Concerted Evolution of the Replication-Dependent Histone Gene Family inDrosophila immigransKakubayashi N1,2, Fujita E1, Morikawa M1, Ohashi S1 and Matsuo Y1-4*

1Laboratory of Adaptive Evolution, Faculty of Integrated Arts and Sciences, Tokushima University, Tokushima, Japan2Graduate School of Integrated Arts and Sciences, Tokushima University, Tokushima, Japan3Institute of Socio-Arts and Sciences, Tokushima University, Tokushima, Japan4Graduate School of Science and Technology, Tokushima University, Tokushima, Japan*Corresponding author: Matsuo Y, Graduate School of Science and Technology, Tokushima University, Minamijosanjima-cho 2-1, Tokushima, 770-8506, Japan, Tel:81886567270; E-mail: matsuo.yoshinori@tokushima-u.ac.jp

Received date: Dec 02, 2016; Accepted date: Dec 19, 2016; Published date: Jan 05, 2017

Copyright: © 2017 Kakubayashi N, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Abstract

The replication-dependent histone genes in Drosophila immigrans were analyzed for elucidating the evolutionarymechanism of the histone multigene family. A region of approximately 3.9 kb containing H2A-H2B-H1 genes wascloned. Six independent clones were sequenced and analyzed for nucleotide variability. The average nucleotidesequence identity in the region among repetitive copies was more than 99%, indicating that the histone multigenefamily in D. immigrans has evolved in a concerted fashion and with a similar level as in D. melanogaster. Amino acidvariants were found at a low frequency. Analysis of the GC content at the 3rd codon position of histone genesrevealed that a change in GC content, i.e., a decrease, observed in D. hydei and D. americana has occurred afterthe divergence of an ancestor of these two species from D. immigrans.

Keywords: Concerted evolution; Histone multigene family; GCcontent; Drosophila

IntroductionEvolutionary factors, including selection, genetic drift, migration

and mutation, interact and cause genetic changes in organisms [1-2].Evolutionary mechanisms can be studied by investigating measurablevalues, such as genetic variability [1,3-6], molecular evolutionary rate[7-10], concerted evolution of a multigene family [11-17] and changesin GC content [14-15,18-20], and by speculating on the factors thataffect them. For studying the evolution of a multigene family,additional information, such as copy number and variability amongcopies, is necessary [13,16-17]. Gene copies of replication-dependenthistones in Drosophila melanogaster were reported to be 0.40%different within a chromosome [13]. In addition, a 0.6-0.9% differencewas reported for the histone repeating unit in other Drosophila species[17,21-22]. Investigations of many species are required to determinethe kinds of evolutionary changes that have occurred and the level ofnucleotide variability in a multigene family. The factors contributing tothe evolutionary mechanism of a multigene family can be understoodmore clearly if the nucleotide variability among copies in a multigenefamily is studied in many species.

There are two types of histones: Replication-dependent andreplication-independent [23]. In Drosophila, histone genes for thereplication-dependent type are tandemly clustered with approximately110 copies [24]; in contrast, the histone genes for the replication-independent type comprise only one or a few copies [25-28]. There isalso a large difference in the gene structures of the two types ofhistones [25-28]. Two types of histone genes have been evolvedindependently [29-31].

In this paper, for studying the evolutionary mechanism of thehistone multigene family, the nucleotide variability among repetitivegenes was investigated in a region of approximately 3.9 kb containingthe H2A-H2B-H1 genes of the histone repeating unit in D. immigrans.By studying the GC content in D. immigrans, information on GCcontent evolution can be obtained for the lineage leading to specieswith a low GC content, i.e., D. americana and D. hydei.

Materials and Methods

Drosophila strain and DNA extractionAn isofemale strain of D. immigrans was donated by Kyushu

University, Japan. Genomic DNA from D. immigrans was extractedfrom larvae with a DNA extraction kit (Sepa Gene Kit, Sanko Junyaku,Co., Ltd., Tokyo, Japan) and studied for variability in the gene familywithin the population.

PCR cloningA 3.9 kb region containing the H2A-H2B-H1 genes of the histone

repeating unit was amplified by PCR from genomic DNA (Figure 1).PCR reactions were conducted with Takara EX Taq (Takara Bio, Kyoto,Japan) [32] under the following conditions: 40 cycles of denaturationat 94°C for 1 min, annealing at 55°C for 2 min and polymerization at70°C for 2 min, followed by extension for 5 s. The nucleotide sequencesof the primers used for cloning the 3.9 kb region are shown in Table 1.The PCR products were then cloned into the plasmid vector PCR 2.1(Invitrogen, Carlsbad, CA, USA). Six independent clones wereanalyzed for genetic variation of the multigene family in the 3.9 kbregion (Figure 1).

Kakubayashi et al., J Data Mining Genomics Proteomics 2017, 8:1

DOI: 10.4172/2153-0602.1000210

Research Article OMICS International

J Data Mining Genomics Proteomics, an open access journalISSN: 2153-0602

Volume 8 • Issue 1 • 1000210

Journal of Data Mining in Genomics & ProteomicsJo

urna

l of D

ata Mining in Genomics &

Proteomics

ISSN: 2153-0602

Primers Sequence (5’-3’) Primers Sequence (5’-3’)

H1F01i TTCGTTTCTAGGAG H1R01i CATTAGTCACTCAA

H1F02i CGGTCTTGGGCTTT H1R02i CGCTCAATTTCCGT

H1F03i ACGGAAATTGAGCG H1R03i GCAATGCGTCTAAT

H1F04i CCACCACGTTCCTT H1R04i AAGGAACGTGGTGG

H1F05i ATTAGACGCATTGC H1R05i TTATTGGCATACAC

H1F06i GTGTATGCCAATAA H1RLi AAAGCCCAAGACCG

H1FLi TTGAGTGACTAATG H2AR1L ATGTCTGGTCGTGG

H2AF2 TTAGGCCTTCTTCT H2BR10i GCTGTTCATGATGC

H2BF1i CCACGACCAGACAT H2BR11i TACGGAATTACTCC

H2BF8i GCATCATGAACAGC H2BR12i GTCATCGAAACACT

H2BF9i GAGGCCTCCCGTTT T7 TAATACGACTCACTATAGGG

H3F20 GCGAACGTGCTTAA Reverse CAGGAAACAGCTATGAC

Table 1: Sequences of the primers used for cloning and sequencing.

DNA sequencingThe sequencing strategy for the 3.9 kb region of the histone gene

repeating unit is shown in Figure 1. The nucleotide sequences of theprimers used for sequencing are indicated in Table 1. The PCRproducts were sequenced with a BigDye Terminator sequencing kit(Applied Biosystems, Foster City, CA, USA) using an ABI310sequencer [33]. DNA sequences for the 3.9 kb region of histone generepeating unit in D. immigrans are deposited in the DNA Data Bank ofJapan (DDBJ). The accession numbers for clones, imm 1, imm 5, imm6, imm 8, imm 10 and imm 11 are LC194855, LC194856, LC194857,LC194858, LC194859, and LC194860, respectively.

Figure 1: Sequencing strategy and the 3.9 kb region for studyingnucleotide variation in Drosophila immigrans.

ResultsThe nucleotide sequence of the region was compared between six

independent clones. The different sites of the nucleotide sequences ofthe clones are shown in Figure 2. Seven of the 12 different sites in thecoding region showed a change in amino acid. In D. immigrans, avariation in amino acid was found at two sites (R-C, L-F) in H2A, onesite (L-P) in H2B and 4 sites (A-P, K-R, T-A, K-E) in H1. Each varianttype was found only once among the 6 samples (Figures 2 and 3).Nucleotide differences were observed over the whole region; however,indels were found only in the 3’ spacer of the H1 gene. The averagenucleotide variability in the region was 0.28%, i.e., the average identitywas 99.72%. The average variability among copies in D. immigrans wasconsiderably small when compared to the corresponding interspeciesdifferences: 32% for D. immigrans and D. americana and 33% for D.immigrans and D. hydei. These results indicated that a strongconcerted evolution has occurred for the multigene family ofreplication-dependent histone genes in D. immigrans.

The GC contents at the 3rd codon position of the histone genes forH1, H2A, H2B and H3 are shown in Figure 3. For comparison, the GCcontents at the 3rd codon position of the histone genes from D.melanogaster, D. americana and D. hydei are also shown. D. americanaand D. hydei are Drosophila species that have a low GC content in thegenes [19,21]. Although the GC content of D. melanogaster is lowerthan those of D. lutescens and D. takahashii [20], it is higher thanthose of D. americana and D. hydei [16]. If the level of GC content atthe 3rd codon position in D. immigrans is similar to that in D.melanogaster rather than those in D. hydei and D. americana, the GCcontent must have been changed after the divergence of D. immigransand an ancestor of D. hydei and D. americana. Alternatively if it issimilar to those of D. hydei and D. americana, the GC content musthave been changed after the divergence of D. melanogaster and anancestor of D. immigrans, D. hydei and D. americana. Figure 4 showedthat the GC content of each histone gene, H3, H2A, H2B or H1, of D.immigrans was comparable to that of D. melanogaster. These resultssuggested that the low GC content observed for D. americana and D.hydei was caused by a GC content decrease after the divergence of anancestor of these species from D. immigrans.

Figure 2: Nucleotide sequence comparison of the 3.9 kb region ofthe histone gene repeating unit in Drosophila immigrans.

Citation: Kakubayashi N, Fujita E, Morikawa M, Ohashi S, Matsuo Y (2017) Concerted Evolution of the Replication-Dependent Histone GeneFamily in Drosophila immigrans. J Data Mining Genomics Proteomics 8: 210. doi:10.4172/2153-0602.1000210

Page 2 of 7

J Data Mining Genomics Proteomics, an open access journalISSN: 2153-0602

Volume 8 • Issue 1 • 1000210

Citation: Kakubayashi N, Fujita E, Morikawa M, Ohashi S, Matsuo Y (2017) Concerted Evolution of the Replication-Dependent Histone GeneFamily in Drosophila immigrans. J Data Mining Genomics Proteomics 8: 210. doi:10.4172/2153-0602.1000210

Page 3 of 7

J Data Mining Genomics Proteomics, an open access journalISSN: 2153-0602

Volume 8 • Issue 1 • 1000210

Citation: Kakubayashi N, Fujita E, Morikawa M, Ohashi S, Matsuo Y (2017) Concerted Evolution of the Replication-Dependent Histone GeneFamily in Drosophila immigrans. J Data Mining Genomics Proteomics 8: 210. doi:10.4172/2153-0602.1000210

Page 4 of 7

J Data Mining Genomics Proteomics, an open access journalISSN: 2153-0602

Volume 8 • Issue 1 • 1000210

Figure 3: Comparison of the nucleotide sequences of the 3.9 kb region from 6 independent clones, imm 1, imm 5, imm 6, imm 8, imm 10, andimm 11 in Drosophila immigrans. Asteriks under the sequences indicate an identical nucleotide in the six clones.

Citation: Kakubayashi N, Fujita E, Morikawa M, Ohashi S, Matsuo Y (2017) Concerted Evolution of the Replication-Dependent Histone GeneFamily in Drosophila immigrans. J Data Mining Genomics Proteomics 8: 210. doi:10.4172/2153-0602.1000210

Page 5 of 7

J Data Mining Genomics Proteomics, an open access journalISSN: 2153-0602

Volume 8 • Issue 1 • 1000210

Figure 4: Evolution of GC content at the 3rd codon positions of the H3 (yellow), H1 (grey), H2A (blue) and H2B (red) genes in D.melanogaster, D. americana, D. hydei and D. immigrans. The GC content data for the H3 gene were obtained from [15-16] for comparison.Evolutionary relationship for these Drosophila species has been already known as reported for the H3 genes [15].

DiscussionThe differences in nucleotide sequence observed in the histone gene

repeating sequences of D. immigrans were caused by either nucleotidesubstitutions or small indels. Although nucleotide substitutions wereobserved in most of the regions, indels were observed only in thespacer region of H1-H4. This is understandable because indels, whichchange the length of the sequence, would be more deleterious whencompared to nucleotide substitutions. Alternatively, mutations byindels would occur more frequent in the spacer region than in theother regions. Some nucleotide substitutions that occurred in thecoding region may cause amino acid changes in the histone proteins.Amino acid variants of replication-dependent histones with lowfrequency have been reported in the gene family [13]. Variants of theamino acids for histones should be called ‘histone variants’ even if thehistone is a replication-dependent type of histone. Histone proteins arehighly conserved at the amino acid level, especially in H3 and H4, i.e.,strong purifying selection is present at the amino acid level. Differentfrom the ‘variants’, the replication-independent type of histones, thevariants of the replication-dependent type of histones must be, in thiscase, deleterious rather than conferring distinctive or new functions.Multiple copy numbers in a gene family must be permissible for theexistence of excessive variants.

The average nucleotide variability for the histone gene repeatingunit was 0.28% in D. immigrans. Corresponding data for the histonerepeating unit from other Drosophila species are indicated in Table 2.Variability in D. immigrans was relatively low and was comparable tothat in D. melanogaster, indicating a strong concerted evolution. Theseresults suggested that the interaction of evolutionary factors, such asselection, gene conversion, unequal crossing over and mutation, mightbe very similar for these two species.

Species

Nucleotide

differenceamong

repetitivecopies

(%)

Numberof

repeatsstudied

References

D. melanogaster 0.40* 10 Matsuo and Yamazaki [13]

D. sechellia 0.61 3 Kakita et al. [17]

D. yakuba 0.65 2 Kakita et al. [17]

D. hydei 0.89 2Fitch and Strausbauch [22],

Kremer and Hennig [21]

D. immigrans 0.28 6 This study

Table 2: Nucleotide variation in the histone multigene family inDrosophila. *Data on variation within a chromosome were used.

The low GC content observed in D. americana and D. hydei can beexplained by a GC content decrease after the divergence of an ancestorof these species from D. immigrans. Our hypothesis for GC contentevolution proposed in previous works [14-16,20] can explain thechange as follows. The evolution of the GC content at the 3rd codonposition was caused by a change in the efficiency of negative selectionfor AT content or codon bias [14-16,20]. The efficiency of selectiondepends on the population size: When the size of the populationbecomes larger, the efficiency for selection also becomes larger [8].Therefore, when the population size of an ancestor of D. americanaand D. hydei became smaller after the ancestor diverged from D.immigrans, the GC content must have been decreased by relaxing

Citation: Kakubayashi N, Fujita E, Morikawa M, Ohashi S, Matsuo Y (2017) Concerted Evolution of the Replication-Dependent Histone GeneFamily in Drosophila immigrans. J Data Mining Genomics Proteomics 8: 210. doi:10.4172/2153-0602.1000210

Page 6 of 7

J Data Mining Genomics Proteomics, an open access journalISSN: 2153-0602

Volume 8 • Issue 1 • 1000210

negative selection against A/T. The population size effect is alsoexpected to be seen for other genes in the same genome.

ConclusionThe 3.9 kb region containing H2A-H2B-H1 genes from D.

immigrans was analyzed for nucleotide variability among repeatingunits of histone genes of replication-dependent type. It was found thata strong concerted evolution has occurred in the histone multigenefamily in D. immigrans. Investigations of nucleotide variability frommany Drosophila species will provide valuable data for understandingthe evolutionary mechanisms of the multigene family.

AcknowledgementThis research was supported by a Grant-in-Aid for Scientific

Research to Y. M. from the Ministry of Education, Culture, Sports,Science and Technology of Japan.

References1. Lewontin RC (1970) The genetic basis of evolutionary change. Columbia

University Press, NY, USA.2. Barton NH, Briggs DEG, Aisen JA, Goldstein DB, Patel NH (2007)

‘Evolution’. Cold Spring Harbor Laboratory Press, NY, USA.3. Yamazaki T, Matsuo Y, Inoue Y, Matsuo Y (1984) Genetic analysis of

natural populations of Drosophila melanogaster in Japan I. Proteinpolymorphism, lethal gene, sterility gene, inversion polymorphism andlinkage disequilibrium. Jpn J Genet 59: 33-49.

4. Yamazaki T, Matsuo Y (1984) Genetic analysis of natural populations ofDrosophila melanogaster in Japan. III. Genetic variability of inducingfactors of amylase and fitness. Genetics 108: 223-235.

5. Matsuo Y, Yamazaki T (1984) Genetic analysis of natural populations ofDrosophila melanogaster in Japan. IV. Natural selection on theinducibility, but not on the structural genes, of amylase loci. Genetics 108:879-896.

6. Langley CH, Shrimpton AE, Yamazaki T, Miyashita N, Matsuo Y, et al.(1988) Naturally occurring variation in the restriction map of the Amyregion of Drosophila melanogaster. Genetics 119: 619-629.

7. Kimura M (1983) The Neutral Theory of Molecular Evolution. CambridgeUniv Press, Cambridge.

8. Ohta T (1972) Population size and rate of evolution. J Mol Evol 1:305-314.

9. Matsuo Y, Yokoyama S (1990) Cloning and sequencing of a processedpseudogene derived from a human class III alcohol dehydrogenase gene.Am J Hum Genet 46: 85-91.

10. Tsunemoto K, Matsuo Y (2001) Molecular evolutionary analysis of ahistone gene repeating unit from Drosophila simulans. Genes Genet Syst76: 355-361.

11. Ohta T (1980) Evolution and variation of multigene families. Springer-Verlag, NY, USA.

12. Coen E, Strachan T, Dover G (1982) Dynamic of concerted evolution ofribosomal DNA and histone gene families in the melanogaster speciessubgroup of Drosophila. J Mol Biol 158: 17-35.

13. Matsuo Y, Yamazaki T (1989) Nucleotide variation and divergence in thehistone multigene family in Drosophila melanogaster. Genetics 122:87-97.

14. Matsuo Y (2000) Molecular evolution of the histone 3 multigene family inthe Drosophila melanogaster species subgroup. Mol Phylogenet Evol 16:339-343.

15. Matsuo Y (2003) Evolution of the GC content of the histone 3 gene inseven Drosophila species. Genes Genet Syst 78: 309-318.

16. Matsuo Y (2006) Genomic structure and evolution of the histone genefamily in Drosophila. Current Topics in Genetics 2: 1-14.

17. Kakita M, Shimizu T, Emoto M, Nagai M, Takeguchi M, et al. (2003)Divergence and heterogeneity of the histone gene repeating units in theDrosophila melanogaster species subgroup. Genes Genet Syst 78:383-389.

18. Matsuo Y (2000) Evolutionary change of codon usage for the histonegene family in Drosophila melanogaster and Drosophila hydei. MolPhylogenet Evol 15: 283-291.

19. Nagoda N, Fukuda A, Nakashima Y, Matsuo Y (2005) Molecularcharacterization and evolution of the repeating units of histone genes inDrosophila americana: coexistence of quartet and quintet units in agenome. Insect Mol Biol 14: 713-717.

20. Nakashima Y, Higashiyama A, Ushimaru A, Nagoda N, Matsuo Y (2016)Evolution of GC content in the histone gene repeating units fromDrosophila lutescens, D. takahashii and D. pseudoobscura. Genes GenetSyst 91: 27-36.

21. Kremer H, Hennig W (1990) Isolation and characterization of aDrosophila hydei histone DNA repeat unit. Nucleic Acids Res 18:1573-1580.

22. Fitch DHA, Strausbaugh LD (1993) Low codon bias and higher rates ofsynonymous substitution in Drosophila hydei and D. melanogasterhistone genes. Mol Biol Evol 10: 397-413.

23. Schumperli D (1986) Cell-cycle regulation of histone gene expression.Cell 45: 471-472.

24. Lifton RP, Goldberg ML, Karp RW, Hogness DS (1977) The organizationof the histone genes in Drosophila melanogaster: functional andevolutionary implications. Proc Cold Spring Harbor Symp. Quant Biol 42:1047-1051.

25. Fretzin S, Allan BD, Angela van Daal, Elgin SCR (1991) A Drosophilamelanogaster H3.3 cDNA encodes a histone variant identical with thevertebrate H3.3. Gene. 107: 341-342.

26. Akhmanova A, Miedema K, Hennig W (1996) Identification andcharacterization of the Drosophila histone H4 replacement gene. FEBSLett 388: 219-222.

27. van Daal A, White EM, Gorovsky MA, Elgin SCR (1988) Drosophila hasa single copy of the gene encoding a highly conserved histone H2Avariant of the H2A.F/Z type. Nucleic Acids Res 16: 7487-7497.

28. Akhmanova AS, Bindels PC, Xu J, Miedema K, Kremer H, et al. (1995)Structure and expression of histone H3.3 genes in Drosophilamelanogaster and Drosophila hydei. Genome 38: 586-600.

29. Yamamoto Y, Watanabe T, Nakamura M, Kakubayashi N, Saito Y, et al.(2016) Epigenetics evolution and replacement histones: Evolutionarychanges at Drosophila H4r. J Phylogenetics Evol Biol 4: 170.

30. Matsuo Y, Kakubayashi N (2016) Epigenetics evolution and replacementhistones: Evolutionary changes at Drosophila H3.3A and H3.3B. JPhylogenetics Evol Biol 4: 174.

31. Matsuo Y, Kakubayashi N (2017) Epigenetics evolution and replacementhistones: Evolutionary changes at Drosophila H2AvD. J Data MiningGenomics Proteomics 8: 207.

32. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, et al. (1985)Enzymatic amplification of β-globin genomic sequences and restrictionsite analysis for diagnosis of sickle cell anemia. Science 230:1350-1354.

33. Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA? 74: 5463-5467.

Citation: Kakubayashi N, Fujita E, Morikawa M, Ohashi S, Matsuo Y (2017) Concerted Evolution of the Replication-Dependent Histone GeneFamily in Drosophila immigrans. J Data Mining Genomics Proteomics 8: 210. doi:10.4172/2153-0602.1000210

Page 7 of 7

J Data Mining Genomics Proteomics, an open access journalISSN: 2153-0602

Volume 8 • Issue 1 • 1000210