G3: Genes, Genomes, Genetics 1

2

Genome sequence of Saccharomyces carlsbergensis, the world’s first 3

pure culture lager yeast 4

5

Andrea Walther, Ana Hesselbart and Jürgen Wendland* 6

7

Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, Valby, Denmark 8

9

10

(*) Corresponding author: Jürgen Wendland, Carlsberg Laboratory, Yeast Biology, 11

Gamle Carlsberg Vej 10, DK-1799 Copenhagen V, Denmark 12

13

Email: juergen.wendland@carlsberglab.dk 14

Phone: +45/3327 5230; 15

Fax: +45/3327 4708 16

17

18

running title: S. carlsbergensis genome 19

20

key words: genome sequencing, genome evolution, chromosome loss, ploidy, fermentation 21

22

23

24

G3: Genes|Genomes|Genetics Early Online, published on February 27, 2014 as doi:10.1534/g3.113.010090

© The Author(s) 2013. Published by the Genetics Society of America.

Abstract 25

26

Lager yeast beer production was revolutionized by the introduction of pure culture 27

strains. The first established lager yeast strain is known as the bottom fermenting 28

Saccharomyces carlsbergensis, which was originally termed Unterhefe No.1 by Emil 29

Chr. Hansen and used in production in since 1883. S. carlsbergensis belongs to group 30

I/Saaz-type lager yeast strains and is better adapted to cold growth conditions than 31

group II/Frohberg-type lager yeasts, e.g. the Weihenstephan strain WS34/70. Here, we 32

sequenced S. carlsbergensis using next generation sequencing technologies. Lager 33

yeasts are descendants from hybrids formed between a S. cerevisiae parent and a 34

parent similar to S. eubayanus. Accordingly, the S. carlsbergensis 19.5 Mb genome is 35

substantially larger than the 12 Mb S. cerevisiae genome. Based on the sequence 36

scaffolds, synteny to the S. cerevisae genome, and by using directed PCRs for gap 37

closure we generated a chromosomal map of S. carlsbergensis consisting of 29 unique 38

chromosomes. We present evidence for genome and chromosome evolution within S. 39

carlsbergensis via chromosome loss and loss of heterozygosity specifically of parts 40

derived from the S. cerevisiae parent. Based on our sequence data and via FACS 41

analysis we determined the ploidy of S. carlsbergensis. This inferred that this strain is 42

basically triploid with a diploid S. eubayanus and haploid S. cerevisiae genome content. 43

In contrast the Weihenstephan strain, which we re-sequenced, is essentially tetraploid 44

composed of two diploid S. cerevisiae and S. eubayanus genomes. Based on 45

conserved translocations between the parental genomes in S. carlsbergensis and the 46

Weihenstephan strain we propose a joint evolutionary ancestry for lager yeast strains. 47

Introduction 48

Starting from the early ages of agriculture and the domestication of barley fermented 49

beverages played an important role in the emerging societies. Beer has been known for 50

millennia dating back at least to the Sumerians 6000 BC. Fermented beverages 51

provided not only nutrition but were basically the only sources of uncontaminated clean 52

liquids and thus of medicinal value. Although there is a plethora of microorganisms 53

within the Saccharomyces complex that can be found in natural fermentations, 54

Saccharomyces cerevisiae has been the predominant species in certain types of 55

fermentations, e.g. in ale beers and in wine. 56

Today, however, most beer volume is generated with lager beers. Lager brewing was 57

initiated in Bavaria in the 15th century (Libkind et al., 2011). The German Reinheitsgebot 58

from 1516 regulated that beer should only be made of water, malt and hops without any 59

other ingredients – of course at that time S. cerevisiae was not known. Yet, lager beer 60

production differed markedly from ale brewing by its substantially lower fermentation 61

temperatures -starting as low as 5°C. In the 18th century lager beer gained so much 62

popularity that keeping up production required a break with tradition. Supported by the 63

invention of refrigeration lager beer was then also produced in the summer months 64

which had traditionally been off-season. 65

However, beer spoilage of lager beers became increasingly frequent over summer due 66

to contamination with wild yeasts. This led to the scientific investigation of this problem 67

by Louis Pasteur and Emil Chr. Hansen. Hansen verified that wort became infected by 68

wild yeasts and therefore devised a method to isolate pure cultures of yeast strains 69

(Hansen, 1883). One of these strains, Unterhefe No.1, showed a very convincing 70

brewing performance and was thus chosen as production strain at the Carlsberg 71

brewery in 1883 and given freely to other breweries by its owner J. C. Jacobsen and 72

later entered the CBS strain collection in 1947. 73

Lager yeasts are interspecies hybrids between S. cerevisiae and S. uvarum parents 74

(Nilsson-Tillgren et al., 1986; Kielland-Brandt et al., 1995; Casaregola et al., 2001; 75

Bond, 2009). The first lager yeast draft genome sequence was that of the 76

Weihenstephan (WS34/70) strain demonstrating the allotetraploid hybrid nature of this 77

lager yeast (Nakao et al., 2009). Prior analyses of lager yeast strains indicated that 78

different isolates contain different gene or chromosome sets (Hansen and Kielland-79

Brandt, 1994; Fuji et al., 1996; Borsting et al., 1997; Tamai et al., 1998; Yamagishi and 80

Ogata, 1999). Using PCR-RFLP two types of lager yeasts could be distinguished. On 81

the one hand there were lager strains currently used in production that showed almost a 82

complete set of both of the parental genomes, and on the other a set of lager yeast 83

strains including, S. carlsbergensis and S. monacensis that were found to lack certain 84

portions of the S. cerevisiae genome (Rainieri et al., 2006). By means of array-CGH this 85

partition into two groups was further refined. This indicated that regional distribution 86

matches the gene content and suggested that group I corresponds to the Saaz type, 87

while group 2 is represented by the Frohberg type. It was also suggested that two 88

independent hybridization events generated the two types of lager yeast (Dunn and 89

Sherlock, 2008). 90

The origin of the non-cerevisiae parent in lager yeast has long been debated. Recently, 91

the isolation of S. eubayanus from southern beech (Nothofagus) of Pathagonian forests 92

provided one potential resource of a strain that upon hybridization with e.g. an S. 93

cerevisiae ale yeast could have generated lager yeast hybrids (Dunn and Sherlock, 94

2008; Libkind et al., 2011). Throughout this paper we refer to the non-cerevisiae part of 95

lager yeast genomes as S. eubayanus, instead of S. uvarum or S. eubayanus-like etc. 96

Here we report the genome sequence and analysis of the first pure culture lager yeast 97

production strain S. carlsbergensis and a genome scale comparison of this strain with 98

the Weihenstephan yeast WS34/70. 99

100

Materials and Methods 101

Strains, media and fermentation setup 102

The following strains were used in this study: Saccharomyces carlsbergensis, CBS 1513; 103

Saccharomyces monacensis, CBS 1503; Saccharomyces eubayanus, CBS 12357; 104

Saccharomyces cerevisiae CEN.PK; Saccharomyces pastorianus, Weihenstephan 105

WS34/70; Saccharomyces cerevisiae ale yeast (Carlsberg collection). Growth assays 106

were done in YPD medium (1 % yeast extract, 2 % peptone, 2 % glucose) at various 107

temperatures. Strains were inoculated with an initial OD600 of 0,1 and then grown for 2-4 108

days shaking. Industrial brewing conditions are produced by small scale fermentations 109

in tall tube cylinders with 200 ml volume. 14 °Plato granmalt (150 g/l malt granules, 5 g/l 110

yeast extract) was fermented with selected strains at 14 °C. Yeast strains were 111

propagated in granmalt prior to pitching with an OD600 of 0.2. Stirring of the fermentation 112

cyclinders was set to 190 rpm. The fermentation performance was followed by online 113

measuring of CO2 loss and wort density using an Anton Paar DMA 35 densitometer 114

measuring gravity (i.e. amount of sugars) in °P. End of fermentation was reached when 115

the sugar concentration did not drop further for two days. All fermentations were 116

conducted in biological triplicates. At the end of fermentation alcohol concentration was 117

measured using an Alcolyzer M (Alcolyzer Beer Analyzing System, Anton Paar). A 118

volume of 100 ml was used for flavor analysis. 119

120

121

Flavor analysis: 122

Samples of 100 ml were removed at the end of fermentation for analysis of aroma 123

compounds. Alcohols and esters were measured by solvent extraction with carbon 124

disulphide (CS2). After stirring the samples for 30 min they were centrifuged and a 125

volume of 2 µl of the lipid organic phase was directly injected into the gas 126

chromatograph (GC, Agilent 6890). 1-octanol served as an internal standard. Volatiles 127

were separated on a DBWAX capillary column (30 m x 0.32 mm x 0.25 µm) and 128

detected by a flame ionization detector (FID). 129

130

Sequencing Strategy and chromosomal assembly: 131

Genome sequencing of S. carlsbergensis was performed using 454 GS FLX + 132

sequencing of single reads and of a mate-pair library of 8kb inserts. A fragment library 133

and the additional 8 kb paired-end library were constructed with Rapid Library Prep Kit. 134

An initial number of 635 399 reads and 480 966 paired end reads of an 8 kb library were 135

assembled into 386 contigs and further combined into 78 scaffolds. Assembly into 136

whole chromosomes was based on synteny to S. cerevisiae and S. eubayanus or 137

directed PCR fragments were obtained to merge scaffolds. Primers are listed in table 138

S1. The WS34/70 strain was re-sequenced using Illumina Miseq also including an 8 kb 139

mate-pair library. 140

141

Analysis of the S. carlsbergensis genome 142

The S. carlsbergensis Whole Genome Shotgun project has been deposited at 143

DDBJ/EMBL/GenBank under the accession AZCJ00000000. The version described in 144

this paper is version AZCJ01000000. The Weihenstephan WS34/70 Whole Genome 145

Shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession 146

AZAA00000000. The version described in this paper is version AZAA01000000. For the 147

visualization of chromosomal rearrangements in a Circos plot a pairwise comparison of 148

S. carlsbergensis and S. cerevisiae chromosomes was done. The information about all 149

chromosomal rearrangements was then synthesized in a tabular matrix which can be 150

represented in a circular plot using the Circos software package (Kryzwinski et al., 151

2009). 152

Ploidy analysis was visualized using a violin plot. As a first step the shotgun reads were 153

aligned using the LASTZ program (http://www.bx.psu.edu/~rsharris/lastz/). Then its 154

output was parsed with SAMtools (Li et al., 2009) in order to index and extract the 155

number of aligned reads at each locus. A running average of mapped reads per window 156

was calculated. The violin plot shows the distribution of the log2 ratios of copy number 157

variation across each chromosome. The plot is generated using ggplot2 in R (Ito et al., 158

2013; R Development Core Group, 2013). Scaffold alignments and sequencing analysis 159

of PCR products were done using Lasergene DNAstar 11 (www.dnastar.com). 160

161

FACS analysis 162

Ploidy analysis was confirmed using FACS. Cells were grown o/n at room temperature 163

to an end-exponential growth state. For the staining of cells with propidium iodine 164

cultures were first washed and resuspended in 1xSSC buffer before fixation in 70 % 165

ethanol at -20 °C o/n. Samples were then treated with RNAse o/n at 37 °C followed by 166

proteinase K treatment at 50 °C for 1 hour. A final concentration of 3 µg/ml propidium 167

iodine was added to each sample and incubated for 18 hours in darkness before FACS 168

analysis (www.aragonlab.com/Protocols-Yeast.html). 169

170

171

172

Results 173

Growth and fermentation characteristics of lager yeast strains 174

Lager yeasts are currently grouped into two categories, group I/Saaz and group 175

II/Frohberg. We compared growth and fermentation characteristics of two group I 176

strains, S. carlsbergensis and S. monacensis and the group II Weihenstephan WS34/70 177

strain with S. eubayanus, an ale yeast and the CEN.PK laboratory yeast strain. At low 178

temperatures of 10 °C S. eubayanus had a short lag phase and relatively rapid growth. 179

This profile was best matched by S. carlsbergensis. At 20 °C all assayed strains 180

grouped closely together. At higher temperature, however, S. cerevisiae and the ale 181

yeast strain showed better growth compared to S. eubayanus and both group I lager 182

yeasts. The Weihenstephan lager yeast showed intermediate growth rates at the upper 183

and lower end of the temperature range (Fig. 1). This indicates that S. carlsbergensis is 184

better adapted to cold fermentation temperatures than the group II lager 185

yeast/Weihenstephan strain. Historically, lager beer fermentation was carried out at very 186

low temperatures (as low as 5 °C). Currently, however, higher fermentation 187

temperatures are applied in industry. Here, we assayed fermentation performance at 14 188

°C using 14 °P wort. Under these conditions the group II lager yeast was fastest in 189

fermentation and wort attenuation. Amongst the group I lager yeasts S. carlsbergensis 190

was faster than S. monacensis and reached the same attenuation level as the 191

Weihenstephan strain (Fig. 2A). These results indicate that group II lager yeasts are 192

better adapted to higher temperature fermentation conditions than group I yeasts. Two 193

main post-fermentation parameters of industrial importance are the percentage of 194

surviving cells and the ratio of petite cells amongst them. This is because for the setup 195

of a second fermentation yeast cells from a previous fermentation are used as inoculum 196

(termed “repitching”) and due to the inferior fermentation performance of petite cells. 197

Survival rates of group I and II lager yeasts at the end of fermentation were similar. Yet, 198

the Weihenstephan strain generated a lower amount of respiratory deficient “petite” 199

cells (not shown). 200

Lager yeast strains provide a clean taste to beers associated with rather low levels of 201

aroma alcohols and esters compared to more fruity ale and wine yeasts. We used 202

GC/FID to determine flavour differences in our group I and II lager yeast strains (Fig. 203

2B, Tab. S2). S. monacensis produced only low amounts of flavours. Group I lager 204

yeasts showed higher amounts of acetaldehyde (perceived as fruity at these 205

concentrations) while the group II strain produced far more ethylacetate (pear drops 206

flavour) and also more isoamyl alcohol/acetate (banana flavour). 207

208

Sequencing of S. carlsbergensis 209

We sequenced the S. carlsbergensis genome using 454 GS FLX+ technology. More 210

than 106 reads were generated and assembled into a 19.5 Mb genome. We obtained 211

>20x coverage with 680 bases average single-read length and an additional 8x 212

coverage via an 8 kb paired end library with 325 bases average read length. A draft 213

genome of the Weihenstephan has recently been generated (Nakao et al., 2009). Due 214

to the large number of sequence contigs we re-sequenced this strain using Illumina 215

MiSeq v2 to obtain similar high level coverage and quality as for the S. carlsbergensis 216

strain. To this end 107 reads derived from 250 bp paired-end reads and an 8 kb mate-217

pair library were used and assembled in the 23 Mb genome resulting in a total coverage 218

of 55x based on high quality reads (Tab.1). 219

The Weihenstephan lager yeast contains essentially two complete parental genomes. 220

As was shown previously, there is some loss of heterozygosity at chromosome ends, 221

which in WS34/70 resulted in loss of ends of S. eubayanus chromosomes III, VII, XIII, 222

and XVI (Nakao et al., 2009). 223

Large scale loss of S. cerevisiae parental DNA in S. carlsbergensis 224

We found a substantial size difference between WS34/70 and S. carlsbergensis 225

indicating a loss of app. 3.5 Mb from the group I lager yeast strain. To generate an 226

overview of which parts of the parental genomes were lost we partitioned the scaffolds 227

into their S. cerevisiae and S. eubayanus origin based on sequence conservation. This 228

is straight-forward as scaffolds derived from the S. cerevisiae parent are >95% identical 229

to the S288C genome sequence whereas scaffolds derived from the S. eubayanus 230

parent are <95% identical to S288C. The two sets of scaffolds were then aligned to the 231

S288C genome sequence. To generate a genome overview and visualize both parental 232

genomes of S. carlsbergensis compared to the 16 S. cerevisiae chromosomes we used 233

CIRCOS (Fig. 3; see Materials and Methods for details). It became apparent that S. 234

carlsbergensis does not contain sequences from S. cerevisiae chromosomes VI, XI, and 235

XII. Our results are consistent with previous data obtained by PCR/RFLP mapping or by 236

array-based comparative genomic hybridization (array-CGH) (Rainieri et al., 2006, Dunn 237

and Sherlock, 2008). Next to loss of complete S. cerevisiae chromosomes we identified 238

several regions of loss of heterozygosity (LOH) in S. cerevisiae chromosomes IV, XIII, 239

XV, and XVI (Fig., 3; Tab. 2). In contrast, there was only two position of LOH for the S. 240

eubayanus part of chromosome III and XVI. In these cases sequences that were lost 241

were replenished by orthologous regions from the other parental genome, which 242

resulted in homozygous sequences derived from only one parental genome. In the S. 243

eubayanus part two reciprocal translocations can be noted encompassing the 244

chromosomes II and IV as well as VIII and XV (Fig. 3, see below). The total amount of 245

DNA lost by chromosome loss and LOH is sufficient to explain the genome size 246

difference between the group I and group II lager yeast strains. The Weihenstephan 247

genome sequence initially was sized to 25 Mb. Our genome data comprises 23.6 Mb, 248

yet lacks telomeric regions due to redundancies. Thus, as indicated in Table 2 the 249

difference between the S. carlsbergensis and Weihenstephan genomes can readily be 250

explained by the loss of S. cerevisiae DNA observed in S. carlsbergensis. 251

252

Generation of a chromosomal map of S. carlsbergensis 253

Based on the high quality sequencing we could assemble the S. carlsbergensis genome 254

into just 78 scaffolds. Starting from these scaffolds we went on to merge the scaffolds 255

into chromosome-size super scaffolds. There were basically two sets of scaffold breaks: 256

either within parental scaffolds (Sc/Sc or Se/Se) or in case of LOH and lack of 257

contiguous sequences between Sc/Se scaffolds (Tab. 3). We used directed PCR 258

sequencing to obtain evidence of scaffold linkages. As an example the hybrid 259

chromosome XVI is shown (Fig. 4). Preliminary assembly of this chromosome 260

containing 5 scaffolds was done based on synteny to S. cerevisiae. One scaffold, 261

scaffold 18, covered the position of a reciprocal translocation within YPL240C of the S. 262

cerevisiae and S. eubayanus parental genomes (see below). Two scaffolds, 26 and 45, 263

could be manually assembled and were initially separated due to their short overlapping 264

regions. Scaffolds 18 and 26 were joined by directed PCR using primers specific for the 265

S. eubayanus sequence. The remaining two gaps were located between Sc/Sc and 266

Se/Se scaffolds and were joined based on synteny (Fig. 4). We analysed all scaffolds in 267

this way. Some scaffolds were merged based on synteny with their gaps presumably 268

marking positions of transposable elements (Tab. S3). Linkage mapping of all scaffolds 269

resulted in a total of 29 different chromosomes for S. carlsbergensis (Fig. 5). In contrast, 270

the Weihenstephan lager yeast was shown to harbour 36 different chromosomes which 271

is confirmed by our analysis (Nakao et al., 2009). The complete list of S. carlsbergensis 272

chromosomes also enables an overview of the number and position of translocations in 273

this genome (Tab. 4). In the S. carlsbergensis genome we find conserved reciprocal 274

translocations between the S. eubayanus-derived chromosomes II/IV and VIII/XV that 275

are also present in the WS34/70 strain. Apparently, these translocations are ancestral 276

as they also occur in S. bayanus. Interestingly, the S. carlsbergensis and 277

Weihenstephan lager yeast strains share three translocations: One on chromosome XVI 278

shown in Fig. 4 within YPL240C, another one at the MAT-locus, and the last one within 279

YGL173C (see also below). In addition S. carlsbergensis harbours 7 unique 280

translocations between chromosomes of both parental genomes. The translocations 281

generated several chimeric chromosomes that are a distinguishing feature of this yeast. 282

WS34/70, on the other hand, carries 8 translocations that are specific for this strain. 283

284

Ploidy assessment for S. carlsbergensis 285

Previous reports suggested that based on array hybridization signal intensities group I 286

lager yeasts have a DNA content resembling that of 2n S. cerevisiae. Thus it was 287

hypothesized that group I lager yeasts originated from a hybridization of two haploid S. 288

cerevisiae and S. eubayanus cells (Dunn and Sherlock, 2008). Based on the high 289

coverage sequencing we could use the amount of sequence reads per scaffold unit size 290

as a measure of abundance of the corresponding chromosomes. To this end we used 291

LASTZ to map all S. carlsbergensis reads to the scaffolds and SAMtools to get sorted 292

alignments of the reads to the scaffolds. This was used to calculate the read depth per 293

1500 bp window. The data were visualized using ggplot2 in R (Fig. 6A). The data were 294

consistent with our mapping of individual scaffolds into chromosomes and the additional 295

translocation events observed, e.g. based on our chromosomal map the S. eubayanus-296

derived scaffold 15 is present in three copies. Based on these data we were able to 297

generate an overview on the ploidy of each chromosome in S. carlsbergensis (Fig. 7 298

and Tab. 3). Surprisingly, these results indicate that S. carlsbergensis basically is a 299

triploid strain harbouring less than one haploid S. cerevisiae and more than a diploid S. 300

eubayanus genome. Two chromosomes are distinct: chromosome I is present only in 301

one S. cerevisiae and one S. eubayanus copy each, whereas chromosome III is present 302

in two S. cerevisiae copies and only one S. eubayanus copy. Based on our data we can 303

infer that S. carlsbergensis harbors 29 different chromosomes and a total of 47 304

chromosomes - i.e. 3n-1 (Tab. 3). Of these 47 chromosomes 10 are chimeric. The 305

ploidy analysis also revealed that the ratio for S. eubayanus vs S. cerevisiae derived 306

DNA is 2:1 in S. carlsbergensis (Fig. 6A). A similar analysis for WS34/70 using our 307

sequence data indicates that this group II lager yeast strain is tetraploid composed of 308

basically two diploid S. cerevisiae and S. eubayanus genomes (Fig. 6B). We also 309

performed FACS analyses with both lager yeast strains to obtain independent evidence 310

on their ploidies compared to 1n and 2n laboratory strains (Fig. 6C). These data are 311

consistent with the ploidy data generated from NGS data. 312

313

314

Discussion 315

The tradition of beer making is ancient and goes back thousands of years. In central 316

Europe it was associated with monks, and one of the most famous places was Munich 317

in Bavaria (which actually literally means “the monks’ place”). Originally dark beers were 318

produced that became replaced at the end of the 19th century with pilsner type beers. 319

This movement may have originated in Munich as Gabriel Sedlmayer started pale ale 320

production in the Spaten Brewery of Munich (Hornsey, 2003; Kodama et al., 2005). 321

From there lager beer brewing spread to Pilsen, Czech Republic, and to Copenhagen, 322

Denmark. This geographic associations and affiliations with specific breweries is 323

reflected in today’s grouping of lager yeasts as group I (Czech and Carlsberg) or group 324

II (Weihenstephan and Heineken) (Dunn and Sherlock, 2008). 325

Lager beer production was revolutionized by the use of pure culture lager yeast strains 326

introduced by Emil Chr. Hansen at Carlsberg (Hansen, 1883). Up to this time point new 327

brews were initiated by repitching yeasts from a previous brew. This tradition has been 328

kept, however, from then on care was taken that the production strains were kept 329

isolated from other yeast strains. 330

Here we have determined the genome sequence of Saccharomyces carlsbergensis, the 331

Carlsberg brewery production strain since 1883. Our data fit well with previous reports 332

either covering the hybrid nature of lager yeasts based on the study of single genes or 333

using more global analyses like array-CGH (Rainieri et al., 2006, Dunn and Sherlock, 334

2008). 335

A clear distinction between group I and group II lager yeast strains is the selective loss 336

of parts of the S. cerevisiae parental genome in group I lager yeasts. For S. 337

carlsbergensis this resulted in the complete loss of three chromosomes (VI, XI, and XII) 338

and in loss of heterozygosity at four chromosomes (IV, XIII, XV, and XVI) amounting to 339

a total of > 3.5 Mb of S. cerevisiae DNA. The driving force behind this evolution is yet 340

unclear. Loss of chromosome 12, for example, encompasses elimination of the S. 341

cerevisiae rDNA cluster in S. carlsbergensis. In contrast in the Weihenstephan strain a 342

massive loss of the S. eubayanus rDNA cluster was observed (Nakao et al., 2009). The 343

loss of other genome parts may be attributed to the cold fermentation conditions applied 344

during lager beer fermentation in the 19th century. At Carlsberg, fermentation 345

temperatures were as low as 5 °C. We found, correspondingly, that S. carlsbergensis 346

was better adapted to cold temperature growth conditions than group II lager yeasts 347

including the WS34/70 strain. The S. eubayanus ancestor is also a psychrophilic strain, 348

thus, maintenance of the S. eubayanus genome part may have been selected for under 349

these fermentation conditions. Current lager beer fermentations are carried out at 350

considerably higher temperatures and e.g. at 14 °C the group II lager yeasts are slightly 351

faster than group I strains (see Fig. 2; Saerens et al., 2008). 352

In S. carlsbergensis we noted loss of the left arm of S. eubayanus chromosome XVI 353

(~100 kb) and loss of the right arm of chromosome III starting at the MAT-locus (~100 354

kb). Both positions involved translocations between the respective S. cerevisiae and S. 355

eubayanus chromosomes and, interestingly, are conserved between group I and group 356

II lager yeasts. Genes involved in these translocations are the MAT-locus and the 357

HSP90 homolog HSP82. These re-arrangements may have played key roles in lager 358

yeast evolution. Alterations at the MAT-locus may have been instrumental to e.g. avoid 359

sporulation under adverse conditions such as at the end of fermentation. The 360

translocation at HSP82 occurred within the gene and thus has generated a chimeric 361

gene. HSP82, encodes a HSP90 chaperone required e.g. for refolding of denatured 362

proteins (Burnie et al., 2006; Pursell et al., 2012). HSP90 has been shown to act as a 363

capacitor for morphological evolution (Rutherford and Lindquist, 1998; Taipale et al., 364

2010). Thus a translocation at YPL240C may have played a substantial role in lager 365

yeast evolution that is currently under further investigation. 366

Genome sequencing in lager yeasts is only at its early beginnings and the S. 367

carlsbergensis genome presented here is the first done using next-generation 368

sequencing technologies, which we also used to update the genome sequence of the 369

WS34/70 strain. Several hypotheses have been developed on the evolution of lager 370

yeast and the origin of the parental yeast strains. Currently, the non-cerevisiae parent is 371

viewed to be a close relative of S. eubayanus and the S. cerevisiae parent may have 372

been a strain already used for beer brewing, e.g. an ale yeast (Dunn and Sherlock, 373

2008; Bond, 2009; Libkind et al., 2011; Nguyen et al., 2011). Our work adds to this as 374

we can promote two hypotheses. First, based on our ploidy analyses, S. carlsbergensis 375

is functionally an allotriploid strain whereas group II lager yeasts are allotetraploid. This 376

could argue in favor of at least two independent hybridization events in that group I 377

lager yeasts were generated by a fusion of 1n S. cerevisiae with 2n S. eubayanus and 378

group II lager yeasts by fusion of two 2n yeasts. However, comparison of translocations 379

in S. carlsbergensis with those in the Weihenstephan strain identified 3 conserved 380

events and 7 to 8 strain specific events. Based on these conserved events, however, 381

and based on the history of lager beer production originating in Munich we favor the 382

notion that both strains share a joint history and a common ancestor. Previously, a close 383

relationship of CBS1513 with WS34/70 was also proposed based on the analysis of 384

single genes (Nguyen et al., 2011). A joint ancestry, on the other hand, suggests that S. 385

carlsbergensis evolved by massively reducing its S. cerevisiae genome content. Most of 386

this evolution was apparently due to whole chromosome loss but could also have come 387

about by meiotic reduction and remating. Whole genome duplication in the shared 388

ancestor between S. cerevisiae and e.g. S. castellii was also followed by massive gene 389

losses. In S. cerevisiae this did not lead to wholesale chromosome loss, whereas S. 390

castellii has reduced the number of chromosomes from 16 down to 9 (Cliften et al., 391

2006; Scannell et al., 2007). We are currently investigating this in more detail by e.g. by 392

comparing the relationship between S. carlsbergensis and S. monacensis, another 393

strain isolated by Hansen in the 19th century, which apparently has lost additional parts 394

of the S. cerevisiae parental genome (our unpublished data). 395

The use and conservation of pure culture yeast strains in lager beer production has had 396

a profound impact on the quality and reproducibility in beer production and promoted 397

large scale productions. Yet, at the same time evolution of lager yeast strains was 398

impaired under these conditions. Batches of beer that were inferior compared to the 399

standard or became contaminated were readily discarded as the production strain could 400

be propagated from a pure culture. This generated consistent production results and on 401

the other hand diminished the chance of yeast strains to evolve further. To estimate the 402

level of diversity we obtained several historic bottles from the Carlsberg Museum bottle 403

collection filled with original beer from the late 19th century. In the slurry present in these 404

bottles yeast cells were found that could be stained with the cell wall dye calcofluor. 405

Using PCR we could detect S. carlsbergensis specific DNA fragments. Attempts to 406

isolate living material from these bottles generated two isolates, one determined as 407

Sporobolomyces roseus (a beer spoilage yeast not present in our lab) and the other as 408

S. carlsbergensis based on rDNA sequencing. Sequencing of this presumptive bottle 409

isolate revealed it to be identical to the CBS1513 genome sequence, which has been 410

kept in the CBS strain collection since 1947 with minimal propagation cycles. This 411

suggests very limited evolution of pure cultured yeast strains under industrial 412

fermentation conditions. Future work on lager yeast evolution will not only cover the 413

historic spectrum of lager yeast strains but move on to demonstrate the evolutionary 414

potential of lager yeast hybrids to adapt to altered fermentation conditions and to study 415

the dynamics within lager yeast populations. 416

417

418

419

Acknowledgments 420

We thank Bjarne Maurer for providing access to the Carlsberg bottle collection and 421

insight into exact dating of bottles based on the respective labels used. We kindly thank 422

the analytical team of the Carlsberg Group Development in Strasbourg concerning 423

flavor analyses. This work was funded by grant 2010_01_0135 of the Carlsberg 424

Foundation to JWW. 425

426

427

References 428

Bond, U., 2009 Chapter 6: The genomes of lager yeasts. Adv Appl Microbiol 69: 159-429 182. 430

Borsting, C., R. Hummel, E. R. Schultz, T. M. Rose, M. B. Pedersen et al., 1997 431 Saccharomyces carlsbergensis contains two functional genes encoding the acyl-432 CoA binding protein, one similar to the ACB1 gene from S. cerevisiae and one 433 identical to the ACB1 gene from S. monacensis. Yeast 13: 1409-1421. 434

Burnie, J. P., T. L. Carter, S. J. Hodgetts and R. C. Matthews, 2006 Fungal heat-shock 435 proteins in human disease. FEMS Microbiol Rev 30: 53-88. 436

Casaregola, S., H. V. Nguyen, G. Lapathitis, A. Kotyk and C. Gaillardin, 2001 Analysis 437 of the constitution of the beer yeast genome by PCR, sequencing and 438 subtelomeric sequence hybridization. Int J Syst Evol Microbiol 51: 1607-1618. 439

Cliften, P. F., R. S. Fulton, R. K. Wilson and M. Johnston, 2006 After the duplication: 440 gene loss and adaptation in Saccharomyces genomes. Genetics 172: 863-872. 441

Dunn, B., and G. Sherlock, 2008 Reconstruction of the genome origins and evolution of 442 the hybrid lager yeast Saccharomyces pastorianus. Genome Res 18: 1610-1623. 443

Fujii, T., H. Yoshimoto, N. Nagasawa, T. Bogaki, Y. Tamai et al., 1996 Nucleotide 444 sequences of alcohol acetyltransferase genes from lager brewing yeast, 445 Saccharomyces carlsbergensis. Yeast 12: 593-598. 446

Hansen, E.C., 1883. Recherches sur la physiologie et la morphologie des ferments 447 alcooliques V. Methodes pour obtenir des cultures pures de Saccharomyces et 448 de mikroorganismes analogues. C.R. Trav. Lab. Carlsberg 2: 92–105. 449

Hansen, J., and M. C. Kielland-Brandt, 1994 Saccharomyces carlsbergensis contains 450 two functional MET2 alleles similar to homologues from S. cerevisiae and S. 451 monacensis. Gene 140: 33-40. 452

Hornsey, I., 2003 A history of beer and brewing. RSC Paperbacks, Cambridge UK. 453 Ito, K., and D. Murphy, 2013 Application of ggplot2 to Pharmacometric Graphics. CPT 454

Pharmacometrics Syst Pharmacol 2: e79. 455 Kielland-Brandt, M. C., Nilsson-Tillgren, T., Gjermansen, C., Hollenberg, S., and M. B. 456

Pedersen, 1995. Genetics of brewing yeasts. In The yeasts (eds. A.H. Rose et 457 al.), pp. 223–254. Academic Press, London. 458

Kodama, Y., Kielland-Brandt, M. C., and J. Hansen, 2005. Lager brewing yeast. In 459 Comparative genomics (eds. P. Sunnerhagen and J. Piskur), pp. 145–164. 460 Springer-Verlag, Berlin. 461

Krzywinski, M., J. Schein, I. Birol, J. Connors, R. Gascoyne et al., 2009 Circos: an 462 information aesthetic for comparative genomics. Genome Res 19: 1639-1645. 463

Li, H., B. Handsaker, A. Wysoker, T. Fennell, J. Ruan et al., 2009 The Sequence 464 Alignment/Map format and SAMtools. Bioinformatics 25: 2078-2079. 465

Libkind, D., C. T. Hittinger, E. Valerio, C. Goncalves, J. Dover et al., 2011 Microbe 466 domestication and the identification of the wild genetic stock of lager-brewing 467 yeast. Proc Natl Acad Sci U S A 108: 14539-14544. 468

Nakao, Y., T. Kanamori, T. Itoh, Y. Kodama, S. Rainieri et al., 2009 Genome sequence 469 of the lager brewing yeast, an interspecies hybrid. DNA Res 16: 115-129. 470

Nguyen, H. V., J. L. Legras, C. Neuveglise and C. Gaillardin, 2011 Deciphering the 471 hybridisation history leading to the Lager lineage based on the mosaic genomes 472 of Saccharomyces bayanus strains NBRC1948 and CBS380. PLoS One 6: 473 e25821. 474

Nilsson-Tillgren, T., Gjermansen, C., Holmberg, S., Petersen, J. G. L. and Kielland-475 Brandt. M. C., 1986 Analysis of chromosome V and the ILV1 gene from 476 Saccharomyces carlsbergensis. Carlsberg Res Commun 51: 309-326. 477

Pursell, N. W., P. Mishra and D. N. Bolon, 2012 Solubility-promoting function of Hsp90 478 contributes to client maturation and robust cell growth. Eukaryot Cell 11: 1033-479 1041. 480

Rainieri, S., Y. Kodama, Y. Kaneko, K. Mikata, Y. Nakao et al., 2006 Pure and mixed 481 genetic lines of Saccharomyces bayanus and Saccharomyces pastorianus and 482 their contribution to the lager brewing strain genome. Appl Environ Microbiol 72: 483 3968-3974. 484

R Development Core Team (2013). R: A language and environment for statistical 485 computing. R Foundation for Statistical Computing, Vienna, Austria. URL 486 http://www.R-project.org/. 487

Rutherford, S. L., and S. Lindquist, 1998 Hsp90 as a capacitor for morphological 488 evolution. Nature 396: 336-342. 489

Saerens, S. M., P. J. Verbelen, N. Vanbeneden, J. M. Thevelein and F. R. Delvaux, 490 2008 Monitoring the influence of high-gravity brewing and fermentation 491 temperature on flavour formation by analysis of gene expression levels in 492 brewing yeast. Appl Microbiol Biotechnol 80: 1039-1051. 493

Scannell, D. R., G. Butler and K. H. Wolfe, 2007 Yeast genome evolution--the origin of 494 the species. Yeast 24: 929-942. 495

Taipale, M., D. F. Jarosz and S. Lindquist, 2010 HSP90 at the hub of protein 496 homeostasis: emerging mechanistic insights. Nat Rev Mol Cell Biol 11: 515-528. 497

Tamai, Y., T. Momma, H. Yoshimoto and Y. Kaneko, 1998 Co-existence of two types of 498 chromosome in the bottom fermenting yeast, Saccharomyces pastorianus. Yeast 499 14: 923-933. 500

Yamagishi, H., and T. Ogata, 1999 Chromosomal structures of bottom fermenting 501 yeasts. Syst Appl Microbiol 22: 341-353. 502

503 504

505

Figure Legends 506

507

Figure 1. Growth comparisons with lager yeasts. 508

Growth curves were obtained from YPD cultures grown at 10°C, 20°C, and 30°C over a 509

period of 2- 4 days. The following strains were used: Group I lager yeast S. 510

carlsbergensis (1513), S. monacensis (1503), group II lager yeast (WS34/70), an S. 511

cerevisiae ale yeast (ALE), S. eubayanus (EUB), and the laboratory S. cerevisiae strain 512

CEN.PK. 513

514

Figure 2. Malt based fermentations and volatile compound analysis with lager 515

yeast strains. 516

(A) Representative fermentation kinetics of S. carlsbergensis (CBS1513), S. 517

monacensis (CBS1503), and the Weihenstephan strain (WS34/70) with granulated malt 518

of 14 °P at 14 °C. Data were averaged based on n>4 parallel fermentations. The upper 519

plot shows the weight loss over time based on CO2 release (g/l) the lower chart 520

indicates the reduction of sugar content. (B) Spider chart representing the volatile 521

flavors analysed by GC/FID. The values obtained for the Weihenstephan strain were set 522

to 100% (see Tab. S2 for details) and compared to those from the group I lager yeasts. 523

524

Figure 3. Overview of the S. carlsbergensis subgenomes. 525

Genome sequencing data for S. carlsbergensis were assembled into the S. cerevisiae and S. 526

eubayanus sub-genomes and used in a pairwise comparison with the S. cerevisiae S288C 527

chromosomes. The resulting information on all chromosome rearrangements is converted from 528

tabular data into a circular plot by the Circos software package. Highlighted in green are the lack 529

of chromosomes VI, XI, and XII in the S. cerevisiae sub-genome and the translocations between 530

chromosomes II/IV and VIII/XV in the S. eubayanus sub-genome of S. carlsbergensis (see also 531

Tab. 2). 532

533

Figure 4. Strategy of chromosome assembly for the S. carlsbergensis genome. 534

The scaffold composition of the chimeric chromosome XVI consisting of a telomeric left 535

end derived from its S. cerevisiae parent and a major part of S. eubayanus is shown. 536

Scaffolds were merged based on assembly of initial sequence reads (scaffold 537

assembly) by directed PCR using S. eubayanus specific primers to merge scaffolds 18 538

and 26 (PCR) or based on synteny to the parental genomes (synteny). Lasergene 539

DNAstar software was used for sequence alignments, alignment snapshots of the 540

scaffold ends and the linking PCR or template sequences are shown. 541

542

Figure 5. Chromosomal composition of the S. carlsbergensis genome. 543

The chromosomal structure of the S. carlsbergensis genome is summarized and 544

compared to the 16 chromosomes of the S. cerevisiae genome. The chromosome sizes 545

are proportional to the size bar (in bp) on top of the chart. Chromosomal DNA derived 546

from the S. cerevisiae sub-genome is indicated in blue, that of the S. eubayanus sub-547

genome in orange. Loss of heterozygosyity (LOH) e.g. on chromosomes III and XVI can 548

be located, reciprocal translocations in the S. eubayanus sub-genome (II/IV and VIII/XV) 549

are shown in checkers and stripes on the chromosomes, respectively. Additional LOH-550

events in the S. cerevisiae sub-genome on chromosomes IV and XV are marked with 551

connectors encompassing the chromosomal segments involved. 552

553

554

555 Figure 6. Ploidy analysis for the S. carlsbergensis genome. 556

557

A violin plot generated by ggplot2 shows the ploidy calculated based on the read depth 558

for S. carlsbergensis CBS1513 (A) and S. pastorianus WS34/70 (B). The individual 559

reads were aligned to the respective scaffolds using LASTZ, the alignment output was 560

parsed with SAMtools in order to index and extract the number of aligned reads at each 561

locus. A running average of mapped reads per 1500 bp window was calculated. The 562

violin plot shows the distribution of the log2 ratios of copy number variation across each 563

chromosome. Blue represents the S. cerevisiae sub-genome, orange the S. eubayanus 564

sub-genome and green indicates hybrid scaffolds/chromosomes. (C) Flow cytometry 565

analysis of the DNA content of the S. carlsbergensis and Weihenstephan strains 566

compared to 1n and 2n laboratory strains. DNA content is plotted versus cell counts. 567

568

Figure 7. Chromosomal structure and chromosome copy number of S. 569

carlsbergensis. 570

The 16 Saccharomyces sensus stricto chromosomes were used to align the 571

chromosomes of S. carlsbergensis. Blue parts of chromosomes represent the S. 572

cerevisiae sub-genome, orange the S. eubayanus sub-genome. Ploidy was taken into 573

account to represent the parental contribution. 574

575

576

577

578

579

580

581 Tables 582

Table 1. Genome Assembly data 583

584

CBS1513 WS34/70

Number of Contigs 386 1336

Number of Scaffolds 78 985

N50 scaffold size 552 537 92 939

Largest scaffold size 1 262 187 1 252 108

Annotated bases in scaffolds 19 436 056 22 954 394 585

586

587 Table 2. Genome reduction in Saccharomyces carlsbergensis 588

589

S. cerevisiae genome size (Mb) 12.1

S. bayanus genome size (Mb) 11.5

Hypothetical hybrid tetraploid genome (Mb) 23.6

Unterhefe No1 genome (Mb) 19.5

Loss of chromosomes CHR6 0.27

CHR11 0.67

CHR12 1.1

Loss of heterozygosity

Chr3nonSc 0.11

CHR4sc 0.38

CHR13sc 0.12

CHR13sc 0.08

CHR15sc 0.48

CHR16nonSc 0.11

CHR16sc 0.36

CHR16sc 0.02

Total (Mb) 23.2

590

591

592 Table 3. Chromosomal make-up of Saccharomyces carlsbergensis 593

Sc Chr SC copies chimeric Se Chr** Se copies unique Chr

I 1 0 I 1 2

II 1 0 II-IV 2 2 III 2 1 III 0 2

IV 0 1 IV-II 2 2

V 1 0 V 2 2

VI 0 0 X-VI 3 1

VII 0 3* VII 0 2

VIII 1 0 VIII-XV 2 2

IX 1 0 IX 2 2

X 1 0 VI-X 2 2

XI 0 0 XI 3 1

XII 0 0 XII 3 1

XIII 0 1 XIII 2 2

XIV 1 0 XIV 2 2

XV 0 1 XV-XIII 2 2

XVI 0 3* XVI 0 2

Sum 9 10 28 29

Total 47

* for Chr7 and 16 are 2 different chimera present

** Se = S. eubayanus 594

595 Table 4. List of translocations in the Saccharomyces carlsbergensis genome 596

Type TranslocationGene:

Systematic NameGene:

Standard Name

S.eub-S.eub II-IV YBR030w - YDR012w* RKM3 - RPL4B

IV-II YDR011w - YBR031w* SNQ2- RPL4A

VIII-XV YHR014w - YOR019w* SPO13 - n/a

XV-VIII YOR018w - YHR015w* ROD1 - MIP6

S.eub-S.cer III-III YCR038c - YCR039c* BUD5 - MATALPHA2

VII-VII YGL173c - YGL173c* XRN1

XIII-XIII YML074c - YML073c FPR3 - RPL6A

XVI-XVI YPL036c - YPL036c PMA2

S.cer-S.eub IV-IV YDR324c - YDR324c UTP4

VII-VII YGL173c - YGL173c KEM1

XIII-XIII YMR287c - YMR287c MSU1

XV-XV YOR133w - YOR134w EFT1 - BAG7

XVI-XVI YPL240c - YPL240c* HSP82

XVI-XVI YPR184w - YPR185w GDB1 - ATG13

* Indentical translocations to WS34/70

597

598

599

600 Table S1. Primers used in this study to bridge gaps between scaffolds 601

 602

Chr  Primer 1 

sequence  Primer 2 

sequence 2  scaffold 

2/4  6479  GGCGACAGCACGACCAGTACCCC 6485  GGAAGCAGGAGTGACTGAGGC 1 

4  6591  GTTGCGTGTGCACAGTAGAGGG 6611  cagtgtactccggaggagcattcac 3+42 

4  6964  GTGTAATAGACGACCCATG 6965 GAAGGCTTATGCTGGAGC 42+1p

4/2  6480  GGTATGTAAGTAAAACCAG 6486  CATAAGGAAAAGTAAGCAATG 4 

7  6482  CTCTTAATAAAGAAAGGTGCAAAAGAA 6488  TAGTCCACCTGTACTTGGGCCG 6 

7  6593  CTGATTCATAGCCTCGTAtAG 6613  GCTCAGAGTTTACCAAGAGAG 6+32 

7  6481  CTTAATAAAGAAAGATGTAATAAGT 6487  GTTGTTCCAGGCATACTCGCA 2 

7  6594  CCAGTAGGTCCTCTGTAAGAC 6614 CCAATGTCGACCCAGACGAG 32+77

7  6595  CAACCACCAGATTTGATGTTC 6615  GAGATTCGCCAAGCAGACGTC 77+59 

8  6596  CATAAATTTGATCTTAGCATC 6616  GGACAACGTGGATAGCAAGGAC 50+22 

8/15  6520  GTTATTTCGTTCGGTTCTCAAGG 6528  CTGTAAGGATTATTTGGTCAAACTC 27+15 

8/15  6551  CTGTGATCCAAAGGCTGACTTG 6552  GTATACTACCTTATTATATGTATTAC 27+15 

10  6598  GGAGAATATTGACAGTTACAC 6618 GTGAAAGTTCTTTGCAAGATG 24+23

10  6599  GGATTGCAGACCATTTCATC 6619  GAATTTCGTTATTCCTACCTTC 25+37 

10  6600  CAGATTCTCCAAATTACTGG 6620  GAAGAAGCTGCCATTTCCG 37+28 

11  6601  CTCGAAGACAGTTCATCGTATG 6621  CTGTGTGTTCCGTAGTTCACC 53+10 

12  6602  GATGACCGTAAATGCTGCTTG 6622 CGAACGACTTGTCAGACGC 5+40

13  6517  GGTGATACGGATGGTAATGGGCATCG 6526 CATTGCTACCTCTACTAAGGTT 39+51

13  6604  CTGGTGGGGCTGTGTGGATGC 6624  CTACCCGTAATCAAGTTGCC 11+41 

13  6515  GCAAGTAATTCCAATATTAATGG 6523  CTATTGGGTGTACCGAGTATCCTG 41+47 

13  6517  GGTGATACGGATGGTAATGGGCATCG 6525  CATTGCCACCTCCACCAACGTC 39+30 

13  6548  CCGTTCTACCCTGAACTACGAG 6549 TCACGACTTATAGCTGCAATTAATCAC 39+30

13  6605  CCATTGTTGACCTGATTCTG 6625 GATGAAGGCCTTCGACCGTC 30+16

13  6515  GCAAGTAATTCCAATATTAATGG 6524  CTTTATACGTCGCTCCCTCAG 16+47 

14  6606  CAGCGAAGTGGAAGATGACC 6626  GAACATCAAGGCTTTGGACC 46+14 

14  6607  GACATTGTCTTGTGGAGCC 6627  GCAATGATAAGGTGTTCTTC 14+36 

15  6608  GACGAAGACAGTTAGCTTTAC 6628 GAGCGGACCATTGCAAGTGG 44+17

15  6519  gtcgctgtcgaagtcaagaacgc 6527  GTTGGGGACGAGTCGCCTTGAG 17+15 

15  6550  CAGAATCCAAGGTCCAAACTACG 6528  CTGTAAGGATTATTTGGTCAAACTC 17+15 

15/8  6609  GCCATCTCATTTAGCACCAGC 6629  GTCACCATCTCTCATTTCCAAG 9+43 

16  6521  GCACCAGCAGAAGAGTTAGTC 6529  TGAGTCAGAATCATCAGCGGCAGAAG 18+20 

16  6521  GCACCAGCAGAAGAGTTAGTC 6530 GGAGTCGGAGTCGTTAGCAGCAGGCA 18+26

16  6522  GAAAGTGTGTGGGCAGGATTG 6531  CTCTTTCTCGTTATTCAGATTG 20+52 

603 604 605

606

607 608 Table S2. Volatile compound analysis 609

610

compound WS34/70 CBS1513 CBS1503

Ethanol % v/v 5,86 ± 0,01 6,04 ± 0,01 5,13 ± 0,00

acetaldehyde ppm 3,5 ± 0,7 5,2 ± 0,2 4,5 ± 0,2

ethylacetate mg/l 35,1 ± 1,3 18,1 ± 1,3 17,5 ± 4,4

isobutanol mg/l 116,8 ± 11,0 194,9 ± 1,4 76,6 ± 27,2

isobutylacetate mg/l 0,3 ± 0,1 0,2 ± 0,1 0,1 ± 0,1

propanol mg/l 31,0 ± 1,1 25,4 ± 0,3 24,8 ± 1,2

isoamyl alcohol mg/l 244,1 ± 17,2 224,3 ± 1,2 174,0 ± 32,1

isoamylacetate mg/l 7,5 ± 0,8 4,9 ± 0,4 2,5 ± 1,1

2-phenylethanol mg/l 57,8 ± 6,4 76,9 ± 7,2 60,1 ± 17,9

2-phenylethyl acetate mg/l 1,3 ± 0,1 1,3 ± 0,1 0,7 ± 0,3

ethyl hexanoate mg/l 0,2 ± 0,1 0,2 ± 0,0 0,2 ± 0,1

ethyl octanoate mg/l 0,2 ± 0,0 0,2 ± 0,0 0,1 ± 0,0

hexanoic acid mg/l 0,8 ± 0,0 0,7 ± 0,1 0,7 ± 0,2

octanoic acid mg/l 5,4 ± 0,2 6,5 ± 0,3 5,6 ± 1,6

vinyl gaïacol mg/l 0,7 ± 0,1 0,7 ± 0,1 0,8 ± 0,0

Decanoic acid mg/l 0,2 ± 0,0 1,3 ± 0,1 1,3 ± 0,3

Total acids mg/l 6,4 ± 0,2 8,5 ± 0,3 7,6 ± 1,6

Sub-total alcohols mg/l 205,6 ± 17,8 297,3 ± 8,8 161,4 ± 44,7

Total esters mg/l 43,3 ± 2,2 23,7 ± 1,8 20,3 ± 5,5

611

612

613 Table S3. Scaffold assembly for S. carlsbergensis. 614

615

Saccharomyces carlsbergensis

Sc Chr Scaffolds Se Chr Scaffolds I 33 I 34

II 7 II‐IV 1

III 38 (TY) 35 III 31+78+35part

IV 3+42+1part IV‐II 4

V 12 V 13

VI ‐ VI 29

VII 6+32+77+59 VII 2

VIII 50+22**48 VIII‐XV 27+15

IX 19 IX 21

X 24 (TY) 23 X 25*37+28

XI ‐ XI 53*10, 52

XII ‐ XII 5+40

XIII 39+51 (TY) 11+41+47 XIII 39+30 (TY) 16+47

XIV 46 (TY) 14 (TY) 36 XIV 8

XV 44+17+15 XV‐XIII 9+43

XVI 56+18*20+52 XVI 56+18+26+45+52

616

A „+“ indicates that scaffolds were combined by PCR and sequencing. Grey 617

boxes mark scaffolds that represent either chromosomes consisting of only one 618

scaffold or chromosomes which were generated by merging scaffolds. Red 619

boxes mark scaffolds with gaps containing TY-elements. A “*” indicates a gap < 620

0.5 kb verified by PCR and “**” indicates the region between YHR165C and 621

YHR174W that is apparently missing in S. carlsbergensis. 622

623

624

625

626

627