genetic diversity and phylogenetic relationships among and within species of oriental cymbidiums...

Genetic diversity and phylogenetic relationships among and within

species of oriental cymbidiums based on RAPD analysis

S.H. Choi, M.J. Kim, J.S. Lee, K.H. Ryu *

Division of Environmental and Life Sciences, Seoul Women’s University, Seoul 139-774, Republic of Korea

Received 17 November 2005; accepted 9 January 2006

Abstract

The classifications of oriental cymbidiums that are native to Korea, China, Taiwan and Japan were examined by molecular analysis. A total of

21 cymbidiums, 15 species including three Cymbidium gyokuchin, 4 Cymbidium kanran and 2 Cymbidium goeringii cultivars, were analyzed by

using randomly amplified polymorphic DNA (RAPD) to determine the interspecific and intraspecific relationships. Twenty-two primers were used

in the RAPD analysis to distinguish, by comparing differences in DNA banding patterns, all species and cultivars. Similarity values ranged from

0.501 for Cymbidium aloifoilum and C. kanran to 0.935 for Cymbidium ensifolium and Cymbidium marginatum with analysis of total bands score.

Phylogenetic tree analysis of the RAPD results from the 21 cymbidiums identified specific groupings. The cymbidiums could be divided into two

clusters based upon ecological traits. One trait was temperate zone preference, with each cymbidium preferring either an Asian or subtropical

temperate zone. The group that comprised the subtropical cymbidiums was C. aloifoilum, Cymbidium insigne and Cymbidium lowianum.

Additionally, we found that Cymbidium lancifolium and Cymbidium aspidistrifolium could be separated based on different flowering physiology

and unique leaf form. The groups identified by morphological, physiological and ecological characteristics were in full agreement with those

determined by RAPD analysis. The phylogenetic tree derived from the RAPD results was similar to that of the traditional classification. The data

acquired from this study could be used for identification and classification of other orchid genera and oriental cymbidium.

# 2006 Elsevier B.V. All rights reserved.

Keywords: Cymbidium; RAPD; Genetic diversity; Classification; Identification; Interspecies; Intraspecies orchid

www.elsevier.com/locate/scihorti

Scientia Horticulturae 108 (2006) 79–85

1. Introduction

Orchidaceae is one of the most highly developed mono-

cotyledonous families. They are known for the large number of

species (775 genera consisting of 19,500 species), great

variations in floral morphology (three sepals, two lateral petals

and one labellum), pollinator relationships and diversity of their

ecological habitat (terrestrial or epiphytic; vines with rhizomes,

corms, root tubers or occasionally with mycoparasitic fungi)

(Arditti, 1992; Judd et al., 1999). The family, which includes

Cattleya, Dendrobium, Epidendrum, Paphiopedilum, Phalae-

nopsis, Vanda, Brassica, Cymbidium, Laelia, Miltonia and

Oncidium, is economically important because of the orna-

mental value (Judd et al., 1999).

The genus Cymbidium is comprised of 44 species and is

found in northwest India, China, Taiwan, Korea, Japan, the

Malay Archipelago and the north and eastern regions of

* Corresponding author. Tel.: +82 2 970 5618; fax: +82 2 970 5610.

E-mail address: [email protected] (K.H. Ryu).

0304-4238/$ – see front matter # 2006 Elsevier B.V. All rights reserved.

doi:10.1016/j.scienta.2006.01.010

Australia (Du Pay and Cribb, 1988; Obara-Okeyo and Kako,

1998). Oriental cymbidiums have been cultivated for over 500

years, and remain the most important orchids for the commerce

of northeastern Asia (Wolff, 1999). However, the genetic

relationship among many of the major lineages of cymbidiums

remains unclear. The development of new cultivars that lack

distinguishing morphological characteristics has even further

emphasized the need for more unambiguous identification

methods.

An adjunct method to the morphological and physiological

techniques used for classification is a test based on isozyme

expression, which has been introduced to fingerprint species

and ornamental cultivars of various species (Deloose, 1979;

Chapparro et al., 1987; Obara-Okeyo and Kako, 1997).

However, DNA based methods have many advantages

compared to the isozyme technique. DNA content is

independent of environmental conditions and the DNA

sequence is identical in all plant tissues or tissue stages (Erlich

et al., 1991). The development of highly reliable and

discriminatory methods for identifying species and cultivars

has become increasingly more important to plant breeders and

S.H. Choi et al. / Scientia Horticulturae 108 (2006) 79–8580

members of the nursery industry who need sensitive and

accurate tools to differentiate and identify cultivars for the

purpose of plant patent protection. A number of molecular

techniques, which include gene mapping and gene sequencing,

are available for generating and analyzing molecular data (Judd

et al., 1999). Molecular data has played an essential role in

determining the genetic relationship among many plants, and

has led to new genetic classifications that often conflict with

traditional taxonomy (Jobst et al., 1998). In Cymbidium species,

RAPD (Obara-Okeyo and Kako, 1998) and nr ITS sequences

(Zhang et al., 2002) studies have been reported. Phylogeny can

also be used to understand the evolutionary process, which

leads to the development of hypothesis concerning subjects,

such as morphological adaptation, physiological changes or

biogeography (Lazaro and Aguinagalde, 1996; Dubouzet et al.,

1998; Kim et al., 2005).

The objectives of this study were to present a comprehensive

phylogenetic reconstruction of oriental cymbidiums based on

RAPDmolecular data and to evaluate the results with respect to

phylogenetic relationships and classifications.

2. Materials and methods

2.1. Plant materials and DNA extraction

The plant genotypes used for this study were 15 species

including 3 Cymbidium gyokuchin, 4 Cymbidium kanran and 2

Cymbidium goeringii cultivars: Cymbidium aloifolium, Cym-

bidium insigne, Cymbidium lowianum, Cymbidium sinense,

Cymbidium ensifolium, Cymbidium marginatum, Cymbidium

faberi, C. gyokuchin‘C’, C. gyokuchin‘K’, C. gyokuchin‘Y’, C.

kanran (JK), C. kanran (CH), C. kanran (TW), C. kanran (J),

Cymbidium formosanum, Cymbidium rubrigemmum, Cymbi-

Table 1

List of species and cultivars for genetic relationship of cymbidiums used in this s

No. Scientific name Characteristics

Blooming season

1 Cymbidium aloifolium March–May

2 Cymbidium insigne March–May

3 Cymbidium lowianum March–April

4 Cymbidium sinense June–February

5 Cymbidium ensifolium August–September

6 Cymbidium marginatum August–September

7 Cymbidium faberi May

8 Cymbidium gyokuchin‘C’ August–September

9 Cymbidium gyokuchin‘K’ August–September

10 Cymbidium gyokuchin‘Y’ August–September

11 Cymbidium kanran (JK) October–Decembe

12 Cymbidium kanran (CH) October–Novembe

13 Cymbidium kanran (TW) October–Novembe

14 Cymbidium kanran (J) October–Novembe

15 Cymbidium formosanum March

16 Cymbidium rubrigemmum July–September

17 Cymbidium lancifolium June–August

18 Cymbidium aspidistrifolium October–Novembe

19 Cymbidium forrestii March

20 Cymbidium goeringii March–April

21 Cymbidium goeringii (U) March–April

dium lancifolium, Cymbidium aspidistrifolium, Cymbidium

forrestii, C. goeringii and C. goeringii (U). Cymbidium species

and cultivars, their Korean name, and characteristics are shown

in Table 1 (Lee, 1979). Genomic DNA from each cymbidium

was extracted from leaves using a modification of the

cetyltrimethylammonium bromide (CTAB) method (Knapp

and Chandlee, 1996). One hundred milligrams of fresh leaf

tissue was placed in a mortar and ground to a powder in liquid

nitrogen. Six hundred microliters of cold extraction buffer (3%

CTAB, 1.42 M NaCl, 20 mM EDTA, 100 mM Tris–Cl pH 8.0,

2% polyvinylpyrrolidone and 5 mM ascorbic acid) was added

and the tissue further homogenized for 2 min. Ground

samples were treated at 65 8C for 15 min and then extracted

once with chloroform-isoamyl alcohol (24:1, v/v) to obtain a

clear supernatant. Supernatant containing plant genomic

DNA was transferred to a fresh tube after centrifugation at

12,000 rpm for 5 min. One-fifth volume of a 5% CTAB

solution in 0.7 M NaCl was added to the aqueous phase, the

samples were treated at 65 8C for 15 min, and then extracted

once more with chloroform-isoamyl alcohol. DNA was

precipitated from the supernatant by the addition of two

volumes cold absolute ethanol, incubation at �80 8C for

15 min and centrifugation at 12,000 rpm for 20 min at 4 8C.DNA was dried under a vacuum after rinsing the pellet

containing the DNA in cold 70% ethanol. The dried DNAwas

resuspended in 100 ml of distilled water.

2.2. RAPD amplification

The RAPD DNA amplification reactions were performed in

a total volume of 20 ml that contained: 10 ng of template DNA,

0.2 mM each of dATP, dGTP, dCTP and dTTP, 50 pM UBC

primer (University of British Columbia, Canada), URP primer

tudy

Korean name

Color of flowers

Yellowish brown

Peach or deep pink

Reddish brown

Red purple Bosae

Greenish yellow Keonlan

Greenish yellow Okhwa

Olive green Ilkyunguhwa

Ivory Cholgolsosim

Bluish white Kwanumsosim

Bluish white Yongamsosim

r Purple green Hanlan

r White, yellow, pale pink Chungukhanlan

r White, yellow, pale pink Daemanhanlan

r Blue, red Ilbonhanlan

Pale yellowish green Sarlan

Yellowish white Shinjuklan

Ivory Jugbaeklan

r Light green Nokhwajugbaeklan

Yellowish green Chungukchunlan

Yellowish green Bochunhwa

Yellowish green Ulungdobochunhwa

S.H. Choi et al. / Scientia Horticulturae 108 (2006) 79–85 81

(Seoulin, Korea) (Table 2), 20 mM Tris–Cl (pH 8.0), 100 mM

KCl, 0.1 mM EDTA, 1 mM DTT, 0.5% Tween-20, 0.5%

Nonidet P-40, 50% glycerol, 1 unit of Taq DNA polymerase

(Takara, Japan), 5 mM MgCl2 and sterilized water. Amplifica-

tion was performed in a thermal cycler (Model 480, Perkin-

Elmer, USA). Denaturation was executed at 94 8C for 3 min

before the start of cycling. An amplification cycle consisted of

40 s at 94 8C, 1 min at 37 8C and 1 min at 72 8C. A total of 40

cycles were performed and the cycling ended with a final

extension at 72 8C for 10 min.

2.3. Preliminary screening of primers

Three primer sets, UBC #2, UBC #7 and URP were supplied

with 100 primers, 100 primers and 12 primers, respectively,

were tested for PCR amplification. These 10-mer and 20-mer

primers were used in RAPD to investigate the extent of

polymorphisms and to select primers that are capable of

detecting polymorphisms within cymbidiums. Only those

primers that produce identical polymorphic bands two or more

times were selected for further analysis.

2.4. RAPD data analysis

The presence of amplified bands with different intensities

and locations were detected and analyzed with the Quantity

One 4.1 (BioRad, Hercules, CA, USA) software using the

following values: noise filter: 4; lane width: 4.063 mm; size

scale: 5; sensitivity: 4.665. Bands were scored for their

presence (1) or absence (0) for numerical analysis. Genetic

distances were calculated between all pairs of entries using

Nei’s coefficient of genetic distance (Nei and Li, 1979):

S = (2Nxy)/Nx + Ny, D = �log 10S; where S is the pairwise

Table 2

Primers used for study in Cymbidium identification using RAPD

No. primer Nucleotide sequences (50 ! 30) GC (%)

UBC 701 CCCACAACCC 70

UBC 702 GGGAGAAGGG 70

UBC 706 GGTGGTTGGG 70

UBC 707 CCCAACACCC 70

UBC 708 GGGTTGTGGG 70

UBC 709 CCTCCTCCCT 70

UBC 728 GTGGGTGGTG 70

UBC 730 CCACACCCAC 70

UBC 731 CCCACACCAC 70

UBC 735 GGGAGAGGAG 70

UBC 736 GAGGGAGGAG 70

UBC 751 CCCACCACAC 70

UBC 759 CCAACCCACC 70

UBC 763 CACACCACCC 70

UBC 771 CCCTCCTCCC 80

UBC 772 CCCACCACCC 80

UBC 777 GGAGAGGAGA 60

UBC 778 CCACACCACA 60

UBC 782 GGGAAGAAGG 60

URP 3 GTGTGCGATCAGTTGCTGGG 60

URP 5 GGCAAGCTGGTGGGAGGTAC 65

URP 6 ATGTGTGCGATCAGTTGCTG 50

similarity coefficient, Nx and Ny are the total number of

bands produced by cymbidiums x and y, respectively, Nxy is

the number of bands shared by cymbidiums x and y, and D is

the genetic distance between cymbidiums x and y. The

relationship between cymbidiums was displayed as a

dendrogram, which was constructed based on the similarity

matrix data by applying unweighted pair group method with

arithmetic averages (UPGMA) cluster analysis using the

NTSYS program (Exeter Software, Setauker, NY) (Rohlf,

1990).

3. Results

Among the prescreened primers with 50, 60, 65, 70 and

80% GC content, 22 primers amplified polymorphic DNA

bands (Table 2). These primers produced a total of 617 bands,

588 (95%) being polymorphic bands, according to the

method used for band scoring. The bands were characterized

based on size and ranged from approximately 0.1–3.5 kb. The

number of amplified bands varied from 16 (URP 3) to 36

(UBC 709).

Three typical examples of the polymorphisms detected with

primers UBC 706, UBC 709 and UBC 730 are shown (Fig. 1).

Different band profiling patterns were obtained for C.

aloifolium, C. insigne, C. lowianum with eight primers

(UBC 701, UBC 706, UBC 707, UBC 709, UBC 728, UBC

730, UBC 763 and URP 6), and for C. goeringii and C.

goeringii (U) with three primers (UBC 702, UBC 709 and URP

6). Pairwise Nei’s coefficients of similarity for all accessions

are listed in Table 3. Percent similarity ranged from 50.1,

between C. aloifolium and C. kanran (CH), to 93.7, between C.

ensifolium and C. marginatum. The dendrogram resulting from

the UPGMA cluster analysis is shown in Fig. 2. The

dendrogram shows that the UPGMA separated the orchids

into two major clusters. The first cluster (I) included three

species: C. aloifolium, C. insigne and C. lowianum. The second

cluster (II) was comprised of 12 species: C. sinense, C. faberi,

C. ensifolium, C. marginatum, C. gyokuchin, C. rubrigemmum,

C. kanran, C. formosanum, C. forrestii, C. goeringii, C.

lancifolium and C. aspidistrifolium.

Subtropical orchids, C. aloifolium, C. insigne and C.

lowianum that grow in warm environments were all clustered

together in cluster I. Cluster II included oriental cymbidiums

that prefer cooler environments and are native to temperate

regions. In C. gyokuchin, C. kanran and C. geringii several

cultivars or intraspecific cymbidiums formed subgroups II-2, II-

3 and II-4, respectively. Percent similarity between C.

ensifolium and C. marginatum was the highest at 93.7, and

produced a small subcluster in II-2 near the C. gyokuchin group.

C. sinense and C. faberi formed a single group in II-1. C.

formosanum, C. forrestii, C. goeringii and C. goeringii (U)

were in the subgroup II-4. C. lancifolium and C. aspidis-

trifolium clustered separately, forming II-5, away from the

other oriental cymbidiums. The results from this study

demonstrated that cymbidiums have genetic polymorphisms

that correspond with the phenotypic and ecological diversity

within the genus.


Fig. 1. DNA banding profiles from the RAPDs of 21 cymbidiums. (A) UBC 706, (B) UBC 709 and (C) UBC 730. Lane M, DNA standards; arrows indicate band

specific to: panel (A) lanes 4–21, panel (B) lanes 20 and 21 and panel (C) monomorphic band. Cultivar numbers correspond to those in Table 1.

Table 3

Percent of similarity matrix from 21 cymbidiums generated from Nei’s estimate of similarity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

1 100

2 77.1 100

3 77.7 83.6 100

4 74.9 72.1 74.6 100

5 75.0 76.6 79.1 79.1 100

6 75.5 76.7 78.3 79.2 84.7 100

7 71.6 71.6 72.6 74.7 77.1 77.5 100

8 73.2 72.9 72.6 74.4 77.1 80.3 74.0 100

9 73.3 71.5 73.6 73.6 77.8 81.4 72.6 79.4 100

10 74.3 71.8 74.3 76.1 80.3 81.7 76.0 80.0 83.6 100

11 75.0 74.1 74.1 76.0 78.6 78.4 75.8 75.8 75.0 77.2 100

12 73.3 70.9 71.8 74.6 76.9 77.1 77.2 74.4 74.0 78.0 79.4 100

13 74.0 72.4 73.6 73.3 76.6 77.4 76.0 74.4 74.0 76.7 80.0 82.9 100

14 72.9 72.6 72.9 75.0 78.9 79.7 76.1 76.1 77.5 77.5 79.8 80.3 80.9 100

15 74.7 71.6 71.9 75.3 75.5 77.8 75.8 74.9 74.4 75.3 78.6 79.4 78.4 78.6 100

16 72.7 70.5 72.7 75.5 76.3 76.4 73.8 74.7 74.9 74.0 74.1 72.4 73.6 76.9 75.3 100

17 74.4 71.0 70.7 72.6 71.8 73.8 71.2 71.8 70.1 73.2 73.3 71.6 72.9 74.0 74.0 73.8 100

18 74.9 71.5 72.1 72.7 73.5 73.6 71.9 73.5 71.2 72.1 72.9 73.3 72.1 73.5 75.7 75.5 77.5 100

19 75.2 72.1 73.6 74.3 75.0 78.3 72.9 76.3 72.4 74.0 76.3 75.5 74.6 76.6 77.5 78.3 75.3 76.4 100

20 75.2 72.4 72.4 72.7 74.1 74.9 75.0 72.2 71.8 72.1 75.7 74.6 73.6 76.0 78.8 75.8 72.6 76.1 80.2 100

21 75.7 71.9 73.5 72.2 74.9 75.3 75.8 74.3 72.6 73.2 76.1 75.0 72.6 75.8 75.8 77.2 74.3 75.7 82.5 81.6 100


Fig. 2. Phenogram of the 21 cymbidiums, 15 species including 3 C. gyokuchin, 4 C. kanran and 2 C. goeringii cultivars, based on UPGMA cluster analysis and the

similarity index of Nei and Li (1979). Scale (bottom) and value above the branch are the UPGMA coefficient.

4. Discussion

Besse et al. (2004) reported that the level of intraspecific

variation detected with RAPD markers in cultivars of the

Vanilla, one of the orchidaceae, was low. However, poly-

morphic bands from RAPD analysis of cymbidiums composed

95% of the total bands in this study. This result indicated that

high levels of polymorphisms in the 21 cymbidiums examined

and that the technique could possibly differentiate Cymbidium

ssp. Identification of subtropical cymbidium cultivars has been

previously investigated using RAPD. Obara-Okeyo and Kako

(1998) reported that 25 cultivars were distinguishable by RAPD

marker, and that a high genetic diversity existed. They reported

that the extensive genetic variation among the present

cymbidium cultivars was a result of the breeding program.

Zhang et al. (2002) reported that the sequences of ITS

regions was useful the infrageneric classification currently in

use for Cymbidium. They used the sequences of nrDNA regions

of 27 species and 3 cultivars of Cymbidium and 3 outgroup

species (Eulophia graminea, Geodorum densiflorum and

Amitostigma pinguiculum) using PCR amplification and direct

DNA sequencing. The phylogenetic trees generated from

maximum parsimony analysis, however, show that the existing

division among three subgenera (subgen. Cymbidium, subgen.

Cyperorchis and subgen. Jensoa) should be evaluated with

more data. However, because of the insufficiency of

informative characters of ITS sequences, some of die clades

identified, especially the major lineages of Cymbidium,

received relatively low support; sectional delimitations were

also not clear within each subgenus. They suggested that further

study was needed for achieving a robust phylogeny of

Cymbidium.

In this study, different groupings of subtropical cymbidiums

could be used as selection markers for this ecological

characteristic (Fig. 2). C. aloifolium, native to India, Sri Lanka

and Myanmar, is an epiphytic orchid. The leaf of C. aloifolium

is broad, 2 cm in width and the inflorescence is pendulous, up to

40 cm. It is also called C. crassifolium. C. insigne is native to

China, its inflorescence is up to 1 m in length, and it has peach

pink colored flowers. C. lowianum is native to India and

Myanmar and the color of the flower is yellow-greenish with

longitudinal brown streaks and inflorescence is up to 150 cm


long with 18–25 flowers. It has narrow linear leaves 50–75 cm

long. It is also known as C. gigantum. These subtropical

cymbidiums are of the epiphytic type, whereas the oriental

orchids are terrestrial.

C. sinense has broad leaves compared to other oriental

cymbidiums, and is native to China, Taiwan and Japan having a

round leaf margin and purplish or reddish brown colored

flowers. C. faberi is native to China, and has a thick leaf,

fragrance and a spring blooming season. Its inflorescence is

multi-flowered. Both have an excellent fragrance. RAPD

analysis found that C. sinense was related to C. faberi (Fig. 2).

The results of the RAPD analysis showed C. ensifolium and

C. marginatum were very closely related. Both these two

cymbidiums are summer blooming orchids, fragrant and many

flowered. C. ensifolium blooms in the summer and fall, and has

a light yellow flower and fragrance. C. marginatum blooms in

summer, has a yellow green flower with red a spot in the

labellum, and fragrant. The percent similarity within the C.

gyokuchin species was 82.7–89.8%. Among the C. kanran

species, the percent similarity was 78.0–82.7%. The percent

similarity (93.7) between C. ensifolium and C. marginatum was

higher than that between C. gyokuchin and C. kanran species. It

is possible that C. ensifolium and C. marginatum arose from

closely related genetic backgrounds, but are nevertheless

included in different species.

C. rubrigemmum is native to Taiwan and has a similar

morphology and fragrance to C. gyokuchin. It has a narrow and

thin leafed, and flowers from July to September. It was grouped

with C. gyokuchin in subcluster II-2. C. gyokuchin (K) and C.

gyokuchin (Y) especially seem to have originated from C.

gyokuchin (C) based on the dendrogram (Fig. 2). C. gyokuchin

(C) is native to China and Taiwan and has a rigid, narrow leaf

with a deep cave. C. goykuchin (K) is native to Taiwan and is

very fragrant. The geographical origin of C. gyokuchin (Y) is in

China, and it has a very similar phenotype to C. gyokuchin (K).

All these gyokuchin cultivars have a blooming season in the

autumn, a labellum of solid white color, and are many flowered

on one stalk. They are included in the narrow leaved and many

flowered cymbidiums, and also grouped together in the

dendrogram.

C. kanran (TW) is also named C. purpureo-hienale and is

native to the mountains in Taiwan and found at a height of 800–

1000 m. C. kanran (JK) is native to the Mountain of Hanla on

Jeju Island in Korea. It has leaves that are linear and pendulous.

C. kanran (J) is native to Japan and has a bluish or purplish

green flower. C. kanran (CH) is native to China. These orchids

have a winter blooming season, narrow leaves and a many-

flowered character. The common English name is the ‘‘winter

orchid’’. Sepal shape of C. kanran is long and sharpened

compared to that of other cymbidiums. The RAPD grouping

results for these Cymbidia was in agreement with their

morphological and physiological characters. However, culti-

vars of C. gyokuchin and C. kanran, originating from different

locations, seem to possess sufficient genetic diversity for

classification as an Astragalus (Mehrnia et al., 2005).

Classical taxonomic methods indicated that C. formosanum

was derived from C. goeringii, which is native to Taiwan (in

Oriental Orchid, 1989). The group of C. formosanum and C.

forrestii lied near the C. goeringii group (II-4). C. formosanum

has narrow leaves compared to C. goeringii and it has only one

or two flowers per stalk. C. forrestii is native to China and has

yellowish green flowers with red spotted labellum like C.

goeringii, but this flower is slightly bigger than that of C.

goeringii. C. goeringii is endemic to Korea and has no

fragrance. Floral colors of C. goeringii usually are yellowish

or dark green with several purplish red spots on the labellum.

C. goeringii (U), which is distributed throughout Ulung

Island, Korea, is believed to be an ecotype of C. goeringii. Its

percent similarity (82.7) was the same as that found between

cultivars TW and J of C. kanran. C. goeringii (U) has almost

the same phenotype as C. goeringi and C. forrestii, but is more

closely related to C. goeringii than C. forrestii in the

dendrogram. C. goeringii, C. formosanum, C. forrestii and C.

goeringii (U) are all spring blooming and have one flower per

stalk. Leaf appearance, except for the leaves of C.

formosanum, of these species is very similar. The dendrogram

differentiated two small groups in subcluster II-4 according to

the fragrance character; C. formosanum and C. forrestii being

fragrant and C. goeringii and C. goeringii (U) having no

fragrance.

The leaves of C. lancifolium, the white bamboo-leaf orchid

in English, is thin textured, elliptic and has a 4–5 cm broad,

6 cm long, slender petiole. Its inflorescence is erect with six to

eight white or ivory colored flowers having a purplish red spot

in the labellum. Its blooming season is from June to August. C.

aspidistrifolium, or green bamboo-leaf orchid, is also known as

C. javanicum var. aspidistrifolium or C. lancifolium var.

aspidistrifolium. The overall phenotype ofC. aspidistrifolium is

similar to C. lancifolium, but it is slightly smaller than C.

lancifolium. It has a light green flower with a purplish brown

spot in the labellum. Its flowering season is in October and

November. These two cymbidiums have different flowering

seasons, but they have similar appearances. C. lancifolium and

C. aspidistrifolium grouped together in the dendrogram

suggesting they should be given one scientific name.

In conclusion, RAPD results in this study clearly indicated

that (1) oriental cymbidiums were different from subtropical

cymbidiums, (2) the physiological character of having a single

terminal flower (C. formosanum, C. forrestii, C. goeringii and

C. goeringii (U)) differentiated the subtropical cymbidiums

from the many flowered oriental cymbidiums, (3) C.

lancifolium and C. aspidistrifolium have a unique phenotype

that is distinct from other clusters and that they clustered

separately from the general leaf form oriental cymbidiums, (4)

cultivars or intraspecies of cymbidium could be differentiated

from each other and (5) that classification using RAPD agreed

well with ecological, physiological and morphological based

classifications. Although RAPD markers have been success-

fully employed to reveal relationships and classifications at the

cymbidium cultivar level (Obara-Okeyo and Kako, 1998; Ok

et al., 2004), this study shows that RAPD markers based on the

genomic DNA of cymbidiums provided phylogenetic informa-

tion that addresses the genetic relationship of inter/intraspecies

oriental cymbidiums. The discriminatory band patterns and


phylogenetic tree created from the results of this study were

successfully used to determine oriental cymbidium lineages.

Acknowledgements

The authors thankDr. C.S. Kim and anonymous reviewers for

critical reviews and helpful suggestions. This study was

supported in part by grants from the Plant Signaling Network

Research Center (R11-2003-008-02002-0) of the Korea Science

&EngineeringFoundation inKorea, and by grants from thePlant

Diversity Research Center of the 21C Frontier R&D Programs

from the Ministry of Science & Technology in Korea.

References

Arditti, J., 1992. Classification and naming of orchids. In: The Fundamentals of

Orchid Biology, John Wiley and Sons Press, pp. 55–101.

Besse, P., Da Silva, D., Bory, S., Grisoni, M., Le Bellec, F., Duval, M., 2004.

RAPD genetic diversity in cultivated Vanilla: Vanilla planifolia, and

relationships with V. tahitensis and V. pompona. Plant Sci. 167, 379–385.

Chapparro, J.X., Durham, R.E., Moore, G.A., Sherman, W.B., 1987. Use of

isozyme techniques to Horticulture. HortScience 22, 300–302.

Deloose, R., 1979. Characterization of Rhododendron cultivars by flavonoid

and isozyme markers. Sci. Hort. 2, 175–182.

Du Pay, D., Cribb, P., 1988. The Genus Cymbidium. Timber Press, Oregon.

Dubouzet, J.G., Murata, N., Shinoda, K., 1998. Relationships among some

cultivated species and varieties of Alstroemeria L. based on RAPD analysis.

Sci. Hort. 73, 37–44.

Erlich, H.A., Gelfand, D., Sninsky, J.J., 1991. Recent advances in the poly-

merase chain reaction. Science 252, 1643–1650.

Jobst, J., King, K., Hemleben, V., 1998. Molecular evolution of the internal

transcribed spacers (ITS1 and ITS2) and phylogenetic relationships among

species of the family Cucurbitaceae. Mol. Phylogenet. E 9, 204–219.

Judd, W.S., Campbell, C.S., Kellog, E.A., Stevens, P.F., 1999. Phylogenetic

relationships of angiosperms. In: De Jussieu, A.L. (Ed.), Plant Systematics:

A Phylogenetic Approach. Sinauer Associates Inc., MA, USA.

Kim, C.S., Lee, C.H., Park, K.W., Kang, S.J., Shin, I.S., Lee, G.P., 2005.

Phylogenetic relationships among Pyrus pyrifolia and P. communis detected

by randomly amplified polymorphic DNA (RAPD) and conserved rDNA

sequences. Sci. Hort. 106, 491–501.

Knapp, J.E., Chandlee, J.M., 1996. RNA/DNAmini-prep from single sample of

orchid tissue. BioTechniques 21, 54–56.

Lazaro, A., Aguinagalde, I., 1996. Phylogenetic relationships between the wild

taxa of the Brassica oleracea L group (2n = 18) using random amplified

polymorphic DNA assay. Sci. Hort. 65, 219–227.

Lee, C.B., 1979. Illustrated flora of Korea. Hyangmunsa (in Korean).

Mehrnia, M., Zarre, S., Sokhan-Sanj, A., 2005. Intra- and inter-specific relation-

ships within the Astragalus microcephalus complex (Fabaceae) using

RAPD. Biochem. Sys. Ecol. 33, 149–158.

Nei, M., Li, W.H., 1979. Mathematical model for studying genetic variation in

terms of restriction endonucleases. Proc. Natl. Acad. Sci. U.S.A. 76, 5269–

5273.

Obara-Okeyo, P., Kako, S., 1997. In vitro and in vivo characterization of

Cymbidium cultivars by isozyme analysis. J. Hort. Sci. 72, 263–270.

Obara-Okeyo, P., Kako, S., 1998. Genetic diversity and identification of

Cymbidium cultivars as measured by random amplified polymorphic

DNA (RAPD) markers. Euphytica 99, 95–101.

Ok, S.H., Jeung, J.U., Kang, H.M., Jung, K.W., Lee, J.S., Shin, J.S., 2004.

Development and utilization of sequence tagged site-polymorphic sequence

markers for classification of oriental cymbidium cultivars and variegates. J.

Kor. Soc. Hort. Sci. 45, 216–221.

Oriental Orchid, 1989. Orchid and Life Press, Seoul (in Korean).

Rohlf, F.J., 1990. NTSYS-pc: Numerical Taxonomy and Multivariate Analysis

System. Applied Biostatistics Inc., New York.

Wolff, E., 1999. Chinese cymbidium species. In: TheMagazine of the American

Orchid Society, American Orchid Society Press.

Zhang, M.Y., Sun, C.Y., Hao, G., Ye, X.L., Liang, C.Y., Zhu, G.H., 2002. A

preliminary analysis of phylogenetic relationships in Cymbidium (orchida-

ceae) based on nrITS sequence. Acta Bot. Sin. 44, 588–592.

genetic diversity and phylogenetic relationships among and within species of oriental cymbidiums...

Documents