fungal genetics and biology · with septation h proteins from other ﬁlamentous fungi based on the...

Fungal Genetics and Biology xxx (2012) xxx–xxx

Contents lists available at SciVerse ScienceDirect

Fungal Genetics and Biology

journal homepage: www.elsevier .com/locate /yfgbi

A septation related gene AcsepH in Acremonium chrysogenum is involvedin the cellular differentiation and cephalosporin production

Liang-kun Long 1, Yanling Wang 1, Jing Yang, Xinxin Xu, Gang Liu ⇑State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China

a r t i c l e i n f o

Article history:Received 16 July 2012Accepted 5 November 2012Available online xxxx

Keywords:Acremonium chrysogenumSeptationConidiationCephalosporin

1087-1845/$ - see front matter � 2012 Elsevier Inc. Ahttp://dx.doi.org/10.1016/j.fgb.2012.11.002

⇑ Corresponding author. Fax: +86 10 64806017.E-mail address: [email protected] (G. Liu).

1 These authors contributed equally to this work.

Please cite this article in press as: Long, L.-k., etand cephalosporin production. Fungal Genet. Bi

a b s t r a c t

T-DNA inserted mutants of Acremonium chrysogenum were constructed by Agrobacterium tumefaciens-mediated transformation (ATMT). One mutant 1223 which grew slowly was selected. TAIL-PCR andsequence analysis indicated that a putative septation protein encoding gene AcsepH was partially deletedin this mutant. AcsepH contains nine introns, and its deduced protein AcSEPH has a conserved serine/threonine protein kinase catalytic (S_TKc) domain at its N-terminal region. AcSEPH shows high similaritywith septation H proteins from other filamentous fungi based on the phylogenetic analysis of S_TKcdomains. In sporulation (LPE) medium, the conidia of AcsepH mutant was only about one-seventh ofthe wild-type, and more than 20% of conidia produced by the mutant contain multiple nuclei which wererare in the wild-type. During fermentation, the AcsepH disruption mutant grew slowly and its cephalo-sporin production was only about one quarter of the wild-type, and the transcription analysis showedthat pcbC expression was delayed and the expressions of cefEF, cefD1 and cefD2 were significantlydecreased. The vegetative hyphae of AcsepH mutant swelled abnormally and hardly formed the typicalyeast-like cells. The amount of yeast-like cells was about one-tenth of the wild-type after fermentationfor 5 days. Comparison of hyphal viabilities revealed that the cells of AcsepH mutant died easily thanthe wild-type at the late stage of fermentation. Fluorescent stains revealed that the absence of AcsepHin A. chrysogenum led to reduction of septation and formation of multinucleate cells. These data indicatesthat AcsepH is required for the normal cellular septation and differentiation of A. chrysogenum, and itsabsence may change the cellular physiological status and causes the decline in cephalosporin production.

� 2012 Elsevier Inc. All rights reserved.

1. Introduction

Acremonium chrysogenum (the former Cephalosporium acremo-nium) is an important industrial fungus for the exclusive productionof pharmaceutically relevant b-lactam antibiotic cephalosporin C.The biosynthetic pathway of cephalosporin C in A. chrysogenum in-cludes eight enzyme reactions, and the expression of these enzymeencoding genes is controlled by several factors (e.g. CreA, PACC,CPCR1) through complex regulatory processes (Martin et al.,2010; Schmitt et al., 2004a). Recently, lots of inspiring works aboutthis important fungus have been done from its basic physiology toindustry application with molecular techniques (An et al., 2012;Liu et al., 2010; Martin et al., 2004; Pöggeler et al., 2008).

The morphological differentiation generally is related with thephysiological status which changes during fermentations and withthe operating conditions in filamentous fungi (Sámi et al., 2001;Sándor et al., 2001; Scott and Eaton, 2008). At the same time, the

ll rights reserved.

al. A septation related gene Acol. (2012), http://dx.doi.org/10

fungal secondary metabolism commonly is associated with cellularmorphological differentiation and development (Calvo et al., 2002;Keller et al., 2005). In A. chrysogenum, three types of culture differ-entiation are formed. The formation of conidia from vegetativemycelium is associated with the lower production of cephalospo-rin. The formation of arthrospores at the late stage of fungal devel-opment is associated with the basic metabolism and lowerproduction of cephalosporin. The arthrospore chains (also called‘‘yeast-like’’ cell) represent metabolically active cells enriched withintracellular organelles and lipid-containing vacuoles, and the cel-lular differentiation into arthrospores coincides with the maxi-mum rate of cephalosporin production (Bartoshevich et al., 1990;Hoff et al., 2005). It is well-known that DL-methionine (Met) couldsignificantly stimulate cephalosporin biosynthesis and arthrosporechains formation in A. chrysogenum (Demain and Zhang, 1998). Asimilar stimulatory effect was also found by addition of glycerolin the fermentation of A. chrysogenum producer strain M35 (Shinet al., 2010). Although there is no obligate relationship betweenthe antibiotic biosynthesis and cellular differentiation in A. chrys-ogenum (Nash and Huber, 1971; Sándor et al., 1998, 2001), analysisof the morphology related genes is important for a good under-standing of secondary metabolic biosynthesis in this fungus.

sepH in Acremonium chrysogenum is involved in the cellular differentiation.1016/j.fgb.2012.11.002

http://dx.doi.org/10.1016/j.fgb.2012.11.002

mailto:[email protected]


http://www.sciencedirect.com/science/journal/10871845

http://www.elsevier.com/locate/yfgbi


2 L.-k. Long et al. / Fungal Genetics and Biology xxx (2012) xxx–xxx

Septum formation is one of the key processes in fungal cellularmorphogenesis (Harris, 2012). Septation is closely related with nu-clear division through a conserved kinase cascade which is calledthe septation initiation network (SIN) (Krapp and Simanis, 2008).The SIN pathway activates the GTPase Rho4 which recruits SepAand in turn triggers the formation of cytokinetic actin ring whichis essential for septation (Si et al., 2010). The mitotic cyclin-depen-dent kinases (CDKs) are the important components of SIN in fungi(Csikász-Nagy et al., 2007). It is reported that the CDK activity in-creased 10-times during asexual development of Aspergillus nidulans(Ye et al., 1999), suggesting that the morphological differentiation isregulated by the kinase cascade. As secondary metabolic biosynthe-sis is commonly associated with the developmental processesincluding morphological differentiation (Calvo, 2008; Calvo et al.,2002), it is possible that the SIN pathway also affects secondary met-abolic biosynthesis through some pleiotropic regulators which in-volved in both morphological differentiation and secondarymetabolism of fungi. However, no any study of SIN pathway on thesecondary metabolic biosynthesis has been reported although themitogen-activated protein kinase might regulate secondary meta-bolic biosynthesis in filamentous fungi (Park et al., 2008).

A. chrysogenum belongs to the Deuteromycetes which lack asexual cycle and are not accessible for conventional genetic analy-sis (Schmitt et al., 2004a). T-DNA insertional mutagenesis has beenused and developed as an effective tool for investigating gene func-tions in many filamentous fungi (Weld et al., 2006; Zhong et al.,2011, 2012). In this study, we identified a septation related geneAcsepH in A. chrysogenum by T-DNA mediated insertional mutagen-esis, and its functions on hyphal growth, cellular differentiationand cephalosporin biosynthesis were investigated.

2. Materials and methods

2.1. Strains, media and growth conditions

A. chrysogenum wild-type (WT) strain CGMCC 3.3795 was pur-chased from the China General Microbiological Culture CollectionCenter (CGMCC). Agrobacterium tumefaciens AGL-1 was used forfungal transformation. Escherichia coli JM109 was used for plasmidpropagation. Bacillus subtilis CGMCC 1.1630 (a cephalosporin-sen-sitive strain) was used for bioassays.

For sporulation, A. chrysogenum was grown in LPE medium (perliter, 1 g glucose, 2 g yeast extraction, 1.5 g NaCl, 10 g CaCl2, 25 gagar, pH 6.8) at 28 �C for 7 days. TSA, MMC, MMDN (per liter,10 g Glucose, 6 g NaNO3, 27 g K2HPO4�3H2O, 0.52 g KCl, 0.18 gMgSO4�7H2O, 1 ml Salt solution (1.3% Fe(NH4)2(SO4)2�6H2O, 0.3%MnSO4�4H2O, 0.3% ZnSO4�7H2O, 0.08% CuSO4�5H2O)) and MDFA(modified) media were used for the fungal growth or fermentationas described previously (Long et al., 2012; Sato et al., 2011). E. coliwas grown at 37 �C in Luria–Bertani (LB) medium (per liter, 10 gtryptone, 5 g yeast extraction, 10 g NaCl, pH 7.0) supplementedwith necessary antibiotics for propagating plasmids.

2.2. Construction and screening T-DNA inserted mutants of A.chrysogenum

The plasmid pAg1-H3 was transformed into the A. chrysogenumwild-type strain by A. tumefaciens-mediated transformation(ATMT) (Long et al., 2012; Zhang et al., 2003). T-DNA inserted mu-tants were selected on TSA plates containing 50 lg/ml hygromycinB. All the T-DNA inserted mutants and the wild-type strain wereinoculated onto TSA, MMDN or MMC plates respectively. Aftergrowth at 28 �C for 3–5 days, the target mutants were selectedon the basis of colony size, hyphal morphology or pigmentationusing the wild-type strain as a control.

Please cite this article in press as: Long, L.-k., et al. A septation related gene Acand cephalosporin production. Fungal Genet. Biol. (2012), http://dx.doi.org/10

2.3. Identification of T-DNA insertion sites in mutants

Thermal asymmetric interlaced (TAIL-) PCR was used to obtainthe flanking sequences of T-DNA in mutants. All of the primersused in this study were listed in Table 1. Each mutant was incu-bated in 20 ml of MMC liquid medium for 60 h at 28 �C, 220 rpm.The mycelia were harvested by a steel wire mesh, dried with filterpaper and ground in liquid nitrogen using sterilized mortar andpestle. Genomic DNA was isolated with DNA Quick Plant System(TianGen, China). TAIL-PCR was performed using the primers listedin Table 1 as described by Liu and Chen (2007). The amplified frag-ments were cloned into the vector pEasy-Blunt (TranGene, China)and sequenced by Invitrogen Trading Co., Ltd (Shanghai). Obtainedflanking sequences were compared with the whole-genomic DNAsequence of A. chrysogenum CGMCC 3.3795 (unpublished data),the flanking sequences were localized and the T-DNA inserted siteswere identified. The target mutants were further identified by spe-cific PCR amplifications.

2.4. Complementation of mutant 1223 with gene AcsepH

To confirm the function of a putative septation protein H encod-ing gene (AcsepH), a 7.046-kb DNA fragment containing the intactAcsepH gene with 1.6 kb upstream region and 0.6 kb downstreamregion was obtained from the wild-type strain by three PCR ampli-fications and fragments ligation. After the 7.046-kb fragment wasligated into the plasmid pMB (Long et al., 2012), the recombinantplasmid pMB-AcsepH was introduced into the mutant 1223 byPEG-mediated protoplast transformation as described previously(Long et al., 2012). The complementary transformants (CM) wereselected on TSA plates containing 10 lg/ml bleomycin.

2.5. cDNA cloning and sequence analysis of AcsepH

Total RNA was isolated from the A. chrysogenum wild-typestrain using Trizol Reagent (Invitrogen, USA) according to the com-mercial manual. First-strand cDNA was synthesized by reversetranscript kit (oligo (dT) was used) (Promega, USA). The cDNA ofAcsepH was amplified with four specific primer sets, respectively.After their sequences were validated, the four fragments were di-gested and orderly ligated together. To characterize AcsepH, the de-duced protein was analyzed by online software SMART (http://smart.embl-heidelberg.de/smart/), and phylogenetic analysis ofconserved amino acid was performed by using the neighbor-join-ing method (p-distance model) with MEGA 5 software.

2.6. Determination of hyphal growth and conidia formation

Conidia of the A. chrysogenum wild-type, mutant 1223 and CMstrain were collected from LPE plates, and resuspended in sterilizeddH2O to a final concentration of (1–2) � 107 spores/ml, respec-tively. Per 100 ll of spore suspension was spread onto a LPE platecovered with a cellophane paper, and then incubated at 28 �C for10 days. At least three repeats were established for each fungalstrain. For each plate, the fungal cultures were collected, and putinto a 250-ml flask containing 10 ml sterilized dH2O, vortexed for2 min and incubated in an orbital shaker at 120 rpm for 30 min.After separated the conidia from hyphae by a steel wire mesh,the quantity of conidia was determined by hemacytometer countmethod. At the same time, dry cell weight of the collected myceliawas determined. To test the temperature sensitivity of mutant1223, 1 ll of spore suspension (about 1 � 107 spores/ml) was spot-ted onto MMC plates, and incubated for 4 days at 28, 37, 40 and42 �C respectively.


http://smart.embl-heidelberg.de/smart/

http://smart.embl-heidelberg.de/smart/


Table 1Primers used in this study.

Primer Sequence (50–30) Source

Primers used for TAIL-PCRAC1 acgatggactccagag Liu and Chen (2007)LAD1-4 acgatggactccagagcggccgcbdnbnnncggt Liu and Chen (2007)LAD1-1 acgatggactccagagcggccgcvnvnnnggaa Liu and Chen (2007)RB-a ttcggcgtgggtatggtgg This studyRB-b acgatggactccagtccggcctactactgggctgcttcctaatg This studyRB-c cagattgtcgtttcccgccttca This studyLB-a tgtgctcaccgcctggacgact This studyLB-b acgatggactccagtccggcctccagccaagcccaaaaagtgc This studyLB-c taatcgccttgcagcacatcc This study

Primers used for clone DNA of AcsepHAcsepH _f1 ccaagcttacgacgcacaccgccattcag This studyAcsepH _r1 ggagcagttagcacaccaagc This studyAcsepH _f2 cccaagcttcatcgcctcgctacc This studyAcsepH _r2 acatgccttcttcacccctt This studyAcsepH _f3 tatgtcacccgttctatgtcc This studyAcsepH _r3 gctctagacctccctttgagtctctatcc This study

Primers used for clone cDNA of AcsepHAcsepH_c_f1 gacttcctcatgcaatgcttc This studyAcsepH_c_r1 gctcgctctcttccttctcta This studyAcsepH_c_f2 ccacccgtcagatctcaccag This studyAcsepH_c_r2 ctccacattcgccgtctcctc This studyAcsepH_c_f3 atcattcccctgttacttcgc This studyAcsepH_c_r3 catcattgctgcctctctctc This studyAcsepH_c_f4 acgcaaaagaccgtggagatg This studyAcsepH_c_r4 aggagctttcgggctgtgact This study

Primers used for real-time PCRAcsepH_q_f cttggatagtcggttgtc This studyAcsepH_q_r taggttcggttctgatga This studycpcR1_q_f cttccacggcacattgac This studycpcR1_q_r tacagaacaaggtcgcactc This studycefD1_F tgctgctcctgccctcat This studycefD1_R cgaagccgctcaccaact This studycefD2_F aggaacaagtcgtccatctgc This studycefD2_R cttgagaaggacctctgtggg This studycefEF_U1 ccgtaaccaccaagggtatct Dreyer et al. (2007)cefEF_L1 ctcctcgcttccgttcttga Dreyer et al. (2007)Ac_IPNS_U1 accagtccgacgtgcagaat Dreyer et al. (2007)Ac_IPNS_L1 tcggtgatatgggccatgtag Dreyer et al. (2007)Ac_act_U3 gcgacgtcgatgtccgtaa Dreyer et al. (2007)Ac_act_L3 agaaggagcaagagcagtgatctc Dreyer et al. (2007)GAPDH_F gccaagaaggtcatcatc This studyGAPDH_R caagaagcgttggagatg This study

Primers used for identification of hygromycin phosphotransferase genehph_f aagttcgacagcgtctcc This studyhph_r ttccactatcggcgagta This study

L.-k. Long et al. / Fungal Genetics and Biology xxx (2012) xxx–xxx 3

2.7. Fungal fermentation and cephalosporin production

About 3 � 107 spores of the A. chrysogenum wild-type, mutant1223 and CM strain were inoculated into 40 ml of seed medium(MDFA without glycerol) in 250-ml flask, respectively. After incuba-tion for 2 days in an orbital shaker at 28 �C and 220 rpm, 1 ml ofseed culture was inoculated into 25 ml MDFA medium, and fermen-tation was carried out for 6 days at 28 �C, 220 rpm. The fungal bio-mass and cephalosporin production were determined every day.

Cephalosporin production during fermentation was determinedby bioassays against B. subtilis CGMCC 1.1630 with agar-diffusionmethod (LB medium, 1% (w/v) agar). Each test plate was added50,000 units of penicillinase to exclude accumulated penicillin infermentation (RodrÍguez-Sáiz et al., 2005). Standard of cephalospo-rin C-Zn (Sigma, USA) was used as control.

2.8. Quantitative real-time PCR

Total RNAs of all the samples were prepared with Trizol Reagentand followed by DNase 1 digestion. cDNAs were synthesized fromabout 1 lg of total RNA with PrimeScript™ RT reagent kit (oligo


(dT) and 6-mers random primers were used) (TaKaRa, Japan). Quan-titative real-time PCR (qRT-PCR) was performed in 25 ll of mix-tures in 8-strip PCR tubes in a Mastercycler (Eppendorf,Germany). The PCR cycling reaction was performed with 1� SYBRPremix Ex Taq (TaKaRa, Japan) according to the following parame-ters: one cycle of pre-denaturation at 95 �C for 30 s, and 40 cyclesof denaturation at 95 �C for 5 s, annealing at 60 �C for 20 s and elon-gation at 72 �C for 15 s. As a negative control, PCR was done withoutreverse transcript reaction. The relative abundance of mRNAs wasstandardized against the levels of glyceraldehyde-3-phosphatedehydrogenase (GAPDH) gene using Pfaffl’s method (Pfaffl, 2001).

2.9. Microscopy and image analysis

Hyphal morphology at different fermentation times (1–5 days)was analyzed by using 40� objective lenses under an OlympusBX51 phase contrast microscope (Olympus, Tokyo, Japan). Imageswere captured with a Canon EOS 450D digital camera and pro-cessed with Adobe Photoshop 7.0 software. Hyphal vitality was as-sessed under bright field illumination on the microscope afterEvans blue staining (Jacobson et al., 1998) or under the fluorescene




microscope after propidium iodide (PI) staining (Raschke andKnorr, 2009). Septa and cell nuclei were fluorescently stained usingCalcofluor white (CFW, Sigma) or 40, 6-diamidino-2-phenylindole(DAPI, Roche) by the reported method (Harris et al., 1994), andexamined under an upright Zeiss Axio imager A1 fluorescentmicroscope (Carl Zeiss, Germany) at an excitation wavelength of450–490 nm. Images were captured by a Zeiss AxioCam MR cam-era with Axiovision Release 4.8.2 software.

3. Results

3.1. Construction and identification of the T-DNA inserted mutants

Total 1632 mutants of A. chrysogenum were obtained by one-time ATMT transformation of about 1 � 107 fungal spores. The mu-tants which grew normally in TSA medium and grew slowly inMMDN or MMC medium were further selected. Among them, 23mutants displayed obviously different from the wild-type strain

Fig. 1. Construction of the AcsepH disruption mutant of A. chrysogenum.(A) Schematic representation of the T-DNA insertion mutagenesis in mutant 1223.kb, kilobases; hph, hygromycin phosphotransferase gene. (B) Identification of themutant 1223 by PCR. PCR1 and PCR2 were performed with primer sets AcsepH_f2/AcsepH_r2 and hph_f/hph_r, respectively. NC, negative control; ladder, 1 kb ladder.

Fig. 2. Phylogeny of protein kinase catalytic domains illustrating the position of AcSEPserine/threonine protein kinase catalytic (S_TKc) domains were extracted by online aneighbor-joining method (p-distance model) with MEGA 5 software.


in hyphal growth, colonial size or pigmentation when grown inTAS, MMDN or MMC medium. For most of them, the insertion sitescould be identified by TAIL-PCR and sequence analysis of the T-DNA flanking regions. Since growth and development are relatedwith metabolic activity in fungi, it might be also related with ceph-alosporin production in A. chrysogenum. Therefore, one slow-growth mutant (numbered 1223) in MMDN medium (NaNO3 asnitrogen source) was selected for further study. Mutant 1223 grewslowly and appeared roughened on the colony surface in MMDNmedium, but it could restore to the same growth level as thewild-type strain in TSA or MMC medium. These suggested thatthe mutation might affect the growth and morphological differen-tiation of A. chrysogenum. Through tail-PCR, the flanking sequencesof T-DNA inserted site in the mutant 1223 were determined. Insearch of the genomic sequence, the flanking sequences were local-ized in the genome and the T-DNA inserted site was found in oneopen reading frame (ORF) encoding a homologous of SepH, thisORF was designated as AcsepH. This T-DNA insertion led to a par-tially (1.7-kb fragment of the 50 terminus) deletion in AcsepH(Fig. 1A). This mutagenesis was reconfirmed by specific PCR ampli-fications (Fig. 1B).

3.2. Isolation and characterization of the AcsepH gene

Integrated DNA and cDNA fragments of AcsepH gene (GenBankaccession number JQ937328) were obtained by PCR and fragmentsligation. Alignment analysis of the two sequences indicates that the4245 bp coding region is interrupted by nine small introns (Supple-mentary Fig. 1A). Its deduced protein AcSEPH consists of 1415 ami-no acid residues with a theoretical molecular mass of 156.3 kDa. Aconserved Ser/Thr protein kinases catalytic (S_TKc) domain is foundat the N-terminal region (sites 48–301) of AcSEPH by sequenceanalysis with software SMART (Supplementary Fig. 1B), and it con-tains twelve conserved subdomains in the catalytic portion of Ser/Thr protein kinases (Supplementary Fig. 2) compared with the pub-lished data (Hanks et al., 1988; Schweitzer and Philippsen, 1991).Phylogenetic analysis of the conserved domain indicates that Ac-SEPH is similar to SEPH proteins from other filamentous fungi andit is mostly closed to the SEPH of Neurospora crassa (Fig. 2). AcSEPHshows 49.9% identity with SEPH from A. nidulans (AF011756.2). AsSEPH is required for SepA localizing at septation site of A. nidulans(Sharpless and Harris, 2002), AcSEPH might be also involved inthe morphological differentiation of A. chrysogenum.

3.3. AcsepH is involved in normal conidiation of A. chrysogenum

Sequence analysis showed that the coding region of the S_TKcdomain of AcSEPH was completely absent in the slow-growth mu-

H. Related protein kinase sequences were collected from NCBI database, and theirnalysis using software SMART. The phylogenetic tree was constructed using the



Fig. 3. Comparison of growth and conidia formation in the A. chrysogenum wild-type (WT), AcsepH disruption mutant (1223) and complementary strain (CM). (A) Biomass ofWT, 1223 and CM strains. Dry cell weight was determined after drying the fungal mycelia at 70 �C in a hot air oven until a constant weight. (B) Conidia formation in WT, 1223and CM strains. Per 1.2 � 106 spores was spread onto a LPE plate covered with a cellophane paper, and then incubated at 28 �C for 10 days. Error bars represent standarddeviations from three independent experiments. (C) Number of nuclei in conidia of WT, 1223 and CM strains. About 200 conidia of each fungal strain were stained with DAPIand examined under an upright fluorescent microscope. Bar = 5 lm.

Fig. 4. Comparison of growth and cephalosporin production in the A. chrysogenumwild-type (WT), AcsepH disruption mutant (1223) and complementary strain (CM)in MDFA medium. (A) Growth of the WT, 1223 and CM strains under the


tant 1223. As the conserved S_TKc domain plays an essential role inenzyme structure and function of SEPH (Bardin et al., 2003; Dick-mana and Yarden, 1999; Hanks and Hunter, 1995), deletion ofS_TKc domain could result in the inactivation of AcSEPH in A.chrysogenum.

To further study the function of AcsepH in A. chrysogenum, theAcsepH complementary strains (CM) were constructed by introduc-ing the entire AcsepH gene into the mutant 1223. Total 18 comple-mentary strains were obtained and one of them (C15) was chosenfor the subsequent experiments. RT-PCR analysis demonstratedthat AcsepH was normally expressing in the CM strain but not inthe mutant (Supplementary Fig. 3). In LPE medium, the AcsepH dis-ruption mutant (1223) grew more slowly than the wild-type, butthe final biomass of them tended to the same after incubated for10 days (Fig. 3A). The quantity of new-formed conidia in the mu-tant was about one-seventh of the wild-type, and it was restoredto the wild-type level in the complementary strain (Fig. 3B). Theresult indicated that AcsepH was required for normal conidiationof A. chrysogenum as sepH in A. nidulans (Bruno et al., 2001).

At least 200 conidia from each fungal strain were observed un-der a phase contrast microscope. The average size of the wild-typeconidia was 1.17 � 3.47 lm, the average size of the mutant conidiawas 1.34 � 4.41 lm and that of the complementary strain was1.13 � 3.44 lm. About 20% of the conidia from the mutant wereabnormal in shape and their average size was two to fourfold ofthe normal conidia, while the WT or CM strain rarely producedthe big size conidia (generally only about 1%). DAPI nucleic acidstain demonstrated that these big conidia usually contained multi-ple nuclei. Conidia with double-nuclei (19%), three-nuclei (4%),even four-nuclei (0.45%) were produced by the mutant strain,while the WT or CM strain always produced single-nucleus conidia(Fig. 3C). Obviously, absence of AcsepH in A. chrysogenum resultedin reduction of conidia production and formation of abnormalconidia.

fermentation condition. Dry cell weight was determined after drying the fungalmycelia at 70 �C in a hot air oven until a constant weight. (B) Time courses of totalcephalosporin production by the WT, 1223 and CM strains. (C) Cephalosporinproduction was determined by bioassays against B. subtilis. Forty ll of culturefiltrates after 5 days fermentation was used to detect the cephalosporin production.The plate was added 50,000 units of penicillinase to exclude penicillin in culturefiltrates. PenG, penicillin (20 lg/ml). Error bars represent standard deviations fromthree independent experiments.

3.4. AcsepH is required for the normal hyphal growth of A.chrysogenum

In MDFA medium, the hyphal growth of AcsepH disruption mu-tant was delayed comparing with the wild-type strain. After incuba-

Please cite this article in press as: Long, L.-k., et al. A septation related gene AcsepH in Acremonium chrysogenum is involved in the cellular differentiationand cephalosporin production. Fungal Genet. Biol. (2012), http://dx.doi.org/10.1016/j.fgb.2012.11.002


Fig. 5. Relative expression levels of AcsepH, cpcR1, pcbC, cefEF, cefD1 and cefD2 genes in the A. chrysogenum wild-type strain (WT), AcsepH disruption mutant (1223) and thecomplementary strain grown in MDFA medium. The primers used for real time-PCR were listed in Table 1. Gene expression levels were calculated relative to thetranscriptional level of the wild-type strain after 1 day fermentation. The relative abundance of mRNAs was standardized against to the levels of GAPDH gene. Error barsrepresent standard deviations from three independent experiments.


tion for 2 days, the cellular dry weight of mutant 1223 was about onehalf of the wild-type strain. After incubation for 4 days, the cellulardry weight of the mutant gradually reached the wild-type level.These suggested that the biomass of mutant 1223 was not signifi-cantly different from the wild-type at the late stage of fermentation.The growth of complementary strain was close to the wild-type(Fig. 4A). It has been reported that the SEPH-deficient mutants ofsome filamentous fungi displayed temperature-sensitivity (Harriset al., 1994; Saunders et al., 2010), but our result showed that the Ac-sepH disruption mutant exhibited the same sensitivity to high tem-perature as the wild-type strain (Supplementary Fig. 4).

3.5. Disruption of AcsepH reduces cephalosporin production

In the wild-type or CM strain, the cephalosporin yield signifi-cantly increased after fermentation for 4–5 days (Fig. 4B). Whereas,the cephalosporin production in the AcsepH mutant was always ata low level that was about one quarter of the wild-type during fer-mentation (Fig. 4B). In addition, doubling the seeds of inoculationin the fermentation of AcsepH mutant could only improve the accu-mulation of biomass but not the cephalosporin production (datanot shown).

The expressions of cephalosporin biosynthetic genes pcbC (theisopenicillin N-synthetase encoding gene), cefEF (the bifunctionaldeacetoxycephalosporin C synthase/hydroxylase encoding gene),cefD1 (the isopenicillinyl N-CoA synthetase encoding gene) andcefD2 (the isopenicillinyl N-CoA epimerase encoding gene) in thewild-type and mutant strains were measured by qRT-PCR (Fig. 5).At the early stage (1–2 days) of fermentation, pcbC showed a lowtranscriptional level in the mutant compared with the wild-type,and it gradually increased to the similar level of wild-type after fer-mentation for 3 days. The transcriptional level of cefEF and cefD1 in


the mutant was always lower than that of the wild-type during fer-mentation (1–4 days). The transcription of cefD2 was significantlyreduced at the late stage of fermentation (3–4 days). Absence of Ac-sepH in A. chrysogenum affected the transcriptions of cephalosporinbiosynthetic genes during fermentation, suggesting that AcsepH isrelated to cephalosporin biosynthesis probably through some un-known transcriptional regulators.

3.6. AcsepH is involved in the arthrospore formation of A.chrysogenum

For the wild-type or CM strain, about 30% hyphae transformedinto yeast-like cells (arthrospore chains) after 2 days of cultivation,and the yeast-like cells increased to 70–90% after 3–5 days (Fig. 6).At the same time the vegetative hyphae of AcsepH mutant swelledlargely, but it was difficult to form typical yeast-like cells (only3.3–8.3% hyphae transformed into yeast-like cells), and the amountof yeast-like cells was about one-tenth of the WT strain during thelast stage of fermentation (Fig. 6). Transcriptional analysis revealedthat the expression of AcsepH was getting higher in the wild-typestrain at the late stage of fermentation (Fig. 5), suggesting that Ac-sepH is related to fungal physiological state. The further resultshowed that the transcriptional level of arthrosporulation-controlgene cpcR1 in the mutant was lower than that of the wilt-type atthe late stage of fermentation (Fig. 5). These data indicated that Ac-sepH was related to the arthrospores formation of A. chrysogenum.

3.7. Reduction of cell vitality and septation in AcsepH disruptionmutant

During fermentation, a remarkable increase in cellular deathwas observed in the AcsepH mutant under the bright-field micro-



Fig. 6. Arthrospore formation of the A. chrysogenum wild-type strain (WT), AcsepH disruption mutant (1223) and complementary strain (CM) in MDFA medium. After 2–5 days of cultivation, fungal tissues were observed under a phase contrast microscope. Typical yeast-like cells formed in the WT or CM strains, and few single arthrosporesformed by the mutant at 4–5 days. The percent of hyphae transformed into arthroposres were calculated. Error bars represent standard deviations from three independentexperiments. Bar = 5 lm.


scope or the fluorescene microscope after Evans blue staining andpropidium iodide (PI) staining (Fig. 7). At least 30% cells of the Ac-sepH mutant were dead (stained blue by Evans blue or red by PI)after 4 days fermentation. In contrast, under the same conditionmore than 90% cells of the wild-type or CM strains were still alive.To elucidate the reason of cellular death in the AcsepH mutant, sep-tation and nuclear distribution in these fungal strains were inves-tigated by fluorescent stain (Fig. 8). In the hyphae of AcsepHmutant, the number of septa was obviously reduced comparedwith the wild-type strain. After fermentation for 2 days, the num-ber of nuclei but not septa per unit length hyphae was increased inthe AcsepH mutant, resulting in multinucleate cells. These resultsindicated that AcsepH was critical for normal septation, but notfor nuclear division in A. chrysogenum.

As observed under phase contrast microscope, the typical yeast-like cells were abundantly formed in the wild-type but not in themutant after fermentation for 3 days. At the same time, the hyphaseptation in AcsepH mutant was about 30% of the wild-type inquantity. Unlike the wild-type, more hyphae of the mutant weredead which could not be stained with DAPI after fermentationfor 4 days. The defections of septation and hyphal vitality were res-cued in the complementary strain (Figs. 7 and 8). Additionally, thelack of AcsepH also resulted in reduction (20–30%) in the number of


hyphal septa when the fungus grew in the sporulation medium.This further confirmed that deficiency of AcSEPH hindered the sep-tum formation and cytokinesis in A. chrysogenum.

4. Discussion

Secondary metabolites are produced from primary metaboliteswhich are closely related with cellular growth and utilization ofnitrogen and carbon source, therefore fungal growth and morpho-logical differentiation have some relationships with the secondarymetabolism (Bartoshevich et al., 1990; Betina, 1995; Keller et al.,2005). The nitrogen source is different in TSA and MMDN media.MMDN is the defined medium containing inorganic nitrogen. TSAis the complex medium with tryptone and soytone as nitrogensource. Thus the growth rate demonstrated the fungal utilizationability for different nitrogen source. We speculate that the utiliza-tion ability for different nitrogen source may affect secondarymetabolism in fungi. Thus, the mutants which grew normally inTSA medium and grew slowly in MMDN medium were selected.To search the genes involved in the cephalosporin production inA. chrysogenum, we constructed T-DNA inserted mutants of thewild-type strain CGMCC3.3795 and screened the mutants on the



Fig. 7. Cellular death of the A. chrysogenum wild-type strain (WT), AcsepH disruption mutant (1223) and complemented strain (CM). After 4 days of fermentation in MDFAmedium, fungal tissues were stained with Evans blue (A) or propidium iodide (B), and examined under the bright-field microscope or the fluorescene microscope. Dead cellswere strained blue after Evans blue staining or stained red with propidium iodide. Bar = 15 lm.


basis of fungal growth or morphogenesis. A slow-growth mutant1223 was found to reduce cephalosporin production in the primaryfermentation experiment (data not shown). Analysis of the T-DNAflanking regions revealed that the mutant was partially (1.7-kbfragment of the 50 terminus) deleted in a putative septation proteinencoding gene AcsepH. The deduced AcSEPH (1415 aa) contains aconserved S_TKc domain with twelve subdomains at the N-termi-nal region (sites 48–301), which plays essential roles in enzymestructure and function (Bardin et al., 2003; Dickmana and Yarden,1999; Hanks and Hunter, 1995).

AcSEPH is most closely to the septation protein H from other fil-amentous fungi based on the phylogenetic analysis of S_TKc do-mains. SEPH of A. nidulans is an orthologue of Schizosaccharomycespombe Cdc7 protein, and similar to Cdc15 of Saccharomyces cerevisi-ae (Bruno et al., 2001). Cdc7 of S. pombe plays a key role in initiationof septum formation and cytokinesis, and is a dosage dependentregulator of septum formation (Fankhauser and Simanis, 1994). InA. nidulans, sepH is required for the initiation of cytokinesis and con-struction of the actin ring (Bruno et al., 2001). In our investigation,disruption of AcsepH prevented the septation and resulted in theformation of multinucleate cells, this defection was rescued in thecomplementary strain, suggesting that AcsepH is invovled in septa-tion of A. chrysogenum. Not all the SEPH homologs positively regu-late septum formation, Sep1 (the homolog of S. pombe Cdc7) ofMagnaporthe oryzae may act as a negative regulator of cytokinesisas more septa were formed in the mutant of sep1G849R (Saunderset al., 2010). Thus, the functions of conserved cytokinesis relatedprotein in eukaryotes may not always be identical across differentspecies (Goh et al., 2011).

The Cdc7-deficient strain of S. pombe and the sep1G849R mutants ofM. oryzae display temperature-sensitive (Fankhauser and Simanis,1994; Saunders et al., 2010). At restrictive temperature (42 �C), theA. nidulans sepH1 mutant is unable to form septa and conidiation(Bruno et al., 2001). However, the AcsepH disruption mutant of A.chrysogenum did not show more sensitive to high temperature(40 �C) than the wild-type strain in our study. Since the A. chrysoge-num wild-type and AcsepH mutant strains did not germinate andgrow at 42 �C in the test medium, it could not compare the sensitivityof A. chrysogenum and other fungi.


The SEPH is not required for vegetative growth of A. nidulans bythe comparison of radial growth rate sepH1 mutant and wild-typecolonies at permissive or restrictive temperatures (Bruno et al.,2001; Harris et al., 1994). Differently, the lacking of sep1 in M. ory-zae could lead to the hyphal growth defect (Saunders et al., 2010).We found that there was no significant difference of the colonialsizes between the AcsepH mutant and wild-type strain grown onLPE plate, but the biomass of the mutant was lower than thewild-type at the early stage of growth (data not shown). Thegrowth of AcsepH mutant was also delayed in liquid MDFA med-ium. The functional difference between AcsepH of A. chrysogenumand sepH of A. nidulans is probably due to the different septationregulatory cascade in different fungi. To elucidate the septationregulatory cascade of A. chrysogenum, more studies need to do infuture.

Conidiation of the AcsepH-deficient strain was significantlyinhibited in sporulation medium (LPE), only one-seventh of conidiawas formed comparing with the wild-type strain. On the otherhand, more than 20% conidia from the AcsepH disruption mutantcontained multiple nuclei. This is similar to A. nidulans which thesepH is required for production of uninucleate spores (Brunoet al., 2001). It is possible that the formation of multinucleate cellsis due to the inhibition of septation and continuing nuclei division.

Hyphal growth and morphological differentiation of A. chrysoge-num commonly associated with the secondary metabolism(Bartoshevich et al., 1990; Queenearn and Ellis, 1975). In MDFAmedium, the hyphal growth of AcsepH mutant was delayed1–2 days compared to the wild-type strain, and cephalosporinproduction of the mutant declined to about one quarter of that pro-duced by the wild-type. Since absence of AcsepH reduced the fungalgrowth, increment of seed inoculation was performed in the fer-mentation of AcsepH mutant. However, this could not improve theaccumulation of cephalosporin (data not shown). The cephalosporinC production decreased was closely coordinated with the decline ofyeast-like cells which are associated with the active synthesis ofcephalosporin C (Bartoshevich et al., 1990). Although transcrip-tional analysis further verified that the transcriptions of cephalo-sporin biosynthetic genes pcbC and cefEF declined significantlyduring the early stage (for pcbC) and throughout (for cefEF) fermen-



Fig. 8. Distributions of nuclei and septa in the A. chrysogenum wild-type strain (WT), AcsepH disruption mutant (1223) and complemented strain (CM) grown in MDFAmedium. Fungal tissues were stained with DAPI/CFW and examined under an upright fluorescent microscope. Quantity of septa in the AcsepH mutant was less than the WT orCM strain. The septa in mutant were marked by arrowheads. Bar = 5 lm.


tation in the AcsepH mutant, it is still hard to know how lack of Ac-SEPH in A. chrysogenum seriously reduced the cephalosporinbiosynthesis.

In A. chrysogenum, arthrospores especially yeast-like cells repre-sent metabolically active cells and the morphological differentia-tion into arthrospores coincides with the maximum productionof cephalosporin C (Bartoshevich et al., 1990; Nash and Huber,1971). After 3–4 days fermentation, the vegetative hyphae of Ac-sepH mutant swelled largely but they were difficult to form typicalyeast-like cells which abundantly formed by the wild-type, and afew arthrospores were formed by the mutant during the final stageof fermentation. The reduced arthrospores formation in the AcsepHmutant might be a possible explanation for the decline in cephalo-sporin production. It is known that the global regulator CPCR1 con-trols the arthroposre formation and the transcription of pcbC in A.chrysogenum (Hoff et al., 2005; Schmitt et al., 2004b). The tran-scriptional level of cpcR1 in the mutant was lower than the wilt-type at 3 or 4 days of fermentation. Then, we speculate that thereexist some relationship between AcSEPH and CPCR1.

Evans blue and PI stains are easy and effective methods todetermine cell viability (Chen and Dickman, 2005; Jacobsonet al., 1998; Raschke and Knorr, 2009). By the determinations, wefound that the percentage of dead cells in AcsepH mutant was high-er than these in the wild-type at the late stage of fermentation,suggesting that absence of AcSEPH in A. chrysogenum acceleratedthe cell death in liquid fermentation. The cell death might relateto low number of septa formed in the AcsepH mutant, resultingin multinucleate cells, and the abnormal swell of hyphae. Since Ac-sepH is required for normal septation in A. chrysogenum, its absencemight change the cellular physiological status and decline thecephalosporin production. Understanding the action mechanismof AcsepH in vivo will be helpful to reveal the molecular base of celldivision cycle and cellular differentiation in this important indus-trial fungus.


Acknowledgments

We thank Prof. Xingzhong Liu (Institute of Microbiology, Chi-nese Academy of Sciences) and Prof. Seogchan Kang (Penn StateUniversity, USA) for providing the plasmid pAg1-H3. This workwas supported by grants from the National Natural ScienceFoundation of China (grant number 31030003), the KnowledgeInnovation Program of the Chinese Academy of Sciences (GrantNo. KSCX2-EW-J-6) and the Ministry of Science and Technologyof China (Grant No. 2010ZX09401-403).

Appendix A. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.fgb.2012.11.002.

References

An, Y., Dong, H.L., Liu, G., 2012. Expression of cefF significantly decreaseddeacetoxycephalosporin C formation during cephalosporin C production inAcremonium chrysogenum. J. Ind. Microbiol. Biot. 39, 269–274.

Bardin, A.J., Boselli, M.G., Amon, A., 2003. Mitotic exit regulation through distinctdomains within the protein kinase Cdc15. Mol. Cell. Biol. 23, 5018–5030.

Bartoshevich, Y.E., Zaslavskaya, P.L., Novak, M.J., Yudina, O.D., 1990. Acremoniumchrysogenum differentiation and biosynthesis of cephalosporin. J. BasicMicrobiol. 30, 313–320.

Betina, V., 1995. Differentiation and secondary metabolism in some prokaryotesand fungi. Folia Microbiol. 40, 51–67.

Bruno, K.S., Morrell, J.L., Hamer, J.E., Staiger, C.J., 2001. SEPH, a Cdc7p orthologuefrom Aspergillus nidulans, functions upstream of actin ring formation duringcytokinesis. Mol. Microbiol. 42, 3–12.

Calvo, A.M., 2008. The VeA regulatory system and its role in morphological andchemical development in fungi. Fungal Genet. Biol. 45, 1053–1061.

Calvo, A.M., Wilson, R.A., Bok, J.W., Keller, N.P., 2002. Relationship betweensecondary metabolism and fungal development. Microbiol. Mol. Biol. Rev. 66,447–459.

Chen, C., Dickman, M.B., 2005. Proline suppresses apoptosis in the fungal pathogenColletotrichum trifolii. PNAS 102, 3459–3464.





Csikász-Nagy, A., Kapuy, O., Gyorffy, B., Tyson, J.J., Novák, B., 2007. Modeling theseptation initiation network (SIN) in fission yeast cells. Curr. Genet. 51, 245–255.

Demain, A.L., Zhang, J.Y., 1998. Cephalosporin C production by Cephalosporiumacremonium: the methionine story. Crit. Rev. Biotechnol. 18, 283–294.

Dickmana, M.B., Yarden, O., 1999. Serine/threonine protein kinases andphosphatases in filamentious fungi. Fungal Genet. Biol. 26, 99–117.

Dreyer, J., Eichhorn, H., Friedlin, E., Kurnsteiner, H., Kuck, U., 2007. A homologue ofthe Aspergillus velvet gene regulates both cephalosporin C biosynthesis andhyphal fragmentation in Acremonium chrysogenum. Appl. Environ. Microbiol. 73,3412–3422.

Fankhauser, C., Simanis, V., 1994. The cdc7 protein kinase is a dosage dependentregulator of septum formation in fission yeast. EMBO J. 13, 3011–3019.

Goh, J.G., Kim, K.S., Park, J., Jeon, J., Park, S.-Y., Lee, Y.-H., 2011. The cell cycle geneMoCDC15 regulates hyphal growth, asexual development and plant infection inthe rice blast pathogen Magnaporthe oryzae. Fungal Genet. Biol. 48, 784–792.

Hanks, S.K., Hunter, T., 1995. Protein kinases 6. The eukaryotic protein kinasesuperfamily: kinase (catalytic) domain structure and classification. FASEB J. 9,576–596.

Hanks, S.K., Quinn, A.M., Hunter, T., 1988. The protein-kinase family-conservedfeatures and deduced phylogeny of the catalytic domains. Science 241, 42–52.

Harris, S.D., 2012. Molecular basis of morphogenesis in fungi. Morphogenesis andpathogenicity in fungi. Topics Curr. Genet. 22 (2012), 1–20. http://dx.doi.org/10.1007/978-3-642-22916-9_1.

Harris, S.D., Morrell, J.L., Hamer, J., 1994. Identification and characterization ofAspergillus nidulans mutants defective in cytokinesis. Genetics 136, 517–532.

Hoff, B., Schmitt, E.K., Kuck, U., 2005. CPCR1, but not its interacting transcriptionfactor AcFKH1, controls fungal arthrospore formation in Acremoniumchrysogenum. Mol. Microbiol. 56, 1220–1233.

Jacobson, D.J., Beurkens, K., Klomparens, K.L., 1998. Microscopic and ultrastructuralexamination of vegetative incompatibility in partial diploids heterozygous athet loci in Neurospora crassa. Fungal Genet. Biol. 23, 45–56.

Keller, N.P., Turner, G., Bennett, J.W., 2005. Fungal secondary metabolism-frombiochemistry to genomics. Nat. Rev. Microbiol. 3, 937–947.

Krapp, A., Simanis, V., 2008. An overview of the fission yeast septation initiationnetwork (SIN). Biochem. Soc. Trans. 36, 411–415.

Liu, Y., Gong, G., Xie, L., Yuan, N., Zhu, C., Zhu, B., Hu, Y., 2010. Improvement ofcephalosporin C production by recombinant DNA integration in Acremoniumchrysogenum. Mol. Biotechnol. 44, 101–109.

Liu, Y.G., Chen, Y., 2007. High-efficiency thermal asymmetric interlaced PCR foramplification of unknown flanking sequences. Biotechniques 43, 649–656.

Long, L.K., Yang, J., An, Y., Liu, G., 2012. Disruption of a glutathione reductaseencoding gene in Acremonium chrysogenum leads to reduction of its growth,cephalosporin production and antioxidative ability which is recovered byexogenous methionine. Fungal Genet. Biol. 49, 114–122.

Martin, J.F., Ullan, R.V., Casqueiro, J., 2004. Novel genes involved in cephalosporinbiosynthesis: the three-component isopenicillin N epimerase system. Adv.Biochem. Eng. Biotechnol. 88, 91–109.

Martin, J.F., Ullan, R.V., Garcia-Estrada, C., 2010. Regulation andcompartmentalization of beta-lactam biosynthesis. Microb. Biotechnol. 3,285–299.

Nash, C.H., Huber, F.M., 1971. Antibiotic synthesis and morphological differentiationof Cephalosporium acremonium. Appl. Microbiol. 22, 6–10.

Park, G., Pan, S., Borkovich, K.A., 2008. Mitogen-activated protein kinase cascaderequired for regulation of development and secondary metabolism inNeurospora crassa. Eukaryotic Cell 7, 2113–2122.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucl. Acids Res. 29, 2002–2007.

Pöggeler, S., Hoff, B., Kück, U., 2008. Asexual cephalosporin C producer Acremoniumchrysogenum carries a functional mating type locus. Appl. Environ. Microbiol.74, 6006–6016.


Queenearn, S.W., Ellis, D.L.F., 1975. Differentiation of mutants of Cephalosporiumacremonium in complex medium: the formation of unicellular arthrospores andtheir germination. Can. J. Microbiol. 21, 1981–1996.

Raschke, D., Knorr, D., 2009. Rapid monitoring of cell size, vitality and lipid dropletdevelopment in the oleaginous yeast Waltomyces lipofer. J. Microbiol. Methods79, 178–183.

RodrÍguez-Sáiz, M., de la Fuente, J., Barredo, J.-L., 2005. Metabolic Engineering ofAcremonium chrysogenum to produce deacetoxycephalosporin C andbioconversion to 7-aminodeacetoxycephalosporanic acid. Microb. ProcessProd. 18, 41–64.

Sámi, L., Emri, T., Pócsi, I., 2001. Autolysis and ageing of Penicillium chrysogenumcultures under carbon starvation: glutathione-metabolism and formation ofreactive oxygen species. Mycol. Res. 105, 1246–1250.

Sándor, E., Pusztahelyi, T., Karaffa, L., Karányi, Z., Pócsi, I., Biró, S., Szentirmai, A.,Pócsi, I., 1998. Allosamidin inhibits the fragmentation of Acremoniumchrysogenum but does not influence the cephalosporin-C production of thefungus. FEMS Microbiol. Lett. 164, 231–236.

Sándor, E., Szentirmai, A., Paul, G.C., Thomas, C.R., Pócsi, L., Karaffa, L., 2001. Analysisof the relationship between growth, cephalosporin C production, andfragmentation in Acremonium chrysogenum. Can. J. Microbiol. 47, 801–806.

Sato, I., Shimatani, K., Fujita, K., Abe, T., Shimizu, M., Fujii, T., Hoshino, T., Takaya, N.,2011. Glutathione reductase/glutathione is responsible for cytotoxic elementalsulfur tolerance via polysulfide shuttle in fungi. J. Biol. Chem. 286, 20283–20291.

Saunders, D.G.O., Dagdas, Y.F., Talbot, N.J., 2010. Spatial uncoupling of mitosis andcytokinesis during appresorium-mediated plant infection by the rice blastfungus Magnaporthe oryzae. Plant Cell. 22, 2417–2428.

Schmitt, E.K., Hoff, B., Kuck, U., 2004a. Regulation of cephalosporin biosynthesis.Adv. Biochem. Eng. Biotechnol. 88, 1–43.

Schmitt, E.K., Hoff, B., Kuck, U., 2004b. AcFKH1, a novel member of the forkheadfamily, associates with the RFX transcription factor CPCR1 in the cephalosporinC producing fungus Acremonium chrysogenum. Gene 342, 269–281.

Schweitzer, B., Philippsen, P., 1991. CDC15, an essential cell cycle gene inSaccharomyces cerevisiae, encodes a protein kinased domain. Yeast 7, 265–273.

Scott, B., Eaton, C.J., 2008. Role of reactive oxygen species in fungal cellulardifferentiations. Curr. Opin. Microbiol. 11, 488–493.

Sharpless, K.E., Harris, S.D., 2002. Functional characterization and localization of theAspergillus nidulans formin SEPA. Mol. Biol. Cell 13, 469–479.

Shin, H.Y., Lee, J.Y., Jung, Y.R., Kim, S.W., 2010. Stimulation of cephalosporin Cproduction in Acremonium chrysogenum M35 by glycerol. Bioresour. Technol.101, 4549–4553.

Si, H., Justa-Schuch, D., Seiler, S., Harris, S.D., 2010. Regulation of septum formationby the Bud3-Rho4 GTPase module in Aspergillus nidulans. Genetics 185, 165–176.

Weld, R.J., Plummer, K.M., Carpenter, M.A., Ridgway, H.J., 2006. Approaches tofunctional genomics in filamentous fungi. Cell Res. 16, 31–44.

Ye, X.S., Lee, S.L., Wolkow, T.D., McGuire, S.L., Hamer, J.E., Wood, G.C., Osmani, S.A.,1999. Interaction between developmental and cell cycle regulators is requiredfor morphogenesis in Aspergillus nidulans. EMBO J. 18, 6994–7001.

Zhang, A., Lu, P., Dahl-Roshak, A.M., Paress, P.S., Kennedy, S., Tkacz, J.S., An, Z., 2003.Efficient disruption of a polyketide synthase gene (pks1) required for melaninsynthesis through Agrobacterium-mediated transformation of Glarea lozoyensis.Mol. Gen. Genom. 268, 645–655.

Zhong, Y., Wang, X., Yu, H., Liang, S., Wang, T., 2012. Application of T-DNAinsertional mutagenesis for improving cellulase production in the filamentousfungus Trichoderma reesei. Bioresour. Technol. 110, 572–577.

Zhong, Y.H., Yu, H.N., Wang, X.L., Lu, Y., Wang, T.H., 2011. Towards a novel efficientT-DNA-based mutagenesis and screening system using green fluorescentprotein as a vital reporter in the industrially important fungus Trichodermareesei. Mol. Biol. Rep. 38, 4145–4151.


http://dx.doi.org/10.1007/978-3-642-22916-9_1


fungal genetics and biology · with septation h proteins from other ﬁlamentous fungi based on the...

Documents