GENETIC DISSECTION OF Dh31 SIGNALING IN DROSOPHILA

By

COLIN A. BRETZ

A Thesis Submitted to the Graduate Faculty of

WAKE FOREST UNIVERSITY

In Partial Fulfillment of the Requirements

For the Degree of

MASTER OF SCIENCE

In the Department of Biology

May 2009

Winston-Salem, North Carolina

Approved By:

Erik C Johnson, Ph.D., Advisor ___________________________________________

Examining Committee:

Susan Fahrbach, Ph.D. ___________________________________________

Gloria Muday, Ph.D. ___________________________________________

ii

ACKNOWLEDGEMENTS

First and foremost I would like to extend my thanks and gratitude to my advisor,

Erik Johnson, both for the opportunity to work in his lab for the past two years as well as

for all the support and guidance over that time. I hold myself extremely lucky to have

started my graduate career in the Johnson lab, and believe that a great deal of my current

and future success will stem from the impact Dr. Johnson has had on that career.

I would also like to acknowledge and thank my committee members, Susan

Fahrbach and Gloria Muday who have provided valuable input and support on this

project from it’s beginning, and who have helped shape me as a graduate student both in

and outside of the classroom.

I also owe an immeasurable amount of gratitude to the other members of the

Johnson Lab both official and unofficial. In particular I’d like to thank, Dr. Lord and

Megan White, who have listened to more fly related conversations then any non-

Drosophila researcher should, but have always done so with a smile and a willingness to

help and offer alternative perspective that I have greatly appreciated. I’d also like to

thank Clare Hector, who in addition to her contributions in the lab, helps keep me in

check and whose energy and drive helps push and challenge the rest of us. I also owe a

great deal of thanks to Yan Zhao, whose patience and skill made him responsible for

dissecting the majority of the brains imaged in this thesis and for that matter the lab, and

whose research as an undergraduate really set the table for my own work.

Lastly, this work is dedicated to my parents, Debra and Vance, who have always

supported me in whatever I chose to do, and without whom I would not be the person or

in the place that I am today.

iii

TABLE OF CONTENTS

Page

LIST OF FIGURES ………………..………………………………………………. iv

LIST OF ABREVIATIONS ………………………………………………………. v

ABSTRACT ……………………………………………………………………….. vi

INTRODUCTION …………………………………………………………………. 1

MATERIALS AND METHODS

Drosophila Husbandry ……………………………………………………… 9

Immunocytochemistry ……………………………………………………… 9

Transcript Analysis ………………………………………………………… 9

Lifespan Assays ……………………………………………………………. 10

Locomotor Assays …………………………………………………………. 11

RESULTS

Generation of a Dh31 loss of function mutation...………………………….. 12

Loss of Dh31 Function Impacts Survival Under Stress Conditions…….…... 14

Genetic Verification of Dh31 Loss of Function Phenotypes………………… 15

Loss of Dh31 Function Impacts Locomotor Activity……………………….. 18

DH31 Expression Analysis ………………………………………………… 20

DISCUSSION ……………………………………………………………………... 23

REFERENCES …………………………………………………………………….. 28

APPENDICES ……………………………………………………………………… 31

SCHOLASTIC VITA ……………………………………………………………… 36

iv

LIST OF FIGURES

FIGURES

Page

1 Proposed Homologous Neuroendocrine Pathways.…………………... 7

2 Dh31 Allele Maps ……………………………………………………… 13

3 Loss of DH31 Expression in Dh3101 Mutants………………………….. 14

4 Dh31 Loss of Function Lines are Hypersensitive to Stress Conditions… 16

5 Dh31 Deficiency Mapping Phenocopies Homozygous Lines………….. 17

6 DH31-Receptor Knockdown Phenocopies Dh31 loss of function lines… 19

7 Loss of Dh31 Function Results in Abnormal Locomotor Behavior …… 21

8 DH31 and DH31-Receptor Expression..………………………………… 22

v

ABBREVIATIONS

ACTH …….. Adrenocorticotropic Hormone

AKH …….... Adipokinetic Hormone

Camp………. Cyclic Adenosine Monophosphate

CGRP ……… Calcitonin Gene Related Peptide

CRF … …….. Corticotropin Releasing Factor

Crz … ……… Corazonin

Crz-R … …… Corazonin Receptor

CLR ……….. Calcitonin Receptor-like Receptor

CNS ……….. Central Nervous System

DH31 ………. Diuretic Hormone 33

DH31-R … … Diuretic Hormone 33 Receptor

DH44 …. ….. Diuretic Hormone 44

DH44-R …… Diuretic Hormone 44 Receptor

FSH ……….. Follicle Stimulating Hormone

GAS ………. General Adaptation Syndrome

GnRH ……... Gonadotropin Releasing Hormone

HPA Axis …. Hypothalamic-Pituitary-Adrenal Axis

LD …………. Light Dark

LH …………. Luitenizing Hormone

ORF…. …….. Open Reading Frame

PCR … ……. Polymerase Chain Reaction

RC …………. Reverse Complement

RP49 ………. Ribosomal Protein 49

ZT …………. Zeitgeiber Time

vi

ABSTRACT

Bretz, Colin A.

GENETIC DISSECTION OF Dh31 SIGNALING IN DROSOPHILA

Thesis under the direction of

Erik C. Johnson, Ph.D., Assistant Professor of Biology

Dh31, which is homologous to the mammalian Calcitonin Gene-Related Peptide, is

a multifunctional neuropeptide in Drosophila. To evaluate the roles of Dh31 signaling in

Drosophila, we took advantage of the KG09001 line because it has a transposable

element inserted in the third intron of the Dh31 gene. We employed an excision screen to

mobilize the element and generated 500 excision lines. Evaluation of these excision lines

led to the identification of a revertant, Dh31rev, and two mutant alleles, Dh31

01 and Dh3102.

Subsequent analysis of these alleles indicated that revertant lines exhibited wild type

responses to osmotic and starvation stress, whereas mutant lines were hypersensitive to

stress-inducing conditions. Expression analysis of Dh31 in both larval and adult CNS

showed that mutant alleles had no DH31 immunoreactivity, while revertant lines appeared

wild-type for Dh31 expression. Locomotor analysis of mutant lines demonstrated

abnormal locomotor phenotypes under both normal and stress conditions. Provocatively,

RNAi knockdown of the receptor for DH31, resulted in a phenocopy of lifespan

phenotypes, but not locomotor phenotypes. Our results refine our understanding of the

multiple roles of Dh31 signaling in Drosophila, and suggest a conservation of CGRP

signaling in mediating stress behaviors throughout the Metazoa.

1

INTRODUCTION

Stress is defined broadly as a challenge to homeostasis, and consequently,

confronts every organism. Anything that causes stress ultimately endangers life, unless it

is met by adequate adaptive responses. This juxtaposition between dangers to life and

adaptive responses led Hans Selye to suggest that, “In the biological sense stress is the

interaction between damage and defense, just as in physics tension or pressure represent

the interplay between a force and the resistance offered to it,”(Selye 1950). Just as

pressure and tension exist between all objects, stress is something which all organisms on

the planet encounter and coexist with. Despite the ubiquitous nature of stress, there

remain a vast number of stressors which may meet this definition but fail to elicit

physiological or behavioral responses because they presumably exist beyond the realm of

evolutionary selection as they are rare in occurrences, and so will not be dealt with here.

Instead the present study will focus on “ecologically- relevant” stresses, stressors which

an organism faces on a regular basis within its normal environment, such as starvation

and osmotic stress. Notably, these different stressors have been shown to elicit

stereotypical behavioral and physiological responses.

The General Adaptation Syndrome (GAS) model pioneered by Hans Selye is a

useful conceptual framework within which to interpret the specific behavioral and

physiological responses to stress and to place specific stress hormones within a functional

hierarchy. The GAS states that the dynamics of stress responses are predictable and take

place in three stages: the Alarm Stage, the Adaptation Stage, and the Exhaustion Stage.

The Alarm Stage is the phase in which the organism perceives inhospitable changes in

the environment and so becomes aware of or senses the stressor. This is followed by the

2

Adaptation Stage in which various physiological and behavioral responses, specifically

discussed below, are generated to cope with the homeostatic challenge. If the

physiological and behavioral responses are inadequate at relieving the stress and

returning the organism to homeostasis, then the Adaptation phase proceeds to the

Exhaustion phase, during which the organism succumbs to the combined effects of the

stress and its own response (Selye 1950). Furthermore, it has been noted that many of the

characteristic manifestations of the alarm stage disappear or are reversed during the

resistance (adaptation) stage and only appear once again if the stage of exhaustion is

reached. This led Selye to suggest that the ability of living organisms to adapt

themselves to changes in their surroundings, their “adaptation energy” as he described it,

is a finite quantity, the magnitude of which he believed relied largely on genetic factors

(Selye, 1950). In the context of the GAS model, these proposed genetic factors would

give rise to a stress sensory system that relays the nature, duration, and intensity of the

stressor to a central processor capable of coordinating an appropriate stress response. The

specific molecular network by which such a system detects and relays this information

has been the focal point of many research endeavors utilizing a variety of different model

organisms (Charmandari et al. 2005).

Building upon the GAS model, it is unsurprising to find that there is a suite of

characteristic stress responses exhibited by all animals. This suite of responses is

complex with differential responses by many tissues. Specifically, heart rate, energy

mobilization, and activity levels are increased, while simultaneously digestion,

reproduction, and immune function are inhibited (Johnson and White, 2009). This

“general response” is in keeping with Selye’s notion of animals possessing finite

3

adaptation energy, and the behavioral manifestations of these characteristic responses fall

in line with the larger GAS model. This becomes evident upon closer inspection of these

responses in the context of our model organism and particular stress inducing

environments.

Starvation is a commonly used ecologically relevant stressor, as food availability

is a dynamic aspect of most environments. In Drosophila, starvation induces hyperactive

behaviors (Lee and Park 2004). This change in locomotion is unsurprising from an

adaptive perspective, as increased activity facilitates increased foraging, and the

subsequent removal of an organism from a stressful environment. While increased

locomotion may be an adaptive response to starvation, it also hastens lethality as energy

stores continue to become depleted. Analysis of both locomotion and survivorship under

this environment can provide insight into the mechanisms of how an organism perceives

stress and potentially identify critical signaling pathways (Johnson and White, 2009).

Starvation conditions have also been shown to result in inhibition of egg-laying behaviors,

female receptivity, and ovarian development in female Drosophila (Neckameyer and

Weinstein 2005). These observations provide strong support for the GAS model of

stress-induced energy redistribution, and the use of starvation conditions to dissect the

molecular pathways involved in such responses (Rush et al. 2007).

Osmotic stress is another ecologically significant stressor for Drosophila, due to

the critical need for appropriate water balance. Not surprising, initial behavioral

responses to osmotic stress are manifest as changes in activity levels which mirror

behavioral responses to starvation for what are presumably similar adaptive reasons

(Johnson and White, 2009). This is in keeping with the GAS model, which predicts that

4

such stressors affect similar physiological and behavioral repertoires. Therefore, the use

of multiple ecologically significant stressors within a study allows not only for increased

insight regarding general behavioral responses to stress, but also for the possibility to

potentially identify and separate different signaling pathways and molecules specific to

the varied environmental conditions.

In addition to offering a robust array of various behavioral and physiological

responses to stress, the powerful molecular and genetic tools available in Drosophila

offer unique avenues for investigating the molecular mechanisms of stress responses. The

presence of multiple genes encoding highly similar proteins that can confound

interpretations of mutant phenotypes in mammalian models, is largely not a concern in

Drosophila. Additionally the targeted deletion of specific genes and the introduction of

transgenes to specific anatomical loci and developmental intervals is routine in

Drosophila (e.g. (Brand and Perrimon 1993). Despite this, the potential significance of

any information gleamed by using Drosophila as a model for understanding the

underlying mechanisms of the behavioral changes accompanying stress, would be

diminished if it had no potential impact on stress systems outside the class Insecta. Stress

however, impacts every animal and has been a major selective force shaping evolutionary

history, and consequently, many of the fundamental organizing principles of how stress is

perceived and processed to form responses are highly conserved.

In mammals, two parallel endocrine systems are thought to be fundamental to

organizing the stress response. Specifically, activation of the sympathetic nervous

system and the concomitant release of norepinephrine, along with the activation of the

hypothalamic-pituitary-adrenal (HPA) axis and its sequential release of corticotrophin-

5

releasing factor (CRF), adrenocorticotropic hormone (ACTH) and glucocorticoids are

thought to be primary mediators of stress responses (Charmandari et al. 2005). In

addition to these pathways, there are many more hormones which have been identified as

playing a role in stress-related behavior. One such hormone of interest is the

Gonadotropin-releasing hormone (GnRH). GnRH is best known for its role in

modulating the levels of follicle stimulating hormones (FSH) and luetinizing hormones

(LH) in mammals (Buffet and Bouchard 2001). Additionally, recent studies have shown

that metabolic stresses profoundly suppress GnRH secretion across a wide variety of

species (Chen et al. 1992; He et al. 1999; Li et al. 2004). GnRH cells within the

hypothalamus express receptors for two stress hormones: corticotropin releasing factor

(CRF) and calcitonin gene-related peptide (CGRP). Both are involved in mediating the

stress-induced suppression of GnRH release (Li et al. 2004). This information is of

particular interest when we begin to look at the role of the insect neuropeptide corazonin.

Corazonin is a highly conserved neuropeptide throughout the insects, and was

originally discovered as a result of its potent cardioacceleratory actions in the cockroach,

Periplaneta (Veenstra 1989). Corazonin has also been shown to be co-expressed in clock

cells and coordinates onset of the ecdysial behavior in Manduca sexta (Wise et al. 2002;

Kim et al. 2004). In addition, an investigation into the neurohormone signaling that

mediates population stress-induced pigmentation and morphological changes in locusts

identified corazonin signaling as a critical component for these responses (Tawfik et al.

1999). Despite this, no unifying theme has been identified that connects the different

functions of corazonin amongst insects. A recent study in our laboratory has identified

variations in stress sensitivities resulting from manipulations of corazonin neurons. One

6

aspect of the study has shown stress-induced inhibition of corazonin expression (Zhao et

al., submitted), which is particularly interesting given that previous studies showed that

the corazonin neuropeptide binds to a receptor belonging to the GnRH receptor family

(Cazzamali et al. 2002; Park et al. 2002), suggesting that corazonin and GnRH are

homologous hormones.

Early analysis to identify receptor molecules for different diuretic hormones

identified that the receptor encoded by CG8422, which is related to mammalian CRF

receptor as a functional DH44 receptor for the DH44 peptide (Reagan 1994; Johnson et al.

2004). The DH31 neuropeptide is a potent ligand for the receptor encoded by CG17415,

by virtue of functional responses derived from both signaling and desensitization assays

(Johnson et al. 2005). This is significant because CG17415 is most closely related to the

mammalian calcitonin receptor-like receptor (CLR), and in mammals CGRP has been

shown to activate CLR (Christopoulos et al. 1999; Hewes and Taghert 2001).

Additionally the same study revealed co-expression of the identified DH31 and DH44

receptors within corazonin neurons, indicating a close association between corazonin

regulation by convergent DH31 and DH44 signaling pathways (Johnson et al. 2005).

Given the now identified role of corazonin neurons in the stress response, these

convergent signaling pathways represent potential inputs for relaying stress status to

corazonin neurons (Zhao et al., submitted). Furthermore, based on receptor similarities

and sequence conservation between the insect hormones Corazonin, DH31, and DH44 and

mammalian hormones GnRH, CGRP, and CRF respectively, these observations indicate

that Drosophila posses a stress response circuit likely homologous to the mammalian

circuit controlling stress-induced GnRH release (Figure1) (Reagan 1994; Christopoulos

7

et al. 1999; Hewes and Taghert 2001; Bale and Vale 2004; Johnson et al. 2005; Taylor

and Samson 2005). This compelling demonstration of conservation of the molecules and

neural circuits that mediate the

responses to stress argues that

findings in Drosophila may be

broadly applicable in understanding

the mechanisms that mediate stress

in other models, and highlights the

upstream signaling mechanisms of

this circuit as critical features for

understanding how organisms across

the Metazoa cope with stress.

CRFCRF CGRPCGRP

GnRHGnRH

Dh44Dh44 Dh31Dh31

CorazoninCorazonin

Corazonin Pathway GnRH Pathway

Figure 1. Proposed Homologous Neuroendocrine Pathways. Corazoninneurons express receptors for DH31 and DH44. We propose that the circuitry of this system is homologous to GnRH modulation by CRF and CGRP, based on the homology of the peptides and receptors.

.

(+) (-)

This particular investigation focuses on one of those upstream signaling

molecules, DH31. Previous studies suggest that DH31 is a multifunctional signaling

peptide within a diversity of insects. Early studies into the effects of both DH44 and

DH31 signaling, indicated these neuropeptides act to increase fluid secretion rates by

raising cAMP levels in the principal cells of the Malpighian tubule (Coast et al. 2001).

The DH31 receptor is expressed in Malpighian tubules, suggesting a direct avenue for

modulation of diuresis via the DH31 peptide (Johnson et al. 2005). Another study in

Rhodnius, has shown that application of DH31 increases heart rate, a physiological

response characteristic of the stress response (Brugge et al. 2008). A recent study

demonstrated that DH31 causes elevated cAMP levels in Drosophila clock cells,

8

suggesting potential functions in circadian timekeeping for DH31 signaling (Shafer et al.

2008).

Based on these previous investigations, we hypothesize that DH31 modulates the

release of corazonin in response to stress, and is a multifunctional neuropeptide that also

serves a critical function in activities as diverse as fluid secretion and circadian rhythms.

In an effort to verify this hypothesis and determine the overall functional significance of

DH31 signaling we used a reverse genetic approach to generate functionally null Dh31

mutants, which we then behaviorally assayed in order to identify phenotypes associated

with the loss of Dh31 function.

9

MATERIALS AND METHODS

Drosophila Husbandry

All Drosophila stocks were reared on a standard cornmeal-malt-agar-molasses

medium supplemented with propionic acid. Stocks were housed in uncrowded conditions

at 250 C on a 12:12 LD cycle. The following stocks were used in this study: KG09001,

w; Kr/Cy; D/TM6, Ki Delta 2-3, Df(2l exel 7038)/Cy, UAS-Dh31R-RNAi, 17415-Gal4(X),

17415-Gal4 (II), Crz –Gal4, PDF-Gal4, CCAP-Gal4, UAS-LacZ and w1118 (Appendix E).

Immunocytochemistry

Third instar wandering larvae and adult flies were dissected for this study. Brains

were fixed in a 4% paraformaldehyde, 7% picric acid fixative for one hour at room

temperature and washed six times with phosphate buffered saline (PBS) containing

Triton-X 100. Brains were then incubated at 40 C overnight in a 1:1000 dilution of anti-

rabbit DH31. The antibody against Dh31 was generously provided by Dr. Jan Veenstra,

University of Bordeaux, and its specificity has been previously documented elsewhere,

and the published reagent was used as described in these investigations (Park et al. 2008;

Veenstra et al. 2008; Veenstra 2009). Brains were then washed and a Cy-3 conjugated

anti-rabbit secondary antibody was applied overnight in a dilution of 1:1000. Tissues

were then mounted, viewed, and imaged on a Zeiss confocal microscope, and all

genotypes were imaged under the same settings.

Transcript Analysis

Ninety flies of each genotype were collected, frozen, and then homogenized in 1

mL of TriZol (Invitrogen, Ca). Total RNA was extracted and used as template for cDNA

synthesis using a SuperScript III Reverse Transcription Kit (Invitrogen) according to

10

manufacturer’s recommendations. Specific primers for the Dh31 ORF were designed to

flank intervening sequences and identify if amplicons originated from cDNA versus

contaminating genomic DNA. The primers for Dh31 were: Forward: 5’- 3’ GAA CTT

TGA TCG CAA ATA AAG CGA and Reverse: CGG TCT CAT CCA GAC GCC TTA

GAC. The primers for corazonin were: Forward: 5’- 3’ ACT CTA ATG GCG AGA

ATG TTT TGT and Reverse: ATT GAA CGG ATA GTG GCT AAT GTT. Specific

primers were also designed to amplify the housekeeping gene RP49 as a control. Primers

for RP49 were: Forward: 5’-3’ ACA AAT GGC GCA AGC CCA AGG and Reverse:

ATG TGG CGG GTG CGC TTG TT.

Lifespan Assays

Lifespan measurements are commonly used as a metric for measuring stress

sensitivity in Drosophila (e.g., Broughton et al. 2005). Thirty flies, three to ten days old,

males and females housed separately, were placed in vials with various stress media.

Animals were collected under mild CO2 anesthesia and placed in a vial containing the

stress at Zeitgeiber Time Zero (ZT0), lights on, following three days of entrainment to a

12:12 LD cycle. Osmotic stress media consisted of food containing 0.6 M NaCl, while

starvation media was a two percent agar solution. Percent survival was assessed twice

daily, every twelve hours, on a minimum of three replicate vials. For each vial, the TD50

(median survival) was assessed by employing a non-linear regression analysis (GraphPad

Prism, La Jolla, CA). A one-way ANOVA with post hoc Tukey’s comparison was used

to assess differences between genotypes/treatments on mean TD50 (Excel).

11

Locomotor Assays

The aggregate locomotor activity of thirty flies was monitored with a TriKinetics

Locomotor Monitor (Waltham, MA). Flies used in the assay were three to ten days old,

and housed in a 12:12 LD cycle for three days prior to the experiments. At ZT0 (lights

on), flies were transferred to a vial containing the appropriate medium, and total beam

counts were monitored continuously via an automated system for 48 hours. A one-way

ANOVA followed by post hoc Tukey’s comparison was applied to evaluate differences

in these parameters between genotypes.

12

RESULTS

Generation of a Dh31 Loss of Function Mutation

To further investigate the role of DH31 signaling in the stress response and

throughout the CNS, we took a reverse genetics approach aimed at generating Dh31 loss

of function alleles. The KG09001 line contains a transposable element located in the

second intervening sequence between exons two and three of the Dh31 open reading

frame (Figure 2). Utilizing this line, we employed a multistep excision scheme to

introduce the transposase (Kinked Delta 2-3) and mobilize this P-element, with aims to

recover lines that carried both precise and imprecise excisions (Appendix A). From this

excision scheme, 500 single male family lines were generated each representing a unique

excision event.

Three different approaches were employed to screen the 500 lines for loss of

function Dh31 alleles. Our primary screening procedure was polymerase chain reaction

(PCR) using genomic DNA isolated from individual lines. Multiple forward and reverse

primers designed to amplify specific regions of the Dh31 open reading frame were used to

define the lesion (Appendix B). A complementary approach was simultaneously

employed and relied on identification of phenotypic differences to osmotic stress and was

conducted on sixty five individual families. Lastly, immunocytochemical evaluation of

anti-DH31 staining was employed on approximately twenty five different families to

evaluate the expression levels of this hormone in different families.

From these screens, we were able to identify two candidate imprecise excision

lines, hereafter referred to as Dh3101 and Dh31

02 and a candidate precise excision line

13

named Dh31rev (Figure 2). To confirm the loss of DH31 expression in Dh31

01 and Dh3102

lines, we employed a molecular analysis of DH31 expression in these lines and compared

the results with those obtained from an identical analysis in wild-type and revertant lines.

There was no evidence of expression of DH31 in the two mutant lines as determined by

immunocytochemistry using an anti-DH31 antibody (Figure 3A) in contrast to similar

experiments performed in either the wild-type background or in the Dh31rev line (N= 40

per genotype).

CG13095CG13088 CG13096

Dh31rev

CG13095CG13088 CG13096

CG13095CG13095CG13088CG13088 CG13096CG13096

Dh31rev

KG09001

CG13095CG13088 CG13096

KG09001

KG09001

CG13095CG13095CG13088CG13088 CG13096CG13096

KG09001KG09001

Dh3101

CG13095CG13088 CG13096?

Dh3101

CG13095CG13095CG13088CG13088 CG13096CG13096?

CG13095CG13088 CG13096

Dh3102

?CG13095CG13095

CG13088CG13088 CG13096CG13096

Dh3102

?

Figure 2. Dh31 Allele Schematics. Dh31 regions of interest for the parental KG09001line and the recovered Dh31 alleles. The Dh31 locus comprises four exons, striped blue boxes and three intervening sequences flanked by two orphan genes, 5’ CG13088and 3’CG13096, with an additional orphan gene, CG13095, located in the first intervening sequence between the 1st and 2nd exon. The KG09001 allele possesses a P-element located between the 2nd and 3rd exon. The Dh31

rev allele is the product of a precise excision of the P-element and possesses wild-type sequence for the entire locus. The Dh31

01 and Dh3102 alleles are imprecise excisions of the P-element which

resulted in a loss of DH31 function. All aspects shown have been confirmed through sequence analysis, and efforts are underway to complete this analysis.

.

14

To further verify the loss of DH31 function in these genotypes, we then measured

transcript levels of Dh31 using gene-specific primers on cDNA derived from these

different lines. We were reliably able to amplify wildtype levels of Dh31 transcript from

the revertant line, but not from either Dh3101 or Dh31

02 (Figure3B). These results lead to

the conclusion that of the 500 lines originally generated by our excision scheme, we were

able to recover two loss of function mutants, Dh3101 and Dh31

02, in addition to a revertant

line, Dh31rev. To the best of our knowledge, this is the first report of flies in which all

DH31 function has been removed.

Dh31 RP49

Dh3101 Dh31

rev Dh3101 Dh31

rev

Dh31 RP49Dh31 RP49Dh31 RP49

Dh3101 Dh31

rev Dh3101 Dh31

rev

B

Figure 3. Loss of DH31 Expression in Dh31

01 Mutants. A) DH31 antibody labeling of larval CNS from Dh31

rev and Dh31

01 lines. B) DH31 and RP49transcript levels from Dh31

rev and Dh3101

lines. Arrows indicate antibody labeled soma, which are noticeably absent in the Dh31

01 larval CNS

DH31 Antibody LabelingA

WT

Loss of Dh31 Function Impacts Survival Under Stress Conditions

To evaluate the effects of the loss of DH31 function in the context of stress

response, we next measured the sensitivity of our loss of function lines, Dh3101 and Dh31

02,

to both osmotic and starvation stress, and compared these results with those from the

revertant Dh31rev and parental KG09001 lines.

15

Under osmotic conditions, survival of males and females homozygous for either

Dh3101 or Dh31

02 were significantly shorter then those of male and female Dh31rev and

KG09001 lines (Figure 4A). Furthermore, TD50 estimates show a significant difference

between our loss of function lines and our controls [Females: F = 404, p= 4.5E-9, Males:

F = 788, p = 3.18E-10 (ANOVA)], and application of Tukey’s post hoc analysis revealed

no significant difference between the two mutants (Figure 4C). All of which indicate that

Dh31 loss of function lines are hypersensitive to osmotic stress.

Under starvation conditions, survival curves for males and females of Dh3101 and

Dh3102 were different, but were still significantly shorter then those of control lines of the

appropriate sex (Figure 4B). Comparison of the estimates of TD50 (median survival) of

these lines (Figure 4D), indicated that Dh31 loss of function mutants were also

hypersensitive to starvation stress [Females: F = 40.14, p = 3.61E-5: Males: F = 59.7, p =

8.08E-6 (ANOVA)], and Tukey’s post hoc analysis again showed no significant difference

between loss of function lines.

Genetic Verification of Dh31 Loss of Function Phenotypes

To verify that phenotypes observed in Dh3101 and Dh31

02 lines, were the result of

the specific genetic variations at our locus of interest, we crossed both lines to the

deficiency line, Df (2L) Exel 7038, which contains a 230 kb deficiency on the left arm of

chromosome II. We screened for progeny possessing both the deficiency and the mutant

alleles, and assayed for deviations in osmotic and starvation sensitivity (Figure 5). Our

results show that the survival phenotypes map to this locus, as heterozygotes for the

deficiency and Dh31 mutant alleles produced phenotypes comparable to those of lines

homozygous for the alleles [Osmotic: Females: F = 562, p= 1.22E-9, Males: F = 77.38,

16

P = 2.99E-6 Starvation: Females: F = 45.832, p= 2.22E-5, Males: F = 28.23, p = .000132

(ANOVA)]. Notably, heterozygotes for the deficiency and the revertant wild-type

chromosome were indistinguishable from wild-type animals, implicating no

haploinsufficient phenotype associated with the deficiency. These results indicate that

the observed survival phenotypes of our Dh31 loss of function mutants map to the

appropriate chromosomal region for the Dh31 gene.

BA Osmotic Stress Starvation StressBA Osmotic Stress Starvation Stress

Figure 4. Dh31 Loss of Function Lines are Hypersensitive to Stress Conditions.A) Osmotic stress and B) Starvation stress survival curves of flies homozygous for various Dh31 alleles. Each data point is the mean of three replicate experiments consisting of thirty flies each. C) Osmotic stress and D) Starvation stress TD50s of homozygous lines. * Indicate significant difference from revertant lines.

Starvation StressOsmotic StressC D

***

**

*

**

Starvation StressOsmotic StressC D Starvation StressOsmotic StressC D

***

**

*

**

17

To verify that these phenotypes were also connected to a loss of Dh31 signaling

and not due to some unidentified modification of a nearby gene also uncovered by the

deficiency, we next evaluated the effects of DH31 Receptor – RNAi knockdown in our

assays. We crossed a UAS- DH31 Receptor - RNAi line with two different GAL4 driver

Starvation StressOsmotic StressC D Starvation StressOsmotic StressC D

Figure 5. Dh31 Deficiency Mapping Phenocopies Homozygous Lines. A) Osmotic stress and B) Starvation stress survival curves for heterozygotes carrying both the deficiency and Dh31

01 or Dh31rev allele. Each data point is the mean of three replicate

experiments consisting of thirty flies each. C) Osmotic stress and D) Starvation stress TD50s of deficieny lines. The Dh31

rev and Dh3101 results are also presented for

comparison. * Indicate significant difference from revertant homozygotes.

**

**

* *

**

Starvation StressBOsmotic StressA Starvation StressBOsmotic StressA

18

lines (with insertions mapping to different chromosomal loci) possessing the 17415

receptor promoter (generously donated by Paul Taghert, Washington University in St.

Louis). Evaluation of the progeny from these crosses resulted in a partial phenocopy of

Dh31 loss of function mutants (Figure 6) [Osmotic: Females: F = 432, p= 3.73E-11, Males:

F = 77.38, p = 1.75E-7 Starvation: Females: F = 31.9, p= 1.15E-5, Males: F = 34.8, p =

7.65E-6 (ANOVA)].

To test the hypothesis that DH31 signaling mediates stress responses by altering

corazonin neuronal function, we also tested the effects of DH31 Receptor knockdown in

corazonin neurons. To do this we crossed the UAS- DH31 Receptor – RNAi line to a Crz-

GAL4 line (Johnson et al., 2005) and evaluated the progeny in the same manner as our

mutant genotypes. Analysis of these results revealed that R-RNAi-Crz flies phenocopied

the stress response phenotypes seen in Dh31 loss of function lines and were significantly

different from the Dh31rev line (Figure 6) [Osmotic: Females: F = 40.16, p=.000336,

Males: F = 35.48, p = .000474 Starvation: Females: F = 39.897, p=.000342, Males: F =

36.12, p = .000451 (ANOVA)]. Preliminary analysis of corazonin transcript levels in the

revertant and Dh31 loss of function lines revealed a baseline two and a half fold increase

of corazonin transcript in Dh3101 and Dh31

02 when compared with Dh31rev .

Loss of Dh31 Function Impacts Locomotor Activity

As previously discussed, increased activity levels are part of the characteristic

suite of responses in the general stress response. We tested the possibility that altered

lifespans in Dh31 mutants may stem from changes in this behavior.

19

Locomotor analysis of Dh31 loss of function mutants under normal conditions

showed an abnormal activity pattern compared with wild type. Specifically, a decreased

startle response and generalized hyperactivity were observed in Dh31 mutant alleles

C DOsmotic Stress Starvation Stress

***

**

*

*

*

**

*

* *

C DOsmotic Stress Starvation StressC DOsmotic Stress Starvation StressC DOsmotic Stress Starvation Stress

***

**

*

*

*

**

*

* *

Figure 6. DH31-Receptor Knockdown Phenocopies Dh31 Loss of Function Lines. A) Osmotic stress and B) Starvation stress survival curves for DH31-Receptor RNAiknockdown lines using either a 17415 (DH31-R)-Gal4 driver or Crz-Gal4 driver and a DH31-R-LacZ control line. Each data point is the mean of three replicate experiments, consisting of thirty flies each. C) Osmotic stress and D) Starvation stress TD50s for receptor knockdown lines and the DH31-R-LacZ control. The Dh31

rev and Dh3101

results are also presented for comparison. * Indicate significant difference from the DH31-R-LacZ control line.

BA Osmotic Stress Starvation StressBA Osmotic Stress Starvation Stress

20

compared to revertants (Figure 7)[Females: F = 862.5, p= 4.2E-8, Males: F = 411.5, p =

3.8E-7 (ANOVA)].

To again confirm that these phenotypes were associated with a loss of DH31

signaling and not some alternative effects of our P-element excision, we conducted

locomotor analysis on deficiency lines as well as the previously described RNAi receptor

knockdown lines. Deficiency mapping once again confirmed that the observed

phenotype, in this case hyperactivity, maps to the Dh31 locus [Females: F = 236.7, p=

3.8E-8, Males: F = 126.314, p = 4.5E-7 (ANOVA)]. Whereas, in contrast, RNAi

knockdown of the DH31 receptor was indistinguishable from wildtype and revertant

activity levels and patterns (Figure 7)[Females: F =196.75, p= 7.8E-8, Males: F = 421.38,

p = 3.8E-9 (ANOVA)].

DH31 Expression Analysis

In efforts to identify the functional roles and effects of Dh31 signaling, we also

conducted experiments aimed at identifying the various cell populations and regions in

which the DH31 neuropeptide is expressed. Adult wild type brains were stained with the

DH31 antibody, previously described in the mutant analysis section. (Figure 8A). This

analysis has indicated that, in addition to specific expression of DH31 within diverse

populations in the central brain, we observed intensely labeled processes within the

ventral nerve cord. In addition, we observed specific immunolabeling within

neuroendocrine cells in the gut as has been previously described for the larva (Veenstra

2009). DH31 immunolabeling also appears to be localized to cells known to express

critical components of the circadian clock, although specific definitions of these cellular

21

DTotal Female Activity Total Male ActivityC DTotal Female Activity Total Male ActivityC

Figure 7. Loss of Dh31 Function Results in Abnormal Locomotor Activity. Locomotion was monitored for forty-eight hours with different Dh31 lines. Data are means from three replicate experiments, consisting of thirty flies each. Flies were maintained on a 12:12 LD cycle and records begin at lights on (ZT0). Representativepopulation activity patterns for Dh31

01 (blue) and wildtype (gray) A) female and B)male flies. Total daily activity graphs for all C) female and D) male genotypes tested. * Indicate significant difference from revertant line.

A BFemale Activity Male ActivityA BFemale Activity Male ActivityA BFemale Activity Male ActivityA BFemale Activity Male Activity

* *

*

*

22

populations are ongoing. Expression in the ventral nerve cord suggests that the peptide is

involved in eliciting some peripheral effects, as does its expression in the gut.

We also performed studies to address the expression patterns of the DH31-R, as

these results might reveal the targets of DH31 modulation. Analysis of the progeny from

two different 17415-GAL4 lines crossed to a UAS-lacZ confirms that these drivers

include the corazonin neurons (Figure 8B). In addition, lacZ staining was observed in

other cellular populations within the brain, and we are currently engaged in mapping the

full extent of driver expression.

Figure 8. DH31 and DH31-R Expression. A) DH31 antibody labeling of adult wildtype flies shows DH31 expression in cell populations of the central brain, ventral nerve cord, neuroendocrine cells of the gut, as well as the optic lobe. B) DH31-R GAL4 driven lacZ expression is colocalized with corazonin in the central brain.

A B

23

DISCUSSION

We report here the generation of two functional null Dh31 mutations, Dh3101 and

Dh3102, and the generation of a revertant line, Dh31

rev from various excision events from

the parental KG09001 line. Lifespan analysis of these lines under stress conditions

indicated that the loss of Dh31 function resulted in hypersensitivity to both osmotic and

starvation stress. In addition, locomotor analysis of these lines revealed abnormal and

significantly increased activity patterns when compared to wild type flies. We predict

that these phenotypes are the direct consequence of the specific loss of DH31 signaling,

because these phenotypes map to the Dh31 locus as confirmed through deficiency

mapping, and because RNAi knockdown of the DH31 specific receptor produced similar

phenotypes.

The lack of expression of the DH31 neuropeptide as evaluated by

immunocytochemistry and the Dh31 transcript as evaluated by RT-PCR in these mutant

lines confirmed that these alleles are loss of function variants, though the exact molecular

definitions of the lesions are still under investigation. In addition, deficiency mapping

further verified that the observed phenotypes and functional effects reported herein are

results of alterations at this region of interest. The presence of orphan genes flanking this

region has been molecularly confirmed in both mutant lines, so it is unlikely that

alterations at these genes are the source of the phenotypes observed. The presence of

multiple alleles exhibiting a loss of Dh31 function and identical phenotypes, deficiency

mapping of observed phenotypes to the region of interest, and RNAi receptor knockdown

phenocopying of these phenotypes, allowed us to conclude that the observed alterations

in stress response are the result of the loss of Dh31 function(s).

24

Previous investigations of DH31 signaling have implicated this hormone in a

diverse range of functional roles. The eponymous function of DH31 is as a modulator of

Malpighian tubule physiology and participates in ionic homoeostasis (Coast et al. 2001;

Johnson et al. 2005). Specifically, the DH31 receptor is expressed in the Malpighian

tubule (Johnson et al. 2005), and one prediction may be that elimination of this signaling

could negatively impact a fly’s ability to regulate ionic balance under osmotic stress. The

loss of tubule regulation in the lines generated here in animals lacking DH31 might

explain the hypersensitivity to osmotic stress exhibited in these mutant lines. However,

while we cannot rule out that the lack of DH31 signaling at the tubule contributes to this

sensitive phenotype, our results from the specific loss of DH31 receptor signaling in

corazonin neurons suggests that the phenotypes associated with DH31 cannot be simply

explained by the lack of peripheral signaling in Dh31 mutants. Additionally, the Dh31

mutant alleles are hypersensitive to heterotypic stresses, such as starvation. Thus, we

favor a model in which, DH31 is also participating in central circuits that mediate

behavioral responses to various physiological stresses.

As previously discussed, sequence and receptor similarity between the

mammalian stress hormones GnRH, CRF, and CGRP and the Drosophila neuropeptides

corazonin, DH44, and DH31 respectively, suggest a homologous central circuit (Figure. 1)

that is modulated in response to physiological stresses. Working within the context of

this model, another hypothesis for the observed hypersensitivity to both osmotic as well

as starvation stress focuses on the modulation of corazonin secretion via DH31. The

DH31-R is expressed in the complete complement of corazonin expressing neurons

(Johnson et al. 2005). Furthermore, recent studies in our lab have shown not only that

25

corazonin expression is inhibited by stress, but also that ablation of corazonin neurons

results in significantly increased lifespan under stress (Zhao et al., submitted). Because

the ablation of corazonin neurons results in a complete loss of corazonin secretion, and

that stress normally inhibits corazonin expression, the heightened inhibition of corazonin

could be responsible for increased lifespan under stress. If this is the case, then the

expectation is that decreased inhibition of corazonin secretion might result in shorter

lifespan during stress. This suggests that DH31 acts as an inhibitor of corazonin in

response to stress, and baseline analysis of corazonin transcript levels across our

genotypes shows a robust increase of corazonin transcript in our loss of Dh31 function

mutants relative to the revertant line. Further analysis is under way to evaluate the

changes in corazonin transcript under stress in these lines. In addition, we have already

reported here the impact of DH31-Receptor knockdown in corazonin cells on survival

under stress conditions, and found that these results phenocopy those of our functionally

null mutants. This hypothesis is consistent with the homologies between the mammalian

and Drosophila neuroendocrine circuits. Mammalian CGRP acts to suppress GnRH

release under stress conditions (Li et al. 2004), and our results suggest that not only are

the neurotransmitter identities of the circuit conserved, but also the actions of these

endocrine factors.

To further evaluate the role of DH31 signaling as a critical determinant of stress

responses, we reduced the expression of the DH31 receptor. Evaluation of these lines

resulted in a partial phenocopy of Dh31 mutant lifespan phenotypes but not Dh31 mutant

locomotor phenotypes. The inability of flies in which receptor expression had been

knocked down to phenocopy in full mutant lifespan phenotypes might be expected based

26

on the technical limitations of RNAi knockdown combined with the stability of the

receptor molecule. Additionally, the as of yet unidentified strength and expression

pattern of the 17415-Gal4 lines may be such that these fail to deliver the requisite amount

of knockdown, or alternatively fail to capture the full expression pattern of the DH31-

Receptor. The lack of any significant difference between receptor knockdown and

revertant genotypes in the amount of locomotor activity may also be a result of these

previously described factors. Another possibility is that DH31 is acting through a

different receptor (presently unidentified) which affects locomotor activity and so

knocking down only the 17415-Dh31-Receptor does not result in mutant locomotor

phenotypes. Additionally, it could be that there are other bioactive molecules emanating

from the Dh31 locus, and may include fragments from the pre-pro forms of DH31. In this

scenario, the loss of Dh31 function alleles might include this other bioactive molecule, the

signaling of which would be independent of the known DH31-R. Nonetheless, this result

suggests that the observed locomotor and lifespan phenotypes are genetically separable

and reinforces the multifunctional nature of Dh31 signaling.

We are currently conducting two additional lines of investigation that may shed

more light on the specifics of where DH31 is acting to elicit these various phenotypes.

Expression analysis of the DH31-R suggests that it may also be expressed in the corpus

cardiacum which is the region responsible for producing adipokinetic hormone (AKH)

(Johnson et al. 2005), which is an important hormone regulating energy balance (Isabel et

al. 2005). If DH31 signaling is modulating AKH production and/or release, this indirect

modulation of energy stores could underlie the phenotypes observed in Dh31 mutants.

Future studies to evaluate this include restricted expression of the DH31-R RNAi element

27

to AKH neuroendocrine cells. Additionally, previous studies have indicated a role for

DH31 in mediating circadian behaviors, and our observation of DH31 expression in the

optic lobes is consistent with a potential role in modulation of photic sensitivity (Shafer et

al. 2008). This suggests that deregulation of this function in our mutants may ultimately

be responsible for some of the observed locomotor phenotypes, and in particular the lack

of a startle response

The results reported herein support and strengthen the understanding of DH31 as a

critical and multifunctional peptide that acts in an important manner to modulate the

response to physiological stresses. The generation of null Dh31 lines now opens up the

full tool box of molecular and genetic techniques available in Drosophila for further

investigating the full breadth and exact mechanisms in which Dh31 acts. One follow up

study currently underway is to quantify corazonin transcript levels in our mutant lines, to

verify that DH31 is indeed acting to inhibit corazonin levels in response to stress. In

addition, now that we have created a null background we can begin to create complicated

mosaics of Dh31 expression in which we use a variety of Gal4 drivers to express the

peptide in discrete cell types and tease apart where and how DH31 is acting to effect the

observed and possibly as of yet unidentified phenotypes.

28

REFERENCES Bale, T. L. and W. W. Vale (2004). "CRF and CRF receptors: role in stress responsivity

and other behaviors." Annu Rev Pharmacol Toxicol 44: 525-57. Brand, A. H. and N. Perrimon (1993). "Targeted gene expression as a means of altering

cell fates and generating dominant phenotypes." Development 118(2): 401-15. Broughton, S. J., M. D. Piper, T. Ikeya, T. M. Bass, J. Jacobson, Y. Driege, P. Martinez,

E. Hafen, D. J. Withers, S. J. Leevers and L. Partridge (2005). "Longer lifespan, altered metabolism, and stress resistance in Drosophila from ablation of cells making insulin-like ligands." Proc Natl Acad Sci U S A 102(8): 3105-10.

Brugge, V. A., D. A. Schooley and I. Orchard (2008). "Amino acid sequence and

biological activity of a calcitonin-like diuretic hormone (DH31) from Rhodnius prolixus." J Exp Biol 211(Pt 3): 382-90.

Buffet, N. C. and P. Bouchard (2001). "The neuroendocrine regulation of the human

ovarian cycle." Chronobiol Int 18(6): 893-919. Cazzamali, G., N. Saxild and C. Grimmelikhuijzen (2002). "Molecular cloning and

functional expression of a Drosophila corazonin receptor." Biochem Biophys Res Commun 298(1): 31-6.

Charmandari, E., C. Tsigos and G. Chrousos (2005). "Endocrinology of the stress

response." Annu Rev Physiol 67: 259-84. Chen, M. D., K. T. O'Byrne, S. E. Chiappini, J. Hotchkiss and E. Knobil (1992).

"Hypoglycemic 'stress' and gonadotropin-releasing hormone pulse generator activity in the rhesus monkey: role of the ovary." Neuroendocrinology 56(5): 666-73.

Christopoulos, G., K. J. Perry, M. Morfis, N. Tilakaratne, Y. Gao, N. J. Fraser, M. J.

Main, S. M. Foord and P. M. Sexton (1999). "Multiple amylin receptors arise from receptor activity-modifying protein interaction with the calcitonin receptor gene product." Mol Pharmacol 56(1): 235-42.

Coast, G. M., S. G. Webster, K. M. Schegg, S. S. Tobe and D. A. Schooley (2001). "The

Drosophila melanogaster homologue of an insect calcitonin-like diuretic peptide stimulates V-ATPase activity in fruit fly Malpighian tubules." J Exp Biol 204(Pt 10): 1795-804.

He, D., T. Funabashi, A. Sano, T. Uemura, H. Minaguchi and F. Kimura (1999). "Effects

of glucose and related substrates on the recovery of the electrical activity of gonadotropin-releasing hormone pulse generator which is decreased by insulin-

29

induced hypoglycemia in the estrogen-primed ovariectomized rat." Brain Res 820(1-2): 71-6.

Hewes, R. S. and P. H. Taghert (2001). "Neuropeptides and neuropeptide receptors in the

Drosophila melanogaster genome." Genome Res 11(6): 1126-42. Isabel, G., J. R. Martin, S. Chidami, J. A. Veenstra and P. Rosay (2005). "AKH-

producing neuroendocrine cell ablation decreases trehalose and induces behavioral changes in Drosophila." Am J Physiol Regul Integr Comp Physiol 288(2): R531-8.

Johnson, E. C., L. M. Bohn and P. H. Taghert (2004). "Drosophila CG8422 encodes a

functional diuretic hormone receptor." J Exp Biol 207(Pt 5): 743-8. Johnson, E. C., O. T. Shafer, J. S. Trigg, J. Park, D. A. Schooley, J. A. Dow and P. H.

Taghert (2005). "A novel diuretic hormone receptor in Drosophila: evidence for conservation of CGRP signaling." J Exp Biol 208(Pt 7): 1239-46.

Kim, Y. J., I. Spalovska-Valachova, K. H. Cho, I. Zitnanova, Y. Park, M. E. Adams and

D. Zitnan (2004). "Corazonin receptor signaling in ecdysis initiation." Proc Natl Acad Sci U S A 101(17): 6704-9.

Lee, G. and J. H. Park (2004). "Hemolymph sugar homeostasis and starvation-induced

hyperactivity affected by genetic manipulations of the adipokinetic hormone-encoding gene in Drosophila melanogaster." Genetics 167(1): 311-23.

Li, X. F., J. E. Bowe, J. C. Mitchell, S. D. Brain, S. L. Lightman and K. T. O'Byrne

(2004). "Stress-induced suppression of the gonadotropin-releasing hormone pulse generator in the female rat: a novel neural action for calcitonin gene-related peptide." Endocrinology 145(4): 1556-63.

Neckameyer, W. S. and J. S. Weinstein (2005). "Stress affects dopaminergic signaling

pathways in Drosophila melanogaster." Stress 8(2): 117-31. Park, D., J. A. Veenstra, J. H. Park and P. H. Taghert (2008). "Mapping peptidergic cells

in Drosophila: where DIMM fits in." PLoS ONE 3(3): e1896. Park, Y., Y. J. Kim and M. E. Adams (2002). "Identification of G protein-coupled

receptors for Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-receptor coevolution." Proc Natl Acad Sci U S A 99(17): 11423-8.

Reagan, J. D. (1994). "Expression cloning of an insect diuretic hormone receptor. A

member of the calcitonin/secretin receptor family." J Biol Chem 269(1): 9-12.

30

Rush, B., S. Sandver, J. Bruer, R. Roche, M. Wells and J. Giebultowicz (2007). "Mating increases starvation resistance and decreases oxidative stress resistance in Drosophila melanogaster females." Aging Cell 6(5): 723-6.

Selye, H. (1950). "Stress and the general adaptation syndrome." Br Med J 1(4667): 1383-

92. Shafer, O. T., D. J. Kim, R. Dunbar-Yaffe, V. O. Nikolaev, M. J. Lohse and P. H.

Taghert (2008). "Widespread receptivity to neuropeptide PDF throughout the neuronal circadian clock network of Drosophila revealed by real-time cyclic AMP imaging." Neuron 58(2): 223-37.

Tawfik, A. I., S. Tanaka, A. De Loof, L. Schoofs, G. Baggerman, E. Waelkens, R. Derua,

Y. Milner, Y. Yerushalmi and M. P. Pener (1999). "Identification of the gregarization-associated dark-pigmentotropin in locusts through an albino mutant." Proc Natl Acad Sci U S A 96(12): 7083-7.

Taylor, M. M. and W. K. Samson (2005). "Stress hormone secretion is altered by central

administration of intermedin/adrenomedullin-2." Brain Res 1045(1-2): 199-205. Veenstra, J. A. (1989). "Isolation and structure of corazonin, a cardioactive peptide from

the American cockroach." FEBS Lett 250(2): 231-4. Veenstra, J. A. (2009). "Peptidergic paracrine and endocrine cells in the midgut of the

fruit fly maggot." Cell Tissue Res 336(2): 309-23. Veenstra, J. A., H. J. Agricola and A. Sellami (2008). "Regulatory peptides in fruit fly

midgut." Cell Tissue Res 334(3): 499-516. Wise, S., N. T. Davis, E. Tyndale, J. Noveral, M. G. Folwell, V. Bedian, I. F. Emery and

K. K. Siwicki (2002). "Neuroanatomical studies of period gene expression in the hawkmoth, Manduca sexta." J Comp Neurol 447(4): 366-80.

Zhao, Y., Bretz, C.A., Hawksworth, S.A., Hirsh, J., and Johnson, E.C. (2009).

“Corazonin neurons function in sexual dimorphic circuitry that shape behavioral responses to stress in Drosophila.” (Submitted)

31

APPENDICES

A. Excision Scheme For KG09001 P-element

32

CG13

096

→1F→12 ← 13

← 1R

→10→8

→2

← 11← 9

← 5← 3

← 1

→6

← R1

CG13

088

CG13

095

1.2

kb13

610

9

KG09

001→14

←15

126

1.3k

b31

833

316

410

.3kb

← 7

→4

CG13

096

→1F →1F→12 →12 ← 13← 13

← 1R← 1R

→10 →10→8 →8

→2 →2

← 11← 11← 9← 9

← 5← 5← 3← 3

← 1← 1

→6 →6

← R1← R1

136

CG13

088

CG13

095

1.2

kbCG

1309

5CG

1309

5

1.2

kb10

916

412

6

KG09

001→14

←15KG

0900

1→14

←15KG

0900

1→14 →14

←15 ←15

333

1.3k

b31

810

.3kb

← 7← 7

→4 →4

B. P

rimer

Map

33

C. Primer Sequences and Locations

Primer Primer Sequence 5’-3’ Primer Location 1 ACATCGGTCTCGGATCGTC End of ORF 2 CCAAACGAACCGTGGACTT 4th Exon 3 RC OF 2 4th Exon 4 TGTGCAACTAAAGTTCTCTTACTCA 4th Intron 5 RC OF 4 4th Intron 6 CTGGCTATAACGAACTGGAGGAG 3rd Exon 7 RC OF 6 3rd Exon 8 TCAAACTCAATTTCCCTTCCA Flanking P-element 3’ 9 RC OF 8 Flanking P-element 3’ 10 TTCCAATTTGGCTGAACACA Flanking P-element 5’ 11 RC OF 10 Flanking P-element 5’ 12 GTGTTATGAAGGCAATGACAGAAG 2nd Intron 13 RC OF 12 2nd Intron 14 CACCCAAGGCTCTGCTCCCACAAT KG09001 5’ 15 TATCGCTGTCTCACTCAG KG09001 3’ 1F CGCTGTAGTAGTGCTCCTGGCAGC CG13095 5’ 1R GCGGATCGTTAATTAGGCGAC CG13095 3’ R1 GCGCGATTATGCTTACACTTG Outside ORF 3’ Side

RT-PCR Primers

DH31-F GAACTTTGATCGCAAATAAAGCGA Dh31 mRNA DH31-R CGGTCTCATCCAGACGCCTTAGAC Dh31 mRNA RP49-F ACAAATGGCGCAAGCCCAAGG House Keeping Gene RP49-R ATGTGGCGGGTGCGCTTGTT House Keeping Gene

34

D. PCR Protocols

5ul 10x Extaq Buffer 4ul DNTP Mix 1.25ul Primer A 1.25ul Primer B

1ul DNA Template .065ul Extaq 37.5ul DH20

Primer Pairings Optimal Temperature (C)

10-R1 52 10-1 56 – 65 10-5 50 – 52 10-9 50 10-15 55 1F-1R 56 - 65 6-R1 64 4-R1 56 2-R1 50 – 65 8-1 52 – 65 12-9 50-52

E. Stocks Used

Lines Stock Center W1118 Bloomington

KG09001 Bloomington Wi; Kr/Cy; D/TM6 Bloomington

Ki Delta 2-3 Bloomington Df(2l exel 7038)/Cyo Bloomington UAS-Dh31R-RNAi Taghert (UnPub)

17415-Gal4 (X) Taghert (UnPub) 17415-Gal4 (II) Taghert (UnPub)

Crz –Gal4 Johnson et al 2005 PDF-Gal4 Renn et al 1999

CCAP-Gal4 Park et al 2003 UAS- LacZ Bloomington

35

F. TD50 of Genotypes Under Stress Conditions Genotype Osmotic Starvation

♀ ♂ ♀ ♂

Dh31rev 84.0 ± 2.3 84.0 ±0.3 74.8 ± 3.2 47.0 ±3.4

Dh3101 48.0 ± 1.0 36.0 ± 2.5 60.1 ± 2.4 33.2 ±1.3

Dh3102 54.2 ± 2.1 48.0 ± 0.3 60.0 ± 3.8 24.0 ±0.3

Df// Dh31rev 96.0 ± 0.4 76..9 ± 8.2 84.8 ± 3.3 42.9 ±1.7

Df// Dh3101 63.7 ± 1.8 52.1 ± 1.5 58.8 ± 3.7 35.0 ±1.4

Dh31R-RNAi-17415(X) 72.0 ± 0.4 71.2 ± 3.3 72.0 ± 0.3 24.0 ± 4.2 Dh31R -RNAi- Crz 60.0 ± 0.5 36.0 ± 0.5 60.0 ± 0.6 36.0 ± 0.1

LacZ-17415(X) 90.7 ± 2.7 99.8 ± 6.3 90.3 ± 5.2 48.6 ± 4.6 G. Total Daily Activity of Genotypes

Genotype Daily Activity ♀ ♂

Dh31rev 58949 ± 3152 79865 ± 7654

Dh3101 230832± 9568 222522 ±7865

Df// Dh31rev 60880 ± 12664 87591 ± 25021

Df// Dh3101 228226 ± 14978 278797 ± 13676

Dh31R-RNAi-17415(X) 59258± 17180 64603 ± 1395 Dh31R-RNAi- Crz 100353 ± 2640 104209 ± 4898

36

SCHOLASTIC VITA

COLIN ANDREW BRETZ

BORN: March 1, 1985, Miami, Florida

UNDERGRADUATE Vanderbilt University STUDY: Nashville, TN B.S., Interdisciplinary Neuroscience, 2007

GRADUATE STUDY: Wake Forest University M.S., Biology, 2009

Thesis Title: Genetic Dissection of Dh31 Signaling In Drosophila

SCHOLASTIC AND PROFESSIONAL EXPERIENCE:

Undergraduate Research Assistant, Vanderbilt University, 2006 - 2007

Graduate Teaching Assistant, Wake Forest University, 2007 – 2009

Graduate Research Assistant, Wake Forest University, 2007 - 2009

PUBLICATIONS:

Zhao, Y., Bretz, C.A., Hawksworth, S.A., Hirsh, J., and Johnson, E.C. Corazonin neurons function in sexual dimorphic circuitry that shape behavioral responses to stress in Drosophila. (Submitted-Genetics) Hector, C.E*., Bretz, C.A*., Zhao, Y., and Johnson, Erik. C. Functional differences between two CRF-related diuretic hormone receptors in Drosophila. (Submitted JEB) * Co-first author

In prep: Bretz, C.A., Zhao, Y., and Johnson, Erik. C. Genetic Dissection of Dh31 signaling in Drosophila. Johnson, E.C., Kazgan, N., Bretz, C.A., Zhao, Y., and Brenman, J.E. Metabolic defects are caused by a reduction in functional AMPK in Drosophila. ABSTRACTS: Bretz, C.A, and Johnson, E.C. (2009). Behavioral phenotypes associated with DH31 neurohormone signaling in Drosophila. 50th Annual Drosophila Research Conference.

37

Hector, C.E., Bretz, C.A., and Johnson, E.C. (2009). The role of AMP-activated protein kinase signaling in the Drosophila ovary. 50th Annual Drosophila Research Conference. Bretz, C.A. and Johnson, E.C., (2008). Genetic dissection of DH31 signaling in Drosophila. 24th Annual Perspectives in Biology Symposium. Johnson, E.C., Kazgan, N., Bretz, C.A., Zhao, Y., and Brenman, J.E., (2008). A reduction in AMP-activated kinase function causes multiple behavioral changes and metabolic defects in Drosophila. 24th Annual Perspectives in Biology Symposium. Johnson, E.C., Bretz, C.A, and Williamson, L. (2008). Integration of neuropeptidergic signaling and stress behaviors via the AMP-activated kinase in Drosophila. 23rd International Conference of Entomology.