the effect of wounding methods (scalpel wounding, vaccum infiltration, blot drying, chilling injury, sand injury) on regeneration and transformation of Jayadhar (Gossypium herbaceaum) and Surabhi (G. hirsutum) genotypes using Agrobacterium strain EHA-105 harbouring binary vector pBINAR, carrying cry2Aa gene. Scalpel wounding followed by colonization with agroculture resulted in 60 and 61.25 per cent regeneration as compared to non wounded plants of 78.75 and 80 per cent in both Jayadhar and Surabhi genotypes respectively.

Per cent regeneration for vacuum infiltration of 10 and 20 min were on par in both the genotypes. Regeneration response reduced with blot drying and sand injury. Explants chilled for >48 hours showed lower regeneration response. Out of 7530 explants cocultivated only three were PCR positive one in Jayadhar genotype with scalpel wounding and colonization for 10 min and two in Jayadhar genotype with 30 min of chilling treatment.

Sangannavar et al. (2011a) reported the effect of pre-culturing, effect of colonization with Agrobacterium, co-cultivation of Agrobacterium with shoot apical meristem (SAM) and vacuum infiltration on regeneration. Regeneration of plants was severely affected when SAM subjected to 72 hours of co-cultivation treatments. The putative transgenic plants were obtained when SAM was subjected to vacuum infiltration. The effect of trimming of shoot apical meristem (SAM), chilling injury, sand injury and blot drying before colonization of SAM with Agrobacterium and co-cultivation of Agrobacterium with SAM was studied. Regeneration of plants was drastically affected when SAM were subjected to chilling injury for two days.

Sangannavar et al. (2011b) reported that the effect of wounding, vertical cut and horizontal cut shoot apical meristem on regeneration. Highest recovery of plantlets was recorded on wounding of shoot apical meristem as compare to vertical cut and horizontal cut.

2.3 GENETIC TRANSFORMATION FOR ABIOTIC MOISTURE STRESS

Transgenic plants over-expressing various transcription factors have been demonstrated to have a higher stress tolerance. For example, in Arabidopsis, significant improvement of freezing stress tolerance was demonstrated by the over-expression of the transcription factor CBF1 (Jaglo-Ottosen et al., 1998); enhancement of drought and freezing tolerance by CBF4 (Haake et al., 2002) and increased tolerance to freezing, water and salinity stress by over-expression of DREB1A gene (Kasuga et al., 1999), whereas transgenic rice over-expressing CBF3 demonstrated elevated tolerance to drought and salinity but very low freezing tolerance (Oh et al., 2005). It appears, therefore, that these transcription factors are able to enhance tolerance to a variety of stresses however such enhancement may be species-specific (Oh et al., 2005).

Hsieh et al. (2002) reported an expression vector containing an Arabidopsis C-repeat/dehydration responsive element binding factor 1 (CBF1) cDNA driven by a cauliflower mosaic virus 35S promoter was transferred into tomato plants. Transgenic expression of CBF1 was proved by northern and western blot analyses. The degree of chilling tolerance of transgenic T1 and T2 plants was found to be significantly greater than that of wild-type tomato plants as measured by survival rate, chlorophyll fluorescence value, and radical elongation. The transgenic tomato plants exhibited patterns of growth retardation; however, they resumed normal growth after GA3 (gibberellic acid) treatment. More importantly, GA3-treated transgenic plants still exhibited a greater degree of chilling tolerance compared with wild-type plants. Subtractive hybridization was performed to isolate the responsive genes of heterologous Arabidopsis CBF1 in transgenic tomato plants. CATALASE1 (CAT1) was obtained and showed activation in transgenic tomato plants. The CAT1 gene and catalase activity were also highly induced in the transgenic tomato plants. The level of H2O2 in the transgenic plants was lower than that in the wild-type plants under either normal or cold conditions. The transgenic plants also exhibited considerable tolerance against oxidative damage induced by methyl viologen. Results from the current study suggest that heterologous CBF1 expression in transgenic tomato plants may induce several oxidative-stress responsive genes to protect from chilling stress.

Wang et al. (2006) reported expression vector pBAC128F, which carries DREB transcriptional factor gene driven by drought inducing promoter rd29B and bar gene driven by CaMV 35S promoter and maize Adh1 gene first intron, was transferred into the explants of immature inflorescence and immature embryos of hexaploid winter wheat cv. 8901, 5-98, 99-92 and 104 by particle bombardment. More than 70 resistant transgenic plants were obtained. Genomic PCR and RNA dot blotting analyses showed that DREB gene had been integrated into wheat genome of the transgenic plants (T0 and T1) and was well expressed in offspring seed of different transgenic lines. The content of proline in leaves and seeds of T2 transgenic lines was analyzed. Among 16 tested transgenic lines, 10 transgenic lines exhibited more than two fold of proline level in leaves as compared with CK plants. Under drought condition, after stopping water for 15 days the leaves of transgenic lines were still green, while CK were faded. After rewatering for 10 days, the leaves of transgenic lines maintained their green, while all CK plants were dead. Their research suggested that introducing a novel DREB transcriptional factor into wheat is an effective way to improve its drought-tolerance ability.

Kav et al. (2008) reported transgenic plants are more tolerant to environmental stresses than untransformed plants. The pea ABR17 (Abscisic acid responsive 17) is used to enhance germination of plants such as Arabidopsis sp. and Brassica sp. while under multiple abiotic stresses, and to enhance the tolerance of these plants to these stresses. Three independently derived Arabidopsis transgenic lines, containing ABR17 germinated better in the presence of salt, cold temperature or both. The transgenic plants also exhibited enhanced tolerance to freezing temperature or extreme heat. Furthermore, the transgenic plants demonstrated early flowering even under normal, non-stressed conditions.

Shi-Qing Gao et al. (2009) isolated dehydration responsive element binding protein gene, GhDREB, which encodes a 153 amino acid protein containing a conserved AP2/EREBP domain from the cDNA library of cotton cv. Simian 3 by a yeast one-hybrid system. RNA blot analysis showed that the GhDREB gene was induced in cotton seedlings by drought, high salt and cold stresses. Two expression vectors containing the GhDREB gene with either of the Ubiqutin or rd29A promoters were constructed and transferred into wheat (Triticum aestivum L.) by bombardment.

Zhao et al. (2010) reported DREB proteins are involved mainly in plant responses to abiotic stresses such as cold, drought or high salinity as well as ABA signalling. However, the function of most rice DREB genes and the underlying molecular mechanisms controlling these responses remains elusive. Methods Antisense and overexpression constructs of ARAG1 were introduced into rice by an Agrobacterium mediated method. RT-PCR and western blot were used to detect ARAG1 accumulation in transgenics. PEG and ABA were used to test their response to abiotic stresses.

Liu et al. (2010) suggested new full-length cDNA encoding an AP2/EREBP domain-containing transcription factor named AoDREB was isolated from Asparagus officinalis L. using the RACE-PCR method. It is a homolog to the dehydrationresponsive element binding protein (DREB) and classified to the A6 subgroup of the DREB subfamily. Using the yeast one-hybrid system, we conducted a DRE binding assay and demonstrated that AtDREB can bind the DRE element specifically. A transcriptional activity assay showed that AtDREB is a transcription factor capable of activating expression of the reporter gene in yeast. RT-PCR analysis revealed that expression of the AtDREB gene is induced under 20% PEG and high salinity stress, whereas no obvious response to low temperature was observed. Overexpression of AtDREB in transgenic Arabidopsis caused no growth retardation and induced stronger expression of the target genes, including RD29A and COR15A, than in wild type, resulting in increased tolerance of transgenic Arabidopsis to drought and high salinity.

Polizel et al. (2011) evaluated the molecular, anatomical and physiological properties of a soybean line transformed to improve drought tolerance with an rd29A:AtDREB1a construct. This construct expressed dehydrationresponsive element binding protein DREB1A from the stress-inducible rd29A promoter. The greenhouse growth test included four randomized blocks of soybean plants, with each treatment performed in triplicate. Seeds from the non-transformed soybean cultivar BR16 and from the genetically modified soybean P58 line (T2 generation) were grown at 15% gravimetric humidity for 31 days. To induce water deficit, the humidity was reduced to 5% gravimetric humidity (moderate stress) for 29 days and then to 2.5% gravimetric humidity (severe stress). AtDREB1a gene expression was higher in the genetically modified P58 plants during water deficit, demonstrating transgene stability in T2 generations and induction of the rd29A promoter. Drought-response genes, including GmPI-PLC, GmSTP, GmGRP, and GmLEA14, were highly expressed in plants submitted to severe stress. Genetically modified plants had higher stomatal conductance and consequently higher photosynthetic and transpiration rates. In addition, they had more chlorophyll. Overexpression of AtDREB1a may contribute to a decrease in leaf thickness; however, a thicker abaxial epidermis was observed. Overexpression of AtDREB1a in soybean appears to enhance drought tolerance.

Tang et al. (2011) reported Jatropha curcas L. is valuable to know the molecular mechanism of J. curcas response to adverse abiotic environmental factors, especially freezing stress, in order to change the plant’s characteristics. Until now there are just a few reports about J. curcas molecular biology. They cloned and characterized a DNA binding protein from plant, designated as JcDREB. Sequence analysis and yeast one-hybrid assays show that JcDREB can effectively function as a transcription factor of DREB protein family belonging to A-6 subgroup member. Expression patterns of JcDREB showed that it was induced by cold, salt and drought stresses, not by ABA. Over-expression of JcDREB in transgenic Arabidopsis exhibited enhanced salt and freezing stresses. Understanding the molecular mechanisms of J. curcas responses to environmental stresses, for example, high salinity, drought and low temperature, is crucial for improving their stress tolerance and productivity. This work provides more information about A-6 subgroup members of DREB subfamily.

MATERIAL AND METHODS The present study entitled “Genetic transformation for drought resistance in cotton” was

carried out at Agricultural Research Station, Dharwad farm, University of Agricultural Sciences, Dharwad during 2009-2012. The methodologies and materials used in the present study are discussed in this chapter.

3.1 MATERIALS

3.1.1 Genotypes

Coker-312 and Sahana (Gossypium hirsutum L.) cotton genotypes were used in genetic transformation studies. Coker-312 is the commercial variety in US, posses, totipotency, susceptible to sucking pests and moisture stress, big bolls, high yielding with fibre quality suitable for 40s-50s count (fiber length of 28-29 mm; fiber strength of 22-23 g/t; fiber fineness of 4-4.5 micro gram/inch; 35% GOT).

Sahana (Gossypium hirsutum) is the commercial variety, known for its tolerance to bollworm, higher adaptability and potentially high seed cotton yielding 18-20 q/ha. It possesses fiber traits suitable for 40s count (fiber length of 26-27 mm; fiber strength of 19-20 g/t; fiber fineness of 4-4.5 micro gram/inch; 39% GOT).

3.1.2 Source of genes/ constructs

The disarmed Agrobacterium strain LBA-4404 harbouring binary vector pCambia 2300, carrying AtDREB1a gene linked to the rd29 promoter, nopaline synthase (nos) terminator I and npt-II gene under the control of 35S promoter and 35S polyA terminator was used in transformation studies. npt-II is the selectable marker. AtDREB1a is transcription factors enhance resistance to drought. Details of the map of the gene cassette are mentioned in the figure 1a.

The disarmed Agrobacterium strain LBA-4404 harbouring binary vector pBINAR, carrying BcZAF12 gene linked to the LEA1 promoter, nopaline synthase (nos) terminator I and npt-II gene under the control of 35S promoter and 35S polyA terminator was used in transformation studies. npt-II is the selectable marker. BcZAF12 is a transcription factor also enhances resistance to drought. Details of the map of the gene cassette are mentioned in the figure 1b. These two genes for the present study were obtained from National Research Centre for Plant Biotechnology, New Delhi under Indo-US collaborative research project.

3.1.3 Media, Growth regulators, Chemicals and Reagents

Tissue culture media was primarily based on the formulation developed by Murashige and Skoog (1962). Details of PGRs, Medium, reagents and chemicals used in the study are mentioned below.

S. No

Items Commercial name Make

1 MS medium Murashige and Skoog (1962) HiMedia, Mumbai

2 2, 4- Dichlorophenoxy Acetic Acid HiMedia, Mumbai

Kinetin HiMedia, Mumbai

PGRs

Thidiazuron (TDZ) HiMedia, Mumbai

3 Sucrose HiMedia, Mumbai

Glucose HiMedia, Mumbai

Carbon source

Maltose HiMedia, Mumbai

4 Selection agent Kanamycin Sulphate HiMedia, Mumbai

5 Antibiotic Cefotaxime HiMedia, Mumbai

6 Myo-inositol Sigma, Germany

Inorganic compounds KNO3 HiMedia, Mumbai

7 Gelrite Sigma, Germany

Solidifying agent

Agar agar HiMedia, Mumbai

8 RNA isolation Total Plant RNA isolation Kit Sigma, Germany

9 cDNA synthesis kit cDNA synthesis Kit Finnzymes, USA

10 DNA detection kit DIG labeling detection Kit Roche, Germany

Figure 1a. Map of AtDREB1a gene Construction

Figure 1b. Map of BcZAF12 gene Construction

3.2 METHODOLOGY

3.2.1 Preparation of Explants

3.2.1.1 Delinting of seeds

Seeds were delinted by treating with commercial grade H2SO4 with a concentration of 100 ml/kg of seeds. After adding H2SO4, the seeds were continuously stirred with the help of spatula for 10-15 minutes until the surface of seeds become shiny due to complete removal of fuzz on the seed.

The delinted seeds were washed 6 times under running tap water to remove the acid completely from the surface of the seeds. Floating seeds were discarded as they are poor in germination.

3.2.1.2 Surface sterilization of seeds

Delinted seeds were dipped in 0.2% mercuric chloride for 20 minutes with constant stirring followed by the repeated washes with sterile water under laminar airflow. Seeds were soaked in sterile water over night to germinate at 26

0C.

3.2.1.3 Preparation of explants for somatic embryogenesis, regeneration and transformation

Delinted and surface sterilized seeds soaked in sterile water over night were later incubated on ½ strength MS basal medium for germination.

Hypocotyl (5-6 mm) and cotyledon (1 mm2) explants from 6-7 days old aseptically grown

seedlings were prepared for callus induction and regeneration.

3.2.1.4 Preparation of explants for in planta genetic transformation.

Delinted and surface sterilized seeds were soaked in sterile water over night, later incubated on ½ strength MS basal medium for germination of seedlings. About 6-7 days old seedlings were used as explants in genetic transformation.

3.2.2 Preparation of media

The MS medium (Hi-media, Mumbai) was used in all experiments of the present study. As solidifying agent, 3 g/l gelrite (Sigma Aldrich, USA) was used. As carbon source sucrose, maltose and glucose at different concentrations were added before autoclaving. The pH was adjusted to 5.6 to 5.8 prior to autoclaving of media.

Phytohormones and antibiotic stocks were filter sterilized using disposable filter assembly and added to media according to our specific concentration before or after autoclaving, depending on, the nature of chemical used with respect to its stability.

Autoclaved media was poured into the sterile petri plates or bottles in laminar air flow after cooling to 50-60

0C. The plates were kept open until the media was solidified, later closed and sealed

thoroughly with parafilm.

The media plates were stored in culture rooms at 25±2 0C. To ensure the contamination free

media, plates were used 3-4 days after preparation.

3.2.3 Preparation of stock of hormones and antibiotics

3.2.3.1 Preparation of Growth regulators

1) Filter sterilized 2,4-Dichlorophenoxy Acetic Acid (Hi-media, Mumbai) stock of 10 mg/ml was prepared in double distilled water and stored at 4

0C.

2) Filter sterilized Kinetin (Hi-media, Mumbai) stock of 10 mg/ml was prepared in double distilled water and stored at 4

0C.

3) Filter sterilized Thidiazuron (Hi-media, Mumbai) stock of 10 mg/ml was prepared in double distilled water and stored at 4

0C.

3.2.3.2 Preparation of thermolabile hormones

1) Filter sterilized kanamycin (Hi-media, Mumbai) stock of 100 mg/ml was prepared in double distilled water under laminar air flow and stored at 4

0C.

2) Filter sterilized cefotaxime (Hi-media, Mumbai) stock of 200 mg/ml was prepared in double distilled sterile water under laminar air flow and stored at 4

0C.

3.2.4 Regeneration via callus cultures in Coker-312

3.2.4.1 Callus induction, proliferation and maintenance

Explants were inoculated on MS medium supplemented with various combination of 2, 4-D (0.1 to 1.5 mg/l), kinetin (0.1 to 1.5 mg/l) and TDZ (0.1 to 1.5 mg/l) to induce callus. The days to callus initiation, per cent callus induction, fresh callus weight and nature of callus were recorded. Different carbon sources (glucose, maltose and sucrose) with various concentrations (1, 2, 3 and 4 %) were studied for callus induction. Callus induction medium was used for callus proliferation. However, in callus maintenance media, concentrations 2, 4-D and kinetin were reduced from 0.1 to 0.01 mg/l and 0.5 to 0.1 mg/l respectively.

3.2.4.2 Embryogenesis

The friable and non-friable (compact) calli (each callus clamp of 500 mg mass) were subcultured to various combination of kinetin (0.1 to 1.0 mg/l), TDZ (0.1 to 1.0 mg/l) and 2, 4-D (0.01 mg/l) hormones with 3% (w/v) maltose used to induce embryogenesis, with control, total of 13 treatments. The frequency of somatic embryogenesis was recorded by the number of calli showed embryos.

3.2.4.3 Maturation of somatic embryos

Torpedo and cotyledonary stage embryos were then taken further for maturation and germination. They were transferred onto MS medium with 2, 4-D and kinetin growth regulators and additional myo-inositol (100 mg/l) and KNO3 (1.90 g/l) with 3% (w/v) sucrose. The frequency of somatic embryo maturation was counted as number of cotyledonary stage plantlet.

Abnormal somatic embryos were characterized by lack of well developed cotyledons whereas normal somatic embryos were those with a pair of cotyledons and normal morphology. Embryo germination refers to the development of the apical area of the somatic embryo resulting in production of true leaves, and production of plantlets, when germinated embryos produced roots as well (Firoozabady and DeBoer 1993).

3.2.4.4 Hardening and establishment of plant

To proliferate shoots and roots, plantlets were incubated for different duration in MS medium followed by transplanting them to pots containing soil and peat mixture in equal proportion.

Transplanted plants were further hardened with and without placing in plant growth chamber for a week before shifting them to green house condition. Observation on establishment of plants after different duration of incubation in MS medium before shifting to green house was recorded.

During this period of hardening, plants were covered with a polythene bag for maintaining high humidity and nourished with progressively reduced concentrations of MS medium; this was followed by irrigation with tap water in the second week.

Later these established plants were transferred to the green house and 3 months later, fertile flowers were observed followed by normal boll setting.

3.3 GENETIC TRANSFORMATION STUDIES IN COKER-312

3.3.1 Maintenance of Agrobacterium

The Agrobacterium strain LBA-4404 harbouring binary vector pCambia 2300 containing AtDREB1a and binary vector pBinAR containing BcZAF12 genes construct were maintained on solid Yeast Extract Mannitol Agar (YEM) medium (Appendix II) containing kanamycin at 50 mg/ml and refampicin at 50 mg/ml. It was subcultured once in every 30-40 days on fresh medium and incubated at 28

0C temperature for 48 hours followed by 4-8

0C for rest of the period.

3.3.2 Preparation of Agrobacterium culture for co-cultivation

A colony of bacteria grown for 48 hours was taken from petri dish and was inoculated in 150 ml of liquid YEM medium containing 50 mg/l of Kanamycin and 50 mg/l refampicin and incubated for 45-48 hours at 22

0C under orbital shaker with 150 rpm.

When bacterium growth reached to OD (600 nm) of 0.6, pellet of bacterium obtained after centrifuge at 8000 rpm for 5 minute. It was resuspended in 150 ml of MS medium and 150 µM of acetosyringone was added to the Agrobacterium culture before 30 minute of its use.

3.3.3 Colonization, co-cultivation and plant regeneration studies

Hypocotyls from 5-7 days old seedlings and 2 months old previously induced calli were used in genetic transformation studies.

3.3.3.1 Effect of colonization and co-cultivation period on establishment free of Agrobacterium contamination cultures

Effect of colonization and co-cultivation on cultures (hypocotyls and calli) free of Agrobacterium contamination was studied with three duration of colonization (10, 20 and 30 minutes) and co-cultivation (24, 48 and 72 hours).

Excess bacteria blot dried after colonization and later they were transferred to MS medium supplemented with 0.1 mg/l 2, 4-D and 0.5 mg/l Kinetin and co-cultivated under dark for 48 hours at 22 ± 2

0C.

Then the explants were washed with MS medium having cefotaxime, blot dried and inoculated on the same medium but additionally supplemented 1000 mg/l cefotaxime and 100 mg/l kanamycin. Observations were recorded 6-8 days after co-cultivation.

3.3.3.2 Effect of cefotaxime on controlling Agrobacterium growth in cultures after colonization, co-cultivation and subsequent sub-culturing

To find out the suitable concentration of cefotaxime to prevent bacterial (Agrobacterium tumefaciens) contamination during further subcultures after co-cultivation, this experiment was conducted with 0, 100, 200, 300, 400 and 1000 mg/l cefotaxmine.

3.3.3.3 Effect of kanamycin on non transformed hypocotyls and calli

Kanamycin sensitivity test was carried out to find out the minimum concentration of kanamycin required to kill normal, untransformed explants to design the medium for selection of transformed calli, embryos and plantlets.

This was done by culturing the explants on optimized callus induction and proliferation medium with the following levels of kanamycin added to it (0, 25, 50, 75 and 100 mg/l).

Observation on callus induction and proliferation on kanamycin supplemented media was recorded 4-5 weeks after explant cultured on this medium.

3.3.3.4 Effect of pre-culture period on callus induction after colonization/co-cultivation

Effect of pre-culture period on callus induction after colonization and co-cultivation was studied with four pre-culture periods (0, 24, 48, 72 hours).

In this study 30 minutes of colonization and 48 hours of co-cultivation was followed.

Observation on callus induction was recorded 4-5 weeks after colonization and co-cultivation.

3.3.3.5 Effect of vacuum infiltration on establishment of calli induction with free from Agrobacterium contamination

To know the effect of vacuum infiltration on establishment of calli induction which is free from Agrobacterium was studied. With and without vacuum infiltration as colonization for 30 minutes followed by 48 hours of co-cultivation was done.

Observations of callus induction and proliferation were recorded 4-5 weeks after colonization and co-cultivation.

3.4 IN PLANTA GENETIC TRANSFORMATION STUDIES IN SAHANA

Germinating seedlings of Sahana were used for co-cultivation. Seedlings were potted after co-cultivation directly on to pots (soil and peat mixture in equal proportion) and incubated in low light intensity with high humidity for proper establishment of seedling and they were further shifted to green house.

3.5 CONFIRMATION OF GENE INTEGRATION

3.5.1 PCR screening

The putative transgenic plants were subjected to PCR analysis using gene specific primer.

3.5.1.1 DNA extraction

DNA was extracted with CTAB method with few modifications, as mentioned below.

1. One gram of fresh 2nd

or 3rd

top most leaf was taken for DNA extraction, leaf was harvested and kept in the 1.50 ml eppendorf tube.

2. By using extraction buffer leaf samples were crushed and kept in water bath for 45 minute at 65

0C (extraction buffer – Appendix III).

3. After 45 min, samples were taken out from water bath. The solution was centrifuged at 13,000 rpm for 10 minutes and supernatant was transferred to fresh eppendorf tube.

4. Supernatant was mixed with 500 µl of phenol:chloroform solution and centrifuged at 13,000 rpm for 10 min.

5. By using micropipette, supernatant was collected and transferred to new eppendorf tube. To that eppendorf tube, 500 µl chloroform solution was added and centrifuged at 13,000 rpm for 10 min.

6. Once again supernatant was collected to new eppendorf tube and 800 µl isopropanol was added and kept at -20

0C for precipitation for 1-2 hours.

7. After 2 hours, tubes were removed from the deep freezer and kept out side to attain room temperature. After that, centrifuged at 13,000 rpm for 5 min.

8. Supernatant was decanted without disturbing the pellet. To that, 70% alcohol was added and centrifuged for 5,000 rpm for 5 min. After centrifuge alcohol was decanted without disturbing the pellet.

9. Pellet was dried and suspended in 100 µl of 1 X T10E1 buffer.

10. 100 µl RNase was added (1 mg/ml) to the DNA and incubated at 37 0C in water bath for

half an hour.

11. DNA was precipitated using 1/10th volume of 3 M sodium acetate and ethanol and

incubated over night at 4 0C.

12. The solution was centrifuged at 13,000 rpm for 2 min and pellet was dried again.

13. Pellet was suspended in 50 µl 1X T10E1 buffer.

3.5.1.2 Estimation of quality and quantity of DNA

The concentration and quality of DNA was assessed in Nanodrop. It was also assessed with 0.8 per cent agarose gel.

In Nanodrop analysis, 1 µl of DNA sample was subjected to Nanodrop reading at absorbance of 230nm, 260nm and 280nm. A good DNA preparation generally exhibits the following spectral property: A260/A280 > 1.80

To test the quality and quantity of DNA, samples were run on 0.80 per cent agarose in 1x TAE (Tris Acetic acid EDTA) buffer and stained with ethidium bromide and checked for contamination by RNA and the DNA was evaluated by comparing it with a standard undigested DNA sample.

3.5.1.3 PCR amplification

DNA extracted from leaves of transformants was used as template DNA. Taq DNA polymerase (New England BioLabs), Taq Buffer (New England BioLabs), dNTPs (Bangalore Genei), Mgcl2 (Bangalore Genei) and Eppendorf Gradient PCR (Germany) were used for cyclic amplification of DNA. Following AtDREB1a and BcZAF12 gene specific primers were used for confirming transgenic.

To look for the presence of the transgenes, amplification of AtDREB1a and BcZAF12 specific genes were done through PCR.

The genomic DNA from the putatively transformed plant as well as the control untransformed plants and plasmid DNA from the Agrobacterium was isolated.

Plasmid DNA served as a positive control. The DNA from control untransformed plant was used as a negative control.

The primer specific for the AtDREB1a and BcZAF12 were used in the PCR analysis. The PCR products were electrophoreses on a 1.2% agarose gel using 100 bp, double digest marker.

Primers used for the amplification of genes in cotton

Sl. no.

Genes Primer Sequences (5’- 3’)

Forward primer TAGGCTCCGATTACGAGTCTTCGG 1 AtDREB1a

Reverse primer GCATACGTCGTCATCATCGCCGTCG

Forward primer GGGCCCATGGTTGCTATTTCAGAGAT 2 BcZAF12

Reverse primer GGTACCTCAACAAACAGGTCTTCCAA

Forward primer GAGGCCATTCGGCTATGACTG 3 npt-II

Reverse primer ATCGGGAGGGGCGATACCGAT

The PCR mix was made fresh in bulk depending on the number of samples each time. Each 20 µl mix contained;

Taq polymerase : 0.2µl

Taq Buffer : 2.0µl

dNTPs : 2.0µl

MgCl2 : 1.0µl

Forward primer : 0.5µl

Reverse primer : 0.5µl

Template : 1µl

SDDW : 12.8µl

Total : 20µl

The PCR amplification steps were as follows

Stage Step Temperature (0C)

Duration (sec)

No. of cycle

I

II

III

1.Initial Denaturation

1.Denaturation

2.Annealing

3.Extension

1.Final Extension

2.Hold

94

94

64

72

72

4

300

30

30

30

10

-

1

34

1

-

After the completion of required cycles of amplification, the samples were stored at 4 0C in a

refrigerator until further use.

3.5.1.4 Agarose Gel Electrophoresis of DNA

1. Sufficient 1x electrophoresis buffer was prepared from 50 x stock.

2. Agarose powder was added (1%) to TAE buffer (1x) and was dissolved by melting at 100 0C. The solution was cooled to 50

0C and ethidium bromide was added (0.5 µg/ml) and

the comb was positioned at 0.5-1.0 mm above the plate. Then agarose solution was poured into the gel frame and was allowed to polymerize. The gel tank was filled with TAE buffer (1x) just enough to cover the surface of the gel to a depth of 1 mm.

3. The DNA sample was mixed with gel loading buffer and it was slowly loaded into the wells of the submerged gel using a disposable microtips. λ DNA /Eco RI + Hind II double digest/ 100bp/ 1kb were used as molecular weight marker.

4. The system was connected to the power supply and electrophoresis was carried out at 70 volts for 30-45 min.

5. It was examined by gel documentation system.

3.5.2 RT-PCR

Two each putative transformants, generated through in vitro and in planta were subjected to RT-PCR analysis of both AtDREB1a and BcZAF12 transcriptional factors.

The total RNA were extracted from leaf using plant total RNA isolation kit (Cat.No.STRN50-1KT) provided by Sigma Aldrich, USA and the protocol was carried out according to manufacturer’s instructions. Isolated RNA used to synthesize cDNAs (Finnzyme, cDNA synthesis kit). The cDNAs were used as templates, and the primers and reaction conditions for RT-PCR were the same as for PCR above. RT-PCR was performed in a total volume of 20µl. Amplified products were resolved on 1.5% agarose gels with ethidium bromide staining.

3.5.3 Dot blot analysis

The RT-PCR positive plants were analyzed for dot blot using Roche DIG labeling detection kit. Gene specific probes were designed using labeled dNTPs mixture given with Roche DNA detection kit. The genomic DNA was isolated from the putative transgenic plants and was denatured for 94

0C for 5 minutes followed by rapid cooling by placing in ice. Denatured DNA then loaded on to

the nylon membrane which is negatively charge so that DNA will bind on to the membrane, followed by hybridization of gene for specific probe.

3.6 STATISTICAL ANALYSIS

The data obtained from the in vitro experiments conducted in the laboratory, under uniform culture conditions were analyzed for statistical significance as per CRD using MS excel computer software programme and presented with observation means and ANOVA parameters. Wherever, necessary data in percentages were transferred to angular values.

EXPERIMENTAL RESULTSSeveral gene transfer methods have been developed in the past thirty five years for a wide

range of plant species. Most of these methods are tissue culture based, requiring regeneration ofwhole plants from transformed cells. The utility of the techniques greatly depends on theestablishment of tissue culture procedures in the species (Birch, 1997).

Hence, in the current investigation, tissue culture based transformation via somaticembryogenesis techniques was studied. Tissue culture free in planta genetic transformation was alsotried. The results of these studies are presented in this chapter.


4.1.1 Days to callus initiation

Number of days required for initiation of callus in primary cultures of cotyledon and hypocotylswith different combinations of growth regulators is presented in Table 1. Callus initiation was early inhypocotyls (11.91 days) than cotyledon (12.58 days), irrespective of plant growth regulators.

Earliest callus initiation (10 days after culture) was observed in hypocotyls cultured in MSmedium supplemented with 0.1mg/l 2, 4-D + 0.5 mg/l Kinetin (Plate 1).

Longest duration taken (14 days) for callus initiation was observed in cotyledons in differentmedia. These observations were recorded between 7-15 days after explant cultures.

4.1.2 Per cent callus induction

Analysis of variance for per cent callus induction indicated that there was significantdifferences among explant, media and their interaction effects and the results are presented in Table2.

4.1.2.1 Effect of explant

Per cent callus induction was higher in hypocotyls (93.58%) than cotyledons (91.83%) (Plate2).

4.1.2.2 Effect of PGRs

Basal MS medium supplemented with 0.1 mg/l 2, 4-D + 1.0 mg/l kinetin and 0.1 mg/l 2, 4-D +0.5 mg/l kinetin induced callus in significantly higher number of explants (98.00% and 98.50%respectively) than media supplemented with 2, 4-D alone at 0.1 and 0.5 mg/l. Lowest response wasrecorded at 0.1 mg/l 2, 4-D (75%).

4.1.2.3 Effect of explant × PGRs

As an effect of interaction between explant and media, the highest per cent callus induction(99%) was recorded in hypocotyls in MS with 0.1 mg/l 2, 4-D + 0.5 mg/l Kinetin and MS with 0.1mg/l 2, 4-D + 1.0 mg/l and lowest response was recorded in MS with 0.1 mg/l 2, 4-D in cotyledons(70%).

4.1.3 Fresh callus weight

Fresh weight of callus collected from the explants in different media combination after 30 daysof culture were recorded. Analysis of variance for fresh callus weight showed significant differencesamong explants, media and their interaction effects (Table 3).

4.1.3.1 Effect of explant

Fresh callus weight of hypocotyls (0.70 g) was significantly higher than callus of cotyledon(0.63 g).

4.1.3.2 Effect of PGRs

Irrespective of explants, MS medium with 0.1 mg/l 2, 4-D and 0.5 mg/l kinetin producedsignificantly highest fresh callus (0.85 g). MS medium with 0.1 mg/l 2, 4-D and 0.5 mg/l TDZ produced0.76 g fresh callus while lowest quantity of fresh callus induction was observed in 0.1 mg/l 2, 4-D(0.33 g).

Table 1: Days to callus initiation in primary culture of cotyledon and hypocotyl explant at different combinations of growth regulators in MSmedium

Levels of growth regulators in mg/l

2, 4-D 2, 4-D+kin 2, 4-D+TDZExplant

0.1 0.5 1.0 1.5 0.1 +0.1

0.1 +0.5

0.1 +1.0

0.1 +1.5

0.1 +0.1

0.1 +0.5

0.1 +1.0

0.1 +1.5

Mean

Cotyledon 14 13 12 13 14 11 12 12 12 11 13 14 12.58

Hypocotyl 13 12 12 12 12 10 12 12 12 11 12 13 11.91

Mean 13.5 12.5 12 12.5 13 10.5 12 12 12 11 12.5 13.5 12.25

SEm± CD at 1%

Explant 0.054 4.89

Media 0.022 0.09

Explant X Media 0.077 0.33

Note: 10 explants were used per treatment and repeated four times

0

2

4

6

8

10

12

14

No.

of d

ays

Cotyledons 14 13 12 13 14 11 12 12 12 11 13 14

Hypocotyls 13 12 12 12 12 10 12 12 12 11 12 13

T1 – 2, 4-D(0.1)

T2 – 2, 4-D(0.5)

T3 – 2, 4-D(1.0)

T4 – 2, 4-D(1.5)

T5 – 2, 4-D(0.1)+Kin

(0.1)

T6– 2, 4-D(0.1)+ Kin

(0.5)

T7 – 2, 4-D(0.1)+Kin

(1.0)

T8– 2, 4-D(0.1)+ Kin

(1.5)

T9 – 2, 4-D(0.1)+TDZ

(0.1)

T10– 2, 4-D(0.1)+ TDZ

(0.5)

T11 – 2, 4-D (0.1)+TDZ

(1.0)

T12– 2, 4-D(0.1)+ TDZ

(1.5)

Fig. 2. Days to callus initiation in primary culture of cotyledon and hypocotyl explant of Coker-312 at differentcombinations of growth regulators in MS medium

Fig. 2. Days to callus initiation in primary culture of cotyledon and hypocotyl explant of Coker-312 at different combinations of growthregulators in MS medium

Table 2: Per cent callus induction from cotyledon and hypocotyl explants on MS media supplemented with various levels of growth regulators inCoker-312

Levels of growth regulators (mg/l)

2, 4-D 2, 4-D+kinetin 2, 4-D+TDZExplant

NOPGRs

0.1 0.5 1.0 1.5 0.1 +0.1

0.1 +0.5

0.1 +1.0

0.1 +1.5

0.1 +0.1

0.1 +0.5

0.1 +1.0

0.1 +1.5

Mean

Cotyledon 0.00

(0.01)

70.00

(56.79)

89.00

(70.63)

91.00

(72.54)

93.00

(74.66)

94.00

(75.82)

98.00

(81.87)

97.00

(80.03)

96.00

(78.46)

92.00

(73.57)

93.00

(74.66)

96.00

(78.46)

93.00

(74.66)

91.83

(73.36)

Hypocotyl 0.00

(0.01)

80.00

(63.43)

92.00

(73.57)

93.00

(74.66)

97.00

(80.03)

97.00

(80.03)

99.00

(84.26)

99.00

(84.26)

95.00

(77.08)

92.00

(73.57)

94.00

(75.82)

95.00

(77.08)

90.00

(71.57)

93.58

(75.11)

Mean 0.00

(0.01)

75.00

(60.00)

90.50

(71.95)

92.00

(73.57)

95.00

(77.08)

95.50

(77.08)

98.50

(82.73)

98.00

(81.87)

95.50

(77.62)

92.00

(73.57)

93.50

(75.11)

95.50

(77.62)

91.50

(72.95)

SEm± CD at 1%

Explant 0.06 5.88

Media 0.10 0.44


Figures in parenthesis are angular transformation values Note: 10 explants were used per treatment and repeated two times

Fig. 3. Per cent callus induction from cotyledon and hypocotyl explants on MS media supplemented withvarious levels of growth regulators in Coker-312

0

10

20

30

40

50

60

70

80

90

100Pe

r ce

nt c

allu

s in

duct

ion

Cotyledons 0 70 89 91 93 94 98 97 96 92 93 96 93

Hypocotyls 0 80 92 93 97 97 99 99 95 92 94 95 90

ControlT1 – 2, 4-

D (0.1)T2 – 2, 4-

D (0.5)T3 – 2, 4-

D (1.0)T4 – 2, 4-

D (1.5)

T5 – 2, 4-D

(0.1)+Kin

T6– 2, 4-D (0.1)+Kin (0.5)

T7 – 2, 4-D

(0.1)+Kin

T8– 2, 4-D (0.1)+Kin (1.5)

T9 – 2, 4-D

(0.1)+TDZ

T10– 2, 4-D (0.1)+

TDZ (0.5)

T11 – 2, 4-D

(0.1)+TDZ

T12– 2, 4-D (0.1)+

TDZ (1.5)

Fig. 3. Per cent callus induction from cotyledon and hypocotyl explants on MS media supplemented withvarious levels of growth regulators in Coker-312

Plate 1. Hypocotyl explants cultured on MS + 0.1 mg/l 2, 4-D + 0.5 mg/l Kinetin in Coker-312a) On the day of explants cultured b) 15 days after cultured

Plate 2. Callus induction in cotyledon and hypocotyl explants cultured on MS + 0.1 mg/l 2, 4-D+ 0.5 mg/l Kinetin in Coker-312 a) Hard colorless callus b) Light yellow to cream color

Plate 3. Callus induction in different carbon sources cultured on MS + 0.1 mg/l 2, 4-D + 0.5 mg/lKinetin in Coker-312 a) 3% glucose ( without browing) b) 3% sucrose (with browing)

4.1.3.3 Effect of explant x PGRs

Highest amount of callus (0.88g) was recorded in the MS media supplemented with 0.1 mg/l2, 4-D + 0.5 mg/l kinetin in hypocotyl, while the lowest fresh callus weight was recorded in MSsupplemented with 0.1 mg/l 2, 4-D in cotyledon (0.28g).

4.1.4 Carbon sources on callus induction

Analysis of variance for different carbon sources and concentrations showed significantdifferences (Table 4). Callus induction was significantly highest in 3 % glucose (94%) compare to allother concentrations of carbon sources (Plate 3). The lowest callus induction was obtained in 1 %maltose (34 %).

4.1.5 Nature of callus

The nature of callus differed with different concentrations of plant growth regulators added toMS medium. The detail of nature of callus was mentioned in table 5. Cream friable callus productionwas observed in MS supplemented with 0.1 mg/l 2, 4-D + 0.5 mg/l Kinetin and 0.1 mg/l 2, 4-D + 1.0mg/l kinetin on both hypocotyls and cotyledons respectively (Plate 4).

4.1.6 Embryogenesis

The per cent embryogenesis was significantly higher (71 %) in MS medium with 0.1 mg/lkinetin + 0.01mg/l 2, 4-D followed by 0.5 mg/l kinetin (63 %) and 1.0 mg/l kinetin (58 %) as shown intable 6. Compact calli did not show embryogenesis.

4.1.7 Embryos maturation

After 30 days of subculture of torpedo/cotyledonary stage embryos, the rate of embryomaturation was significantly higher in Basal MS medium (95 %) compare to MS supplemented withmyo-inositol (60), MS supplemented with KNO3 (40 %) and MS supplemented with 0.1 mg/l kinetin +0.01mg/l 2, 4-D (20 %) shown in table 7 and Plate 5.

4.1.8 Hardening and establishment ex vitro condition

Plantlets were cultured on MS medium with varying incubation duration from 1 week to 6weeks followed by 1 week with and without growth chamber incubation. MS with 4 week incubationfollowed by 1 week incubation in growth chamber showed significantly higher number of plantsestablished (95 %) compare to MS with 1, 2, 3, 5 and 6 weeks incubation. As the incubation durationbeyond 4 weeks reduction in plantlet development was observed (Table 8 and Plate 6).


4.2.1 Effect of colonization and co-cultivation period on establishment of cultures free ofAgrobacterium contamination

Cultures were allowed to colonize with Agrobacterium tumefaciens LBA-4404 containingAtDREB1a and BcZAF12 genes of transcriptional factors carrying in separate cultures. The durationof colonization for 10, 20 and 30 minutes followed by 24, 48, 72 hours co-cultivation period werestudied. It was observed that number of culture without Agrobacterium was highest when thecolonization period was 10 minutes with 24 hours co-cultivation (18.5), (Table 9) irrespective ofexplants. However, highest numbers of cultures 19 out of 25 were free of Agrobacterium on callicolonized for 10 minutes and co-cultivated for 48 hours (Plate 7).

4.2.2 Effect of cefotaxime on controlling Agrobacterium growth in cultures after colonization and co-cultivation

The five levels of cefotaxime differed significantly in inhibition of Agrobacterium growth.Reappearance of Agrobacterium tumefaciens on explants was highest in cultures devoid ofcefotaxime (100%). But this reappearance varied from 85 to 0 per cent when cultures were having200 to 1000 mg/l cefotaxime respectively as shown in table 10. So cefotaxime at 1000 mg/l wasadded to the culture medium routinely in the further experiments.

4.2.3 Effect of kanamycin on non transformed hypocotyls with calli

In order to avoid the possibility of selecting the untransformed calli on medium containingkanamycin, the intrinsic kanamycin resistance of cotton calli/hypocotyls was determined. Kanamycin

concentration at 100 mg/l resulted in loose and browning of hypocotyls as well as calli (Table 11)(Plate 8).

Table 3: Fresh callus weight (g) from cotyledon and hypocotyl explants on MS media supplemented with various levels of growth regulators inCoker-312

Levels of growth regulators in mg/l

2, 4-D 2, 4-D+kin 2, 4-D+TDZExplant

0.1 0.5 1.0 1.5 0.1 +0.1

0.1 +0.5

0.1 +1.0

0.1 +1.5

0.1 +0.1

0.1 +0.5

0.1 +1.0

0.1 +1.5

Mean

Cotyledon 0.28 0.58 0.59 0.68 0.69 0.82 0.70 0.62 0.68 0.74 0.66 0.61 0.63

Hypocotyl 0.38 0.66 0.68 0.75 0.76 0.88 0.74 0.70 0.74 0.78 0.69 0.64 0.70

Mean 0.33 0.62 0.63 0.71 0.72 0.85 0.72 0.66 0.71 0.76 0.67 0.62 0.66

SEm± CD at 1%

Explant 0.007 0.60

Media 0.001 0.051


Note: 10 explants were used per treatment and repeated two times

Fig. 4. Fresh callus weight (g) from cotyledon and hypocotyl explants on MS media supplemented withvarious levels of growth regulators in Coker-312

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

Fres

h ca

llus

wei

ght

(g)

Cotyledons 0.28 0.58 0.59 0.68 0.69 0.82 0.7 0.62 0.68 0.74 0.66 0.61

Hypocotyls 0.38 0.66 0.68 0.75 0.76 0.88 0.74 0.7 0.74 0.78 0.69 0.64

T1 – 2, 4-D(0.1)

T2 – 2, 4-D(0.5)

T3 – 2, 4-D(1.0)

T4 – 2, 4-D(1.5)

T5 – 2, 4-D(0.1)+Kin

(0.1)

T6– 2, 4-D(0.1)+ Kin

(0.5)

T7 – 2, 4-D(0.1)+Kin

(1.0)

T8– 2, 4-D(0.1)+ Kin

(1.5)

T9 – 2, 4-D(0.1)+TDZ

(0.1)

T10– 2, 4-D(0.1)+ TDZ

(0.5)

T11 – 2, 4-D(0.1)+TDZ

(1.0)

T12– 2, 4-D(0.1)+ TDZ

(1.5)

Fig. 4. Fresh callus weight (g) from cotyledon and hypocotyl explants on MS media supplementedwith various levels of growth regulators in Coker-312

Table 4: Effect of carbon sources on callus induction in Coker-312

Sl.No. Carbon source

Concentration(%)

No. of hypocotyls recordedfor callus induction

Per centresponse

1 1 19 38

2 2 26 52

3 3 47 94

4

Glucose

4 43 86

5 1 17 34

6 2 24 48

7 3 29 58

8

Maltose

4 21 42

9 1 18 36

10 2 24 48

11 3 27 54

12

Sucrose

4 20 40

Mean 26.90

SEm± 0.16

CD at 1% 0.65

Note: 50 hypocotyls were used per treatment and repeated for 3 times Medium used in this study MS +0.1 mg/l 2, 4-D + 0.5 mg/l Kinetin

Fig. 5. Effect of carbon sources on callus induction in Coker-312

0

10

20

30

40

50

60

70

80

90

100

Per

cent

cal

lus

indu

ctio

n

Hypocotyls 38 52 94 86 34 48 58 42 36 48 54 40

1 2 3 4 1 2 3 4 1 2 3 4

Glucose Maltose Sucrose

Fig. 5. Effect of carbon sources on callus induction in Coker-312

Table 5: Nature of callus in primary culture of cotyledon and hypocotyl explants at differentcombinations of growth regulators in MS medium

Sl.no.

Type ofexplant

Plant growth regulators (mg/l)* Nature of callus in primarycultures

1 T1 – 2, 4-D (0.1) Loose

2 T2 – 2, 4-D (0.5) Loose

3 T3 – 2, 4-D (1.0) Compact white


5 T5 – 2, 4-D (0.1)+Kin (0.1) Compact yellow to cream

6 T6– 2, 4-D (0.1)+ Kin (0.5) yellow to cream friable

7 T7 – 2, 4-D (0.1)+Kin (1.0) yellow to cream friable

8 T8– 2, 4-D (0.1)+ Kin (1.5) Compact green

9 T9 – 2, 4-D (0.1)+TDZ (0.1) Compact white

10 T10– 2, 4-D (0.1)+ TDZ (0.5) Compact green


12

Cot

yled

on

T12– 2, 4-D (0.1)+ TDZ (1.5) Hard green

13 T13 – 2, 4-D (0.1) Loose

14 T14 – 2, 4-D (0.5) Loose



17 T17 – 2, 4-D (0.1)+Kin (0.1) Compact yellow to cream

18 T18– 2, 4-D (0.1)+ Kin (0.5) yellow to cream friable

19 T19 – 2, 4-D (0.1)+Kin (1.0) yellow to cream friable

20 T20– 2, 4-D (0.1)+ Kin (1.5) Compact green


22 T22– 2, 4-D (0.1)+ TDZ (0.5) Compact green


24

Hyp

ocot

yl

T24– 2, 4-D (0.1)+ TDZ (1.5) Hard green * Figures in parenthesis indicate concentration of growth regulators in mg/l

Table 6: Effect of MS media supplemented with various combinations of growth regulators on somaticembryogenesis in Coker-312

Sl.No

Calli Plant growth regulators (mg/l)* Embryogenesis (%)**

1 T1 –Kin (1.0) 58 (49.60)

2 T2–Kin (0.5) 63 (52.54)

3 T3 –Kin (0.1)+ 2, 4-D (0.01) 71 (57.42)

4 T4 –TDZ (1.0) 49 (44.43)

5 T5–TDZ (0.5) 42 (40.40)

6

CreamFriable

T6 –TDZ (0.1)+ 2, 4-D (0.01) 47 (43.28)

7 T7 –Kin (1.0) 0 (1.81)

8 T8–Kin (0.5) 0 (1.81)

9 T9 –Kin (0.1)+ 2, 4-D (0.01) 0 (1.81)

10 T10 –TDZ (1.0) 0 (1.81)

11 T11–TDZ (0.5) 0 (1.81)

12

Compactnon friable

T12 –TDZ (0.1)+ 2, 4-D (0.01) 0 (1.81)

13 T13 – MS 0 (1.81)

Mean 25.38 (23.10)

SEm± 0.10

CD at 1% 0.40

* Figures in parenthesis are indicates concentration of PGR in mg/l** Figures in parenthetis are indicates angular transformation values

0

10

20

30

40

50

60

70

80

Per

cent

som

atic

em

bryo

gene

sis

Friable calli 58 63 71 49 42 47

Non friable calli 0 0 0 0 0 0

T1 –Kin (1.0) T2–Kin (0.5)T3 –Kin (0.1)+ 2, 4-

D (0.01)T4 –TDZ (1.0) T5–TDZ (0.5)

T6 –TDZ (0.1)+ 2, 4-D (0.01)

Fig. 6. Effect of MS media supplemented with various combinations of growth regulators on somaticembryogenesis in Coker-312

Fig. 6. Effect of MS media supplemented with various combinations of growth regulatorson somatic embryogenesis in Coker-312

Table 7: Effect of MS media supplemented with organic compounds/PGRs on embryomaturation in Coker-312

Sl.No.

Media No. of matureembryo

Per centresponse

1 MS basal 19 95

2 Myo-inositol (100 mg/l 12 60

3 KNO3 (1.90 g/l) 8 40

4 0.01mg/l 2, 4-D+0.1 mg/l kinetin 4 20

Mean 10.75

SEm± 0.20

CD at 1% 0.84

Note: 20 torpedo to cotyledonary stage embryos were cultured on each treatment and repeatedfor 5 times.

Fig. 7. Effect of MS media supplemented with organic compounds / PGRs on embryo maturation in Coker-312

0

10

20

30

40

50

60

70

80

90

100Pe

r ce

nt r

espo

nse

Embryos 95 60 40 20

MS basal Myo-inositol (100 mg/l KNO3 (1.90 g/l)0.01mg/l 2, 4-D+0.1 mg/l

kinetin

Fig. 7. Effect of MS media supplemented with organic compounds / PGRs on embryo maturation in Coker-312

Plate 4. Nature of callus in Coker-312a) Compact/Hard green b) Compact/Hard white c) Cream friable

Plate 5. Somatic embryogenesis in Coker-312a) Globular embryos b) Torpede-cotyledonary embryos

c) Germinating embryos d) Plantlets

Table 8: Effect of duration of in vitro incubation of plantlets in hardening and establishment of plants

Sl.No.

No. of weeks invitro incubation on

MS medium

With and withoutincubation in plant

growth chambertransferring to green

house

Averageno. ofplants

established

Per centestablishment

1 1 week incubation 4 20





6 6 week incubation

1 week incubation in growthchamber after transplanting

in soil: peat (1:1) mixturefollowed by incubating in ex

vitro condition (greenhouse).

9 45






12 6 week incubation

Placing directly in ex vitrocondition after transplanting

1 5

Mean 7.08

SEm± 0.16

CD at 1% 0.65

Note: 20 plantlets per treat were used per treatment and repeated for 3 times

Fig. 8. Effect of duration of in vitro incubation of plantlets in hardening and establishment of plants in Coker-312

0

10

20

30

40

50

60

70

80

90

100

Per

cent

est

ablis

hmen

t

Growth Chamber 20 40 60 95 75 45

with out Growth chamber 5 10 20 35 15 5

1 week incubation 2 weeks incubation 3 weeks incubation 4 weeks incubation 5 weeks incubation 6 weeks incubation

Fig. 8. Effect of duration of in vitro incubation of plantlets in hardening and establishment of plants in Coker-312

Plate 6. In vitro and ex vitro plant hardening and establishment in Coker-312

a) 1 week incubation b) 2 weeks of incubation c) 3 weeks of incubationd) 4 weeks of incubation e) 1 week of incubation in plant growth chamber f) Hardening in green house g) and h) Established plant

Table 9: Effect of colonization and co-cultivation period on establishment of cultures free of Agrobacterium contamination

No. of cultures without AgrobacteriumColonization

(minutes) 10 20 30ExplantCo-cultivation

(hours) 24 48 72 24 48 72 24 48 72

Mean

Calli 19* 0+ 0++ 16* 0+ 0++ 15* 0+ 0++ 5.55Hypocotyl 18* 0+ 0++ 17* 0+ 0++ 14* 0+ 0++ 5.44Mean 18.5 0 0 16.5 0 0 14.5 0 0 5.5

SEm± CD at 1%Explant 0.02 0.13Colonization 0.03 0.09Co-cultivation 0.03 0.08Explant X Colonization 0.04 0.12Explant X co-cultivation 0.04 0.11Colonization X Co-cultivation 0.05 0.14Explant X Colonization X Co-cultivation 0.07 0.19

Note: 25 hypocotyls and 25 calli clumps were used per treatment and repeated for 2 times*: Complete inhibition of Agrobacterium growth+: Slight growth of Agrobacterium++: Prominent growth of Agrobacterium

Fig. 9. Effect of colonization and co-cultivation period on establishment of cultures free of Agrobacteriumcontamination in Coker-312

0

2

4

6

8

10

12

14

16

18

20N

o . o

f cul

ture

wit

hout

Agr

obac

teri

um

19 0 0 16 0 0 15 0 0 18 0 0 17 0 0 14 0 0

24 48 72 24 48 72 24 48 72 24 48 72 24 48 72 24 48 72

10 20 30 10 20 30

Calli Hypocotyls

Fig. 9. Effect of colonization and co-cultivation period on establishment ofcultures free of Agrobacterium contamination in Coker-312

Table 10: Effect of cefotaxime on controlling Agrobacterium growth in cultures after colonization and co-cultivation

Reappearance of Agrobacterium in culturesExplant Cefotaxime

(mg/l)0 200 400 600 800 1000

Mean

Calli 100++ (88.19) 85++ (67.21) 70++ (56.79) 50+ (45.00) 30+ (33.21) 0* (1.81) 55.83 (48.33)

Hypocotyl 100++ (88.19) 80++ (63.43) 65++ (53.73) 55+ (47.87) 40+ (39.23) 0* (1.81) 56.66 (48.79)

Mean 100 (88.19) 82.5 (65.27) 67.5 (55.24) 52.5 (46.43) 35 (36.27) 0 (1.81) 56.25 (48.87)

SEm± CD at 1%

Explant 0.10 9.11

Treatment 0.05 0.25

Explant X treatment 0.14 0.62

Note: 100 hypocotyls and 100 calli clumps were used and repeated for 3 timesFigures in parenthesis are angular transformation values

*: Complete inhibition of Agrobacterium growth+: Slight growth of Agrobacterium++: Prominent growth of Agrobacterium

Fig. 10. Effect of cefotaxime on controlling Agrobacterium growth in cultures of Coker-312 after colonizationand co-cultivation

0

10

20

30

40

50

60

70

80

90

100Pe

r ce

nt r

eapp

eren

ce o

fAgr

obac

etri

um

Calli 100 85 70 50 30 0

Hypocotyls 100 80 65 55 40 0

0 200 400 600 800 1000

Fig. 10. Effect of cefotaxime on controlling Agrobacterium growth in cultures ofCoker-312 after colonization and co-cultivation

Table 11: Effect of kanamycin on non transformed hypocotyls with calli

Sl. No. Kanamycinconcentration

(mg/l)

No. of hypocotylscontinued callusing and

callus proliferationPer cent response

1 0 25 100

2 25 17 68

3 50 12 50

4 75 6 24

5 100 0 0

Mean 12

SEm± 0.001

CD at 1% 0.004

Note: 25 sufficient calli induced hypocotyls were used per treatment and repeated for four times

Fig. 11. Effect of kanamycin on non transformed hypocotyls with calli

0

10

20

30

40

50

60

70

80

90

100

Per

cent

sur

viva

l

Per cent survival 100 70 50 25 0

0 25 50 75 100

Fig. 11. Effect of kanamycin on non transformed hypocotyls with calli

Plate 7. Excess Agrobacterium growth on explants after co-cultivation followedby washing in cefotaxime antibiotics and 4-5 days after culturing on cefotaxime

supplemented mediaa) No growth (10 min colonization + 24 hrs co-cultivation)b) Slight growth (30 min colonization + 48 hrs co-cultivationc) Prominent growth (30 min colonization + 72 hrs co-cultivation

Plate 8. Kanamycin selection of untransformed calli in Coker-312a) Kanamycin sulphate (100 mg/L) b) Kanmycin sulphate (0 mg/L)

Plate 9. Kanamycin selection of colonized and co-cultivated explants in Coker-312 a) Calli explant week after colonization and co-cultivation

b) Calli explant 5 weeks after colonization and co-cultivation C) Hypocotyl explants week after colonization and co-cultivation

d) Hypocotyl eplants 5 weeks after colonization and co-cultivation

4.2.4 Effect of pre-culture on callus induction after colonization/co-cultivationThe cream friable calli and hypocotyls were inoculated on MS medium (MS 0.1 mg/l 2, 4-D

+ 0.5 mg/l kinetin) for different periods prior to co-cultivation. The number of calli grown on kanamycinafter colonization and co-cultivation was higher in 48 hours (29 in hypocotyl and 19 in calli) comparedto 0, 24 and 72 hours of pre-culture (Table 12). Irrespective of pre-culture duration hypocotyls showedhigh number of calli (24.5) than calli (16.25). However the growth and proliferation of cells wasreduced due to co-cultivation without pre-culture.4.2.5 Effect of vacuum infiltration on establishment of kanamycin resistant calli free of Agrobacterium

The establishment of calli free of Agrobacterium was on par when they were incubated for 30minutes vacuum infiltration and without vacuum infiltration (23 and 24 respectively). The number ofcalli grown on kanamycin was significantly higher in hypocotyls (28.5) than calli (18.5) as shown intable 13.4.2.6 Large scale genetic transformation studies in Coker-312

A total of 500 hypocotyls and 240 calli for each transcriptional factor gene were used forgenetic transformation. Observations on number of explants showing emergence of calli onkanamycin supplemented media were recorded 4-5 weeks after colonization and co-cultivation (Plate9). Out of 500 explants, emergence of calli was recorded in 280 and 240 hypocotyls respectively forAtDREB1a and BcZAF12 accounting to 56% and 48% respectively.

However, elimination of untransformed calli was observed in subsequent sub-culturing in MSmedium supplemented with 100 mg/l kanamycin. Finally at the stage of embryogenesis only 10 and 3calli respectively for AtDREB1a and BcZAF12 gene were remained as a kanamycin resistant calli.Based on this per cent transformation was 2 % and 0.6 % respectively for AtDREB1a and BcZAF12(Plate 10).

Similarly incase of calli as explant 90 and 80 calli accounting to 37.5 % and 33.33 % wereresistant respectively for AtDREB1a and BcZAF12 at 4-5 weeks after colonization and co-cultivation.However, by the time of induction of somatic embryogenesis 1.6 % and 0.4 % kanamycin resistantcalli were observed (Table 14).

Out of 14 events (14 resistant calli remained after 11-12 weeks after colonization and co-cultivation), complete plantlets from 6 different events were established for AtDREB1a gene. Similarlyplants from 2 events for calli were also established. For BcZAF12 gene, totally 4 plants from 3 events(2 hypocotyl and 1 calli) were established (Plate 11).4.3 IN PLANTA GENETIC TRANSFORMATION STUDIES IN SAHANA

A total of 140 and 80 seedlings were used for transformation for both AtDREB1a andBcZAF12 transcriptional factors respectively. 24 and 18 Plants were established after genetictransformation using AtDREB1a and BcZAF12 genes respectively. Seeds were harvested from allthose T0 established plants and germinated under kanamycin (100 mg/l) supplemented media.

Totally 458 seeds from 24 T0 plant when germinated under kanamycin supplemented mediafor AtDREB1a gene, only 4 plants established. Similarly incase for BcZAF12 gene, only 4 plantsestablished out of 355 seed when germinated in kanamycin supplemented media (Table 15, 16 andPlate 12).4.4 GENE INTEGRATION AND EXPRESSION ANALYSIS4.4.1 PCR amplification

PCR analysis was carried out with gene specific primers, in all this established plants. PCRpositive plants were positive for both the genes. However plants of events from calli did not show PCRamplification for AtDREB1a and BcZAF12 in Coker-312. All 8 plants (4 belonging to AtDREB1a and 4belonging BcZAF12) were tested for amplification of integrated genes using gene specific primers.Amplification was observed in 3 plants each in Sahana (Plate 13, 14 and 15).4.4.2 RT-PCR

RT-PCR was also conducted for two each putative plants form in vitro and in plantatransformation regenerated plants of both the transcriptional factors which are confirmed by PCR.Amplification of AtDREB1a and BcZAF12 transcriptional factor putative plants for RT-PCR wasobserved (Plate 16 and 17).4.4.3 Dot Blot Analysis

It was found that for AtDREB1a and BcZAF12 transcriptional factors two each putative plantswere shown positive for DNA-DNA hybridization (Plate 18 and 19).

Table 12: Effect of pre-culture on callus induction after colonization/co-cultivation

No. of calli grown on kanamycinExplant

Pre-culture(hours) 0 24 48 72

Mean

Calli 12 16 19 18 16.25

Hypocotyl 19 22 29 28 24.5

Mean 15.5 19 24 23 20.37

SEm± CD at 1%

Explant 0.10 9.18

Treatment 0.14 0.71


Note: 50 hypocotyls and 50 calli clumps were used per treatment and repeated for 3 times.

Fig. 12. Effect of pre-culture on callus induction after colonization / co-cultivation in Coker-312

0

10

20

30

40

50

60

Per

cent

sur

viva

bilit

y

calli 24 32 38 36

Hypocotyls 38 44 58 56

0 24 48 72

Fig. 12. Effect of pre-culture on callus induction after colonization / co-cultivation in Coker-312

Table 13: Effect of vacuum infiltration on establishment of kanamycin resistant calli free ofAgrobacterium

No. of calli grown on kanamycinExplant

Without vacuum With vacuum

Mean

Calli 19 18 18.5

Hypocotyl 29 28 28.5

Mean 24 23 23.5

SEm± CD at 1%

Explant 0.10 9.31

Treatment 0.10 9.31


Note: 50 hypocotyls and 50 calli clumps were used per treatment and repeated for 5 times.

Fig. 13. Effect of vacuum infiltration on establishment of kanamycin resistant calli free of Agrobacterium inCoker-312

0

10

20

30

40

50

60Pe

r ce

nt r

espo

nse

without vacuum 38 58

with vacuum 36 56

Calli Hypocotyls

Fig. 13. Effect of vacuum infiltration on establishment of kanamycin resistant calli free of Agrobacterium in Coker-312

Table 14: Large scale genetic transformation studies in Coker-312

Sl.No.

Transcription factor

geneExplant

usedNo. of

explant co-cultivated

No. ofexplantsinducing

callisurvived

onkanamycin

media

No. of callisurvived

onKanamycin

(atembryogen

esis)

No. ofindividualsurvived

calli (event)produced

plants

Event namesNo. ofplant

established

No. of plantPCR

positive fornpt-II andSpecific

gene

RT-PCRpositive

forspecific

gene

CKD170810-1 4 2 0

CKD170810-2 8 5 1

CKD170810-3 10 2 1

Hypocotyl 500 280 10 4

CKD130509-1 8 1 0

CKD230610-1 5 0 0

1 AtDREB1a

Calli 240 90 4 2

CKD170810-7 3 0 0

CKB150309-1 2 2 1Hypocotyl 500 240 3 2

CKB150309-2 3 1 1

2 BcZAF12

Calli 240 80 1 1 CKB090410-1 1 0 0

Total 1480 690 18 9 46 13 4

Plate 10. Somatic embryogenesis in Kanamycin supplemented medium and plantestablishment in Coker-312

a) Kanamycin resistant friable calli b) Globular embryosb) Torpedo-cotyledonary embryos d) Shoots and roots developmente) Plantlet development f) 3 weeks incubationg) Pulative transgenic plant in ex vitro condition

Plate 11. T0 putative transgenic plants for AtDREB1a and BcZAF12 gene in Coker-312

a) CKB 150309-1-H b) CKD 170810-3-D

Table 15: In planta genetic transformation studies of AtDREB1a transcriptional factor in Sahana

Sl.No.


gene

No. ofgerminating seedling

used

No. ofestablish

ed (T0)plants

No. ofseeds

screenedfor

kanamycin (T1)

No. ofplant

resistantto

kanamycin

No. of plantPCR


gene

RT-PCRpositive

forspecific

gene

20 - - -

19 - - -

20 - - -

20 - -

20 - - -

18 - - -

19 - - -

18 - - -

20 - - -

22 2 1 1

18 - - -

19 - - -

22 2 2 1

16 - - -

19 - - -

22 - - -

21 - - -

19 - - -

17 - - -

18 - - -

19 - - -

14 - - -

18 - - -

1 AtDREB1a 140 24

20 - - -

Total 140 24 458 4 3 2

Table 16: In planta genetic transformation studies of BcZAF12 transcriptional factor in Sahana

Sl.No.


gene

No. ofgerminati

ngseedling

used

No. ofestablish

ed (T0)plants

No. ofseeds

screenedfor

kanamycin(T1)

No. ofplant

resistantto

kanamycin

No. of plantPCR


gene

RT-PCRpositive

forspecific

gene

19 - - -

22 3 2 1

15 - - -

19 - -

18 - - -

18 - - -

19 - - -

22 - - -

20 - - -

21 - - -

19 - - -

18 - - -

20 1 1 -

22 - - -

24 - - -

22 - - -

18 - - -

1 BcZAF12 80 18

19 - - -

Total 80 18 355 4 3 1

Plate 12. In planta genetic transformation in Sahana

a) To plant b) To originated seeds screening in kanamycin (1000 mg/L)b) AtDREB1a T1 putative transgenic plant d) BcZAF12 T1 putative transgenic plant

Plate 13. Quantity and quality of DNAa) Nanogram DNA/gram of leaf sample (Nanodrop reading) b) Get image for DNA purity

Plate 14. Confirmation of gene integration through PCR for npt-II genea) AtDREB1a gene in Coker-312b) AtDREB1 gene in Sahanac) BcZAF12 gene in Coker-312d) BcZAF12 gene in Sahana

M= 100 bp marker1 to 11 = Plant samples-ve = Negative plant sample+ve = Plasmid sample




Plate 15. Confirmation of gene integration through PCR for gene specific primers

a) AtDREB1a gene in Coker-312b) AtDREB1 gene in Sahanac) BcZAF12 gene in Coker-312d) BcZAF12 gene in Sahana





Plate 16. RNA from Putative transgenic plants

Plate 17. Confirmation of gene integration through RT-PCR for gene specific primers a) AtDREB1a gene in Coker-312 b) AtDREB1a gene in Sahana c) BcZAF12 gene in Coker-312 d) BcZAF12 gene in Sahana

Plate 18. Dot blot analysis in Plate 19. Dot blot analysis in AtDREB1a putative BcZAF12 putative transgenic Transgenic plants plants

1 to 4 = A AtDREB1a gene putative transgenic plant samples5 to 8 = BcZAF12 gene putative transgenic plant sample9 = Negative plant sample


M= Double digest marker1 to 2 = Plant samples-ve = Negative plant sample+ve = Plasmid sample



DISCUSSION Cotton is an important commercial fibre crop, grown in more than 60 countries in the world.

This crop is of great commercial importance as it sustains livelihood of a large number of rural people through cultivation, picking and a large work force employed in both small and large-scale textile and other industrial units. Over 180 million people are associated with the fibre industries that produce 20 to 30 billion dollars worth of raw cotton.

The cotton production constraint in all cotton growing countries has been moisture stress, boll worm incidence, incidence of various sucking pests etc which has been causing a huge economic loss. Development of genetically modified cotton to solve boll worm problem by introducing genes coding for endotoxin crystal protein has become a history now. Cotton has become first genetically modified commercial crop in the world which accounts 25 million hectare (Anon., 2011) area in different countries of genetically modified crops grown.

Transformation procedures allow making small specific changes in the genome of cell, such as the addition of one or a few genes. This is in contrast to conventional breeding, where entire sets of chromosomes are combined when crossed and selection is made in segregating generations. Genetic transformation is therefore a valuable supplement to conventional breeding.

Modern biotechnology, including tissue culture, genetic engineering and genetic transformation techniques has provided new opportunities to enhance the germplasm of crop plants. In comparison with traditional plant breeding practices, biotechnology is contributing towards the development of novel methods to genetically alter and control plant development, plant performance and plant products. Thus, biotechnological approaches have the potential to complement conventional methods of breeding by reducing the time required to produce cultivars with improved characteristics.

For successful development of transgenic plants, identification of suitable target tissue and efficient gene transfer protocols are essential (Taylor and Vasil, 1991). Therefore, understanding the genetic variability of different crop plants and genotypes for in vitro regeneration system and optimization of routine regeneration protocols is a pre-requisite for successful utilization of transformation technology in any crop.

Regeneration via single cell somatic embryogenesis has been more efficient in genetic transformation as single cells are most effective targets of gene transfer, either through Agrobacterium mediated transformation or particle bombardment. It avoids problem of chimeras..

Inspite of development of several methods of transformation in plants, Agrobacterium based method is more preferred (Popelka and Fredy, 2004), in dicots (Krishnamurthy et al., 2000) and monocots (Smith and Elizabeth, 1995) due to single copy gene integration (Hobbs et al., 1993; Wu et al., 2005), greater precision with excellent stability (Lee et al., 1985; Ikaram 2004; Leelavati et al., 2004; Wu et al., 2005) and low cost (Mohanty et al., 1999; Leelavati et al., 2004; Shuangxia et al., 2005; Guo et al., 2007).

Agrobacterium tumefaciens is a soil bacterium that has evolved as a natural genetic engineering system. It contains a segment of DNA that is transferred from the bacterium to plant cells. A. tumefaciens is the causative agent of crown gall disease of dicotyledonous plants. The name refers to the galls or tumors that often form at the crown (junction between the root and the stem) of infected plants. Because the crown of the plant is usually located at the soil surface, it is here that a plant is most likely to be wounded and infected by a soil bacterium. However, A. tumefaciens can infect a plant and induce a tumor at any wound site by the two key events i.e., (1) the plant cells begin to proliferate and form tumors, and (2) they begin to synthesize an arginine derivative called an opine. The opine synthesized is usually either nopaline or octopine which is catabolized and used as energy sources by the infecting bacteria. A. tumefaciens strains that induce the synthesis of nopaline can grow on nopaline, but not on octopine, and vice versa. Clearly, an interesting inter-relationship has evolved between A. tumefaciens and host plant, which is able to divert the metabolic resources and machinery of the host plant to the synthesis of opines, which are of no apparent benefit to the plant but which provide sustenance to the bacterium.

The ability of A. tumefaciens to induce crown galls in plants is controlled by genetic information carried on large plasmids called the Ti plasmid for its tumor induction capacity. Two components of the Ti plasmid, the T-DNA and the vir region, are essential for the transformation of plant cells.

So, the successful stable and heritable genetic transformation is possible when Agrobacterium colonizes on the surface of cells of meristematic tissue which contributes for the growth of the new shoots including reproductive parts.

The present investigation was carried out to develop suitable regeneration and efficient transformation protocol in cotton. Transcription factors are regulatory proteins that implement their functions by binding directly to the promoters of target genes in a sequence-specific manner to either activate or repress the transcription of downstream target genes, and finally enhance the tolerance to various abiotic adversities in plants (Liu et al., 1998; Kasuga et al., 1999; Jaglo et al., 2001; Zhu 2002; Lee et al., 2006; Agarwal et al., 2006; Ito et al., 2006). Till now, very few efforts have been made for genetic transformation for these transcriptional factors. An attempt was made to transfer AtDREB1a and BcZAF12 transcriptional factors through Agrobacterium mediated transformation. The results of the investigations are discussed under the following headings.


Callus is an amorphous tissue consisting of dedifferentiated, unorganized cell masses (George et al., 2008). The cells of callus are parenchymic in nature. A typical plant callus will undergo three stages of development. The first stage is the induction of cell division. The second stage is dedifferentiation, which is a period of active cell division during which differentiated cells of the explants lose any specialized feature. Finally the last stage is the period, during which cell division decreases or ceases and cellular differentiation increases within the callus.

Once callus is induced in any part of the explant, it should be able to proliferate further and be amenable for subsequent growth and maintenance for a reasonable period of time. This is very important for a variety of application involving the cell phase. Callus induction medium itself may or may not help its further proliferation. For callus cultures of large number of monocots and dicot plants several standard media (Gamborg, 1966; Gautheret 1955, Hilderbrandt, 1962; Lin and Staba, 1961; Murashige and Skoog, 1962; White, 1942) were tested for optimum cell growth and colony morphology. Some of the standard media supported the good growth of callus of some species, but little or no growth of callus of other species.

Somatic embryogenesis resulting in regeneration of whole plants is an important step in any plant transformation scheme. Successful stable transformation is the one where the single cell gives rise to a plant. The ideal transformation scheme is that done via somatic embryogenesis because from callus, each transformed cell has the potential to produce a plant. In an extensive study, on the genotype specificity of somatic embryogenesis response in cotton, reported that the highest frequency of regeneration occurred in Coker lines (Trolinder and Xhixian, 1989). The effects of various factors believed to impact regeneration in cotton have been investigated. These factors include source of explant, media types, and combinations of growth regulators, temperature, light intensity and dark conditions (Smith et al., 1977; Finer 1988; Gawel and Robacker, 1990; Sakhanokho et al., 2001). Presence of genetic variability for somatic embryogenesis and regeneration in Coker-312 was recorded in many reports (Trolinder and Xhixian 1989; Firoozabady and DeBoer 1993; Sakhanoko et al., 1998; Kumar et al., 1998; Nobre et al., 2001 and Nagaraj et al., 2012). Therefore, in the present study one of the objective was to establish in vitro somatic embryogenesis and plant regeneration in our laboratory with the available Coker-312 variety. The details of the various experiments conducted on regeneration are discussed in the following headings.

5.1.1 Days to callus initiation

In order to reduce total duration from callus induction to regeneration, identification of shortest duration requirement at each stage of in vitro regeneration is most essential. Irrespective of growth regulators, days required for callus induction in hypocotyls was significantly earlier than cotyledons and in hypocotyls also duration that was taken for callus induction varied significantly with different combinations of PGRs.

The difference in duration taken for callus induction was about 4 days, earliest being the 10 and most late is 14 days after culturing explants among various treatments including type of explant and MS media with different PGRs. It indicates, although in general, PGRs may induce callus, identification of an interaction effect between explants and PGRs is essential for early induction of callus. In studies of Zouzou et al., 1997; Wu et al, 2004; Ikram, 2004; Rao et al., 2006; Sun et al., 2006; Xie et al., 2007; Michel et al., 2008 such desirable interaction effects on duration for callus induction was identified in Gossypium. The earliest callus induction was recorded in hypocotyls, where MS medium supplemented with 0.1 mg/l 2, 4-D and 0.5 mg/l kinetin.

5.1.1.2 Per cent callus induction

Induction of more amount of callus in shortest duration is essential, the effect of explants, PGRs and their interaction effects are discussed interms of per cent callus induction and amount of callus induction. Number explants recorded callus in 15 days after culture was more in hypocotyls than in cotyledons. There is about two per cent difference in callus induction between hypocotyls and cotyledon irrespective of plant growth regulators.

Effect of growth regulators on callus induction was tremendous. There was absolutely no callus induction not even on a single explant of both types was observed 15 days after their culture on media devoid of PGRs, whereas, in MS media supplemented with PGRs, number of explants recorded callus on their surface irrespective of cotyledons and hypocotyls enhanced from 75 to 98.5 per cent.

The highest number of explants that were recorded callus on their surface was 99 per cent in hypocotyls cultured on MS medium supplemented with 0.1 mg/l 2, 4-D and 0.5 to 1.0 mg/l kinetin. Callus induction response was in general more in MS medium supplemented with both auxin (2, 4-D) and cytokinins (kinetin and TDZ) on both the explants and between two cytokinins, callus induction response was more in kinetin supplemented media than TDZ in both the explants, However, callus induction response was more in hypocotyls than cotyledons in 2, 4-D and kinetin supplemented media, but callus induction response was higher in cotyledon than hypocotyls in 2, 4-D with TDZ supplemented media.

From all these experiments it may be concluded that strong interaction effect between explants and media is existed. In studies like Trolinder and Goodin (1988a); Kulkarni (1997); Zhu and Sun (2000); Zouzou et al., (2000); Khan et al., (2006); Kouadio et al., (2007) and Kouakou et al., (2007) effect of explants, media and their interaction effect on callus induction response was recorded. Our results are in line with their finding.

5.1.1.3 Fresh callus weight

Similarly the trend of amount of callus produced on hypocotyls and cotyledons was similar to that of per cent callus induction response. Between hypocotyls and cotyledons, the amount of callus recorded on hypocotyls was significantly more than cotyledons. Highest amount of callus production was also recorded on hypocotyls cultured on MS with 2, 4-D (0.1 mg/l) plus kinetin (0.5 mg/l).

In the present study, the amount of callus induction and number of explants producing calli after 15 days of explant culture was found to be influenced in the similar direction by MS supplemented with 2, 4-D (0.1 mg/l) and Kinetin (0.5 mg/l). There are studies by Zhang et al., (2001); Umbeck et al., (1987); Leelavathi et al., (2004); Firoozabady et al., (1987) that amount of callus produced and number explants responding to interaction effect of explant and media. So it differs from crop to crop and even between genotypes itself in cotton. Genotypic variations could be due to endogenous levels of hormones (Carman 1990).

5.1.1.4 Carbon sources for callus induction

Sugar influence cells proliferation and differentiation (Swankar et al., 1986). Glucose is assimilated form of sugars by plant cells and the most important source of energy production (Richter, 1993). Sucrose is an important biological reservoir for the glucose and fructose sugars. Sucrose is an analogous of glucose as regards to the physico-chemical properties but, with a low reactivity. An acid medium (pH 5.8), hydrolyses this sugar and breaks it into glucose and fructose which are assimilable by plant cells. There is probably a competition between these two sugars for their assimilation by the cells that makes sucrose less active and consequently less available to cotton callogenesis. Carbon manipulation leads to improvement in somatic embryogenesis (Sakhanokho et al., 2001). Sun et al., (2006) reported glucose as good source for callus induction. Glucose 3 to 4 % show good callogenesis and indeed gives green grayish, friable and no necrotic calli (Nomura and Koumamime, 1995; Kouakou, 2003; Thiruvengadam et al., 2006; Zouzou et al., 2008). Therefore, in the present study, readily available glucose was found to be or advantage over interms of induction of callus frequency.

Increase in callus induction response was found increasing with increasing concentration of carbon sources upto 3%. However, highest response was recorded in 3 % glucose (94 %) followed by 4 % glucose (86 %). Significant drop in callus induction response beyond 3 % in all the three carbon sources was recorded. Callus induction response was in fact just about 34-38 % in lowest (1 %) levels of all three carbon sources.

It indicates that there is a requirement of very specific levels of carbon source and also type of source for callus induction. It may depend on the availability of endogenous carbon source for callus induction. Callus induction response may also be the result of stress that is created in the culture through carbon source. As glucose induce less stress and reduced browning in callus than sucrose, for higher callus induction and proliferation, glucose seems to be the best source of carbon.

5.1.1.5 Nature of callus

Generally, nature of callus is defined interms of its texture likes loose, hard and friable with various colors like colorless, green, creamy, light yellow, pinkish etc. in various crops including cotton. Yellow, light yellow, green, light green, yellow green, gray and off-white colored calli with compact, loose, pulpy, hard and friable texture were observed in the different induction media in cotton (Han et al., 2009). Kind of variation in callus from a genotype suggests that nature of callus is a result of interaction effect of explants, medium, plant growth regulator, some inorganic and organic compounds and physical factors like light intensity, temperature etc.

As the nature of callus also further known to determine the regeneration, every tissue culture experiments always aim to understand and produce callus of that nature which enhances somatic embryogenesis or organogenesis followed by regeneration of plants. Light yellow to cream colored friable calli in cotton has been characterized as a callus which enhances somatic embryogenesis and regeneration in several studies (Shoemaker et al., 1986; Firoozabady and DoBoer 1993, Sakhanokho et al., 2001; Sun et al., 2006).

Therefore, in the present study 2, 4-D as auxin was used in many previous studies, suggested 2, 4-D auxin which induces light yellow to cream calli and colorless callus. 2, 4-D coupled with two cytokinins were tried in the present study to induce light yellow to cream colored friable calli. 2, 4-D appears to have inhibitory effect on chlorophyll formulation as suggested by George et al., 2008.

Although NAA, a synthetic auxin, has been found very effective in callus induction in various crops, it is unable to suppress the chlorophyll synthesis and as a result, production of green and hard calli was observed which is undesirable for regeneration (Katageri et al., 1998; Sureshkumar et al., 2003; George et al., 2008).

Prevention of chlorophyll development may itself act as a kind of stress on cells of calli so that they try to regenerate into plants. Condition of low light intensity or dark itself enhances the formation of friable cream colored calli as dark is known to inhibit the chlorophyll expression.

Between hypocotyls and cotyledons, hypocotyls are less in chlorophyll than cotyledons, hypocotyls are preferred in induction of friable calli. In all our further experiments hypocotyls were used as source of explants, as we also recorded production of cream friable callus on surface of hypocotyls. Induction of loose or compact or hard calli was observed on both explants cultured on MS with 2, 4-D alone (0.1 to 1.5 mg/l), 2, 4-D (0.1 mg/l) with varying levels of kinetin (0.1 to 1.5 mg/l) and 2, 4-D (0.1 mg/l) plus varying levels of TDZ (0.1 to 1.5 mg/l). Desired calli, cream to light yellow friable calli production was observed in MS supplemented with 2, 4-D (0.1 mg/l) plus kinetin (0.5-1.0 mg/l).

Multicellular explants are generally heterogeneous in terms of the morphogenic potential of its constituent cells. Only a small proportion of these cells are able to express their cellular totipotency under a set of culture conditions. Therefore, the calli derived from such explants are also heterogeneous. Sometime the embryogenic portions of the callus are distinct from the non-morphogenic tissue on the basis of their morphological appearance and it is essential to make artistic subcultures to establish regenerating tissue cultures.

5.1.1.6 Embryogenesis

Zygotic embryogenesis is the normal process of development of embryos in maturing seed as a result of differentiation of a single cell, referred as polar nuclei formed as result of union between egg and pollen nuclei, in in vivo. This process is genetically and physiologically controlled system, to continue their generations, existed in all living things in nature. Parallel to this, in the process of crop improvement, necessity of such differention from any cell from any part of plant in in vitro was felt necessary seriously. In 1980s and 90s, almost for two decades, innumerable experiments in various crops including cotton were conducted and placed on record very successful research. Somatic embryos have a bipolar structure in which shoot and root meristems are directly connected with no interruption by non-differentiated callus tissue.

What is basically understood from all these historical evidence is that somatic embryogenesis to obtain plants is a result of interaction between genotype, media, growth regulators, some inorganic and organic compounds and physical factors like light intensity. Somatic embryogenesis may also be an effect of abiotic stress created in culture and culture conditions on cells of calli. Several studies were conducted on screening cotton genotypes for somatic embryogenesis and regeneration (Finer and Smith 1984; Firoozabady and DeBoer 1993; Thorpe 1995; Sakhanokho et al., 2001; Sakhanokho et al., 2004). From all these studies, it was a clear evidence that Coker-312, 310 and 315, G. hirsutum were able to produce somatic embryos. However there were few studies (Khan et al., 2006; Kumar et al., 1998; Zhang and Wang 1989) that were reported somatic embryogenesis and regeneration in other than Coker cotton. Since, the main aim of present studies to transfer AtDREB1a and BcZAF12 transcriptional factors to enhance drought resistance in cotton, Coker-312 genotype was used. However, the presence of variability for somatic embryogenesis and plant regeneration within Coker-312 was reported in many studies (Trolinder and Xhixian 1989; Firoozabady and DeBoer 1993; Sakhanoko et al., 1998; Nobre et al., 2001 and Nagaraj et al., 2012). Therefore in order to establish efficient somatic embryogenesis and regeneration system in this research laboratory for the purpose of genetic transformation, somatic embryogenesis and successful regeneration followed by establishment of plants outside the laboratory condition was studied in Coker-312 itself. In discussion on nature of calli, it was mentioned that light yellow to cream colored friable calli would enhance somatic embryogenesis and regeneration. This calli was also referred as embryogenic calli in many studies. Therefore in the present study effect of nature of calli and growth regulators on somatic embryogenesis was studied. From individual calli clumps, emergence of minimum of one somatic embryo (globular) was recorded as positive response, emergence of such globular stage embryos was observed only after 40 days of culture of calli on different media. Therefore final observation interms of counting number of calli produced embryos was recorded on 55-60 days after culturing.

Highest number of calli clumps from which somatic embryogenesis observed was on MS media supplemented with 0.01 mg/l 2, 4-D plus 0.1 mg/l kinetin. That too only from friable calli clumps. There was no any embryo, formed in the hard/compact non friable calli cultured on seven media (MS with various combination and concentrations of PGRs). Even in case of friable calli, embryo induction was significantly lower in media supplemented with only kinetin/TDZ without 2, 4-D and 2, 4-D (0.01 mg/l) plus TDZ (0.1 mg/l) than 2, 4-D (0.01 mg/l) with kinetin (0.1 mg/l). Necessity of low levels of auxins and cytokinins during initiation of differention from the dedifferentiated cell was studied (Finer and Smith 1984; Firoozabady and DeBoer 1993; Thorpe 1995; Sakhanokho et al., 2001; Sakhanokho et al., 2004). Even in media not containing any PGRs fail to induce embryogenesis.

Although, no experiment on effect of light on embryogenesis was made in the present study, it was know established fact that polyphenolic compounds in tissues/cells will be oxidized by polyphenoloxidase enzyme especially in light causing browning of calli (Chawla 2002). Therefore to prevent such browning, calli cultures were maintained at very low light intensity (500 lux) to enhance embryogenesis from such healthy calli.

Exposure of individual cells or group of few cells (calli clump) may have the chance of exposing to culture conditions and start responding to their effects towards embryogenesis in case of hard or compact calli. Sun et al., 2006 reported maltose was more effective than glucose for embryogenesis. In the study of somatic embryogenesis, maltose was used as carbon sources because the disaccharides like maltose and trehalose were effective in stimulating somatic embryo differentiation from callus. Glucose, fructose and other monosaccharides were non-stimulatory.

5.1.1.7 Embryo maturation

In order to obtain plantlets, maturation of advance stage embryos (torpedo or cotyledonary stage) is essential. Although somatic embryogenesis has been reported for several crop species, the quality of somatic embryogenesis with regard to their germinability or conversion into plants has been generally very poor. As poor as 3-5 per cent conversion has been observed in many cases. This is because the apparently, normal looking somatic embryos are actually incomplete in their development. Unlike seed embryos, the somatic embryogenesis, called embryo maturation, which is characterized by the accumulation of embryo specific reserve food materials and proteins which impart desiccation tolerance to the embryos. In several ways embryo maturation was carried in different crops. Bunn et al., 1989 observed that conversion of soyabean somatic embryos was increased by using sucrose as a carbon source. Similarly, somatic embryos of maize required a maturation phase in medium with a high sucrose concentration, resulting in formation of typical storage organ (scutellum) (Emons and Kieft 1991).

During maturation, starch accumulated in the scutellar cells and formation of lignin was suppressed in the zygotic embryos (Emones et al., 1993). Soybean somatic embryos desiccated in empty petri plates until they shriveled to 40-50% of their volume and rapidly imbibed water following transfer to medium and germinated with at least seven times the frequency of non-desiccated embryos. Somatic embryos of red oak germinated and produced shoot only after a period of dehydration treatment with osmotically active sugars (Gingas and Linebergar 1988). Gradual drying of the alfa alfa somatic embryos with progressive and linear loss water gave better response.

Hormone free media helps in maturation of embryos by preventing recallusing and embryogenesis. So in the present study embryos were desiccated by keeping them on sterile filter paper placed on MS medium supplemented with sucrose for nearly 15-20 days or until proper rooting and shooting. Even dehydration of rice callus by placing it on dry filter paper inside a sealed petri plate promote regeneration frequency (Tsukahara and Hirosawa 1992).

In order to find out suitable media for embryo maturation, four media including media used in somatic embryogenesis were tried in this study. Conversion or maturation of embryos into plantlets was found highest in MS media alone (95%) followed by 60 % and 40 % in MS media supplemented with additional 100 mg/l myo-inositol and MS media supplemented with additional 1.9 mg/l KNO3

respectively. Maturation of embryos in the media which supported somatic embryogenesis was lowest. These results indicate that embryos develop into plants in basal media containing macro and micro nutrients with some vitamins and presence of growth regulator is deleterious to embryo maturation.

Embryogenic cultures are transferred to auxin free medium, the disruption of cells from each other stops and the globules develop into globular embryos. In this process the first differentiation step is the formation of a protoderm outside the globule. The globular embryos then continue further development and form typical embryos. But differentiation of protoderm occurs only after transferring to 2, 4-D free media (Emons 1994)

Wochok and Wetherell (1971) have suggested that 2, 4-D induced suppression of embryo development may be mediated through endogenous ethylene production. High ethylene content would result in enhanced activity of cellulose or pectinase or both, causing breakdown of the clumps before polarity is established in the pro-embryos for further organized development. Thus, in 2, 4-D medium tissue multiplication goes on but mature embryos do not appear.

2 to 3 % of Sucrose levels lead to both xylem and phloem differentiation. Shoot differentiation in callus cultures enhanced osmolarity of the medium achieved by the addition of sucrose or mannitol or sorbitol (Kavi Kishore and Reddy, 1986). Sucrose in culture medium functions both as a carbon source and as an osmotic regulator. Both functions are critical for embryoids and callus formation (Last and Brettell, 1990). Sucrose rapidly hydrolyzed to glucose and fructose, nearly doubling the osmolality of the medium.

5.1.1.8 Hardening of plantlets to establish ex vitro condition

The hardening of in vitro raised plantlets is essential for better survival and successful establishment. Direct transfer of tissue culture raised plants to field is not desirable due to high rate of mortality, as the regenerates in the culture condition has been cosseted environment with a very high humidity, varied light and temperature condition and being protected from the attack of microbial and other agents. Direct transfer to sunlight also causes charring of leaves and wilting of the plants (Hiren et al., 2004; Lavanya et al., 2009; Deb and Imchen, 2010). In other words, the survival percentage is determined by the hardening of the plantlets. It is therefore, necessary to accustom the plants to a drier or natural atmosphere by a process called acclimatization or hardening. Subjecting the cultured tissues to periods of stress such as desiccation by incubating embryos in hormone free medium appears to improve the conversion of somatic embryos into mature embryos and subsequently to plants (Parrott et al., 1998; Yehosua et al., 1992; Kazuko and Kazuko, 1994; Liu et al., 1994; Pomeroy et al., 1994; Timbert et al., 1996; Bomal and Tremblay, 1999).

In the present study, highest number of plants (95%) recovered when plantlets were first incubated in MS media supplemented with sucrose (3%) for 4 weeks under high light intensity of about 3000-3500 lux with 80 % relative humidity in in vitro condition followed by incubating them in growth chamber (6000 lux and 65 % relative humidity) after planting in soil and peat mixture (1:1). Reduction in plant recovery was more, in case of not incubating in growth chamber before placing them in ex vitro condition than incubating plantlets for 1 week in growth chamber.

Even in case of incubation in growth chamber before placing them in ex vitro condition, recovery rate was less in cases where incubation of plantlets in vitro for high light intensity for less than four weeks and more than four weeks. The withering of leaves was observed in cases where plantlets were incubated more than four weeks in in vitro under high light intensity. The humidity that was maintained during hardening was 80, 70 and 45 per cent in in vitro, growth chamber and ex vitro conditions respectively. Gradual increase in light intensity and decrease in relative humidity enhanced the rate of establishment of in vitro raised plants in ex vitro condition.


Severe osmotic stress causes detrimental changes in cellular components (Morgan, 1983, Ashok kumar et al., 1984, Morgan et al., 1986, Flower and Ludlow, 1986, Morgan, 1988 and Karen and Mundy, 1990). In stress-tolerant transgenic plants, many genes involved in the synthesis of osmoprotectants organic compounds such as amino acids (e.g. proline), quaternary and other amines (e.g. glycinebetaine and polyamines) and a variety of sugars and sugar alcohols (e.g. mannitol, trehalose and galactinol) that accumulate during osmotic adjustment. Many crops lack the ability to synthesize the special osmoprotectants that are naturally accumulated by stress tolerant organisms. It is believed that osmoregulation would be the best strategy for abiotic stress tolerance, especially if osmoregulatory genes could be triggered in response to drought, salinity and high temperature. Therefore, a widely adopted strategy has been to engineer certain osmolytes or by over expressing such osmolytes in plants, as a potential route to breed stress-tolerant crops.

Transcription factors bind to either enhancer or promoter regions of DNA adjacent to the genes that they regulate. Depending on the transcription factor, the transcription of the adjacent gene is either up- or down-regulated. Transcription factors use a variety of mechanisms for the regulation of gene expression. These mechanisms include: i) stabilize or block the binding of RNA polymerase to DNA. ii) catalyze the acetylation or deacetylation of histone proteins. The transcription factor can either do this directly or recruit other proteins with this catalytic activity.

The dehydration responsive element binding proteins (DREB) are important transcription factors that induce a set of abiotic stress-related genes and impart stress endurance to plants. The DREB transcription factors could be dichotomized as DREB1 and DREB2, which are involved in two separate signal transduction pathways under low temperature and dehydration, respectively. They belong to the ERF (ethylene responsive element binding factors) family of transcription factors. ERF proteins are a sub-family of the APETLA2 (AP2)/ethylene responsive element binding protein (EREBP) transcription factors that is distinctive to plants.

So in the present study two gene constructs for expression of transcriptional factors viz., AtDREB1a and BcZAF12 were used in genetic transformation studies. These two genes were present in Agrobacterium tumefaciens strain LBA-4404, an efficient binary plant transformation vector. Sunilkumar and Rathore (2001) showed the explant of transient transformation events in calli through GFP reporter gene through Agrobacterium mediated genetic transformation. According to them T-DNA transfer to cotton cells is not a rate limiting step, infact, it is highly efficient because they observed strong transient GFP activity in cells of explants after 4 days of co-cultivation.

Transformation is a complex multi-event process. Number of factors are known to affect transformation frequency viz., pre-culture of explants, colonization period, co-cultivation period, use of phenolic compounds like acetosyringone and post co-cultivation wash with bactericide are considered critical. Some of the experiments conducted during this study are discussed in the following heads.

5.2.1 Effect of colonization and co-cultivation period on establishment of cultures free of Agrobacterium contamination

Due to colonization and co-cultivation of Agrobacterium tumefaciens generally it remains always on the surface of the explants with very low possibilities of its presence within the tissue between inter cellular spaces. Agrobacterium strain present on the surface of the explant and with in the intercellular spaces of explant, if it is not removed effectively (not allowed to grow), it over grows on the surface of explants causing incomplete death. Therefore standardization interms of effective elimination of excess Agrobacterium is most important step in genetic transformation with Agrobacterium tumefaciens mediated method. Therefore, in the present study an experiment was conducted in three factorial design including factors like type of explant, duration of colonization and duration of co-cultivation. The results of this experiments were discussed in the following page.

Explants were allowed to colonize the Agrobacterium tumefaciens strains LBA-4404 harbouring pCAMBIA plasmid containing AtDREB1a gene and pBINAR plasmid containing BcZAF12 gene suspension by shaking for 10 minutes. Colonization beyond 10 min found to be lethal for survival of explants, as growth of Agrobacterium was observed on the surface of all explants used for colonization and co-cultivation.

The periods of co-cultivation differ according to plant species. Longer periods of co-cultivation seem to be effective for efficient transfer of the T1 plasmid to plant cells. Cao et al. (1998) suggested that low efficiency of transformation in earlier work on apples was due to insufficient length of co-cultivation. Optimal co-cultivation duration was critical for transformation in crops (Vergauwe et al., 1998; Shuangxia et al., 2005). However, the optimal co-cultivation duration for transformation in cotton was uncertain in the previous reports, ranging from 36 to 72 hours (Sunilkumar and Rathore, 2001, Leelavati et al., 2004). In the current study, among the co-cultivation duration of 24, 48, 72 hours, Agrobacterium was observed on the surface of all explants used for colonization and co-cultivation.

Co-cultivation beyond this period, resulted in softening, browning and death of explants and the survival was very poor. Liu et al. (1990) and Leelavati et al., (2004) have observed overgrowth of bacterium beyond three days of co-cultivation. It indicates that, more the time of co-cultivation more is the difficult for elimination of Agrobacterium present on surface of explants and intercellular spaces within the tissue (Momtaz et al., 1998).

A longer co-cultivation period (72 hours) resulted in over growth of bacterium and decreased regeneration. Cervera et al. (1998) and Muthukumar et al. (1996) reported that, more than three day co-cultivation period resulted in over growth of Agrobacterium and a subsequent decrease in regeneration frequency of the transformed shoots.

In the present study it was very clear that 10 minutes of colonization followed by 24 hours of co-cultivation was found free of Agrobacterium to the extent of 72-76 % hypocotyls and calli explant respectively. However, the presence of Agrobacterium at a very mild level in all the explants of both calli and hypocotyls was observed in 20-30 minutes of colonization followed by 48 hours of co-cultivation, but in case of 72 hours of co-cultivation with all three duration of colonization, very sever over growth of Agrobacterium on the surface of explant was detected. Therefore an experiment was further conducted using 30 minutes of colonization followed by 48 hours co-cultivation to check the possibility of elimination of Agrobacterium from the culture, in cefotaxime supplemented media. In the subsequent subculture, it was decided to follow 30 minutes of colonization with 48 hours of co-cultivation in the further transformation experiment. The reason for adopting this duration of colonization and co-cultivation is presence of Agrobacterium on the surface of explant which may enhance genetic transformation and also its presence in very low levels (detectable range), which may be eliminated in subsequent subculture using cefotaxime antibiotic which is known to kill the Agrobacterium very effectively.

5.2.2 Effect of cefotaxime on controlling Agrobacterium growth in cultures after colonization and co-cultivation

Titer of bacterium is another factor that is known to affect transformation frequency. The titer of bacteria (0.5 × 108 cells/ml equivalent to 0.6 OD) is found sufficient for cotton (Katageri et al., 2007: Sumithra et al., 2010a, Sangannavar et al., 2011a). High titers usually result in overgrowth of bacteria. Although, cefotaxime is non-toxic to plant tissues, but at higher concentrations, it inhibits the growth of the plant tissue/cells. There was no any single adverse opinion of cefotaxime use in previous genetic transformation experiments of cotton. Therefore in the present study 5 levels of cefotaxime (mg/l) were tested for effective control of Agrobacterium growth in cultures. None of the levels except 1000mg/l cefotaxime did control Agrobacterium growth on culture. Complete control of Agrobacterium growth was observed in 1000 mg/l. In subsequent 2-3 subcultures, in 1000 mg/l cefotaxime was also verified for Agrobacterium free cultures. However in many studies (Manoharan et al., 1998, Leelavathi et al., 2004) effective control of Agrobacterium was observed in 600 mg/l to 1000 mg/l cefotaxime.

5.2.3 Effect of kanamycin on non transformed hypocotyls with calli

A selectable marker gene is added to the gene construct in order to identify cells or tissues that have successfully integrated the transgene. This is necessary because, achieving incorporation and expression of transgenes in plant cells is an event, occurring in just a few percent of the targeted tissues or cells. Selectable marker genes encode proteins that provide resistance to agents that are non-toxic to plants, such as an antibiotics or herbicides.

A suitable marker gene allows the preferential growth of transformed cells in the presence of the corresponding selective agent. Many antibiotics and herbicide genes are used as selectable markers. Selection efficiency depends on the size and developmental state of the plant cells, regeneration response and concentration of the selective agent.

Kanamycin resistance is the most widely used selection for higher plant transformation. The gene npt-II conferring resistance to the aminoglycoside antibiotics, such as kanamycin, was first established as useful dominant selectable marker for higher plants in 1983 (Bevan et al., 1983b; Fraley et al., 1983; Herrera-Estrella et al., 1983). Since then its usefulness has been demonstrated with a broad group of plants (Steinbiss and Davidson, 1989). Kanamycin resistance is conferred by transgenic expression of neomycin phosphotransferase, the product of the npt-II gene from the bacterial transposon Tn5. The enzyme neomycin phosphotransferase transfers a phosphate from ATP to the aminoglycoside and thereby inactivates it.

In the present experiment, construct under genetic transformation study were also containing npt-II along with the gene of interest viz., AtDREB1a and BcZAF12. In order to know the levels of kanamycin that suppress the untransformed explants/ calli growth, the experiment including 4 levels of kanamycin (mg/l) and calli containing hypocotyls was used. Hypocotyl explants which were incubated on callus induction media for 4 weeks were cultured on callus and proliferation media supplemented with different levels of kanamycin. The callus induction and proliferation was observed in all levels of kanamycin at different frequency except 100 mg/l. In this highest level of kanamycin there was no callus induction. Already induced calli and hypocotyl used were yellowing and there was no any further fresh callus induction from the explants at this level of kanamycin. Therefore, in the genetic transformation experiments, kanamycin at 100 mg/l was used.

5.2.4 Effect of pre-culture on callus induction after colonization/co-cultivation

Agrobacterium tumefacenise strains effectively used in genetic transformation studies in various crops as it transfer its T-DNA segment containing gene of interest into cells on which it colonize. T-DNA conatining gene of our interest integrate into gemone of cell, some nucleous express trasienter. For heritable and stable genetic transformation, integration of T-DNA segment containing gene of interest must integrate into the genome of a plant cell. The presence of active cell division stage during Agrobacterium co-cultivation may enhance the gene integration into genome of a plant cell. Therefore in the present study explants were pre-cultured for different durations on callus induction media before co-cultivation. At the time of co-cultivation there must be initiation of active cell division to induce callus from the cut end of hypocotyls. The experiment was also conducted to find out a pre-cultured duration which may help in obtaining more number of calli resistant to kanamycin after co-cultivation.

In the present study 48-72 hours of pre-culture of calli on fresh mediuam and fresh hypocotyl on callus induction media found to proliferate more calli in kanamycin (100 mg/l) supplemented media which was significantly higher than 0 and 24 hours of pre-culture in case of both the explants. It indicates that pre-culture of explants beyond 24 hours helps in stimulating in cell division which intern enhances gene integration. The advantage of pre-culture in terms of incerasing frequency of transfornation was reported by Liu et al. (1990), Rama (1997), Moralejo et al. (1998) and Leelavati et al. (2004).

5.2.5 Effect of vacuum infiltration on establishment of kanamycin resistant calli free of Agrobacterium

For effective colonization and co-cultivation of Agrobacterium on cell surface of explants or calli is a must for enhancing T-DNA transfer from Agrobacterium to plant cell nuclei. Colonization of Agrobacterium via vacuum infiltration was found to enhance frequency of genetic transformation in various crops (Ye et al., 1999, Tjokrokusumo et al., 2000, Song and Yamaguchi 2003, Ikram 2004, Leelavathi et al., 2004 and Peixoto de Oliveira et al., 2009), because of the reason that removing air from surface of explants and forcible infiltration of Agrobacterium into the tissues. So, an experiment was conducted to see the possibility of increasing emergence of kanamycin resistant calli after colonization through vacuum infiltration followed by co-cultivation. An experiment with and without vacuum infiltration followed by 48 hours of co-cultivation was carried out. Observation on calli induction and proliferation was recorded after 4 weeks of co-cultivation. Before taking observation, these explants were subcultured in callus induction and proliferation media containing cefotaxime (1000mg/l) and kanamycin (100 mg/l).

The number of calli proliferation in kanamycin supplemented media was on par in both the cases when they subjected to without and with vacuum infiltration for 30 minute colonization. So, colonization under vacuum was followed in further transformation studies.

5.2.6 Large scale genetic transformation studies in Coker-312

Based on the results of all the experiments on genetic transformation following mentioned protocol were applied for large scale genetic transformation in Coker-312.

Step 1: Preparation of hypocotyls: Hypocotyls (5-7mm) excised from aseptically grown 6-7 days old seedling of Coker-312 were used.

Step 2: Pre-culture of hypocotyls: Incubation of hypocotyls on callus induction (0.1 mg/l 2, 4-D + 0.5 mg/l kinetin) media for 48 hours at 2000 lux light intensity, 22±2

0C temperature with 80 % relative

humidity, 16 hour photoperiod.

Step 3: Colonization: Incubation of pre-cultured (48 hours) hypocotyls with Agrobacterium in vacuum for 30 minutes

Step 4: Co-cultivation: Incubation of Agrobacterium colonized hypocotyls in (0.1 mg/l 2, 4-D + 0.5 mg/l kinetin) media under dark for 48 hours with 22±2

0C temperature and 80 % relative humidity.

Step 5: Selection of kanamycin resistant calli and its proliferation: Incubation of co-cultivated hypocotyls after removing excess Agrobacterium from the explant by washing with cefotaxime (1000 mg/l) followed by incubation on MS media supplemented 0.1 mg/l 2, 4-D + 0.5 mg/l kinetin with cefotaxime (1000 mg/l) and kanamycin (100 mg/l) at 2000 lux light intensity, 22±2

0C temperature and

80 % relative humidity for 4-5 weeks with intermediate sub-culturing of different calli as independent events.

Step 6: Embryogenesis from kanamycin resistant calli: Incubation of kanamycin resistant light yellow to cream color friable calli on MS media supplemented with 0.01 mg/l 2, 4-D+ 0.1 mg/l kinetin at 2000 lux light intensity, 22±2

0C temperature with 80 % relative humidity and intermittent sub-culturing in

cefotaxime (1000 mg/l) and kanamycin (100 mg/l) for 5-6 weeks.

Step 7: Embryo maturation and germination to plantlets: Incubation of torpedo and cotyledonary stage embryos on MS media supplemented with cefotaxime (1000 mg/l) and kanamycin (100 mg/l) at 2000 lux light intensity, 22±2

0C temperature with 80 % relative humidity for 4 weeks.

Step 8: Hardening and establishment of plants: Incubation of putative transgenic plantlets on MS media for 4 weeks at 3000 lux light intensity, transplanting them in small plastic pots (8 x 5 cm) containing sterilized soil:peat mixture (1:1) and placing them in the plant growth chamber for 1 week at light intensity of 6000 lux with 65-70 % relative humidity and nourished with ½ strength MS basal media. After 1 week of incubation in growth chamber, putative plants were transferred to green house for proper establishment, at 10,000 lux light intensity with 26-30

0C and 35-40 % relative humidity.

Transformation events in the form of kanamycin-resistant callus growth were seen 3–4 weeks after transformation in both hypocotyls and cotyledons in the studies Sunilkumar and Rathore (2001). Callus lines, excised from explants, when cultured individually on kanamycin medium, all did not survive. Callus size had a strong influence on its survival. Calluses of smaller size (at the time of excision) had a strong influence on its survival. However, for a regular transformation experiment, it is impractical to wait for all the calluses on the explant to grow to a large enough size before excision in order to increase their chance of survival because this leads to the possible merging of two growing calluses. it is possible that some of the calluses died because either they were escapes or the nptII gene became silenced. The low survival rate of smaller size callus lines may be due to the requirement for certain critical cell density for continued independent growth after excision from the original explant. The situation is similar to the requirement of a critical minimum cell density reported for growth of cells or protoplasts (Nagata and Takebe 1971; Raveh et al. 1973). So it may be possible to minimize loss in cotton callus lines by using feeder cells during early stages of callus growth.

Sunilkumar and Rathore (2001) observed that 50 % callus excised from explant after 4-5 weeks of co-cultivation found GFP positive to indicate the callus that they found positive on kanamycin resistance, only 50 % of it was real transgenic and anther 50 % may be an escape. They also observed the death of about 41 % of callus in the next two month during the selection and proliferation phase. Of the surviving calluses, GFP expressing callus formed the larger (61) per centage compared to 23 for chimeria and 15 for non expression line.

In the present study 37.5% and 56 % calli proliferation observed in calli and hypocotyls respectively, were observed 3-4 weeks after co-cultivation. However, during subsequent subculture, under selection media, elimination of non transformed calli was observed. Non transformed calli had been observed becoming loose and brown after 4-5 subculture (12-14 weeks after co-cultivation). Only 1.66 % and 2 % proliferation of calli was observed for calli and hypocotyls respectively in AtDREB1a transcriptional factor.

33.33 % and 48 % calli proliferation observed in calli and hypocotyls respectively, were observed after 3-4 weeks after co-cultivation. However, during subsequent subculture under selection media elimination of non transformed calli was observed.

Non of the transformed calli had been observed becoming loose brown after 4-5 subculture (12-14 weeks after co-cultivation), only 0.41 % and 0.6 % proliferation of calli was observed for calli and hypocotyls respectively in BcZAF12 transcriptional factor.

In the present study it is demonstrated the possibilities of genetic transformation in Coker-312 to generate putative transgenic plants via somatic embryogenesis and regeneration.


The presence of genotype dependent somatic embryogenesis and regeneration is limiting factor in cotton. Because of this, each and every gene to be introduced in cotton should be first put into Coker followed by transferring into elite cotton cultivars through conventional breeding method like back cross breeding which ultimately take longer time.

Shoot apical meristem (SAM) of plants generates the whole green part of the plant body including the flowers. Thus it is very important tissue in the developmental biology of plants. In particular, the meristem is a tissue with very high regeneration potential.

Theoretically, the advantage of the shoot apex explant over other regeneration systems is that, plants may be obtained from any genotype rather than from only those that regenerate from callus culture.

To-date, meristem based methods have been used successful in Agrobacterium mediated transformation of petunia (Ulian et al., 1988), pea (Hussey et al., 1989), sunflower (Bidney et al., 1992), corn (Gould et al., 1991b), banana (May et al., 1995), tobacco (Zimmerman and Scorza, 1996), rice (Park et al., 1996), and cotton (Gould et al., 1991a; McCabe and Martinell, 1983; Zapata et al., 1999; Katageri et al., 2007; Sumithra et al., 2010a; Sumithra et al., 2010b; Sangannavar et al., 2011a; Sangannavar et al., 2011b).

The meristem is tiny structure and it is often confused with complete shoot apex which also contains leaf primordia and young leaves. The meristem as a tissue may represent a complete pattern of cells. Each of these cells may differ physiologically due to its unique position in the meristem (Joanna and Fleming, 2003).

Cell division pattern within the apical meristem of angiosperms is highly conserved leading to the classical definition of outer tunica layer (in which cell division is restricted to an anticlinal orientation) surrounding an inner corpus (in which cell division orientation is more common) (Steeves and Sussex, 1989). Despite this conservation of structure, the functional significance of tunica/corpus organization remains unclear.

As using SAMs as source of explant for genetic transformation followed by in vitro regeneration and establishment of plant takes longer time, use of SAMs existed on germinating seedling followed by establishment of plant ex vitro seems to be easy and less time consuming and cheaper. There were several studies (Rao et al., 2008; Keshamma et al., 2008) indicate the possibility of in plant transformation successfully.

The protocol adopted in the current study uses transformation of competent cells in the shoot apex of germinating seedlings through Agrobacterium mediated transformation and for plant driven regeneration. Mature seed is used because it is readily available and easily germinated when needed. Isolation and inoculation of shoots is followed by regeneration of normal fertile plants that flower and set viable seed.

Therefore, in the present investigation in planta genetic transformation was tried using AtDREB1a and BcZAF12 transcriptional factors and popular G. hirsutum variety Sahana.

From 140 germinating seedling used for genetic transformation with AtDREB1a gene, 24 T0 plants were established and produced seeds. Seeds harvested from those T0 plants were screened in transgenic green house with kanamycin and from seeds of 2 T0 plants harvested (considered as 2 independent events) produced totally 4 kanamycin resistant plants.

From 80 germinating seedling used for genetic transformation with BcZAF12 gene, 18 T0 plants were established and produced seeds. Seeds harvested from those T0 plants were screened in transgenic green house with kanamycin and from seeds of 2 T0 plants harvested (considered as 2 independent events) produced totally 4 kanamycin resistant plants.

5.4 GENE INTEGRATION AND EXPRESSION ANALYSIS

5.4.1 PCR amplification

In genetic transformation via somatic embryogenesis and regeneration, for AtDREB1a transcriptional factor totally ten putative transgenic plants were obtained and for BcZAF12 transcriptional factor 3 putative transgenic plants were obtained. In in planta genetic transformation only three got positive for npt-II and AtDREB1a specific gene for AtDREB1a construct and only three got positive for npt-II and BcZAF12 specific gene for BcZAF12 construct.

5.4.2 RT-PCR

RT-PCR for 2 plants each putative transgenic from in vitro and in planta genetic transformation were carried and found 2 and 2 from in vitro and in planta respectively for AtDREB1a and 2 and 1 from in vitro and in planta respectively for BcZAF12 transcriptional factor.

5.4.3 Dot Blot Analysis

Dot blot analysis for DNA-DNA hybridization was carried in in vitro transformation derived putative transgenic plants of AtDREB1a and BcZAF12 transcriptional factors and got positive signal.

5.5 FUTURE LINE OF WORK

• In the present study proliferation of non-transformed (escape) calli at very high frequency was observed as mentioned in the table 14. It seems, in increasing efficiency of protocol in selection of transformant calli, including reporter gene viz., GFP may reduce this problem. Therefore, inclusion of GFP may be more useful in genetic transformation studies as it is nondestructive method unlike GUS as reporter gene.

• Looking to the proliferation of calli resistant to kanamycin 5-6 sub-culture after co-cultivation (11-12 weeks) seems to be very low, therefore, efforts through some more experiments on increasing frequency of T-DNA transfer to cotton cells may be taken up.

• Using very virulent strain EHA-105, in genetic transformation, may increase efficiency. Actively dividing suspension culture of cotton may be used as explant to increase the frequency of genetic transformation. Different levels of acetosyringone may be tried to find out the level which enhances genetic transformation.

• Field level screening for drought resistance of these events may be taken up.

SUMMARY AND CONCLUSIONS

The present study entitled “Genetic transformation for drought resistance in cotton” was conducted with the two objectives viz., Standardization of the protocol for efficient somatic embryogenesis and plant regeneration in Coker-312 and genetic transformation studies using transcriptional factors, AtDREB1a and BcZAF12 genes for drought resistance.

All the experiments related to this study were conducted at Agricultural Research Station Dharwad farm, University of Agricultural Science, Dharwad.

6.1 regeneration via callus cultures in coker-312

As Coker-312 was the cotton genotype, used in many successful genetic transformation studies world wide including commercial transgenic Bt cottons because of its totipotential ability. Since many studies indicated the presence of genetic variability for in vitro regeneration in Coker-312, this experiment was first planned to develop efficient in vitro regeneration protocol in this laboratory before initiating actual transformation studies.

Coker-312 seeds available in germplasm pool of Gossypium hirsutum cotton maintained by Dr. I.S. Katageri, Principal Scientist (cotton) at ARS, Dharwad. Under this first study, four experiments were conducted.

6.1.1. Callus induction studies

Between hypocotyls and cotyledons as explants, callus induction rate (days taken for callus induction), callus induction response (callus induction on number explants and amount of callus produced) and nature of callus in combination with different plant growth regulators in MS media, use of hypocotyls was found more useful by culturing on MS medium supplemented with 0.1 mg/l 2, 4-D plus 0.5 or 1.0 mg/l kinetin.

Callus induction was early, high in response and callus was friable in nature, this friable callus is useful in formation of somatic embryogenesis. Production of such friable callus was took in about 8 weeks after culture of explants on this medium. For this experiment, cultures were incubated at 2000 lux light intensity with 80 % relative humidity at 16 hour photoperiod.

6.1.2 Somatic embryogenesis

An experiment was conducted by culturing light yellow to cream colored calli on various media. Emergence of torpedo or cotyledonary stage embryos was observed in 0.01 mg/l 2, 4-D plus 0.1 mg/l kinetin added to MS medium, 8-9 weeks after cultures of friable calli. Cultures were incubated at 2000 lux light intensity with 80 % relative humidity at 16 hour photoperiod.

6.1.3 Maturation and germination of embryos to produce seedlings

Torpedo or cotyledonary stage embryos were cultured on various media. Maturation of such embryos to produce normal plantlets with both shoots and roots was observed in MS salts only without any plant growth regulators, 4-5 weeks after incubation of such embryos at 2000 lux light intensity with 80 % relative humidity at 16 hour photoperiod condition.

6.1.4 Establishment of plants

Incubation of plantlets cultured on MS salts at high light intensity (3000 lux) and humidity (80%) for 4 weeks found beneficial in establishment of plants in ex vitro condition. Additionally after transplanting plantlets to soil and peat mixture (1:1), placing them in plant growth chamber at high light intensity (6000 lux) with relative humidity of 65-70 % for a week before shifting them to ex vitro condition was found most useful in establishment of more number of plants under ex vitro condition.


As stable and heritable genetic transformation through Agrobacterium tumefaciens mediated method depends on duration of colonization and co-cultivation, successful elimination Agrobacterium from cultures to establish contamination free healthy cultures to induce calli and successful screening of transformed calli followed by embryogenesis and regeneration.

Experiments conducted to develop a protocol for transformation are mentioned with conclusions. In vitro regeneration protocol that was developed in this study was successfully utilized in genetic transformation studies.

6.2.1 Effect of colonization and co-cultivation

In comparison, among different combinations of colonization and co-cultivation period using hypocotyl or calli as a source of explants, 30 minutes of colonization followed by 48 hours of co-cultivation was found effective in establishment of more number of calli on kanamycin screening.

Agrobacterium strain LBA-4404 harbouring AtDREB1a and BcZAF12 genes obtained from NRCPB, New Delhi under Indo-US collaborative research programme were used in this study.

6.2.2 Effect of cefotaxime inhibition of Agrobacterium

As cefotaxime antibiotic is effective in killing Agrobacterium, an experiment to find out concentration of cefotaxime on elimination of Agrobacterium during sub-culturing after co-cultivation to establish contamination free healthy culture was conducted. Among various concentrations of cefotaxime, 1000 mg/l was found effective in establishing contamination free cultures.

6.2.3 Effect of kanamycin as selection agent

For elimination of growth non transformed calli during screening, knowing concentration of kanamycin may prevent the growth of non-transformed calli was essential. Based on the experiment on effect of kanamycin on growth of non transformed calli, 100 mg/l kanamycin found effective in suppression of emergence of calli on surface of explant and proliferation of calli. Explant on calli was found becoming loose and brown at this concentration. Therefore, 100 mg/l kanamycin was included in further transformation studies.

6.2.4 Effect of pre-culture of explants before co-cultivation for successful induction kanamycin resistant calli after co-cultivation

Among different duration of pre-culture, hypocotyls on callus induction media, higher number of kanamycin resistant calli induction was observed in cultures of 48 hours pre-culturing.

6.2.5 Effect of vacuum infiltration on establishment of kanamycin resistant calli free of Agrobacterium

The number of kanamycin resistant calli free of Agrobacterium after 30 minutes of colonization followed with or without vacuum infiltration was on par. Colonization for 30 minutes under vacuum infiltration may further help in establishment of kanamycin resistant calli, so colonization under vacuum for 30 minutes was followed in large scale transformation studies later initiated in this study.

6.2.6 Large scale genetic transformation studies in Coker-312

Fresh hypocotyls and 2 months old calli pre-cultured for 48 hours was used in genetic transformation using AtDREB1a and BcZAF12 genes. Methods that were found effective in inducing kanamycin resistant calli were followed. Plants from 2 and 2 events for AtDREB1a and BcZAF12 respectively were found positive for gene integration based on PCR, RT-PCR and dot blot analysis.


As genetic transformation in needy genotype is most essential in eliminating back cross breeding step in transferring gene from transgenic genotype to non-transgenic genotype. There were few studies recorded the possibility of genotype independent genetic transformation via SAMs, in planta, pollen tube mediated genetic transformation etc. In the present study also, in planta method of genetic transformation using germinating seedlings was successfully adopted in Sahana. Plants positive of AtDREB1a and BcZAF12 genes were detected from 2 and 1 events respectively.

REFERENCES

Abdellatef, E. and Khalafallah, M. M., 2008, Influence of growth regulators on callus induction from hypocotyls of medium staple cotton (Gossypium hirsutum L). cultivar Barac B-67, J. Soil. Nature., 2 (1): 17-22.

Agarwal, P. K., Agarwal, P., Reddy, M. K. and Sopory, S. K., 2006, Role of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep, 25: 1263–1274.

Agrawal, D. C., Banerjee, R. R., Kolala, A. B., Dhage, A. V., Kulkarni, A. V., Nalawade, S.H. and Krishnamurthy, K.V., 1997, In vitro induction of multiple shoots and plant regeneration in cotton (Gossypium hirsutum L.). Plant Cell Rep., 16: 647-652.

Anitharani. and Bhojawani, S.S., 1976, Establishment of tissue culture in cotton. Plant Sci. Lett., 7: 163-169.

Anon., 2011, ISAAA Brief 43-2011: Executive Summary Global Status of Commercialized Biotech/GM Crops: 2011. Retrieved 24 September 2012.

Anon., 2012, All India co-ordinated cotton improvement project. Annual report 2011-12. www.cicr.org.in

Ashok kumar, Singh, P., Singh, D.P., Singh, H. and Sharma, H. C., 1984, Differences in osmoregulation in Brassica species, Annals of Botany 54: 537-541.

Balls, W. L., 1906, Studies in Egyptian cotton, in Year book khediv Agriculture Society, 1906. Cairo, Egypt, pp. 29-89.

Baottong, Z., Fang, L. and Chang, B. Y., 2000, plant regeneration via., Somatic Embryogenesis in cotton. Plant Cell Tiss. Organ. Cult., 60 (2): 89-94.

Bedner, T. W. and Bedner, E. M., 1971, Harmone autonomous growth of callus in tobacco. Proce. Natur. Acad. Sci., USA, 68: 1178.

Begg, J. E. and Turner, N. C., 1976, Crop water deficits. Adv Agron 28: 161-217.

Bevan, M., 1984, Binary Agrobacterium vectors for plant transformation. Nucleic Acid Res., 12: 52-55.

Bevan, M., Barnes, W. M. and Chilton, M. D., 1983a, Structures and transcription of nopaline synthase gene region of T-DNA. Nucleic Acids Res., 11: 369-385.

Bevan, M., Flavell, R. B. and Chilton, M. D., 1983b, A chimaeric antibiotic resistance gene as a selectable marker for plant cell transformation. Nature, 304:184-187.

Bidney, D., Scelonge, C., Martich, J., Burrus, M., Sims, L. and Huffman, G., 1992, Microprojectile bombardment of plant tissue increased transformation frequency by Agrobacterium tumefaciens. Plant Mol. Biol., 18: 301-313.

Birch, R.G., 1997, Plant transformation: problems and strategies for practical application. Plant Mol. Biol., 48: 297-326.

Bomal, C. and Tremblay, F. M. 1999, Effect of desiccation to low moisture content on germination, synchronization of root emergence, and plantlet regeneration of black spruce somatic embryos. Plant. Cell Tiss. Organ Cult. 56: 193–200.

Broer, I., Droge, Laser, W., Barkers, R.F., Neumann, K., Klipper, W. and Puhler., 1995, Identification of Agrobacterium tumefaciens C58 T-DNA genes c and f and their impact on crown gall tumor formation. Plant Mol. Biol., 27: 41-57.

Bunn, E., Dixon, K. W. and Langley, M. A., 1989, In vitro propagation of Lueucopagon obtectus Benth. Plant Cell Tissue Organ Cult. 19: 77-84.

Cao, X., Liu, Q., Rowland, I. J. and Hammerschung, F. R., 1998, Gus expression in blue berry, factors influencing Agrobacterium mediated gene transfer efficiency. Plant Cell Rep., 18: 266-270.

Carman, J. G., 1990, Embryogenic cells in plant tissue cultures: occurrence and behavior. In vitro Cell. Dev. Bio. 26: 746-753.

Cervera, M., Pina, J. A., Juarez, J., Navarro, L. and Pena, L., 1998, Agrobacterium mediated transformation of citrange: factors affecting transformation and regeneration. Plant Cell Rep., 18: 271-278.

Chawla, H.S., 2002, Introduction to plant biotechnology, 2nd

Edition, Science Publishers INC, New Hampshire, United States of America. 528 p.

Chee, P. P., Fober, K. A. and Slighton, J. L., 1989, Transformation of soybean (Glycine max) by infecting germinating seeds with Agrobacterium tumefaciens. Plant physiol., 91: 1212-1218.

Cheng, Z. X., Li, S. J. and Trolinder, N. L., 1987, Some characteristics of somatic embryogenesis and plant regeneration from callus suspension culture. Sci. Agri. Sin., 20: 6-11.

Chilton, M. D., Drummand, M. H., Merlo, D. T., Siacky, D., Mantoya, A. L., Gordan, M. P. and Mester, E. W., 1977, Stable incorporation of plasmid DNA into higher plant cells; The Molecular Basis of Crown Gall Tumurogenesis Cell, 11: 263-271.

Chinchane, B. N., Nandeshwar, S. B., Deshpande, L. A. and Chinchane, V. N., 2004, Agrobacterium mediated transformation and regeneration in Gossypium arboreum L. cotton (cv. PV-255). International Symposium on “Strategies for Sustainable Cotton Production- A Global Vision” 1. Crop Improv., pp.23-24.

Cousins, Y. L., Lyon, B. R. and Lleusellyn, T., 1992, Transformation of an Australian cotton cultivar. Prospects for cotton improvement through genetic engineering. Aust. J. Plant Physiol., 18: 481-494.

Datta, S. K., A. Peterhans, K. Datta, and Potrykus.I., 1990, Genetically engineered fertile indica-rice recovered from protoplast. Bio/Technology 8:736-740.

Davidonis, G. H. and Hamilton, R. H., 1983, Plant regeneration from callus tissue of Gossypium hirsutum L. Plant Sci. Lett., 32: 89-93.

Davis, D. G., Dusabaeck, K. E. and Hoerauf, R. A., 1974, In vitro culture of callus tissue and cell suspension from okra (Hibiscus esculantus L.) and cotton (Gossypium hirsutum L.) In vitro (Rockville), 9: 395-398.

Deb, C. R. and Imchen. T., 2010, An efficient in vitro hardening technique of tissue culture raised plants. Biotech., 9 (1): 79-83.

Dillen, W., Declercq, J., Kapila, J., Zambre, M., Van Mantagu, M. and Angerm, G., 1997, The effect of temperature on Agrobacterium tumefaciens mediated gene transfer to plants. Plant J., 12: 1459-1463.

Donaldson, P. A. and Simmonds, D. H., 2000, Susceptibility of Agrobacterium tumefaciens and cotyledonary node transformation in short season soybean. Plant Cell Rep., 19: 478-484.

Dongre, A. B., Gajbhiye, A. and Bhandarkar, M., 2004, Development of insect resistant cotton with indigenously synthesized cry 1Aa3 gene. In: Proceedings of International symposium on “Strategies for sustainable cotton production – A global vision” 23-25 Nov, 2004 held at UAS, Dharwad, p.475.

Edwards, K., Johnstone, C. and Thompson, C., 1991, A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acid Research, 19: 1349.

Emons, A. M. C. and Kieft, H., 1991, Histological comparison of single somatic embryos of maize from suspension culture with somatic embryos attached to callus cells. Plant Cell Rep., 10: 485-488.

Emons, A. M. C., 1994, Somatic embryogenesis: cell biological aspects. Acta Bot. Neerl., 43: 1-4.

Emons, A. M. C., Mulkler, M. M. and Kieft, H., 1993, pyrolysis mass of spectrometry of developmental stages of maize somatic embryos, Acta Bot. Neerl., 42: 319-339.

Feng, R., Zhang, B. H., Zhang, W. S. and Wang, Q. L., 1998, Genotype analysis in cotton tissue culture and plant regeneration. In P.J. Larkin (ed), Agricultural Biotechnology: Laboratory, Field and Market. Proc. 4th Asia-Pacific Conference on Agricultural Biotechnology, Darwin Canberra,13-16 July, UTC Publishing, p. 161-163.

Finer, J. J. and Mcmullen, M. D., 1990, Transformation of cotton (Gossypium hirsutum L.) via particle bombardment. Plant Cell Rep., 8: 886-889.

Finer, J. J., 1988, Plant regeneration from somatic embryogenic suspension cultures of cotton (Gossypium hirsutum L.). Plant Cell Rep., 7: 399-402.

Finer, J. J. and Smith, R. H., 1984, Initiation of callus and somatic embryos from explants of mature cotton (Gossypium Klotzschianum Andress L.). Plant Cell Rep., 3(1): 41-43.

Firoozabady, E. and DeBoer, D. L., 1993, Plant regeneration via somatic embryogenesis in many cultivars of cotton (Gossypium hirsutum L.). In Vitro Cell Dev. Biol. 29: 166–173.

Firoozabady, E., Deboer, D. L., Merlo, D. J., Halk, E. L., Amerson, L. N., Rashka, A. E. and Murray, E. E., 1987, Transformation of cotton (Gossypium hirsutum L.) by Agrobacterium tumefaciens and regeneration of transgenic plants. Plant Mol. Biol., 10: 105-116.

Flower, D. J. and Ludlow, M. M., 1986, Contribution of osmotic adjustment to the dehydration tolerance of water stressed pigeonpea (Canjanus cajan L.) leaves, Plant cell and environment, 9: 33-40.

Fraley, R. T., Rogers, S. G. and Horsch, R. B., 1983, Expression of bacterial genes in plant cells. Proc. of Nation. Acad. of Sci., United States of America, 80: 4803-4807.

Fredrick, J. R., Randy, W. D., Tony, A. A., Roy, L. F., Stewin, R. S., Hohnson, T. and Gand Davis, A. F., 1990, Insect resistant cotton plant. Biotechnology, 11: 1151-1156.

Fromm, M. C., Taylor, L. P. and Walbot, V., 1985, Expression of genes transferred into monocot and dicot plant cell by electroporation. Proc. Natl. Acad. Sci. USA, 82: 5824-5828.

Gamborg, O. L., Miller, R. A. and Ojima, K., 1966, Nutrient requirements of suspension cultures of soybean root cells. Experiment Cell Res., 50: 151-158.

Gautheret, R. J., 1955, The nutrition of plant tissue cultures. Ann. Rev. Plant Physiol., 6: 433- 484.

Gawel, N. J., and Robacker, C. D., 1990. Somatic embryogenesis in two Gossypium hirsutum genotypes on semi-solid versus liquid proliferation media. Plant Cell Tiss. Org. Cult. 23: 201–204.

Gawel, N. J., Rao, A. P. and Robacher, C.D., 1986, Somatic embryogenesis from leaf and petiole callus cultures of G. hirsutum L. Plant Cell Rep., 5: 457-459.

Geetha, N., Venkatachalam, P. and Lakshmi Seta, 1999, Agrobacterium mediated genetic transformation of pigeonpea (Cajanus cajan L.) and development of transgenic plants via direct organogenesis. Plant Biotech., 16: 213-218.

George, E. F, Hall, M. A. and De Klerk, G. J., 2008, Plant Propagation by Tissue Culture 3rd Edition, Vol. 1. Springer, Dordrecht, The Netherlands. 501 p.

Gingas, V. M. and Lineberger, R. D., 1988, plantlet regeneration from asexual embryos of Quercus rubra L. Hort Science, 23: 786.

Gould, J. and Maria Magallenes Cedeno, 1998, Adaptation of cotton shot apex to Agrobacterium mediated transformation. Plant Mol. Boil. Rep., 16: 1-10.

Gould, J., Banister, S., Hasegawa, O., Fahima, M. and Simth, R.H., 1991b, Regeneration of Gossypium hirsutum and Gossypium barbadense from shoot apex tissue for transformation. Plant Cell Rep., 10: 12-16.

Gould, J., Devey, M., Ulian, E. C., Hasegawa, O., Peterson, G. and Smith, G, H., 1991a, Transformation of Zea mays L. using Agrobacterium tumefaciens and the shoot apex. Plant Physiol., 95: 426-434.

Guo, J. C. and Yuan, F. H., 1994, Studies on Plant regeneration from somatic cells and transfer technique for plantlets of upland cotton. Acta Agronomica Sinica, 20: 210-240.

Guo, X., Huang, C., Jin, S., Nie, Y. and Zhang, X., 2007, Agrobacterium mediated transformation of Cry 1C, Cry 2A and Cry 9C genes into Gossypium hirsutum and plant regeneration. Biol. Planta., 51: 242-248.

Gynheung, W.S., 1985, High efficiency transformation of cultured tobacco cells. Plant Physiol., 79: 568-570.

Haake, V., Cook, D., Riechmann, J. L., Pineda, O., Thomashow, M. F. and Zhang, J. Z., 2002, Transcription factor CBF4 is a regulator of drought adaptation in Arabidopsis. Plant Physiol. 130; 639-648.

Han, G. Y., Wang, X. F., Zhang, G. Y. and Ma, Z. Y., 2009, Somatic embryogenesis and plant regeneration of recalcitrant cottons (Gossypium hirsutum), African J. of Biotech., 8 (3), pp. 432-437.

Hemphill, J. K, Maier, C. G. A. and Chapman, K. D., 1998, Rapid in vitro plant regeneration of cotton. Plant Cell Rep., 17: 273-278.

Herrera, Estrella, Depicker, A., Van Montagu, M. and Schulj, 1983, Nature 303, 2 1-213. Embo, J., 2: 987-995.

Hilerbrandt, A.C., 1962, Tissue and single cell culture of higher plants as a basic experimental method. Moderne Methoden der Pflanzenanalyse 5: 383-421.

Hiren, A. P., Saurabh, R. M. and Subramanian, R.B., 2004, in vitro regeneration in Curculigo orchioides Gaertn. An endangered medicinal herb. Phytomorphology, 54: 85-95.

Hobbs, S. L. A., Warkentin, T. D. and Delong, C. M. O., 1993, Transgene copy number can be positively or negatively associated with transgene expression. Plant Mol. Biol., 21: 17-26.

Horsch, R., Fry, J., Hoffman, N., Wallroth, M., Ekhholtz, D., Rogers, S. and Fraley, R., 1985, A single and general method for transferring genes into plants. Sci., 227: 1229-1231.

Hsiao T C., 1973, Plant responses to water stress. Annu Rev Plant Physiol., 24: 519- 570.

Hsieh, H. T., Jent. Turn Lee., Pei Tzu Yang, Li Hui Chiu, Yee yung Charng, Yu Chie Wang, and Ming Tsair Chan, 2002, Heterology Expression of the Arabidopsis C-Repeat/Dehydration Response Element Binding Factor 1 Gene Confers Elevated Tolerance to Chilling and Oxidative Stresses in Transgenic Tomato, Plant Physiol., 129: 1–9.

Hussey, G., Johnson, R. D. and Warren, S., 1989, Transformation of meristematic cells in the shoot apex of cultured pea shoots by A. tumefaciens and A. rhizogenes. Protoplasma, 148: 101-105.

Ikram-Ul-Haq 2005, Callus proliferation and somatic embryogenesis in cotton (Gossypium hirsutum L.), African J. of Biotech., 4 (2):206-209.

Ikram-Ul-Haq and Ysusuf Zafar 2004, Effect of nitrates on embryo induction efficiency in cotton (Gossypium hirsutum L.), African J. of Biotech., 3 (6): 319-323.

Ikram-Ul-Haq, 2004, Agrobacterium mediated transformation of cotton via vacuum infiltration. Plant Mol. Biol. Rep., 22: 279-288.

Iradparah, M. and Khosh, K.M., 1989, Comparisons of in vitro propagation of tomato cultivars. Iran Agri. Res., 8: 37-47.

Ito, Y., Katsura, K., Maruyama, K., Taji, T., Kobayashi, M., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki, K., 2006, Functional analysis of rice DREB1/CBF-type transcription factors involved in cold-responsive gene expression in transgenic rice. Plant Cell Physiol, 47:141–153.

Jaglo, K. R., Kleff, S., Amundsen, K. L., Zhang, X., Haake, V., Zhang, J. Z., Deits, T. and Thomashow, M. F., 2001, Components of the Arabidopsis C-repeat/dehydration-responsive element binding factor cold response pathway are conserved in Brassica napus and other plant species. Plant Physiol, 127:910–917.

Jaglo-Ottosen, K. R., Gilmour, S. J., Zarka, D. G., Schabenberger, O. and Thomashow, M. F., 1998, Arabidopsis CBF1 over expression induces COR genes and enhances freezing tolerance. Science, 280: 104-106.

Jin, S., Zhang, X., Nie. Y., Guo, X., Liang, S. and Zhu, H., 2006, Identification of a novel elite genotype for in vitro culture and genetic transformation of cotton, Biologia Plantarum., 50 (4): 519-524.

Joanna, W. and Fleming, A., 2003, Cell division pattern influences gene expression in the shoot apical meristem. Proc. of the Nation. Acad. of Sci., 100 (9): 5561-5566.

Jorge L. Morre, Hugo R. Permingeat, Maria V. Romagnoli, Cintia M. Heisterborg and Ruben H. Vallejos., 1998, Multiple shoot induction and plant regeneration from embryonic axes of cotton. Plant Cell Tiss. Organ Cul., 54: 131–136.

Karen skriver and John Mundy., 1990, Gene expression in response to Abscisic acid and osmotic stress. The Plant cell, 2: 503-512.

Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K. and Shinozaki K., 1999, Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat Biotechnol., 17: 287–291.

Katageri, I. S. and Khadi, B. M., 1998, Somatic embryogenesis in cultivated cotton (Gossypium Spp.) cotton. J. Indian Soc. Cotton Improve., 23: 184-191.

Katageri, I. S., Khadi, B. M. and Vamadevaiah, H. M., 1998, Callus induction and maintenance in diploid cotton. J. Indian Soc. Cotton improv. 23: 25-31.

Katageri, I. S., Vamadevaiah, H. M., Udikeri, S. S., Khadi, B. M. and Kumar, P. A., 2007, Genetic transformation of an elite Indian genotype of cotton (Gossypium hirsutum L.) for insect resistance. Current Sci., 93(12): 1843-1847.

Katterman, F. R. H., Williams, M. D. and Clay, W. F., 1977, The influence of a strong reducing agent upon the initiation of callus from the germinating seedlings of Gossypium barbadense. Physiologia Plantarum, 40: 99-100.

Kav, Nataraj N., Srivastava, Sanjeeva. and Shah, Salehuzzaman., 2008, Method of conferring multiple stress tolerance and early flowering in plants. http://www.freepatentsonline.com/y2008/0005810.htm

Kavi Kishore, P. B. and Reddy, G. M., 1986, Regeneration of plants from long term cultures of Oryza sativa L. Plant Cell Rep., 5: 391-393.

Kazuko, Y. S. and Kazuko, S., 1994, A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high salt stress. Plant Cell 6: 251–264.

Keshamma, E., Rohini, S., Rao, K. S., Madhusudhan, B. and Udayakumar, M., 2008, Tissue culture independent in planta transformation strategy: an Agrobacterium tumefaciens mediated gene transfer method to over come recalcitrance in cotton (Gossypium hirsutum), The J. of cotton science., 12: 264-272.

Khan, T. K., Tanveer, Singh, Singh, A. K. and Anil, K., 2006, Regeneration via somatic embryogenesis and organogenesis in different cultivars of cotton (Gossypium spp.). In Vitro Cell. and Develop. Biol., 12: 26-29.

Khushwindar, S., Brar, B. S., Sandhu, and Gosal, S. S., 1998, Tissue culture response of cultivated and wild cotton species. Crop Improve., 25 (1): 59-65.

Klein, T. M., Wolf, E. D., Wu, R. and Sandord, J. C., 1987, High-velocity microprojectiles for delivering nucleic acids into living cells. Nature 327:70-73.

Knight, H. and Knight, M. R., 2001, Abiotic stress signaling pathways: specificity and cross-talk. Trends Plant Sci 6:262–267.

Kolganova, T. V., Srivastava, D. K. and Mett, V. L., 1992, Callogenesis and regeneration of cotton (Gossypium hirsutum L.). Plant Physiol., 39: 232-236.

Kouadio, Y. J., Kouakou, T. H., Kone, M., Zouzou, M. and Annoa, P., 2007, Optimum conditions for nitrate reductase extraction and activity measurement. Afric J Biotechnol 6: 923-928.

Kouakou, T. H., 2003, Contribution a letude de lembryogenèse somatique chez le cotonnier : evolution de quelques parametres biochimiques au cours de la callogenese et de la culture de suspension cellulaires. These de doctorat N° 023/2003, Université de Cocody, Abidjan, Côte d’Ivoire

Kouakou, T. H., Waffo, T. P., Kouadio, Y. J., Valls, J., Tristan, R., Decendit, A. and Merillon, J. M., 2007, Phenolic compounds and somatic embryogenesis in cotton (Gossypium hirsutum L.) Plant Cell Tiss Org Cult 90: 25–29.

Kramer, P. J., 1980, Drought, stress, and the origin of adaptations. In NC Turner, PJ Kramer, eds, Adaptation of Plants to Water and High Temperature Stress. John Wiley and Sons, New York, pp 7-20.

Krishnamurthy, K. V., Suhasini, K., Sagare, M. M., Kathen, A. De, Pickard, T. and Schieder, O., 2000, Agrobacterium mediated transformation of chickpea (Cicer arietinum L.) embryo axes. Plant Cell Rep., 19: 235-240.

Kulkarni, M., 1997, In vitro plant morphogenesis in chillies (Capsicum annuum L.). M. Sc. (Agri.) Thesis, University of Agricultural Sciences, Dharwad.

Kumar, S., Sharma, P. and Pental, D., 1998, A genetic approach to in vitro regeneration of non-regenerating cotton (Gossypium hirsutum L.) cultivars. Plant Cell Rep., 18(1): 59-63.

Lashari, Muhammad Ismail., Muhammad Arshad, Yusuf Zafar and Shaheen Asad., 2008, Optimization of zeatin and explant types for efficient embryogenesis and plant regeneration of diploid cotton (Gossypium arboreum l.), J. Agric. Res., 46(1): 1-13.

Last, D. I. and Brettell, I. S., 1990, Embryo yield in wheat anther culture is influenced by the choice of sugar in the culture medium. Plant Cell Rep., 9: 14-16.

Lavanya, M., B., Venkateshwarlu. and Devi, B. P., 2009, Acclimatization of neem microshoots adaptable to semi-sterile conditions. Indian J. Biotechnol., 8: 218-222.

Lee, S.C., Kim, S.H., An, S.H., Yi, S.Y. and Hwang, B.K., 2006, Identification and functional expression of the pepper pathogen-induced gene, CAPIP2, involved in disease resistance and drought and salt stress tolerance. Plant Mol Biol 62: 151–164.

Lee. H. J., Yanofsky, M. and Nester, E. W., 1985, Vectors for transformation of higher plants. Biotechnology, 3: 637-642.

Leelavathi, S., Sunnichan, V. G., Kumria, R., Vijaykanth, G. P., Bhatnagar, R. K. and Reddy, V. S., 2004, A simple and rapid Agrobacterium mediated transformation protocol for cotton (Gossypium hirsutum L.): embryogenic calli as a source to generate large no. of transgenic plants. Plant Cell Rep., 22: 465-470.

Li, F. F., Wu, S. J., Chen, T. Z., Zhang, J., Wang, H. H., Guo, W. Z. and Zhang, T. Z., 2009, Agrobacterium-mediated co-transformation of multiple genes in upland cotton, Plant cell Tiss. Organ cult., 97: 225-235.

Li, Y. L., Weu, L. Y., Guo, X. M., Li, E. L. and Shi, C. M., 1989, Study on regeneration of cotton plants through somatic culture. China Cottons., 6: 13-15.

Lin, M. and Staba, 1961, Peppermint and spearmint tissue cultures. I. Callus formation and submerged culture. Lloydia (Cincinnati), 24: 139-145.

Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki, K. and Shinozaki, K., 1998, Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain, separate two cellular signal transduction pathways in drought and low temperature-responsive gene expression respectively in Arabidopsis. Plant Cell 10:1391–1406.

Liu, W., Parroti, W. A., Hildebrandt, D. F., Collins, G. B. and Williams, E. G., 1990, Agrobacterium induced gall formation in bell pepper (Capsicum annuum L.) and formation of shoot like structures expressing introduced genes. Plant Cell Rep., 9: 360-364.

Liu, W., Hildebrand, D. F., Moore, P. J. and Collins, G. B. 1994, Expression of desiccation-induced and lipoxygenase genes during the transition from the maturation to the germination phases in soybean somatic embryos. Planta 194: 69–76.

Liu, Y., Chen, H., Zhuang, D., Jiang, D., Liu, J., Wu, G., Yang, M. and Shen, S., 2010, Characterization of a dre-binding transcription factor from asparagus (Asparagus officinalis l.) and its over expression in Arabidopsis resulting in salt- and drought-resistant transgenic plants, Int. J. Plant Sci. 171(1):12–23.

Loomis, W. D. and Battaile, J., 1966, Plant phenolic compounds and the isolation of plant enzymes, Phytochemistry, 5: 423-428.

Lyer, V. N., Klee, H. J. and Nester, E. W., 1982, Units of genetic expression in the virulence region of a plant tumor inducing plasmid of Agrobacterium tumefaciens. Mol. Gen. Genet. 188: 418-424.

Mahalakhmi, A. and Kurana, P., 1997, Agrobacterium mediated cereal transformation: A critical appraisal. Indian J. of Exp. Biol., 35: 416-426.

Manoharan, M., Sree Vidya, C.S. and Lakshmi, Sita, G., 1998, Agrobacterium mediated genetic transformation in hot chilli (Capsicum annuum L. var Pusa Jwala). Plant Sci., 131: 77-83.

Maqbool, S. B., Zhong, H., El-Maghraby, Y., Ahmad, A., Chai, B., Wang, W., Sabzikar, R. and Sticklen, M. B., 2002, Competence of oat (Avena sativa L.) shoot apical meristems for integrative transformation, inherited expression, and osmotic tolerance of transgenic lines containing hva1. Theor. Appl. Gene., 105: 201–208.

May, C. D., Afza, R., Mason, H. S., Wiecko, A., Novak, F. J. and Arntzen, C., 1995, Generation of transgenic banana (Musa accuminata) plants via Agrobacterium mediated transformation. Biotech., 13: 486-492.

McCabe, D. E. and Martinell, B. J., 1983, Transformation of elite cotton cultivars via particle bombardment of meristems. Biotech., 11: 596-598.

Medford, J. I., 1992, Vegetative apical meristems. Plant Cell, 4: 1029-1039.

Meng, Z. H., Liang, A. H. and Yang, W. C., 2007, Effects of hygromycin on cotton cultures and its application in Agrobacterium-mediated cotton transformation. In vitro cell. Dev. Biol.-Plant., 43: 111-118.

Michel, Z, Hilaire, K. T, Mongomake, K, Georges, A. N. and Justin, K.Y., 2008, Effect of genotype, explants, growth regulators and sugars on callus induction in cotton (Gossypium hirsutum L.). Australian J. of Crop Sci., 2: 1-9.

Mishra, R., Wang, H. Y., Yadav, N. R. and Wilkins, T. A., 2003, Development of a highly regenerable elite Acala cotton (Gossypium hirsutum cv. Maxxa)-a step towards genotype-independent regeneration, Plant cell Tiss. Organ Cult., 73: 21-35.

Mohanty, A., Sarma, N. P. and Tyagi, A. K., 1999, Agrobacterium mediated high frequency transformation of an elite indica rice variety Pusa Basmati 1 and transmission of the transgenes to R 2 progeny. Plant Sci., 147 (2): 127-137.

Momtaz, O. A., Diab, A. A., Abushady, M. R. and Madkour, M. A., 1998, Transformation of Egyptian cotton tissue (Gossypium barbadense L.) using Agrobacterium tumefaciens. Proc. World Cotton Res. Conf.–2. Athens, Greece, September 6-12: 314-319.

Moralejo, M., Rochange, F., Boudet, A.M. and Teulieres, C., 1998, Generation of transgenic Eucalyptus globulus plant lets through Agrobacterium tumefaciens mediated transformation. Austra. J. of Plant Physiol., 25: 207-212.

Morgan, J. M., 1983, Osmoregulation as a selection criterion for drought tolerance in wheat, Aust. J. Agric. Res., 34: 607-614.

Morgan, J. M., Hare, R. A. and Fletcher, R. J., 1986, Genetic variation in osmoregulation in Bread and Durum Wheats and its relationship to grain yield in a range of field environments, Aust. J. Agric. Res., 37:449-457.

Morgan, P. W. and Hall, W. C., 1963, Idole acetic acid oxidizing enzyme and inhibitors from light grown cotton. Plant Physiol., 38: 365-370.

Morgan. J. M., 1988, The use of coleoptile responses to water stress to differentiate wheat genotypes for osmoregulation, growth and yield. Annals of Botany., 62: 193-198.

Murashige, T. and Skoog, F., 1962, A revised medium for rapid growth and bioassay with tobacco tissue culture. Physiol. Plant., 15: 473-497.

Muthukumar, Mariamma, M., Veluthambi, K. and Gnanam, A., 1996, Genetic transformation of cotyledon explants of cowpea (Vigna unguiculata L. Warp) using Agrobacterium tumefaciens. Plant Cell Rep., 15: 980-985.

Muthuswamy, A., Vasanth, K. and Jayabalan, N., 2004, In vitro regeneration of cotton plants from shoot tip explants: a simple and alternative method. Plant Cell Biotechnol. and Molecul. Biology. 5 (1): 15-20.

Nagaraj Basavaraddi, Savita Mantri., Vamadevaiah, H. M., Khadi, B.M. and Katageri, I. S., 2012, Screening Coker-312 for in vitro regeneration, Cotton Res. J., 3(1): 51-71.

Nagata, T. and Tabake, I., 1971, Planting of isolated tobacco mesophyll protoplast on agar medium. Plant, 99: 12-20.

Nandeshwar, S. B., Moghe, S., Chakrabarty, P. K.., Deshattiwar, M. K., Kranthi, K., Anandkumar, P., Mayee, C. D. and Khadi, B. M., 2009, Agrobacterium-Mediated Transformation of cry1Ac Gene into Shoot tip Meristem of Diploid Cotton Gossypium arboreum cv. RG8 and Regeneration of Transgenic Plants, Plant Mol. Bio. Rep., DOI 10.1007/s11105-009-0102-7

Nobre, J., Keith, D. J. and Dunwell, J. M., 2001, Morphogenesis and regeneration from stomatal guard cell complexes of cotton (Gossypium hirsutum L.). Plant Cell Rep 20: 8–15.

Nomura, K. and Koumamime, A., 1995, Physiological and biochemical aspect of somatic embryogenesis. Curr Plant Biotech Agri., 20 (7): 249-265.

Oh, S. J., Song, S. I., Kim, Y. S., Jang, H. J., Kim, S. Y., Kim, M., Kim, Y. K., Nahm, B. H. and Kim, J. K., 2005, Arabidopsis CBF3/DREB1A and ABF3 in transgenic rice increased tolerance to abiotic stress without stunting growth. Plant Physiol. 138: 341-351.

Ouma, J. P., Young, M. M. and Reichert, N. A., 2004, Optimization of in vitro regeneration of multiple shoots from hypocotyl sections of cotton (Gossypium hirsutum L.). African J. Biotech., 3 (3): 169-173.

Pannetier, C., Giband, M., Couzi, P., Le Tan, V., Maizier, M., Tourneur, J. and Hau. B., 1997, Introduction of new traits into Cotton through genetic engineering: insect resistance as example. Euphytica, 96: 163-166.

Park, S. H., Pinson, S. R. M. and Smith, R. H., 1996, T-DNA integration into genomic DNA of rice following Agrobacterium inoculation of isolated shoot apices. Plant Mol. Biol., 32: 1135-1148.

Parrott, W. A., Dryden, G., Vogt, S., Hildebrandt, D. F., Collin, G. B. and Williams, E.G., 1998, Optimization of somatic embryogenesis and embryo germination in soyabean. In Vitro Cell Dev. Biol., 24: 817-820.

Peixoto de Oliveira, M. L., Febres, V. J., Costa, M. G. C., Moore, G. A. and Otoni, W. C., 2009, High efficiency Agrobacterium mediated transformation of citrus via sonication and vacuum infiltration. Plant cell Rep., 28: 387-395.

Percival, E. and Kohel, R.J., 1990, Distribution collection and evaluation of Gossypium. Adv. Agron., 44: 225-228.

Polizel, A. M., Medri, M. E., Nakashima, K., Yamanaka, N., Farias, J. R. B., de Oliveira, M. C. N., Marin, S. R. R., Abdelnoor, R. V., Marcelino-Guimaraes, F. C., Fuganti, R., Rodrigues, F. A., Stolf-Moreira, R., Beneventi, M. A., Rolla, A. A. P., Neumaier, N., Yamaguchi. S. K., Carvalho, J. F. C. and Nepomuceno, A. L., 2011, Molecular, anatomical and physiological properties of a genetically modified soybean line transformed with rd29A:AtDREB1a for the improvement of drought tolerance, Genetics and Molecular Research (2011) under publication.

Pomeroy, K. Brown, D. C. W. and Takahata, Y., 1994, Response of Brassica napus L. microspore-derived embryos to exogenous abscisic acid and desiccation. In Vitro Cell. Dev. Biol. Plant 30:196-203.

Popelka, J.C. and Fredy, A., 2004, Agrobacterium tumefaciens-mediated genetic transformation of rye (Secale cereale L.). Mol. Breed., 11(3): 203-211.

Potrykus, I., 1990, Gene transfer to cereals. An assessment. Biotech. 8: 535-542.

Price, H. J. and Smith, R. H., 1979, Somatic embryogenesis in suspension cultures of Gossypium klotzschianum Anderss. Planta 145:305–307.

Price, H. J., Smith, R. H. and Grumbles, R. M., 1977, Callus culture of six species of cotton (Gossypium Spp. L.) on defined media. Plant Science Letters, 10: 115-119.

Rama, N., 1997, Standardization of protocols for Agrobacterium-mediated gene transfer in chilli (Capsicum annuum L.). M. Sc. (Agri.) Thesis University of Agricultural Sciences, Bangalore.

Rao, Abdul Qayyum, Hussain S. Sarfraz, Shahzad M. Saqib, Bokhari S. Yassir Abbas., Raza M. Hashim, Rakha Allah, Majeed A., Shahid A. Ali, Saleem Zafar, Husnain Tayyab. and Riazuddin S. 2006, Somatic embryogenesis in wild relatives of cotton (Gossypium Spp.), J. Zhejiang Univ. Sci. B, 7(4): 291-298.

Rao, S. K., Sreevathsa, R., Sharma, P. D., Keshamma, E. and Udaya Kumar, M., 2008, In planta transformation of pigeon pea: a method to overcome recalcitrance of the crop to regeneration in vitro. Physiol. Mol. Biol. Plants. 14(4): 321-328.

Richter, G., 1993, Les glucides. In: Presse Polytechnique et Universitaire Romande (eds) Métabolisme des vegetaux, Physiologie et Biochimie, chap. IV, Paris, France, pp.189-220.

Saeed, N. A., Zafar, Y. and Malik, K. A., 1997, A simple procedure of Gossypium meristem shoot tip culture. Organ Cult., 51: 201–207.

Saeed, R., Hafeez-ur-Rahman and Khan, T. M., 2004, Effect of kinetin on multiple shoot induction in cotton (Gossypium hirsutum L.) cv. NIAB-999. Iranian J. Biotech., 2(4): 279-282.

Sakhanokho, H. M, Allan, Z. F, Rajasekaran, K., Saha, S. and Sharma, G. C., 2001, Induction of highly embryogenic calli and plant regeneration in Upland (Gossypium hirsutum L.) and Pima (Gossypium barbadense L.) Cottons. Crop. Sci. 41: 1235-1240.

Sakhanokho, H., Zipf, A., Rajasekaran, K., Saha, S., Sharma, G.C. and Chee, P.W., 2004, Somatic embryo initiation and germination in diploid cotton (Gossypium arboreum l.), In Vitro Cell. Dev. Biol.-Plant 40:177–181.

Sakhanokho, H. F., S. Saha, G. C. Sharma, A. Zipf, and K. Rajasekaran., 1998, Tissue culture potential of diverse diploid and tetraploid cotton genotypes. p. 590–593. In 1998 Proc. Beltwide Cotton Conf., San Diego, CA. 5–9 Jan. 1998. National Cotton Council, Memphis, TN

Sambrook, J., Fritsch, E. F. and Maniatist, T., 1989, Molecular cloning: A laboratory manual. 2nd

edition Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Sangannavar, P. A., Katageri, I. S., Vamadevaiah, H. M., Nirupama chikodi., Khadi, B. M. and Anand Kumar, P., 2011a, Genetic transformation studies in cotton: a) Effect of pre-culture, colonization, co-cultivation and vacuum infiltration on regeneration of explants b) Effect of trimming, chilling injury, sand injury and blot drying on regeneration of explants, Cotton Res. J., 2 (1): 21-32.

Sangannavar, P. A., Katageri, I. S., Vamadevaiah, H. M. and Khadi, B. M., 2011b, Effect of external damage on regeneration of cotton explants (Gossypium arboreum and G. barbadense), Karnataka J. Agric. Sci., 24 (5): 629-632.

Satyavathi, V. V., Prasad, V., Gita Lakshmi, B. and Lakshmi Sita, G., 2002, High efficiency transformation protocol for three Indian cotton varieties via Agrobacterium tumefaciens. Plant Sci., 162: 215-223.

Sautter, C., Leduc, N., Bilang, R., Iglesiass, V., Pisel. A., Wen, X. and Potrykus, I., 1995, Shoot apical meristems as a target for gene transfer by microballistics. Euphytica, 85: 45-51.

Sehenk, R.U. and Hildebrandt, A.C., 1972, Medium and techniques for induction and growth of monocotyledons and dicotyledons plant cell cultures. Canadian J. Botany, 50: 199-204.

Seki, M., Kamei, A., Yamaguchi-Shinozaki, K. and Shinozaki, K., 2003, Molecular responses to drought, salinity and frost: common and different paths for plant protection. Curr Opin Biotechnol, 14:194–199.

She, J. M., Wu, J. Y., Wang, H. B., Zhou, H. Y., Chen, Z. X., Li, S. J. and Yue, J. X., 1989, Somatic embryogenesis and plant regeneration from protoplasts culture of cotton (Gossypium hirsutum). Jiangsu J. Agric. Sci., 5: 54-60.

Shi-Qing Gao., Ming Chen., Lian-Qin Xia., Hui-Jun Xiu., Zhao-Shi Xu., Lian-Cheng Li., Chang-Ping Zhao., Xian-Guo Cheng. and You-Zhi Ma., 2009, A cotton (Gossypium hirsutum) DRE-binding transcription factor gene, GhDREB, confers enhanced tolerance to drought, high salt, and freezing stresses in transgenic wheat. Plant Cell Rep, 28:301–311.

Shoemaker, R. C., Couche, L. J. and Galbraith, D. W., 1986, Characterization of somatic embryogenesis and plant regeneration in cotton (G. hirsutum). Plant Cell Rep., 3: 178-181.

Shuangxia Jin, Xianlong Zhang, Shaoguang Liang, Yichun Nie, Xiaoping Guo. and Chao Huang, 2005, Factors affecting transformation efficiency of embryogenic callus of upland cotton with Agrobacterium tumefaciens. Plant Cell Tissue Organ Cult., 81: 229-2237.

Smith, R. H., Price, H. J. and Thaxton, J. R., 1977, Defined conditions for the initiation and growth of cotton callus in vitro. I. Gossypium arboreum. In Vitro 13:329–334.

Smith, R. H. and Elizabeth, E. H., 1995, Agrobacterium tumefaciens transformation of monocotyledons. Crop Sci. 35(2): 301-309.

Song, G. and Yamaguchi, K., 2003, Efficient Agroinfiltration-mediated transient expression system of assaying different parameters in rice. Plant Biotechnol 20: 235-239.

Srivastiav, D. K., Kolganva, T. V., Mett, V. L. and Piruzion, E. S., 1991, Genetic transformation of Gossypium hirsutum L. Plant Biotech., 289: 263-264.

Stachel, S. E. and Nester, E. W., 1986, The genetic and transcriptional organization of the vir region of the A6T plasmid of Agrobacterium tumefaciens. Embo. J., 4: 891-898.

Steeves, T. A. and Sussex, T. M., 1989, Patterns in plant development. Cambridge Univ. Press. Cambridge, U.K.

Steinbiss, H. H. and Davidson, A., 1989, Genetic manipulation of plants: from tools to agronomic applications. Sci. Prog. Oxford, 73: 147-168.

Stonier, T., 1971, The role of auxin protectors in autonomous growth, In Les Cultivars de Tissus de Planter, pp. 424-435.

Sumithra, S., Vamadevaiah, H. M., Savith G Kanthi and Katageri, I. S., 2010b, Effect of wounding methods on regeneration and transformation in Gossypium herbaceum and Gossypium hirsutum cotton genotypes. J. of Cotton Res. Develop., 24(2): 164-173.

Sumithra, S., Katageri, I. S. and Vamadevaiah, H. M., 2010a, Factors influencing regeneration and Agrobacterium mediated transformation of Gossypium herbaceaum and Gossypium hirsutum cotton genotypes. Karnataka J. of Agricul. Sci., 23(2):222-226.

Sun, Y., Zhang, X., Huang, C., Guo, X. and Nie, Y., 2006, Somatic embryogenesis and plant regeneration from different wild diploid cotton (Gossypium) species, Plant Cell Rep., 25: 289–296.

Sunilkumar, G. and Rathore, K. S., 2001, Transgenic cotton: factors influencing Agrobacterium-mediated transformation and regeneration. Mol. Breed., 8(1): 37-52.

Sureshkumar, M. V., Katageri, I. S., Vamadevaiah, H. M., Khadi, B. M. and Salimath, P. M., 2003, In vitro screening for regeneration in cotton (Gossypium ssp.). Indian J. of Gene. and Plant Breed.63(1): 54-58.

Swankar, P., Bohra, S. P. and Chandra, N., 1986, Biochemical changes during growth and differentiation of the callus of Solanum surattense. J Plant Physiol 76:75-81.

Tang, M., Liu, X., Deng, H. and Shen, S., 2011, Over-expression of JcDREB, a putative AP2/EREBP domain-containing transcription factor gene in woody biodiesel plant Jatropha curcas, enhances salt and freezing tolerance in transgenic Arabidopsis thaliana, Plant Science 181: 623– 631.

Taylor, M. G. and Vasil, I. K., 1991, History of the particle factor affecting transient GUS expression in Perl millet embryos following microprojectile bombardment. Plant Cell Rep., 10: 120-125.

Thiruvengadam, M., Varisai, S. M., Yang, C. H. and Jayabalan, N., 2006, Development of an embryogenic culture of bitter melon (Momordica charantia L.) Scientia Horticult., 109:123-129.

Thorpe, T. A., 1995, In vitro embryogenesis in plants. Dodrecht, The Netherlands: Kluwer Academic Publishers.

Timbert, R., Barbotin, J. N. and Thomas, D. 1996, Enhancing carrot somatic embryo survival during slow dehydration, by encapsulation and control of dehydration. Plant Sci., 120:215–222.

Tinland, B., 1996, The integration on T-DNA into plant genomes. Trends in Plant Sci., 1: 178-184.

Tjokrokusumo, D., Heinrich, T., Wylie, S., Potter, R. and Mc Comb, J., 2000, Vacuum infiltration of petunia hybrid pollen with Agrobacterium tumefaciens to achieve plant transformation. Plant Cell Rep., 19: 792-797.

Tohidfar, M., Ghareyazie, B., Mosavi, M., Yazdani, S. and Golabchian, R., 2008 Agrobacterium-mediated transformation of cotton (Gossypium hirsutum) using a synthetic cry1Ab gene for enhanced resistance against Heliothis armigera. Iranian J. Biotech., 6(3): 164-173.

Tohidfar, M., Mohammadi, M. and Ghareyazie, B., 2005, Agrobacterium-mediated transformation of cotton (Gossypium hirsutum) using a heterologous bean chitinase gene. Plant Cell Tiss. Organ Cult., 83: 83–96.

Trolinder, N. L. and Goodin, J. R., 1987, Somatic embryogenesis and plant regeneration in cotton (Gossypium hirsutum L.). Plant Cell Rep., 6: 231-234.

Trolinder, N. L. and Goodin, J. R., 1988a, Somatic embryogenesis in cotton (Gossypium hirsutum L.) I-Effects of source of explant and hormone regime. Plant Cell Tissue Organ Cult., 12: 31-42.

Trolinder, N. L. and Xhixian, C., 1989, Genotypic specificity of the somatic embryogenesis response in cotton. Plant Cell Rep., 8: 133-136.

Tsukahara, M. and Hirosawa, T., 1992, simple dehydration treatment promotes plantlet regeneration of rice (Oryza sativa L) callus. Plant Cell Rep., 11: 550-553.

Ulian, E.C., Smith, R.H., Gould, J. H. and McNight, T. D., 1988, In Vitro Cell Devel. Biol., 24: 951-954.

Umbeck, P., Johnson, G., Barton, K. and Swain, W., 1987, Genetically transformed cotton (Gossypium hirsutum L.). Plants. Bio/Tech., 5: 263-266.

Umezawa, T., Fujita, M., Fujita, Y., Yamaguchi-Shinozaki, K. and Shinozaki, K., 2006, Engineering drought tolerance in plants: discovering and tailoring genes to unlock the future. Curr. Opin. Biotechnol, 17:113–122.

Veluthambi, K., Gupta, K. A. and Sharma, A., 2003, The current status of plant transformation technologies. Current Sci., 84 (3): 368-380.

Vergauwe, A., Van Geldre, E., Inze, D., Van Montagu, M. and Van den Eeckhout. E., 1998, Factors influencing Agrobacterium tumefaciens-mediated transformation of Artemisia annua L. Plant Cell Rep., 18 (1): 105-110.

Wang, W., Zhang, X. L. and Liu, J. L., 1992, Effect of BR on somatic embryogenesis of upland cotton. Plant Physiol. Commun. 28(1): 15- 18.

Wang, J. W., Yang, F. P., Chen, X. Q., Liang, R. Q., Zhang, L. Q., Geng, D. M., Zhang, X. D., Song, Y. Z. and Zhang, G. S., 2006, Induced Expression of DREB Transcriptional Factor and Study on Its Physiological Effects of Drought Tolerance in Transgenic Wheat, Acta Genetica Sinica., 33(5): 468-476.

Wang, W., Chen, W., Gao, Y. and Zhu, Z., 1998, Obtaining insect resistant cotton by transformation with Agrobacterium. Proceedings of the World Cotton Research Conference-2, Athens, Grace, September 6-12: 350-353.

White, P.R., 1942, Plant tissue culture. Annual Review of Biochemistry, 11: 615-628.

Wilkins, T. A., Mishra, R. and Trolinder, N. L., 2004, Agrobacterium-mediated transformation and regeneration of cotton, Food, Agriculture & Environment., 2 (1): 179-187.

Wochok, Z. S. and Wetherell, D. F., 1971, Suppression of organized growth in cultured wild carrot tissue by 2-chloroethylphosphonic acid. Plant Cell Physiol. 12: 771-774.

Wu, J. H., Zhang, X. L., Nie, Y. C., Jin, S. X. and Liang, S. G., 2004, Factors affecting somatic embryogenesis and plant regeneration from a range of recalcitrant genotypes of Chinese cottons (Gossypium hirsutum L.). In Vitro Cell Dev Biol Plant 40: 371–375.

Wu, J., Zhang, X., Nie, Y. and Luo, X., 2005, High-efficiency transformation of Gossypium hirsutum embryogenic calli mediated by Agrobacterium tumefaciens and regeneration of insect-resistant plants. Plant Breed., 124: 142-146.

Wu, S. J., Wang, H. H., Li, F. F., Chen, T. Z., Zhang, J., Jiang, J. Y., Ding, Y., Guo, W. Z. and Zhang, T. Z., 2008, Enhanced Agrobacterium-mediated Transformation of Embryogenic Calli of Upland Cotton via Efficient Selection and Timely Subculture of Somatic Embryos, Plant Mol. Biol. Rep., 26: 174-185.

Xie, D. Y., Jin, S. X., Guo, X. P. and Zhang, X. L., 2007, Somatic embryogenesis and plant regeneration in cotton cultivars from Yellow and Yangtze River planting areas. Acta Agron. Sin. 33(3): 394-400.

Yamaguchi-Shinozaki, K. and Shinozaki, K., 1994, A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress. Plant Cell, 6: 251–264.

Yamaguchi-Shinozaki, K. and Shinozaki, K., 2005, Organization of cis-acting regulatory elements in osmotic and cold-stress-responsive promoters. Plant J, 10:88–94.

Ye, G. N., Stone, D., Pang, S. Z., Creely, W., Gonzalez, K. and Hinchee, M., 1999, Arabidopsis ovule is the target for Agrobacterium in planta vacuum infiltration transformation, The Plant Journal., 19(3), 249-257.

Yehoshua, S., Rhodes, D. and Janick, J., 1992, Changes in amino acid composition associated with tolerance to partial desiccation of celery somatic embryos. J. Am. Soc. Hort. Sci., 117:337–341.

Yuqiang, S., Xianlong, Z., Shuangxia, J., Shaoguang, L. and Yichun, N., 2003, Somatic embryogenesis and plant regeneration in wild cotton (G. klotzschianum). Plant Cell Tiss. Organ Cult., 75 (3): 247-253.

Zapata, C., Park, S., El-Zik, K. M. and Smith, R. H., 1999, Transformation of Texas cotton cultivar by using Agrobacterium and the shoot apex. Theor. Appl. Gene., 98: 252-256.

Zhang, B. H., Li, X. L., Li, L. and Li, G. D., 1996, Plant recovery from cotton somatic embryos. Acta Agric. Boreali-occidentalis Sinica 2: 24-28.

Zhang, J. M., Sun, J. Z., Liu, J. L. and Zhang, X. L., 1994, Studies on plant regeneration from somatic cell and transferring technique of plantlets in upland cotton. Acta Agron. Sin. 20 (2): 210-216.

Zhang, B. H., 1994, A rapid induction method for cotton somatic embryos. Chinene Sci. Bull. 39: 1340-1342.

Zhang, B. H., Feng, R., Liu, F., 1999, Direct induction of somatic embryogenesis of cotton, Chinese Science Bulletin., 44(8): 766.

Zhang, B. H., Feng, R., Liu, F. and Wang, Q., 2001, High frequency somatic embryogenesis and of an elite Chinese cotton variety. Bot. Bull. Acad. Sin., 42:9-16.

Zhang, D. L. and Wang, Z. Z., 1989, Tissue culture and embryogensis of Gossypium hirsutum L., Acta Botanica Sinica (in Chinese), 31(2): 161.

Zhao, F. Y., Li, Y. F. and Xu, P., 2006, Agrobacterium-mediated transformation of cotton (Gossypium hirsutum L. cv. Zhongmian 35) using glyphosate as a selectable marker. Biotechnol Lett., 28:1199–1207.

Zhao, L., Hu, Y., Chang, K. and Wang, T., 2010, ARAG1, an ABA-responsive DREB gene, plays a role in seed germination and drought tolerance of rice, Annals of Botany 105: 401–409.

Zhou, J. G., Wang, Y. Zeng, J. Huang, S. Qia, G. and Liu, 1983, Introduction of exogenous DNA into cotton embryos, Meth. Enzymol. 101: 433–448.

Zhu, J. K., 2002, Salt and drought stress signal transduction in plants. Annu Rev Plant Biol, 53: 247–273.

Zhu, S. and Sun, J., 2000, Rapid plant regeneration (Gossypium hirsutum), Chinese Science Bulletin., 45(19): 1771-1774.

Zhu, S. W., Gao, P., Sun, J. S., Wang, H. H., Luo, X. M., Jiao, M. Y., Wang, Z. Y. and Xia, G. X., 2006, Genetic Transformation Of Green-Colored Cotton, In Vitro Cell. Dev. Biol.-Plant 42: 439–444.

Zimmerman, T.M. and Scorza, R., 1996, Genetic transformation through the use of hyperhdric tobacco meristems. Mol. Breed., 20: 73-80.

Zouzou, M., Kouadio, Y.J., Kone, M., Kouakou, T.H. and Denezon, D.O., 2000, Callogenese chez Gossypium hirsutum L.: effects cultivar, conditions de culture et type de materiel. Biot Rev Int Sci Vie Terre 1 (1):48-56.

Zouzou, M., Kouakou, T., Kone, M., Peeters, M. and Swennen, R., 1997, Callogenese chez le cotonnier cultive en Cote d'Ivoire: effects position explant hypocotyle, varietes, source de carbone et regime hormonal. In: African Crop Science Society (eds) Proceedings of 3rd African Crop Science Conference, Kampala, Uganda, pp. 1489-1494.

Zouzou, M., Kouakou, T. H., Kone, M., Amani, N. G. and Kouadio, Y. J., 2008, Effect of genotype, explants, growth regulators and sugars on callus induction in cotton (Gossypium hirsutum L.), Australian J. Crop Sci., 2(1): 1-9.

APPENDIX I

Loading dye (6x)

0.25% Bromophenol blue

40% (w/v) sucrose in water

Stored at 4°C

TAE tris Acetate (Sambrook et al., 1989) 50x

Tris Base - 242gm

Glacial acetic acid - 57.1 ml

0.5 M EDTA (pH 8.0) - 100 ml

Distilled water - 1000 ml

APPENDIX II

YEMA medium (Yeast Extract Mannitol medium)

Mannitol - 10g

Yeast extract - 1g

K2HPO4(2%) - 10 ml

MgSO4.7H2O (1M) - 0.8 ml

CaCl2. 2H2O (1M) - 0.4 ml

Agar - 16 gm

Water - 1000 ml

APPENDIX III

DNA extraction buffer (Edwards et al., 1991)

Tris HCl (pH 7.5) - 200 mM

NaCl - 250 mM

EDTA - 25 mM

SDS (w/v) - 0.5%

APPENDIX IV

Plasmid extraction solutions

Sol I: Stocks 1. 1 M glucose (stored at 4°C)

2. 0.5 M EDTA

3. 1M Tris-HCl (pH 8.0)

Working solutions: 5 ml of IM glucose + 2ml of 0.5M EDTA + 2.5 ml of 1M Tris-HCl were combined and 5 mg/ml lysozyme was added to solution I before use.

Sol II: Stock solutions

1. 10 N NaOH

2. 10% SDS

Working solution: 0.8 ml 10 N NaOH + 4 ml 10% SDS + 35.2 ml of sterile distilled water.

Sol III: Stock solution (stored at 4 0C)

1.5 M Potassium acetate

Working solution: 60 ml of 5M potassium acetate was mixed with 28.5 ml of glacial acetic acid and 11.50 ml of sterile distilled water. pH of the final solution was adjusted to 4.8-5.3 using glacial acetic acid.

Sol IV: 3M sodium acetate

200 µl sodium acetate and 600 µl Isopropanol were added in sequence.

GENETIC TRANSFORMATION FOR DROUGHT

RESISTANCE IN COTTON

2012

PRASHANTH SANGANNAVAR Dr. I. S. KATAGERI

MAJOR ADVISOR

ABSTRACT

Different concentrations and combinations of growth regulators supplemented to MS medium were tried to study the callogenesis from cotyledon and hypocotyl explants of Coker-312 cotton. The media combination of 0.1 mg/l 2, 4-D and 0.5 mg/l kinetin resulted in early callus initiation (10days), high per cent callus induction (99%) and high amount of fresh callus weight (0.88g) with cream friable calli. Irrespective of growth regulators hypocotyl, is better explant than cotyledon for callus initiation, per cent callus induction and fresh callus proliferation. Higher callus induction (94%) was observed in 3% glucose. Reduction of 2, 4-D (0.01mg/l) and kinetin (0.1mg/l) resulted in highest per cent of embryogenesis (71%). Embryo maturation from torpedo embryo’s to plantlets was highest (95%) in media devoid of growth regulators. Incubation in basal MS medium for 4 weeks in in vitro culture condition followed by 1 week incubation in growth chamber in soil and peat mixture resulted in establishment of higher number of plants (95%).

Agrobacterium strain LB-4404 carrying pCambia with AtDREB1a and pBinAR with BcZAF12 transcriptional factors were used for genetic transformation. Colonization for 10 minutes followed by 24 hours co-cultivation resulted in explants free of Agrobacterium contamination. Cefotaxime at 1000 mg/l showed complete elimination of excess Agrobacterium from explant surface. Pre-culture of explants for 48 hours prior to transformation resulted in highest number of kanamycin resistant calli (29). Colonization of Agrobacterium with vacuum infiltration for 30 minutes resulted in kanamycin resistant calli (28).

Analysis of the putative transformants for the presence and expression of gene revealed that the transformation efficiency was 2% and 0.6% respectively for AtDREB1a and BcZAF12 transcriptional factors in transformation via somatic embryogenesis in Coker-312, and transformation efficiency of 1.4% and 2.5% respectively for AtDREB1a and BcZAF12 in transformation via in planta in Sahana was recorded. RT-PCR and dot blot confirmed expression and integration of genes for transcriptional factors in plants.

genetic transformation for drought resistance in cotton

Documents