General enquiries on this form should be made to:Defra, Science Directorate, Management Support and Finance Team,Telephone No. 020 7238 1612E-mail: research.competitions@defra.gsi.gov.uk

SID 5 Research Project Final Report

SID 5 (Rev. 3/06) Page 1 of 14

NoteIn line with the Freedom of Information Act 2000, Defra aims to place the results of its completed research projects in the public domain wherever possible. The SID 5 (Research Project Final Report) is designed to capture the information on the results and outputs of Defra-funded research in a format that is easily publishable through the Defra website. A SID 5 must be completed for all projects.

This form is in Word format and the boxes may be expanded or reduced, as appropriate.

ACCESS TO INFORMATIONThe information collected on this form will be stored electronically and may be sent to any part of Defra, or to individual researchers or organisations outside Defra for the purposes of reviewing the project. Defra may also disclose the information to any outside organisation acting as an agent authorised by Defra to process final research reports on its behalf. Defra intends to publish this form on its website, unless there are strong reasons not to, which fully comply with exemptions under the Environmental Information Regulations or the Freedom of Information Act 2000.Defra may be required to release information, including personal data and commercial information, on request under the Environmental Information Regulations or the Freedom of Information Act 2000. However, Defra will not permit any unwarranted breach of confidentiality or act in contravention of its obligations under the Data Protection Act 1998. Defra or its appointed agents may use the name, address or other details on your form to contact you in connection with occasional customer research aimed at improving the processes through which Defra works with its contractors.

Project identification

1. Defra Project code SE1783

2. Project title

Examination of genes differentially expressed in immune cells following BSE challenge

3. Contractororganisation(s)

Roslin InstituteRoslinMidlothianEH25 9PS          

54. Total Defra project costs £ 427,602(agreed fixed price)

5. Project: start date................ 01 January 2003

end date................. 31 October 2007

SID 5 (Rev. 3/06) Page 2 of 14

6. It is Defra’s intention to publish this form. Please confirm your agreement to do so...................................................................................YES NO (a) When preparing SID 5s contractors should bear in mind that Defra intends that they be made public. They

should be written in a clear and concise manner and represent a full account of the research project which someone not closely associated with the project can follow.Defra recognises that in a small minority of cases there may be information, such as intellectual property or commercially confidential data, used in or generated by the research project, which should not be disclosed. In these cases, such information should be detailed in a separate annex (not to be published) so that the SID 5 can be placed in the public domain. Where it is impossible to complete the Final Report without including references to any sensitive or confidential data, the information should be included and section (b) completed. NB: only in exceptional circumstances will Defra expect contractors to give a "No" answer.In all cases, reasons for withholding information must be fully in line with exemptions under the Environmental Information Regulations or the Freedom of Information Act 2000.

(b) If you have answered NO, please explain why the Final report should not be released into public domain

Executive Summary7. The executive summary must not exceed 2 sides in total of A4 and should be understandable to the

intelligent non-scientist. It should cover the main objectives, methods and findings of the research, together with any other significant events and options for new work.Early detection and identification of the infectious agent or infected individuals are key elements in the effective control of infectious diseases. Transmissible spongiform encephalopathies (TSE), including bovine Transmissible spongiform encephalopathy (BSE) present particular challenges for early diagnosis. Infectivity is associated with a modified form of an endogenous protein, the prion protein, PrP, which can be considered to be the infectious agent, assuming that the prion hypothesis is true. Thus, detection of the ‘infectious agent’ is a problem. TSEs are characterised by a long asymptomatic incubation period when compared with other infectious disease. Thus, early detection of infection is difficult.

The question posed in this project is – are there host responses to BSE infection that can be detected before the onset of overt signs or symptoms of the disease? Can such responses be detected at the most fundamental level in terms of changes which host genes are expressed?

The aim of this project was to examine gene expression profiles of immune cells from normal and infected individuals to identify markers that may be used to diagnose infection at very early stages.

The scientific objectives of the project were:To create the tools to study genes that are expressed and differentially regulated in immune cells of cattle.To use these tools (a cattle-specific micro-array) to investigate changes in patterns of gene expression in lymphoid and spleen cells in normal and BSE infected individuals.

Development of microarray for gene expression profiling in cattle: A 30K-feature cattle microarray was developed and fabricated within the ARK-Genomics Centre for Functional Genomics in Farm Animals. The microarray comprises probes for 30,000 different cattle transcripts spotted onto glass slides. These cDNA microarray resources have been used for a range of gene expression analyses in both cattle and sheep in addition to those undertaken in the context of the current project.

Monitoring changes in gene expression following exposure to BSE: Samples from two BSE-challenge experiments were analysed for evidence of changes in gene expression over time post infection and for differences in gene expression between infected and control animals. The challenge experiments were a) the DEFRA funded controlled BSE challenge project SE1736 that was carried out at the Veterinary Laboratories Agency, Weybridge; Holstein cattle were fed 100 g of BSE infected brain tissue and samples of spleen tissue was collected at 3, 6, 9, 12, 15, 18 and 24 months post infection (mpi) from infected animals and matched control animals; and b) a BSE challenge set up at Greifswald, Germany under the DEFRA funding (SE1786) which comprised four Simmental cattle fed 100 g of BSE-infected brain tissue

SID 5 (Rev. 3/06) Page 3 of 14

plus three control animals; the animals were blood sampled at three-six month intervals.

Although differential expression of some genes was observed at specific time points in the spleen samples there was no consistent pattern across the time course of the study. This lack of consistent patterns may in part be due to the lack of replicates at some time points as well as inconsistent (spatial) sampling of the spleens, i.e. only a very small proportion of each spleen is required for RNA isolation and each spleen aliquot may not have been taken from the same part of the spleen.

Almost all the biomarkers for TSEs as reported by others concern molecules present in the central nervous system. Several hundred such biomarkers have been identified, but to date none represent credible markers for pre-symptomatic diagnosis or surveillance. Rather the utility of these biomarkers is in the differential diagnosis once disease symptoms have manifest themselves, i.e. to distinguish TSE from other neurodegenerative disorders. This differential diagnosis is important in human medicine, but of limited value in the early detection of TSEs in food animals such as cattle, sheep and goats.

This project (SE1783) remains relatively unique in addressing the search for pre-symptomatic markers of TSE disease and in its focus on spleen and blood. Changes in gene expression and differential gene expression between infected and control animals were observed. However, none of the patterns of differential gene expression or changes in gene expression were sufficiently consistent or compelling as robust markers of pre-symptomatic TSE disease in the absence of further evidence.

This project has identified a number of genes that exhibit differential expression between BSE-challenged and control animals before the emergence of symptoms of BSE. These differences in gene expression have been confirmed, in part, by using two different methods – microarray-based expression profiling and quantitative real-time PCR (QPCR). However, validation of these differences in gene expression as markers of pre-symptomatic BSE disease would require testing additional animals.

Project Report to Defra8. As a guide this report should be no longer than 20 sides of A4. This report is to provide Defra with

details of the outputs of the research project for internal purposes; to meet the terms of the contract; and to allow Defra to publish details of the outputs to meet Environmental Information Regulation or Freedom of Information obligations. This short report to Defra does not preclude contractors from also seeking to publish a full, formal scientific report/paper in an appropriate scientific or other journal/publication. Indeed, Defra actively encourages such publications as part of the contract terms. The report to Defra should include: the scientific objectives as set out in the contract; the extent to which the objectives set out in the contract have been met; details of methods used and the results obtained, including statistical analysis (if appropriate); a discussion of the results and their reliability; the main implications of the findings; possible future work; and any action resulting from the research (e.g. IP, Knowledge Transfer).

SID 5 (Rev. 3/06) Page 4 of 14

IntroductionEarly detection and identification of the infectious agent or infected individuals are key elements in the effective control of infectious diseases. Transmissible spongiform encephalopathies (TSE), including bovine Transmissible spongiform encephalopathy (BSE) present particular challenges for early diagnosis. Infectivity is associated with a modified form of an endogenous protein, the prion protein, PrP, which can be considered to be the infectious agent, assuming that the prion hypothesis is true. Thus, detection of the ‘infectious agent’ is a problem. TSEs are characterised by a long asymptomatic incubation period when compared with other infectious disease. Thus, early detection of infection is difficult.

Diagnostic efforts have primarily focussed on the detection of disease-specific isoform of the host prion protein (PrPres), for example in a tonsil biopsy. However, this method is of limited value as PrP res is undetectable in tonsil biopsies in some individuals and species, such as BSE infected cattle (Coghlan 1996). Other than the laborious and invasive detection of the disease-specific PrPres there are no effective in vivo tests for TSE infection in cattle, for example, there are no proven methods of diagnosis using readily accessible tissues such as blood or lymphoidal tissues.

The question posed in this project is – are there host responses to the infection that can be detected before the onset of overt signs or symptoms of the disease? Can such responses be detected at the most fundamental level in terms of changes which host genes are expressed?

Little is known regarding the affect of TSE infection on general gene expression or regulation. Studies of mRNA in scrapie infected neuroblastoma cells in culture have detected five genes with altered expression levels (Doh-ura et. al. 1995). Work done in vivo has focused on the terminal stages of infection in a mouse TSE model (e.g. Duguid and Trzepacz, 1993, Campbell et al., 1994), however, the differentially expressed genes revealed in these studies are a direct result of the neuro-degenerative process, resulting in visible pathology.

It has been established in rodents that the lymphoreticular system, particularly B lymphocytes and dendritic cells of the spleen, play an important role in the replication of the scrapie agent (Brown et al. 1999 and Klein et al. 1998), however, the precise role of these cells and the specific mechanisms involved are unknown. Analysis of the transcription events in scrapie challenged mice using differential display methods (Miele et al. 2001) has identified a novel erythroid cell-specific marker (erythroid differentiation-related factor, EDRF) that is down-regulated in precursor erythroid cells in infected individuals. Whilst useful information can be obtained from model organisms, such as mice, it is important to examine the target species, as biological differences are known to exist between species, e.g. the spleen does not appear to harbour infective material in BSE in cattle. A MAFF funded study, designed to assess infectivity in the lymph nodes and spleen of BSE infected cattle, did not detect clinical signs of disease 86 month following inter-cerebral challenge of healthy cattle with these tissues taken from infected individuals. However, an inability to detect the infectious agent in these tissues does not preclude them from involvement in the disease, as they are known to express PrPC (Horiuchi et al. 1997).

In order to evaluate whether changes in host gene expression in response to BSE infection could form the basis of pre-symptomatic diagnostic test it would be desirable to examine changes in expression of as many genes as possible. It would also be desirable to look for such putative changes in gene expression in cells or tissues likely to be exposed to the infectious agent at early stages of the infection and preferably cells that can be readily biopsied.

In cattle, the most likely source of TSE infection was / is from feed, with the infectious agent entering the body from the gut, most likely via the immunologically active Peyer’s Patches. The route of infection from the gut to the central nervous system is unclear, but in other species cells of the immune system have been implicated in transporting infection. As immune cells are present in circulating blood, this provides an easily accessible source of samples that would be suitable for use in a diagnostic assay.

Differential gene expression within peripheral tissues of BSE infected cattle could provide the means of identification for early BSE infection. The oral route of infection by the infected agent (PrP res) passes from the gastrointestinal system to the CNS via the lymporeticular system.

Aims and objectivesThe aim of this project was to examine gene expression profiles of immune cells from normal and infected individuals to identify markers that may be used to diagnose infection at very early stages.

The original scientific objectives of the project were:

1. The creation of the tools to study genes that are expressed and differentially regulated in immune cells of cattle.The first objective will be to identify, and then sequence, a collection of unique cDNA clones representing the genes expressed in bovine cells. Specifically this project will focus on the genes expressed in bovine immune

SID 5 (Rev. 3/06) Page 5 of 14

tissues. The sequenced cDNA fragments will be used to construct high-density cDNA microarrays on glass in the Roslin ARK-Genomics microarray facility.

2. Using the micro-array to investigate changes in patterns of gene expression in lymphoid and spleen cells in normal and BSE infected individuals.The micro-arrays constructed in objective 1 will be used to examine the expression patterns in normal blood and spleen cells, and in cells obtained from individuals at given stages of infection through to those with clinical disease. The infected blood and spleen samples from defined time points post infection will be obtained from VLA (Weybridge) from the controlled challenge (SE1736) and collected through an EC collaboration (FAIR CT98-778).

Results

1. The creation of the tools to study genes that are expressed and differentially regulated in immune cells of cattle.

In order to carry out the expression profiling work (Objective 2) it was first necessary to construct the bovine microarray (Objective 1). The project will examine gene expression profiles in cells of the immune system, before and after BSE challenge. It is therefore important to have genes expressed in the immune cells represented on the microarray to be used.

The ESTs clones and sequence information for the construction of the optimised microarray set (Objective 1) were already in place in Roslin at the start of the project. As described in the proposal, a 23K non-redundant brain cDNA set and a normalised cDNA library from resting and activated macrophages constructed at Roslin and GATC in Germany were the basis of the bovine microarray. To summarise, the “non-redundant set” of 23K clones was selected from a bovine brain cDNA library containing over 215K clones by hybridization screening with a panel of 200 short oligo-nucleotide probes, then the hybridization patterns (oligo-nucleotide fingerprints) compared in order to cluster clones arising from the same genes. This work was funded by the EC (project FAIR CT98–778) and performed at Max-Planck-Institute, Berlin. A follow-on EC project allowed the 23K non-redundant set of cDNA clones to be sequenced. Further clustering of the clones in the “brain set” identified 14,969 clusters out of the 23,632 sequence reads. The few duplicated sequences were removed to yield a total of 14,597 non-redundant genes / transcripts. To validate the array for differential gene expression analysis, RNA from six bovine tissues was isolated, labelled and used to interrogate the array. The data collected allowed differential gene expression across the tissues to be investigated. In separate experiments RNA from the same bovine tissues was isolated and used in quantitative real-time PCR (QPCR) experiments at Roslin. Statistical analyses revealed 80% agreement between the microarray hybridisations and the QPCR results. Northern Blot analysis was carried out on a subset of the differentially expressed genes, and confirmed the tissue specific expression patterns.

Additional cDNA probes relevant to studies of gene expression in immune tissues were selected from other cattle cDNA resources available in the ARK-Genomics Centre for Functional Genomics in Farm Animals at Roslin. Briefly, 10,000 cDNA clones from a normalised macrophage cDNA library were sequenced in collaboration with The Wellcome Trust Sanger Institute. Analysis of the macrophage library sequence data identified 7.8K singleton clones of which 45% matched bovine sequences present in the public bovine ESTs database. Clones from the brain and macrophage libraries were compared to reduce duplication of genes, and this set of clones formed the basis of the bovine array Version 2.1, which contains 10K ESTs from the 23K “non- redundant” brain set and 4.7K ESTs from the macrophage library each spotted in duplicate on the array slide. The 30K-feature bovine micro-array also contains control genes. The V2.1 bovine micro-array was completed in October 2004 and used in the studies for project objective 2 described below. A new version of the array V2.3 is now available which contains an additional 2,000 cDNA probes from sheep spleen, 4,000 cDNA probes from cattle immune genes (see http://www.ark-genomics.org/microarrays/bySpecies/cattle/ ). These cDNA microarray resources have been used for a range of gene expression analyses in both cattle and sheep in addition to those undertaken in the context of the current project.

2. Using the micro-array to investigate changes in patterns of gene expression in lymphoid and spleen cells in normal and BSE infected individuals.

Expression profiling - spleenSpleen samples for this study were from the DEFRA funded controlled BSE challenge project SE1736 that was carried out at the Veterinary Laboratories Agency, Weybridge. Briefly, Holstein cattle were fed with 100 g of BSE infected brain tissue. Spleen tissue was collected at 3, 6, 9, 12, 15, 18 and 24 months post infection (mpi) from infected animals and matched control animals (Table 1). The spleen tissue was snap frozen and stored for future analyses.

SID 5 (Rev. 3/06) Page 6 of 14

Table 1: Spleen samples from VLA Weybridge BSE-oral challenge

Time (months post infection) Number of animalsBSE-fed Age-matched controls

3 1 36 1 39 1 312 6 315 3 318 3 324 3 3

Spleen samples for selected time points from control and BSE infected cattle were transferred to the Moredun Research Institute to allow the preparation of RNA isolations in Category 3 containment facilities. The method for RNA isolation from bovine spleen was optimised using uninfected samples. The RNA quantity and quality was checked using an Agilent Bioanalyser (lab-on-a-chip) system in the ARK-Genomics Centre for Functional Genomics in Farm Animals at Roslin Institute.

An initial expression profiling experiment was performed on RNA from spleen samples representing 12 and 24 months timepoints using the project cattle cDNA printed microarrays in the ARK-Genomics facility. RNA from 6 BSE infected samples available at 12 months with 3 age-matched controls, and 3 BSE infected samples at 24 months with 3 age-matched controls was analysed. RNA samples were labelled with either Cy3 or Cy5 fluorescent dyes and used to interrogate the microarrays such that each array was Cy3-labeled RNA from an infected animal was simultaneously hybridised to a microarray with Cy5-labeled RNA from a control animal or vie versa. A total of 18 microarrays were hybridised in a dye-swap design in order to avoid any bias arising from labelling all infected samples with one dye and all control samples with the other dye. After scanning of the slides, analysis was performed using the Bluefuse Programme, which aligned the grids of the array and fused duplicated spotted genes (probes). GeneSpring software was used to analyse the data including normalisation procedures and to perform a Student’s t-test on the results. The initial analysis revealed 57 genes that were 1.5 fold differentially expressed in the BSE infected samples compared to control at 12 months, with P<0.05. These genes have now been validated by QPCR analysis using the same RNA samples as used on the microarray. Scrutiny of the data identified 3 members of the Regulators of G-protein signalling (RGS) family of genes were down regulated (RGS1, 2, & 5). Expression of these gene was investigated at additional time points by QPCR, and showed that the 3 RGS genes down regulated at 12 months post infection are not down significantly down regulated at 24 months, compared with the control samples. Validation of other genes with reduced expression at the 12 mpi stage show a high correlation between the array and QPCR results. The most differentially expressed genes at the 12 mpi stage are shown in Figure 1 (below).

Figure 1A

Figure 1B

SID 5 (Rev. 3/06) Page 7 of 14

Figure 1: Differential gene expression for 9 genes between 6 animals at 12 months post infection compared with age matched controls.Genes showing the highest differential expression between infected and uninfected animals were identified by from a microarray study (Fig 1A). The expression of these genes was then compared by QPCR (Fig 1B). The change in expression detected using both techniques show variation in the same direction, although the magnitude of the change differs between techniques (compare FigA with 1B).

A second microarray experiment was performed using RNA from spleens collected at 3, 6, 9, 15, 18 mpi. Only one BSE infected sample was available at each of the early time points (3-9 mpi) (Table 1). Extending the data from the results from the 12 mpi samples, gene expression from a selection of genes was compared at these different time points, using both the microarray and QPCR approaches. Although differential expression of some genes was observed at specific time points there was no consistent pattern across the time course of the study. This lack of consistent patterns may in part be due to the lack of replicates at these time points as well as inconsistent (spatial) sampling of the spleens, i.e. only a very small proportion of each spleen is required for RNA isolation and each spleen aliquot may not have been taken from the same part of the spleen. However, these data were still used for comparisons with the gene expression data from the 12 month time point which was more tractable to statistical analysis.

Expression profiling – white blood cellsTo be useful as an anti-mortem test for BSE infection it would be desirable for the test to be performed on biological samples that are readily accessible, for example on blood or other bodily fluids. Blood samples were collected from a BSE challenge set up at Greifswald, Germany under the DEFRA funding (SE1786). The cattle in the Greifswald experiment were also exposed to an oral challenge of 100 g of BSE-infected brain tissue. The animals comprised four Simmental cattle that were fed the infected material plus three control animals. Details of the cells and RNA samples isolated from the Greifswald challenge experiment are summarised in the report for project SE1786.

Briefly, blood samples were collected at two month intervals from seven months post BSE infection onwards. Initially peripheral blood mononuclear cells (PBM) were collected, then from 12 mpi immune cell populations by MACS sorting. RNA from the earlier time point was isolated by Dr Borthwick visiting Griefswaid. RNA prepared from the early time points for the separated cell populations was partially degraded and of poor quality which is not suitable for the array study. However, RNA isolated from whole PBM at the 2 early time points (7 and 9 mpi) was of reasonable quality. This RNA was used in QPCR experiments to examine expression of genes found to be down regulated at 12 mpi in spleen samples (RGS1, 2 & 5). At 7 mpi RGS1 was found to be down regulated in the PBM samples, however, RGS 2 & 5 were not.

Following the poor RNA obtained from early time points, discussion were held with Greifswald and the isolation protocol modified. Early samples had been held overnight following density centrifugation priors to MACS separation. The yield of RNA from the later time points of fractionated cell sets is low but some samples are of good enough quality to use in an array study, although samples are of variable quality. Identifying a coherent set of samples to design a meaningful study will be difficult. The maximum yield of RNA is 4 μg per sample, which is not sufficient for microarray and QPCR analysis. Methods for RNA amplification have been tested at Roslin, and a protocol was developed that allows as little as 100 ng of RNA to be amplified with sufficient yield for both microarray and QPCR analyses.

SID 5 (Rev. 3/06) Page 8 of 14

Blood samples after 9 mpi were separated into individual white cell groupings. From 19 mpi the following method was applied for the isolation of white cells. Whole blood was centrifuged and buffy coats containing white blood cells were harvested. Residual red blood cells carried over with the buffy coats were removed by hypotonic lysis. The resulting PBMs were fractionated by MACS to yield four sub-populations – ILA24+ (macrophages and neutrophils), CC21+ (B-cells), CC8+ (T-cells) and CC15+ (T-cells). The simpler first step in this modified protocol results in the presence of neutrophils in all the sub-populations. It has not been possible to assay the effectiveness of the enrichment procedures by Fluorescence Activated Cell Sorter (FACS) analyses as there was no FACS equipment within the category 3 facility within which it was necessary to handle the BSE-infected material. To date RNA from the following time points (all animals and all subpopulations, a total of 168 samples) has been isolated at FLI and shipped to Roslin: 11, 13, 15, 17, 19, 21, 23, and 29 m.p.i, plus RNA from whole PBMs at 29pmi. The RNA quality collected from the subpopulations varied as described previously, there the initial array experiments were performed using RNA from all sub populations of the 21mpi samples.

At the outset of the project there were no commercially produced microarrays available for cattle, hence the need to generate such resources (objective 1). However, during the course of the project Affymetrix launched Bovine Genome Array GeneChip® has been made available by Affymetrix (see - http://www.affymetrix.com/products/arrays/specific/bovine.affx ). This array has eleven 25-mer oligonucleotide probes for each of 23K cattle transcripts. The Affymetrix system is acknowledged as the most reproducible system available and the internal controls allow samples to be tested individually, rather than carrying out pair-wise comparisons of samples with different dyes. Comparison of samples is then carried out in silico. This has the advantage that comparisons can be made between different BSE samples and controls and also between BSE samples at different time points.

Results obtained with the spleen samples using the glass microarrays have produced interesting data, but the results have not been consistent. Therefore for the expression study of the immune cells we used the Affymetrix system which offers increased accuracy (due to the number of replicates present) and flexibility.

Array experiments using RNA isolated from white blood cells of blood collected at 7 and 9 mpi were performed using the Affymetrix bovine GeneChip®. The RNA from 4 BSE infected and 3 age matched controls (SE1786), from the same animals at both time points, was used. Analysis was performed in collaboration with Pawel Herzyk at the University of Glasgow using RMA, rank analysis, and Iterative Group Analysis (iGA) which produced the Gene Ontology groupings, from the grouped controls and BSE infected samples (see Table 2). Array results were verified using individual animal RNA samples by QPCR and compared to the individual array analysis. A selection of the top up and down regulated genes were tested by QPCR analysis and compared to the array results. Six genes have been verified by QPCR. Again the fold changes in gene expression are not quantitatively the same in both array and QPCR experiments but the direction of the differential expression is the same for the majority of the genes tested.

Genes that are differentially regulated in both spleen and white blood cells have been identified, and include the members of the RGS family, which are also down regulated in the RNA examined from the 7 and 9 months post infection white blood cells. We are encouraged that these are robust results as these genes which show a common variation in expression are found in different cattle breeds and BSE challenges.

Table 2: GO groupings for regulated genes in PBM during early BSE infectionDown Regulation Up Regulation6955 immune response 6955 immune response6954 inflammatory response IPR001427 Pancreatic ribonuclease

IPR000330 SNF2 related domain 19886 antigen processing, exogenous antigen via MHC class II

1660 fever IPR000353 Class II histocompatibility antigen, beta chain

6935 chemotaxis 4519 endonuclease activity5615 extracellular space 5833 heamoglobin complex8009 chemokine activity 4842 ubiquitin- protein liase activity5125 cytokine activity  IPR001811 Small chemokine, interleukin-8 like  4252 serine-type endopeptidase activity  

8243 plasminogen activator activity  

Initial analysis was performed in collaboration with Pawel Herzyk (see above) and results showed far fewer differentially expressed genes at 21 mpi compared to the 7 and 9 mpi. However there were genes which remained either down or up regulated across all 3 time points (see Table 2).

SID 5 (Rev. 3/06) Page 9 of 14

RNA from 7 and 9 mpi PBMs was used on the Genechip bovine array from Affymetrix and analysis was performed using three levels of analysis - RMA, group rankings and Iterative Group Analysis (iGA) designed and performed by Pawel Herzyk at Sir Henry Wellcome Functional Genomics Facility at the University of Glasgow.

Table 3: Genes consistently regulated at 7, 9 and 21 months post infectionDown Regulated  

Up Regulated  

Name Affy. No. Name Affy No.CD83 Bt.19561.1.S1_at MHCclass II Bt.4594.1.S1_atTyrp8 Bt.4404.1.A1_atMIP-1 Bt.9504.1.A1_atCyclophilin Bt.9791.1.S1_at

unknown transcript Bt.23696.1.A1_at

These genes are significantly regulated in the groupings of all 3 time points.

Further array experiments were performed for sub populations of white blood cells of blood collected at 23 and 29 mpi using the Affymetrix bovine GeneChip®. The RNA used was from 4 BSE infected and 3 age matched controls (SE1786), from the same animals at both time points. Again the initial data analyses were performed in collaboration with Pawel Herzyk at the University of Glasgow using RMA, rank products, and Iterative Group Analysis (iGA), these were collated in group rankings across the time course (Table 4 attached). Three groups are represented in the table with individual gene members showing differential fold change throughout the time course of BSE infection.

Verification of the array results for 11 different genes (Table 5) was sought by QPCR analyses performed on the same individual RNA samples used for the microarray experiments. Most of the differences in gene expression revealed in the analysis of the array data and which were subjected to QPCR analyses were confirmed by the latter assays at least in qualitative terms. QPCR was also used to study the expression of genes not represented on the Affymetrix bovine GeneChip®. For example, the expression of PRSS1 was compared to the extremely down regulated Tryp8, also known as PRSS2 (Figure 2).

Table 5: QPCR primers for analysis of eleven genes showing differential expression by array analysesGenes symbol Array feature. Forward Primer Reverse PrimerB-actin   caaggagaagctctgctacg gatgtcgacgtcacacttca

MIP2 BT.9504.1.A1_AT ctctccatgctcacgactcc gagggacagtgatggcagac

Tryp8 Bt.4404.1.A1_at gactgtgaagcctcgtaccc ccagtccacgtagttgcaga

MHC2 Bt.4594.1.S1_at ttcctgcacctttctgtgtg caggaagcagcatcacagtc

MHC1-4 Bt.27760.1.S1_at agctgtcttttggggactga tctgctggaacaggagtgtg

CCL3L1 Bt.9974.1.S1_at acagccacactctgggactc gtcgctcaactgtctccaca

DQB Bt.4594.1.S1_at cagggtgtgcagacacaact aaccaccgaaccttgatctg

DQA Bt.22867 tcagaacagccactggtgag tccatcaaattcctgggtgt

EDN1 Bt.4398.1.S1_at tctggacatcatctgggtca cttggcaaaaattccagcat

IL8R Bt.155 cgccacccacagaagactat gccaggttcagcaggtagac

PrP Bt.4737 tcccaggcttattaccaacg gcgccaagggtattagcata

CCR5 Bt.21331 cctgttctcctgtggatcgt tgcatcaaccccatcatcta

SID 5 (Rev. 3/06) Page 10 of 14

Figure 2: QPCR was performed on each RNA sample separately and results pooled for analysis and fold change calculated in comparison to b-actin, which had been shown to be constant throughout the time course. This graph shows direct comparison of the fold change between PRSS1 and Tryp8 across different cell types and time course of infection. Tryp8 (anionic trypsinogen) and PRSS1 (cationic trypsinogen) are both secretory proteases synthesised by the pancreas. Mutations of PRSS1 are associated with chronic pancreatitis; whereas mutations in PRSS2 (Tryp8) can protect against chronic pancreatitis.

DiscussionThere is a substantial scientific literature on the search for biomarkers for transmissible spongiform encephalopathies. However, detection of the disease-associated form of prion protein remains the key diagnostic of these diseases. Prion protein is present throughout the body in mammals and the levels of the aberrant protein present in early stages of the disease is low and if present in peripheral tissues soon after infection, then it is currently below the detection limits of current assays. Improvements in the sensitivity of these detection methods are being made and they may provide the route to more effective systems of surveillance.

Almost all the biomarkers for TSEs as reported by others concern molecules present in the central nervous system. Several hundred such biomarkers have been identified, but to date none represent credible markers for pre-symptomatic diagnosis or surveillance. Rather the utility of these biomarkers is in the differential diagnosis once disease symptoms have manifest themselves, i.e. to distinguish TSE from other neurodegenerative disorders. This differential diagnosis is important in human medicine, but of limited value in the early detection of TSEs in food animals such as cattle, sheep and goats.

Research by others has not only focused on changes in protein or transcript profiles in nervous tissue, but also largely on the period after disease symptoms have become evident.

Thus, this project (SE1783) remains relatively unique in addressing the search for pre-symptomatic markers of TSE disease and in its focus on spleen and blood. Changes in gene expression and differential gene expression between infected and control animals were observed. However, none of the patterns of differential gene expression or changes in gene expression were sufficiently consistent or compelling as robust markers of pre-symptomatic TSE disease in the absence of further evidence. The down regulation of the Tryp8 (anionic trypsinogen) gene, however, was not only evident in blood cells from as early as seven months post infection, but

SID 5 (Rev. 3/06) Page 11 of 14

also remained down regulated throughout the post infection period. The down regulation of the Tryp8 (anionic trypsinogen) gene was confirmed by microarray and QPCR analyses and would merit further examination in other samples.

The sensitivity and discriminatory capabilities of transcript profiling using microarray technology was questioned by many when the technology was at a formative stage. However, there is now extensive evidence of the value of this technology, for example, in identifying expression signatures associated with responses to different pathogens and for classifying tumours. Microarray technology is now sufficiently robust that technical replicates (i.e. repeat assays / array hybridisations on the same sample) are no longer a major concern. However, there is still a requirement for adequate biological replicates, i.e. multiple samples of the same type. The biological material available for this project has limitations in terms of meeting this requirement for biological replicates. There are no biological replicates of the BSE-challenge animals at the early time points in the VLA experiment (Table 1). Sample sizes of three challenged and three control animals at all the other time points except 12 months post infection are also limiting especially for an outbred and genetically heterogeneous species such as cattle. The transcript levels detected in any one of the samples represents a single point in a complex four dimensional space (location from which the tissue sample was taken and the time at which the sample was taken) that is large given the small size of the tissue sample collected relative to the size of the animal and the long incubation period of BSE. One of the sampling challenges was addressed by the Griefswald experiment in as much as the samples represented a time series of biopsies from the same animals. Nevertheless the number of biological replicates in the Griefswald experiment is also limited.

This project has identified a number of genes that exhibit differential expression between BSE-challenged and control animals before the emergence of symptoms of BSE. These differences in gene expression have been confirmed, in part, by using two different methods – microarray-based expression profiling and quantitative real-time PCR (QPCR). However, validation of these differences in gene expression as markers of pre-symptomatic BSE disease would require testing additional animals.

SID 5 (Rev. 3/06) Page 12 of 14

References to published material9. This section should be used to record links (hypertext links where possible) or references to other

published material generated by, or relating to this project.Refereed research papersJensen, K., Speed, D., Paxton, E., Williams, J.L. and Glass, J., 2005. Construction of a normalized Bos taurus and Bos indicus macrophage-specific cDNA library. Animal Genetics 37, 75–77. http://www.blackwell-synergy.com/doi/abs/10.1111/j.1365-2052.2005.01407.x

Conference presentationsBorthwick, E., 2004. The search for differentially expressed genes in the spleens of preclinically BSE infected cattle. Oral Presentation at the 4th UK Farm Animal Functional Genomics Workshop, 14/15 December 2004, Manchester. http://www.ark-genomics.org/events/workshops/fourthWorkshop.php

Borthwick, E.B., Willaims, A.C. and Williams, J.L., 2004. Looking for markers of BSE infection: An investigation of the immune system form BSE infected mice and cattle. Prion 2004, First International Conference of the European Network of Excellence NeuroPrion, 24-28 May 2004, Paris, France. Abstract THE-44, pp 176. http://www.neuroprion.com/pdf_docs/conferences/prion2004/abstract_book.pdf

Borthwick, E.B., Willaims, A.C. and Williams, J.L., 2004. Looking for markers of BSE infection: An investigation of the immune system form BSE infected mice and cattle. Prion 2004, First International Conference of the European Network of Excellence NeuroPrion, 24-28 May 2004, Paris, France. Abstract THE-62, pp 185. http://www.neuroprion.com/pdf_docs/conferences/prion2004/abstract_book.pdf

Borthwick, E.B., 2005. The search for differential gene expression during preclinical BSE infection. Invited speaker. TSE-Edinburgh Meeting held at Moredun Research Institute, Midlothian, Scotland, U.K., 27th April 2005

Borthwick, E.B., Herwig, R., Janitz, M., Hawkins, S.A.C., Talbot, R. and Williams, J.L., 2005. The search for differential gene expression in cattle spleen during early BSE infection. Prion 2005, between fundamentals and society’s needs, 19-21 October 2005, Dusseldorf, Germany. Abstract DIA-33, pp 178. http://www.neuroprion.com/pdf_docs/conferences/prion2005/abstract_book.pdf

Borthwick, E.B., Herwig, R., Janitz, M., Hawkins, S.A.C., Talbot, R. and Williams, J.L., 2005. The search for differential gene expression in cattle spleen during early BSE infection. 2nd International Dominique Dormont Conference on Host Pathogen Interactions in Chronic Infections, 1-3 December 2005, Paris, France.

Borthwick, E., 2006. Is there differential gene expression during early BSE infection in cattle white blood cells? Oral Presentation at the 6th UK Farm Animal Functional Genomics Workshop, 27/28 September 2004, Cambridge, U.K. http://www.ark-genomics.org/events/workshops/sixthWorkshop.php

Borthwick, E.B., Brenn, A., Groschup, M., Talbot, R., Hawkins, S., Archibald, A.L. and Williams, J.L., 2006. The search for differential gene expression in cattle spleen and white blood cells during BSE infection. Prion 2006: strategies, advances and trends towards protection of society, 4-6 October 2006, Torino, Italy. Poster DIA-09 pp 191. http://www.neuroprion.com/pdf_docs/conferences/prion2006/abstract_book.pdf

Borthwick, E.B., Brenn, A., Groschup, M.H., Archibald, A.L. and Williams, J.L., 2007. There is differential gene expression in cattle white blood cells during preclinical BSE infection. Prion 2007. 26-28 September 2007, Edinburgh, Scotland, U.K. Abstract P03.150 pp 84. http://www.neuroprion.com/pdf_docs/conferences/prion2007/abstract_book.pdf

Emma B. Borthwick, Claudia Schepers, Richard Talbot, Steve A.C. Hawkins, Ralf Herwig, Michal Jantz, Kirsty McGuire, Liz Glass, Mike Clinton and John L. Williams. Construction of immune-biased microarray: an examination of differential gene expression in bovine tissues Poster Presentation at EADGENE Meeting in Brussels May 2005

Borthwick, E.B., Diephaus, C., Schultz, J., Groschup, M.H., Talbot, R., Hawkins, S.A.C., Herwig, R., Jantz, M. and Williams, J.L., 200*. The search for differentiation of gene expression during BSE infection in

Other outputsCattle cDNA microarray (15K and 20K versions) available from the ARK-Genomics Centre for Functional Genomics in Farm Animals see http://www.ark-genomics.org and

SID 5 (Rev. 3/06) Page 13 of 14

http://www.ark-genomics.org/microarrays/bySpecies/cattle/

SID 5 (Rev. 3/06) Page 14 of 14