Download - Annual Report - 2 0 1 4
M I S S I O NTo conduct fundamental/applied/analytical research in the frontier areas of science with the ultimate objective of contributing to high quality basic research and human resource development and to find application of the research results for the benefit of mankind
UNESCOhasdeclared2014astheInternationalYearofCrystallographytocommemoratethecentennialofX-raydiffraction.Thecoverpagedepicts the tetragonalcrystalsofLactobacillusacidophilusGlyceradehyde3-phosphatedehydrogenase;it'sX-raydiffractionpatternand the putative crystal structure of the enzyme(courtesy:DepartmentofBioinformaticsandStructuralBiology).
C O V E R P A G E
C O N T E N T S
AnnualREPORT 2014
Foreword 2
1. Introduction 3
1.1 Faculty 4
1.2 Research Staff 4
1.3 Research Infrastructure 6
1.4 Lab Equipments 7
2. Institutional Committees 8
2.1 Governing Body 8
3. Research & Development 9
3.1 Human Health & Diseases 9
3.2 Immunology 12
3.3 Genetics & Developmental Biology 20
3.4 Cell Biology 24
3.5 Bioinformatics & Structural Biology 26 3.6 Environmental Science 323.7 Medicinal Chemistry 39
4. Publications 404.1 Research Publications 404.2 Book Chapters 404.3 Presentation 40
5. Awards 43
6. Human Resource Development 446.1 Academic Activities 446.2 External Funded Research Fellowships 446.3 Trainees 456.4 Training Programs 45
7. Financials
7.1 Income and Expenditure Statement
7.2 Research Grants 48
FOREWORD
Shri. Ashwani Puri,Provost, UIAR
My heartiest congratulations to the faculty, administrative and research staff
and the students for the successful beginning of the academic programs at
University and Institute of Advanced Research. With the choice base credit
system, we offer students the flexibility to choose courses of their choice. With
the well equipped research laboratories, we offer the students learning in a
research intensive environment.
In addition to the “School of Biological Sciences & Biotechnology” , this year,
we have initiated a few more departments- The Department of Physics,
Medicinal Chemistry and Department of Language, Culture and Media studies.
New faculties from these fields have joined the University. The University has well equipped laboratories,
library and other support facilities for the students.
The first centre of excellence the “School of Biological Sciences & Biotechnology”is carrying out research
in frontier interdisciplinary areas of Biology. University has large number of students coming from
different states of country for research and Ph.D. course at UIAR campus. The faculties with their research
team from various departments had published many research articles in reputed international journals,
and presented more than 20 papers in national and international conference / symposia during the
current year.
A notable landmark during this year was the MOU signed between UIAR and the London South Bank
University for collabarative research and educational activities.
The University conducted training programs in the field of bioinformatics and developmental biology
which was well appreciated by academia and industry personnel in and around Gujarat.
This report is a summarised document of ongoing research and educational activities at UIAR during the
year 2014. It highlights the update of the research activities, publications of various departments,
educational activities and finances of the University.
These achievements would not have been possible without the continuous support of the University
President, Dr. N R Puri, the guidance of the Board of Governors, Board of Management and the
Academic council and active participation of the faculty and staff of the university.
We would also like to thank the trustees of The Puri Foundation for Education in India for the generous
financial support. I convey my gratitude to all of them.
In the coming years, we wish that we progress as an internationally reputed University where teaching and
education are integrated with intensive research.
With best wishesMr. Ashwani Puri
AnnualREPORT 2014
1. INTRODUCTION
The University and Institute of Advanced Research, which was established under the “Gujarat Private
University Amendment Act 2011, runs various academic programs to provide a unique opportunity for
students, for learning in a research intensive environment. The Indian Institute of Advanced Research is
now part of UIAR. The Institute is registered with the Department of Science and Technology as a SIRO.
The School of Biological Sciences and Biotechnology, which was the first center of excellence established
does cutting edge complementary research in various areas of biology. It has departments of Human
health and disease, Cell biology, Plant molecular biology, Immunology, Developmental biology,
Bioinformatics and structural biology and Environmental science. The Department of Physics,
Department of Chemistry and Department of Language, Culture and Media studies have also been set
up.
The University is offering various choice and credit based undergraduate, postgraduate and doctoral
programs. Presently four undergraduate programs are running in the University. The University is in an
expansion phase and is adding new faculties in multiple disciplines like Physics, Chemistry, Mathematics,
Computer Science, Finance, Law, and Accounting to develop these departments.
The Program support grant, from DBT, Government of India, which supported five projects in institute,
was over during the present year. The projects were successfully completed and resulted in publications in
reputed scientific journals. With the help of this grant the institute was able to develop two new
departments- The Department of Developmental Biology and The Department of Immunology.
AnnualREPORT 2014
1.1.1 RESEARCH FACULTY
Sr.
No.
Name and department
Full Time/
Part Time,
Year of
Joining,
Experience
Research Interests
1. Dr. Dheeraj Naik
Assistant Professor
Environmental Sciences
Full Time
05/06/2012
8 years
Molecular and physiological mechanisms
underlying adaptation and acclamatization of plants
to their stressful environment, which are accelerated
due to changing climate conditions. Effect of
draught and edaphic stresses on forest and
grasslands ecosystem.
2. Dr. Rajani Nadgauda
Professor Emeritus
Plant Cell and Molecular
Biology
Part Time
08/02/2006
29 years
In vitro plant cell culture and isolation of active
principals from cell cultures/ Hairy root
cultures. Conservation of plants through
micropropagation. Understanding the somatic
embryogenesis process technology development and
dissemination.
3. Dr. Chandramani Pathak
Assistant Professor
Cell biology
Full Time
21/10/2009
6 years
Understanding the molecular mechanism and cross
talk between apoptosis and inflammatory signalling
in cancer. Nano-particle based drug delivery in
human cancer cells and evaluating their apoptotic
potential for therapeutic interventions.
4. Dr. Anand Tiwari
Genetics &Developmental
Biology
Full Time
3/5/2010
6 years
Role of molecular chaperons and ubiquitin ligases
during eye development of Drosophilla
melanogaster and the progression of Alzheimer’s
disease using Drosophilla melanogaster as a model
organism. Effect of medicinal plants on
development of Drosophlla melanogaster.
5. Dr. Ashima Bhardwaj
Assistant Professor
Human Health &Disease
Full Time
2/3/2006
17 years
Deciphering the molecular mechanisms that govern
the multidrug resistance phenotype of the isolates of
Vibrio sp . And Shigella sp. Study of mobile genetics
elements, integrons and plasmids that lead to fast
acquisition and dissemination of the genes
responsible for observed drug resistance.
Assistant Professor
AnnualREPORT 2014
1.1 FACULTY
There are currently 10 research faculty members and 13 teaching faculty members in the
University. Dr. T K Rajendra and Dr. Neeraj Jain left institute during this period. Dr. Desh Deepak
Singh is presently at Central University of Punjab, Batinda on lien from UIAR
6. Dr. Reena Rajput
Assistant Professor,
Immunolgy
Full Time
1/7/2010
7 years
Study of Toll -like Receptors mediated immune
outcomes in various disease models and during
vaccine retrogenicity. Study of parallels between
immune and the nervous system to reprogram
immune cells to neurons.
7. Dr. Desh Deepak Singh,
AssociateProfessor,
Bioinformatics &Structural
Biology
Full Time
6/2/2006
11 years
Adhesive and surface proteins from Leishmania
involved in host-pathogen interactions. Study of the
glycome expression and its interactions in biological
systems for mediating cellular interactions.
Genome/Proteome profiling, annotations and
development of related tools and databases.
8. Dr. Anju Papapachan
Assistant Professor,
Bioinformatics &Structural
Biology
Full Time
15/7/2010
5 years
Structural and functional characterization of crucial
metabolic pathway proteins of L. donovani using
biophysical, biochemical and bioinformatics tools
9. Dr. Neeraj Jain
Assistant Professor
Plant Cell & Molecular
Biology
Full Time
1/12/2005
10 years
Plant functional genomics, DNA fingerprinting, marker development and in vitro regeneration studies with practical applications in plant conservation, bio fortification, phytoremediation and production of elite planting material of economic and ecological importance like medicinal plants and biofuel
10. Dr. Satyendra Mishra
Assistant Professor
Department of Medicinal
Chemistry
Full Time 1/09/2014
Development of new methods and strategies in
organic synthesis, natural products synthesis,
synthesis of small bioactive molecule and its
analogs, therapeutic development for cancer and
neurodegenerative disorders, peptidomimetics,bio-
organic /medicinal chemistry.
11. Dr.Roli Mishra
Assistant Professor
Department of Medicinal
Chemistry
Part time 15/09/2014 6 years
Peptide &glycopeptides chemistry; supramolecular chemistry and dendrimers chemistry, synthesis of peptide based chiral ionic liquids and their physio-chemical properties, synthesis of modified oligonucleotides and its biophysical and biological applications
12. Dr. Rajendra TK
Associate Professor
Genetics and Development
Biology
Full Time 04/06/2012 15 years
Global regulation of gene expression, molecular understanding of nuclear organization in relation to regulation of gene expression, biology of noncoding RNAs, protein and RNP assembly dynamics during germ-line development and differentiation, understanding developmental and molecular mechanisms of Spinal Muscular Atrophy, Spinal and Bulbar Muscular Atrophy.
AnnualREPORT 2014
1.1.2 TEACHING FACULTY
Sr.
No Name
Designation
Subject
1
Dr. Ritu Sahni Srivastava
Assistant Professor
Mathematics
2
Dr. Arun K. Agarwal
Assistant Professor
Management
3
Dr. Joshua N. Aston
Visting faculty
Law
4
Mr. Sarat Kumar Jena
Lecturer
Language Literature & Media Studies
5 Mr. Hemenkumar Thakar Lecturer Physics
6 Mr. Chirag Makwana Lecturer
Lecturer
Lecturer
Lecturer
Lecturer
Lecturer
Lecturer
Physics
7 Mr. Suresh Kumar Chemistry
8 Mr. Jignesh Shobhasana Computer Science
9 Mr. Mayank R. Darji Computer Science
10 Mr. Priyankar Darji Accounts
11 Ms. Swati Pathak Economics
12 Ms.Christina Parmar Social Studies
1.2 RESEARCH STAFF:
There are research staff currently assisting the faculty in their research work. Research staff includes Post
Doctoral Fellows, PhD Scholars, SRF, JRF, and Project Assistants. The details of the current research staff
are placed below.
Project Investigators - 10 Research Associate - 2 SRF - 7 JRF - 22 Project Assistant - 7 Technical Assistant - 6 Field Assistant - 2
1.3 RESEARCH INFRASTRUCTURE:
The Institute has the following facilities at the School of Biological Sciences and Biotechnology.
i) Plant cell and Molecular biology lab with green house, plant tissue culture facilities, growth
chamber, laminar air flow.
ii) Bioinformatics and Structural Biology lab with complement of servers, computers, cluster
computer system and experimental lab.
iii) Human Health and Disease laboratory with laminar air flow, biosafety cabinets and allied
microbial culture facilities.
iv) Cell biology lab with class II cell culture facility.
AnnualREPORT 2014
v) Genetics and Developmental Biology with Drosophila model system.
vi) An Environment and Ecology laboratory with Eddy Covariance Instrument to measure climate
change parameters.
vii) Cold room.
1.4 LAB EQUIPMENTS:
The School of Biological Sciences and Biotechnology is equipped with state of the art facilities with
support from the Department of Biotechnology, Department of Science and Technology, ICMR, Govt. of
India and trust- The Puri Foundation for Education in India.
List of key equipments is placed below.
1. AKTA protein purification system
2. Autoclave
3. Automated Cell Counter
4. Binocular Microscope
5. Biosafety Cabinets
6. cDNA synthesis Kit
7. Biosafety hoods
8. Centrifuge Kubota
9. Circulatory Waterbath
10. CO2 Incubators
11. Confocal Microscope
12. Cooling Incubator
13. Deep Freezers
14. Electronic orbital shaker
15. Fume Hoods
16. GC
17. Gel Doc Systems
18. HPLC
19. Incubator Shaker
20. Laminar Flow
21. Microscopes
22. Multi Mode Micro plate
23. PCRs
24. Real Time PCR
25. Rota Vapour
26. Sorval Centrifuge
27. Shaker
28. Spectrophotometers
29. Ultracentrifuge
30. Vaccum concentrator
31. Water purification system
32. Water treatment plants
Besides the above instruments, departments have independent research specific facilities including small
and medium equipment to their specific requirements.
AnnualREPORT 2014
2.1 GOVERNING BODY:
The following members constitute the Governing Body.
2. INSTITUTIONAL COMMITTEES
1 Mr. NR Puri President Chairman
2 Mr. Upendra Puri Trustee by rotation
3. Dr. G.C. Mishra Chairman of RAC
4. Dr. R.C. Maheshwari Chairman of University
Development Committee
5. Dr. B.Rao Exceutive Dean, London South
Bank University
6 Mr. Ashwani Puri CEO, IIAR
7 Govt. Nominee I.A.S. Principal Secretary
Education Department,
Government of Gujarat
8. Dr. Chandramani Pathak Dean, Faculty of Science, UIAR
9. Dr. Rajani Nadgauda Professor Emeritus, UIAR
10. Dr. V.S. Chauhan Scientist, Former Director of
ICGEB
11. Dr. Rajendra Prasad Academician, Head of
Dept. of Life Sciences,
Jawaharlal Nehru University,
New Delhi.
AnnualREPORT 2014
3. RESEARCH & DEVELOPMENT
3.1 Human Health and Diseases:
Principal Investigator:
Dr. Ashima Bhardwaj (Associate Professor,
Group Head)
Research Fellows:
Ms. Neha Rajpara (ICMR- SRF)
Mr. Priyabrata Mohanty (ICMR- SRF)
Mr. Braj Mohan (CSIR- SRF)
Mr. K. Vinothkumar (ICMR- SRF)
Ms. Aneri Shah (DBT programme
support-JRF)
Mr. Shailesh Bhalara (GSBTM-JRF)
3.1.1 Description of research work
Project 1: Molecular characterization of factors
governing antibiotic resistance in the Indian
isolates of Vibrio spp.
Strains Vc IDH02365 PvNBA2365
Parent CO-TRI, NAL, POLY-B,
SUL, TRI, AMP, CIP, STR,
TET
AMP, CIP, CO -TRI, GEN,
NAL, NOR, SUL, TET,
TRI, KAN, CHL, NEO,
STR
Integrase-positive
transformants
NO TRANSFORMANTS AMP, CO-TRI, NAL,
SUL,TRI, KAN
Integrase-negative
transformants
AMP, KAN, NAL, NEO AMP, KAN, NAL, NEO
From the culture of clinical isolate of V. cholerae of
2009 from Kolkata, another organism Providencia
vermicola named Pv NBA2365 was isolated.
V.cholerae Vc IDH02365 and P. vermicolaPv
NBA2365 were authenticated by biochemical
analysis, 16s rRNA sequencing and gene-specific
(OmpW for V. cholerae) PCR. Further to this, drug
resistance phenotypes of these bacteria were
analysed. Out of fourteen antibiotics tested, Vc
IDH02365 isolate showed resistance to nine
antibiotics, while Pv NBA2365 was found to be
resistant to all the antibiotics except polymyxin B
(Table 3.1.1).To understand the factors responsible
for the observed drug resistance traits, the bacteria
were analysed for the presence of mobile genetic
elements such as plasmids, integrons or
conjugative transposons called SXT elements.
Class 1 integrons were found to be present only in
Pv NBA2365 and not in Vc IDH02365. Integrons
in Pv NBA2365 conferred resistance to β-lactams,
aminoglycosides and trimethoprim. Transformation
analysis with Vc IDH02365 and Pv NBA2365
revealed that Pv NBA2365 car r ied two
transformable plasmids imparting distinct
antibiotic resistance traits to their Escherichia coli
transformants while Vc
IDH02365 carried one
t rans ferab le p lasmid
impar t ing res i s tance
phenotype similar to one
of the two plasmids from
PvNBA2365.
Table 3.1.1: Resistance
profiles of Vc IDH02365
and Pv NBA2365 and
their transformants Drug names have been
abbreviated: AMP, ampicillin (10 µg); CHL,
chloramphenicol (30 µg); CO-TRI, co-trimoxazole
(trimethoprim 1.25 µg /sulfamethoxazole 23.75
µg); CIP, ciprofloxacin (5 µg); GEN, gentamicin (10
µg); STR, streptomycin (10 µg); SUL, sulfafurazole
(300 µg); TMP, trimethoprim (5 µg); TET,
AnnualREPORT 2014
tetracycline (30 µg); NEO, neomycin (30 µg); NAL,
nalidixic acid (30 µg); NOR, norfloxacin (10 µg);
KAN, kanamycin (30 µg); POLY-B, polymyxin B
(300 units). Two transformants from each kind of
DNA sample were tested for their antibiograms.
The experiment was done in duplicates. The bold
face indicates the antibiotics for which the
pathogen or transformants showed intermediate
resistance phenotype. E. coli JM109 was resistant
to nalidixic acid.
Project 2: Cloning and characterization of efflux
pumps responsible for multiple drug resistance in
clinical isolates of various Vibrio species.
Two MATE-type efflux pumps (H- and D-type)
from Vibrio fluvialis were cloned in the arabinose-
inducible pBAD E. coli expression vector to study
their role in multidrug resistance. Efflux pumps
provide general protection to the organism from
various drugs and antibiotics by lowering
intracellular drug concentration.Studies were
carried out to determine suitable E. coli host and
expression conditions (inducer concentration and
time of induction) to obtain optimal yield of efflux
pump proteins. Subsequent localisation studies
carried out to determine location of the
recombinant proteins in the heterologous E.coli
host showed their association with the bacterial
membrane. To assess the functionality of these
recombinant efflux pumps, a host strain was
selected with deletion in one of the outer
membrane protein TolC. The recombinant
proteins when expressed in this mutant host could
lead to the assessment of their functionality in
terms of increase or decrease in minimum
inh ib i to r y concen t ra t ion (MIC) . These
recombinant efflux pumps showed elevation in
MIC for certain drugs and antibiotics. The work is
in progress to deduce their functional role in
conferring multidrug resistance using other
transport studies with fluorometry.
Project 3: Study of multidrug resistance in clinical
isolates of Shigella spp.
Studies have been pursued with 95 clinical isolates
of Shigella spp. procured from NICED (courtesy
Dr. T. Ramamurthy), Kolkata, India. These isolates
were multidrug resistant and resistance to drugs
like trimethoprim, co-trimoxazole, streptomycin,
nalidixic acid was very common. Analysis for
mobile genetic elements revealed that out of 95
isolates, 43 isolates were positive for 5' conserved
region (L2/L3) of class 1 integron. Further PCR
analysis for 3' conserved region revealed that out
of 43 isolates only one isolate (IDH0734) yielded
the expected 0.8 kb amplicon. Since IDH0734
indicated the possibility of harboring a typical class
1 integron with 5'CS and 3'CS, it was further
analyzed for the variable region of class 1 integron
where it yielded a ~750 bp amplicon. Sequence
analysis of this amplicon revealed that it harboured
the dihydrofolate reductase (dfrV) gene
responsible for trimethoprim resistance.
To study the clonal relationship between these
Shigella isolates, genomic digests with XbaI of 17
isolates of Shigella were analysed on PFGE (Figure
3.1.1). Among these 17 isolates, M11560 and
NK19108' shared the same pulsotype whereas rest
of the isolates (n=15) were different (Figure 3.1.1).
Genomic and plasmid DNA analysis from these
shigella isolates showed the presence of multiple
plasmids which could be one of the possible
mechanisms for their drug resistance phenotypes.
Further work is in progress to unravel the other
possible drug resistance mechanisms.
AnnualREPORT 2014
Figure 3.1.1: PFGE analysis of XbaI digested clinical isolates of Shigella spp. (n=17). Lane 1: Yeast Marker, Lane 2 to Lane 18: XbaI digested genomic DNA of Shigella isolates. The sample identity has been indicated on the top of each lane. Positions of the marker have been indicated in the left.
Project 4: Unravelling the mechanisms underlying
quinolone resistance in multidrug resistant clinical
isolates of Vibrio and Shigella species from India.
Screening of quinolone resistance genes in the
quinololone resistant clinical isolates of Vibrio
fluvialis and Shigella species was described earlier.
This year, the study was extended to the quinolone
resistant clinical isolates of V. parahaemolyticus
and V. cholerae. Hence, eight V. cholerae, twelve V.
fluvialis, seven V. parahaemolyticus and ten
Shigella isolates (seven S. flexneri, 2 S.
dysenteriae and 1 S. sonnei) were selected for
further analysis and are described in table 3.1.2.
One or two quinolone sensitive strains from each
of the above organism types were included in the
study to serve as a control and are shown in bold
face in table 3.1.2.
The selected quinolone resistant isolates were
subjected to antibiogram analysis for an extended
panel of quinolones also including some higher
generation quinolones such as ofloxacin,
gatifloxacin, levofloxacin, lomefloxacin and
sparfloxacin. It was observed that V. fluvialis and
Shigella isolates showed resistance to most of the
higher generation quinolones (Table 3.1.2). The
selected strains were subjected to MIC assays for
some of these selected quinolones. V. fluvialis and
Shigella isolates showed varying levels of
resistance to the tested quinolones. V. cholerae
isolates chiefly showed nalidixic acid resistance. A
very low level resistance to quinolones was found
in V. parahaemolyticus isolates. In nutshell,
quinolone resistance was widespread among all
the isolates pursued in this study, though the
degree of resistance varied.
To further unravel the mechanism of quinolone
resistance in these isolates, detailes analysis was
carried out. S. flexneri (B36) which showed
resistance to all the tested quinolones was found to
have Serine 83→ Leucine mutation in GyrA
subunits of DNA gyrase as a mechanism of
resistance. S. flexneri (M11560) which showed
intermediate resistance to nalidixic acid and
ciprofloxacin was found to have qnrS gene in its
plasmid.
Table 3.1.2: Antibiograms of quinolone resistant
isolates of Vibrio spp. and Shigella spp.
Bacteria Strain Resistance Intermediate
Vibrio cholerae IDH2365 NAL, LOM CIP
IDH2233 NAL, LOM -
IDH2118 NAL, LOM NOR
IDH2101 NAL, LOM CIP, SPA
IDH2087 NAL, LOM NOR, SPA
IDH1957 NAL, LOM -
IDH1738 NAL, LOM CIP, SPA
IDH1681 NAL, LOM SPA
Vibrio fluvialis L13828 - -
L13230 LOM CIP
L98411 - CIP, LOM
L10734 NAL, LOM CIP, OFX, GAT,
LEV, SPA
L9077 LOM NAL
L12387 NAL, LOM NOR, CIP, SPA
L9978 LOM CIP
L15318 NAL, LOM NOR, CIP,
OFX, GAT,
LEV
AnnualREPORT 2014
BD146 NAL, NOR,
CIP
OFX
BD81 NAL -
BD123 NAL NOR
PL78/6 NAL,CIP NOR, OFX
PL171b NAL, NOR CIP, OFX
Vibrio
parahaemolyticus
IDH01402 - NAL, NOR,
CIP, LOM
IDH01415 - LOM
IDH01473 - CIP
IDH01998 - CIP
IDH02068 - CIP
IDH02189 - NOR, CIP
IDH02191 - NAL, CIP
IDH02208 - CIP, LOM
Shigella flexneri NT4966 NAL, NOR,
CIP LOM,
SPA
OFX,
M11560 LOM NAL, CIP, SPA
NT5120 CIP, NOR NAL
B36 NAL, NOR,
CIP, OFX,
LOM
GAT, LEV
NK4/08 - -
NK05/08 NAL, NOR,
CIP, LOM,
SPA
OFX, GAT,
LEV
IDH00177 NAL, NOR,
CIP, LOM,
SPA
OFX
NK23/08 NAL -
Shigella dysenteriae NK4771 NAL, LOM CIP
Shigella sonnei NK2070 NAL LOM
NAL- Nalidixic acid; NOR- Norfloxacin; CIP-
C i p r o fl o x a c i n ; O F X - O fl o x a c i n ; L O M -
L o m e fl o x a c i n ; S PA - S p a r fl o x a c i n ; G AT-
Gatifloxacin; LEV- Levofloxacin
3.2. Immunology:
Principal Investigator:
Dr. Reena A. Rajput (Assistant Professor)
Research Fellows:
Mr. Sagar Gaikwad (DST JRF)
Ms. Dipeeka Mandaliya (DBT Programme
Support-JRF)
Ms. Kshama Jain (CSIR-JRF)
Mr. Manthan Patel (GSBTM-JRF)
Mr. Divyesh Patel (DBT-MM JRF)
Ms. Farha Memon (DBT-RGYI JRF)
3.2.1 Description of research work
Cellular development and cell fate decisions are
dynamic process and micro environmental cue
provides combinatorial signals that ultimately
drive functional formations. The group is working
on cytokine based T cell fine tuning during
mucosal and CNS immunity. The other arena is
cellular alchemy for neuronal regeneration from
immune or cancer stem cells.
Currently, our group is working on the following
projects:
1. Neuroprotective effects of Toll like receptor 4
(TLR4) antagonists on LPS induced neuronal
insults.
2. Reprogramming of Immune Cells to Functional
Neurons: The New Face of CD40.
3. To study β-glucans induced Dectins mediated
inflammasome activation.
4. To study cholera toxin and flagellin induced
TLR5 mediated immune response.
Project 1: Neuroprotective effects of Toll like
receptor 4 (TLR-4) antagonists and/ or signaling
inhibitors on LPS induced neuronal insults.
(Funding: Department of Science and Technology
(DST), Government of India, Cognitive Science
Initiative (CSI) program).
AnnualREPORT 2014
Microglia cells are the resident macrophages of the
nervous system with pivotal role in innate immune
regulation and neuronal homeostasis. Prolonged
activation of microglia can cause the chronic
neuroinflammation and promote the neuronal
injury due to increase the production of neurotoxic
pro-inflammatory mediators. Neuroinflammation
is an important defence mechanism against
infectious agents and neuronal injuries in the
centra l nervous system (CNS). Chronic
neuroinflammation may result in the neuronal
damage observed in many neurodegenerative
disorders. Evidences suggest that TLR4 play key
role in neuroinflammation by microglial activation
and cytokines production, a major hallmark of
neurodegeneration. Here, our study focuses on
achieving neuroprotection by targeting TLR4
mediated neuronal injury.
In the study, we investigated the effects of RS-LPS,
a TLR4 antagonist, and MAPK inhibitors on LPS
induced inflammatory responses in BV2 microglial
cells. Last year we had reported the following
major observations:
1. LPS-Rs, TLR4 antagonist inhibits microglia
activation and inflammation
2. LPS-Rs regulates NF-κB and MAPKs
signaling pathways, are indispensible for LPS
induced neuroinflammation in microglia
3. LPS-Rs reduce microglial phagocytic activity
and microglia mediated neuronal insults
This year we report following major findings in the
project:
LPS-Rs inhibit costimulatory and leukocyte
trafficking molecules
Appropriate antigen processing and presentation
are the key governing factors that orchestrate the T
cell response. During the neuroinflammatory
burden the T cells are biased to be activated,
aggravating the problem. The governing factor/s
that decide/s the fate of T cell differentiation and
infiltration to the site of injury/infection is/are the
expression of costimulatory molecules and
chemokine receptors and the release of
chemoattractants, chemokines, which guide the T
cells for tissue infiltration. Since TLR4 is
indispensible for leukocyte recruitment into brain
in response to LPS. We investigated tolerogenic
effect of TLR4 antagonism in BM-MΦ-T cell
coculture, (as a substitute for haplotype matched
microglia-T cell interaction). LPS induced
elevated levels of the key costimulatory molecules
and activation markers CD80, CD86 and CD40
were negatively regulated upon pretreatment with
LPS-Rs (Figure 3.2.1 A). LPS-Rs however did not
show significant modulation in the expression of
MHC-II gene. Researchers have highlighted that
TLR4 is indispensible for leukocyte recruitment
into brain in response to LPS and upregulated
expression of CCR5 in neurological diseases is
often immunolocalized in microglia. We report
similar observation that LPS stimulation results in
significantly elevated expression of CCR5 which
was appropriately downregulated by LPS-Rs. The
chemokines, including MIP-1α and CCL5
(RANTES), are the major act ivator and
chemoattractants for monocytes and T cells and
were significantly inhibited by LPS-Rs (Figure
3.2.1 B). Our finding indicates that LPS-Rs
mediate inhibition of gene expression of these
costimulatory molecules, chemokines and
chemokines receptor which may govern microglia-
T cell interaction and T cell infiltration into the
brain.
(A)
AnnualREPORT 2014
Figure 3.2.1. LPS-Rs inhibit costimulatory molecules and leukocyte
trafficking factors required for T cell interaction and infiltration. BV2
microglia were pretreated with LPS-Rs for 2 hrs followed by LPS
treatment for 6 hrs and the mRNA expression of macrophage activation
markers: MHC-II, CD40, CD80, CD86 (A) and chemokines and
chemokine receptors (MIP-1α, CCL5 and CCR5) (B) was detected by
RT-PCR. The error bars represent the mean SEM from three
independent experiments (*P ≤ 0.05 vs control and #P ≤ 0.05 vs LPS).
LPS-Rs inhibit lymphocyte proliferation and
induce Treg population
Activated or tolerogenic antigen presentation and
subsequent events dictate adaptive immune
functions. The activating/tolerogenic effect of LPS-
Rs was investigated in splenocyte cultures and the
proliferation was found to be approximately 3 fold
lesser in the cells treated with LPS-Rs as compared
to the cells activated by LPS (Figure 3.2.2 A). To
further correlate reduced proliferation with
functional markers for the T cells, the expression of
T helper associated transcription factors and
secretary cytokines were analysed. Interestingly,
LPS-Rs pretreatment show downregulated LPS
induced Th1 and Th17 transcription factors, TBET
and ROR-γ respectively accompanied by an
increase in the Treg transcription factor, FOXP3
(Figure 3.2.2 B). The gene expression of
inflammatory cytokine IFN-γ was reduced and the
anti-inflammatory cytokines TGF-β and IL-10
were induced (Figure 3.2.2 C). LPS-Rs significantly
skew T cell response with decreased secretion of
Th1 (IFN-γ) and Th17 (IL-17) cytokines
accompanied by an increase in the Treg cytokine
IL-10 (Figure 3.2.2 D-F). To confirm the
phenotype, the cells from parallel experiment was + + +
analysed for Treg markers (CD4 CD25 Foxp3 ).
LPS-Rs pretreatment significantly enhanced Foxp3 + +
expression (40%) on CD4 CD25 gated cells as
compared to LPS stimulation (Figure 3.2.2 G and
H).The priming of T cells towards T regulatory cells
may be the possible reason for reduced
proliferation. Taken together, the data suggest that
pretreatment with LPS-Rs skews T cell response
with induction of immunosuppressive Tregs cells.
(B)
AnnualREPORT 2014
Figure 3.2.2. LPS-Rs skews T cell response with induction of Tregs cells. Splenocytes were treated with or without LPS-Rs followed by LPS
treatment and cell proliferation was assayed by MTT assay after 72 hrs (A). T helper associated transcription factors: TBET, FOXP3 and ROR-γ (B)
and cytokines IFN-γ, IL-10 and TGF-β (C) were assayed by RT-PCR after 12 hrs. The secretary IFN-γ, IL-17 and IL-10 from culture supernatant
were analysed by ELISA after 72 hrs (D, E, and F). The differentially treated splenocytes after 72 hrs were fixed, surface stained with FITC-CD4
mAb, APC-CD25 mAb followed by permeabilization and intracellular staining with PE-Foxp3 mAb and analyzed by flow cytometry. The
CD4+CD25+ cells were gated and Foxp3 expression was determined and expressed as percentage change. The error bars represent the mean SEM
from three independent experiments (*P ≤ 0.05 vs control and #P ≤ 0.05 vs LPS).
Treg cells confers tolerogenic potential to activated
microglia+ +
Studies have shown that, Foxp3 CD4 Treg cells
play crucial role in maintenance of immunological
homeostasis and tolerance in T lymphocytes and
macrophages. Several studies have shown that
alternative activation of microglia is a beneficial
response to CNS injury. Cellular factors influencing
microglial fate includes CNS infiltrating T cells +
amongst others. Infiltrating CD4 T-cells participate
and inf luence microgl ia l act ivat ion and
consequent neuronal damage. Microglia may
acquire inflammatory neurotoxic phenotype or
immunosuppressive neurosupportive phenotype.
To examine whether immunosuppressive potential
of Treg cells can manipulate activation state of +
microglia the CD4 T cells were treated
differentially. The group treated with rIL-10 along
with rIL-2 showed reduced proliferation and Treg + + +
phenotype (CD4 CD25 Foxp3 ) (data not
shown). Pretreatment with supernatants from
r I L 1 0 + r I L - 2 t r e a t e d T c e l l s c o n f e r s
immunosuppressive functions to microglia during
LPS stimulation, while the supernatants from rIL-2
treated T cells potentiates inflammatory function as
observed by secretion of NO and TNF-α (Figure
3.2.3A and B). The results thus indicate that +
Foxp3 Treg cell can transfer their tolerogenic
potential to microglia that can be a strategy for
bidirectional inhibition of microglia activation.
Figure 3.2.3: Treg cells confers tolerogenic potential to activated
microglia. CD4+ T cells were treated with recombinant IL-2 in
presence or absence of IL-10 for 72 hrs and the supernatants was used
for pretreatment of microglia followed by stimulation with LPS,
production of Nitric oxide (A) and TNF-α (B) in to the culture medium
was analysed by Griess reagent and ELISA, respectively. The error
bars represent the mean SEM from three independent experiments (*P
≤ 0.0001 vs control and #P ≤ 0.0007 vs LPS).
(A)
(B)
AnnualREPORT 2014
We demonstrate that TLR4 antagonism by LPS-Rs
not only rescues microglia mediated inflammatory
events but also results in Treg induction. Treg cells
can mediate their actions by attenuating
inflammatory responses, and thus ameliorating
neuronal degeneration, yet the exact mechanism
of their actions in the injured CNS is poorly
understood. To provide a better understanding in
this context, using the conditioned cytokines we
have shown that Tregs can transfer their
tolerogenic functions to microglia as evidenced by
decreased TNF-α and NO production. Our data
s t rong ly recommend tha t Treg con fe r s
immunosuppressive and neurosuppor tive
microenvironment through secreted cytokines that
may be explo i ted to ga in b id i rec t ional
i m m u n o m o d u l a t o r y s t r a t e g y t o t r e a t
neurodegenerative diseases.
Project 2: Reprogramming of Immune Cells to
Functional Neurons:
The New Face of CD40 Central nervous system
(CNS) has little capacity for self-repair after loss of
cellular elements hence regeneration of neurons is
palliative but neuronal differentiation is a complex
process involving various cell-cell interactions, and
multiple signaling pathways. The current methods
of neuroregeneration are mostly invasive,
expensive and patient incompatible. Methods of
induced pluripotency or transdifferentiation may
lack differentiation ability, homogeneity and
expandability of the final cell population in
addition to being tumorogenic Thus there is a need
to reprogramme a cell type that shares homology
in structure and functions with the nervous system.
In the project we are utilizing the parallels in the
nervous and immune system and exploiting CD40
expressing immune cells and reengineering them
to expressing appropriate CD40 that will render
their lineage shift to a neuronal cell type. Later the
blood immune cells would be harvested and
manipulated to get neuronal population that can
be patient compliant and can be used as potential
therapy for neurodegenerative diseases.
Major finding of the study is mentioned below:
MAP Kinase inhibitor(s) reprogramme immune
cells to neuron.
CNS express a range of receptors that were once
thought to be unique to immune cells. Few
immune receptors like TNFR-I, TNFR-II, Trk high
affinity NFGR and CD40 have been shown to be
involved both in neuronal death and survival
depending on the expression pattern and strength
of ligation with respective ligands. CD40 has been
studied in many brain disorders and has been
shown to activate many families of signalling
molecules including the Mitogen-activated protein
(MAP) kinases that transduce extracellular signals
to cytoplasmic and nuclear effectors [Chang et al.,
2001; Obata et al., 2004]. Several lines of evidence
have suggested that ERK cascades mediate cell
development, growth and survival [Skaper et al.,
1998; Seger et al., 1995], while p38 and JNK
respond to inflammatory cytokines and cellular
stress and promote inflammation and cell death
(Schaeffer et al., 1999). A down-regulation of p38
and up-regulation of ERK protects cortical neurons
from hypoxic stress [Ma et al., 2005]. However,
controversy continues regarding the role of MAP
kinases in cellular survival and death [Zheng et al.,
2004; Serbest et al., 2006].
Based on these facts CD40 expressing immune
cells are highly attractive targets for cell-based
therapy compared to other cells due to their
considerable advantages: nononcogenic,
nonteratogenic, multiple secretary functions
including proangiogenic and growth factors and
their straightforward cell harvesting procedure
[Shechter et al., 2009]. It has already been
reported that increasing the presence of activated
macrophage/microglial cells at a damaged site can
AnnualREPORT 2014
provide an environment beneficial to the
promotion of regeneration of sensory axons,
possibly by the release of cytokines and interaction
with other nonneuronal cells in the immediate
vicinity [Prewitt et al., 1997; Gensel et al., 2009].
We thus tested the kinetics of immune-neuron
transdifferentiation in presence of MAP Kinase and
PI3Kinase inhibitors. JNK1/2 (SP) and PI3 Kinase
inhibitor (Ly) showed prominent neuronal
morphology with neurite outgrowth and branching
(3.2.4 A)
Figure 3.2.4 A: MAPK and PI3K inhibition transdifferentiates
monocyte- macrophage cells to neurons: RAW 264.7 cells after
treatment with inhibitors and subsequent neuronal induction. It was
found that cells treated with NGF , p38 MAPK inhibitor (SB), JNK1/2
inhibitor (SP), ERK1/2 inhibitor (PD and PI3Kinase inhibitor (LY)
and cellular morphology was observed at indicated time points.
The differentially treated cells were later analysed
for the molecular marker specific for monocyte
macrophages and early and late neurons by sq-
RTPCR and/or immunoflouroscent staining with
specific antibody. The differentiated cells were
analysed for the expression of monocyte/
macrophage markers CD14 and CD11b
respectively. The effect on CD40 expression was
also evaluated. Both the RT-PCR and the Western
blot analysis confirm the decrease in the expression
of these molecules indicating reprogramming
(Figure 3.2.4 B)
To evaluate the reprogramming to neuron, the
differentiated cells were evaluated for the early and
late neuronal genes. The early neuronal maker
genes Tubb3 and Nurr1 were induced during the
reprogramming event. Surprisingly event the late
neuronal genes like MAP2, NeuN and -III tubulin
genes were significantly upregulated (Figure 3.2.4
C).To further confirm the findings the cells were
immunostained for early and late neuronal
markers. Nestin, an early neuronal marker was
expressed in the transdifferentiated cells after 3
days (Figure 3.2.4 D). MAP2 and NeuN, the
markers for late neurons were expressed on the
differentiating cells confirming transdifferentiation
(Figure 3.2.4 E).
Figure 3.2.4.B Molecular characterization of generated neurons for
monocyte-macrophage markers: The differentiated cells were analysed
for the expression of monocyte/ macrophage markers CD14 and CD11b
respectively. The effect on CD40 expression was also evaluated. Both
the RT-PCR and the Western blot analysis confirm the decrease in the
expression of these molecules indicating reprogramming.
(C)
AnnualREPORT 2014
Figure 3.2.4C-E: MAPK and PI3K inhibition in the immune cells
reprogramme them to neurons: Analysis of the early and late neuronal
lineage markers: the monocyte-macrophage cells were treated with
indicated inhibitors of kinases and analysed for indicated early
neuronal marker after 3 days and for late neuronal markers after seven
days of treatment in conditioned media.
Project 3: Divers i fy ing the dect ins and
inflammasomes in Aspergillus fumigatus specific
immune response.
Aspergillus fumigatus, a ubiquitous airborne
fungus, can cause invasive infection, invasive
aspergillosis (IA) in immunocompromised
i n d i v i d u a l s b u t a l s o t r i g g e r s a l l e r g i c
bronchopulmonary aspergillosis (ABPA) in a
subset of otherwise healthy individuals repeatedly
exposed to the organism. Recent advances in our
understanding of the pathogenesis of the fungi
have highlighted the multifactorial nature of A.
fumigatus virulence and the complex interplay
between host and microbial factors. Exposure to
fungal spores is ubiquitous and, therefore, of
pivotal importance for mycoses acquired through
the respiratory tract. Consequently, innate
immunity plays a predominant role in clearance of
inhaled spores. Our immune system recognizes
and responds to infection through the pattern
recognition receptors (PRRs) of the innate immune
system. The immune response to inhaled A.
fumigatus is characterized by a complex interaction
between innate and adaptive immune responses,
both of which are activated upon exposure to the
fungus. The pattern associated molecular patterns
(PAMPs) for most of the fungi are β- glucans that
are recognized by many of the pattern recognition
receptors (PRRs) including dectins. The activation
of innate response induce both interferon –gamma
(IFN-γ) producing type 1 T helper (Th1)- and
interleukin-17 (IL-17)-producing Th17 cells and
have been proposed to be involved in anti-fungal
host defense. An essential step for the induction of
Th1/Th17 responses is the activation of the
inflammasome and the subsequent release of
active IL-1β mediated by the dectin-1/Syk pathway
partly. IL-1β has important direct effects on the
innate immune response and on the initiation of
the adaptive Th1 and Th17 cellular responses. No
studies have been employed to assess the impact
of dectin mediated inflammasome and IL-1β
activation on the Th1/Th17 defense mechanisms
during infection with A. fumigatus. In addition, the
inherent resistance to infection suggests the
occurrence of regulatory mechanisms of the T
regulatory (Treg) cells as well but is not well
answered. The relevance of studies aims at
understanding host immune response against A.
fumigatus with respect to its recognition by dectins
and fu r the r downs t ream ac t i va t i on o f
inflammasome. The manipulation of these signals
may allow the host to overcome infection
mediated by appropriate activation of the T cell
subsets.
In the last years report the following achievements
were listed:
1. The carried work confirms the involvement
(D)
(E)
AnnualREPORT 2014
of dectin 2 in addition to dectin 1 during
fungal immunity as shown by upregulated
dectin 1/2 expression.
2. The study shows that β-Glucan induces
proinflammatory cytokines like TNF-α and
IL-1β in a dose dependent manner.
3. The study shows that β-Glucan inhibits
anti-inflammatory cytokines IL-10.
4. β-Glucan regulates Dectin expression and
signalling events differentially during
interference with various signaling and
oxidative pathways inhibition.
The progress made this year is mentioned below:
Generation of the Bone marrow derived dendritic
cells and characterization
Bone marrow cells were flushed from the femur
and tibia of 6-8 weeks old BALB/c mice. The single
cell suspension was loaded onto Ficoll-1077
gradient to isolate low density peripheral blood
mononuclear cells (PBMCs). The PBMCs were
then cultured in presence of rGM-CSF (20 ng/ml)
and rIL-4 (10 ng/ml) wit media and growth factor
replacement every alternate day. On the sixth day
the cells were treated with r TNF-α (5 ng/ml) for
ma tu ra t i on . The gene ra t ed ce l l s we re
characterized for surface marker expression and
confirmed to be ≥ 95% pure DCs (Figure 3.2.5).
Figure 3.2.5: CD11c and MHC-II immunostaining confirms the purity
of DCs.
Signalling inhibition of syk, oxidation , caspase 1
and NF-k B pathway leads to a decrease in TH17
activating cytokines:
The DCs were pretreated with inhibitors for syk,
caspase, NF-k B and oxidation pathways and then
stimulated with β-glucan (curdlan) to explore the
role of these pathways in inflammasome activation
and also to check the cytokine profile to predict the
T cell outcome.The findings indicated clear
suppression of Th17 priming APC activation. The
decrease in IL-23, IL-6 and IL-17 indicates that the
cytokines required for Th17 activation are
decreased following inhibition of pathways (Figure
3.2.6).
Figure 3.2.6: Increase in IL-10 and TGB-β upon syk and caspase
inhibition. Decreased IL-1β, IL-6 and IL23 following inhibition of
signaling pathways may result in Th17 inhibition.
Signalling inhibition differentially modulates
curdlan induced inflammatory cytokines required
for Treg activation:
The DCs were pretreated with inhibitors for syk,
caspase, oxidation and NF-k B pathways and then
stimulated with β-glucan (curdlan) to explore the
role of these pathways in inflammasome activation
and also to check the cytokine profile to predict the
T cell outcome. The findings indicated activation of
the key cytokines required for Treg activation.
Decreased TNF-α, IL-1β and IL-6 and prominent
increase in TGF-β indicates that the DCs are
primed to lead to better Treg generation (Figure
3.2.7).
AnnualREPORT 2014
Figure 3.2.7. Syk inhibition regulates Treg skewing cytokines.
Treated DCs regulate β-glucan (curdlan) induced
T cell proliferation and cytokine secretion:
Spleen was collected from 6-8 weeks healthy
BALB/c mice and was minced with frosted-end
slide followed by RBC depletion using Geys' lysis.
The splenocytes were loaded on to Nylon wool
column for purification of T cells. The CD4+ T cells
were later purified using magnetically labeled
antibody cocktail by negative selection. The cells
were tested for purity by CD4 staining. The DCs
were pretreated with inhibitors for syk, caspase,
oxidation and NF-k B pathways (6 hrs) and then
stimulated with β-glucan (curdlan) for 18 hrs. The
cells were then fixed and purified T cells were
added in the ratio of 1:10 of DC:T cells. The
coculture was incubated for another 48 hrs
followed by enumeration of cellular proliferation
and cytokine secretion. Syk inhibition results in
decreased cell proliferation decreased Th1 and
Th17 cytokines with significant increase in the T
reg signature cytokines (Figure 3.2.8)
Figure 3.2.8: Syk inhibition decreased cell proliferation, Th1 and Th17
cytokines with significant increase in the T reg signature cytokines.
3.3 Genetics & Developmental Biology
Principal Investigator:
Dr. Anand K. Tiwari (Assistant Professor)
Research Team:
Mr. Ajay Kumar (JRF, DST project)
Mr. Bhavin Uttekar (JRF, GSBTM project)
Ms. Pearl Christian (JRF, DBT PS project)
Ms. Komal Panchal (DST, Inspire Fellow)
Research Project Initiated:
1) Study of the role of molecular chaperon
during eye development in Drosophila
melanogaster.
2) Study of the role of molecular chaperone
and ubiquitin ligases in the progression of
Alzheimer's disease using Drosophila
melanogaster as a model organism.
A summary of the progress made under above
mentioned projects are as follows:
Project 1: Study of the role of molecular chaperone
dur ing eye deve lopment in Drosophi la
melanogaster.
Progress made: In earlier report we have shown
that mutation in Hsp70/Hsc70 results in
degenerated eye phenotype with reduction in eye
size in Drosophila. In continuation with the earlier
study the following results were obtained from the
present study:
1) Mutation in Hsp70/Hsc70 results in reduced cell
proliferation in developing Drosophila eye
In order to check the causes of eye size
AnnualREPORT 2014
reduction/retinal degeneration, we have checked
the status of cell death in Hsp70/Hsc70 mutant
eyes. To check the cell death, we perform AO
staining in developing larval/pupal eyes from
Hsp70/Hsc70 mutant. AO staining confirms that
mutation in Hsp70/Hsc70 results in excessive cell
death in developing eye. In the present report, we
are showing that whether the eye size reduction is
the additive consequence of excessive cell death
and abolished cell proliferation (cell cycle), or only
by excessive cell death in developing Drosophila
eye.
To check the cell proliferation (cell cycle) in
Hsp70/Hsc70 mutant eyes, we performed
phospho-histone-3 (PH-3) (a marker for M-phase
cells) staining in developing third instar larval eye +disc of Oregon R (Control) and Hsp70/Hsc70
mutants. PH-3 staining confirms a significant
decrease in PH-3 positive cells in second mitotic
wave (SMW) of Hsp70/Hsc70 mutant larval eye
disc as compare to wild type (Figure 3.3.1).
Figure 3.3.1: Mutation in Hsp70/Hsc70 reduces cell proliferation in
SMW of developing Drosophila eye. (A-C) Phosphohistone-3 staining +in third instar larval eye imaginal discs of Oregon R (Control) (A),
DN DNGMR-GAL4>UAS-Hsp70 (B) and GMR-GAL4>UAS-Hsc70 (C).
Hsp70/Hsc70 mutants show a significant reduction in PH-3 staining (M
phase cells) in second mitotic wave (marked by arrow). (D)Bar diagram
of no. of PH-3 positive cells in control and Hsp70/Hsc70 mutants. The
statistical comparisons of PH3 positive cells between control and
mutant larval eye disc by one way ANOVA showed the data to be
significant with the probability of 0.0012.
2. Cyclin A interacts with Hsp70/Hsc70 gene in
Drosophila eye
As, shown above mutation in Hsp70/Hsc70 results
in reduction of PH-3 positive cells in SMW in
developing Drosophila eye and it is well known
AnnualREPORT 2014
that Cyclin A regulates G1 to S phase transition
during larval eye development in Drosophila.
Thus, to know the status of Cyclin A in
Hsp70/Hsc70 mutants we performed genetic
interaction study between Cyclin A and
Hsp70/Hsc70 mutants. We used UAS-Cyclin-A to C8LR1
overexpress the wild type Cyclin-A and CycA
(amorphic allele of Cyclin-A) to down regulate
Cyclin-A in Hsp70/Hsc70 mutants background.
It was observed that over expression of wild type
CycA causes disorganization of ommatidia in
GMR-GAL4/UAS-CycA; +/+ individuals (shown
in Figure 3.3.2 D) and reduction in eye size, loss of DNbristle cells in UAS-Hsp70 -GMR-GAL4/UAS-
CycA;+/+ individuals (shown in Figure 3.3.2 E)
and disorganized ommatidia and reduced eye size DNin UAS-Hsc70 -GMR-GAL4/UAS-CycA;+/+
individuals (shown in Figure 3.3.2 F). While, down
regulation of CycA by introducing amorphic allele C8LR1(CycA ) genetically doesn't affect the eye
C 8 L R 1phenotype of GMR-GAL4/+; CycA /+
individuals (Figure 3.3.2 G), but showed a DNsignificant rescue in bristle cells in UAS-Hsp70 -
C8LR1GMR-GAL4/+; CycA /+ individuals (shown in
Figure 3.3.2 H)anda rescue in eye size and DNpigmentation in UAS-Hsc70 -GMR-GAL4/+;
C8LR1CycA /+ individuals (shown in Figure 3.3.2 I).
This result clearly suggests an interaction between
CyclinA and Hsp70 and Hsc70 gene in Drosophila
eye.
Figure 3.3.2: Cyclin A interacts with Hsp70/Hsc70 gene in Drosophila eye. (A-C) Light micrograph images of Control fly eye: GMR-
DN DNGAL4/CyO (A), UAS-Hsp70 -GMR-GAL4/+ (B) and UAS-Hsc70 -GMR-GAL4/+ (C). (D-F) Eye phenotype of Hsp70/Hsc70 mutant flies when CyclinA was overexpressed in GMR-GAL4 (D), Hsp70/Hsc70
DNmutant background in UAS-Hsp70 -GMR-GAL4/UAS-CycA; +/+ DN(E), and UAS-Hsc70 -GMR-GAL4/UAS-CycA; +/+ individuals (F).
Overexpression of Cyclin A results in bristle cell abnormality (E), reduction in eye size and loss of pigment (F). (G-I) Eye phenotype of Hsp70/Hsc70 mutant flies when CyclinA was down regulated. (G) Eye
C8LR1phenotype of GMR-GAL4/+; CycA /+ showing no change in eye DNwhile a rescue in bristle cell abnormality in UAS-Hsp70 -GMR-
GAL4/+; CycAC8LR1/+ individuals (H) and a rescue in eye size DNreduction and pigmentation of UAS-Hsc70 -GMR-GAL4/+;
C8LR1CycA /+ flies was observed (I).
Project 2: Study of the role of molecular
chaperones and ubiquit in l igases in the
progression of Alzheimer's disease using
Drosophila melanogaster as a model organism.
Progress made: The following results were
obtained from the present study:
1) AD flies show age-dependent loss of
climbing activity in Drosophila
In earlier report we have shown that mutation in
A p p l g e n e re s u l t e d i n a g e - d e p e n d e n t
neurodegeneration in Drosophila . Since,
locomotor impairment is a key hallmark of
neurodegenerative disease, thus, locomotor
activity of AD flies in Drosophila was examined. To
examine this, number of flies crossed 10cm
distance in 10 second in locomotor apparatus were
counted and % was calculated. It was observed +that 60% of 10 days old Oregon R (Control) flies,
crossed 10cm distance in 10 sec while 50% flies
from Elav-Gal4/+; and 52% of Elav-Gal4/+; 32.12UAS-A H /+ and 50% of Elav-Gal4/+; UAS-42
A (H)/+ flies crossed the given distance in a 42
given time.+In 20 days observation, 45% flies from Oregon R
(Control) crossed 10cm distance in 10 sec and
38% flies from Elav-Gal4/+ and only 5% flies from 32.12Elav-Gal4/+; UAS-A H /+ and 15% flies from 42
Elav-Gal4/+; UAS-A (H)/+ able to cross 10cm 42
distance in 10 sec time. This result suggests a
significant locomotor impairment in AD flies in
age-dependent manner as compared to the control
fly group.
2) Locomotor activity and neurodegenertaion
associated with AD flies were significantly
improved when molecular chaperones and
ubiquitn ligases were over-expressed while
i t became more severe with down
regulation of molecular chaperones and
ubiquitn ligases.
As, shown above, AD flies in Drosophila show age-
dependen t l ocomoto r impa i r men t and
neurodegenertaion, thus, we were interested to
know the effect of over-expression and down
regulation of molecular chaperone (Hsp26, Hsp27
&Hsp70) and ubiquitin ligases (parkin, neuralized)
in AD flies genetic background. A significant
improvement in locomotor act iv i ty and
neurodegenerative phenotype of AD flies were
observed when molecular chaperones and
ubiquitin ligases were over-expressed while it
became more severe with thedown regulation of
molecular chaperones, ubiquitn ligases (Figure
3.3.3, Figure 3.3.4 & Figure 3.3.5).
Figure: 3.3.3. Locomotor activity in AD flies with over-expression of
molecular chaperones & ubiquitin ligases and with downregulation of
molecular chaperones & ubiquitin ligases: (A) Locomotor activity of
AD flies. (B) Locomotor activity of AD flies when molecular
chaperones were overexpressed. (C) Locomotor activity of AD flies
when molecular chaperones were downregulated. (D) Locomotor
activity of AD flies when ubiquitin ligases were over-expressed. (E)
Locomotor activity of AD flies when ubiquitin ligases were down
regulated.
AnnualREPORT 2014
3) Over-expression of molecular chaperones &
ubiquitin ligases improves ageing in Drosophila
while down-regulation reduces longevity in flies
It has been shown that inhibition of Appl gene in
Drosophila results in reduced survival in flies and
our study suggested that molecular chaperone and
ubiquitin ligases plays a protective role in
Alzheimer's disease. Thus, to examine the effect of
molecular chaperone and ubiquitin ligases,
survival ship assay was performed in AD flies in
molecular chaperone and ubiquitin ligases genetic
background. It was observed that over-expression
of molecular chaperones and ubiquitin ligases
significantly improves ageing in AD flies (Figure
3.3.6A & C) while its down regulation reduces
longevity in flies (Figure 3.3.6B & D).
Figure 3.3.4: Genetic interaction study of Drosophila Appl mutant with +molecular chaperone. (A-C) Eye micrograph controls: Oregon R (A),
RNAiGMR-GAL4/+ (B) and GMR-GAL4˃UAS-Appl (C). (D-F) Eye micrograph of Appl flies when molecular chaperones Hsp26, Hsp27 &
RNAiHsp70 were overexpressed in GMR-GAL4/UAS-Hsp26;UAS-Appl /+ RNAi(D), GMR-GAL4/+;UAS-Appl /UAS-Hsp27 (E) and GMR-RNAiGAL4/UAS-Hsp70 (H);UAS-Appl /+ (F). (G-I) Eye micrograph of
Appl flies when molecular chaperone were downregulated in GMR-DN RNAiGAL4/UAS-Hsc70 ;UAS-Appl /+ (G), GMR-GAL4/+;UAS-
RNAi DNAppl /Df(3R)Hsp70 (H) and GMR-GAL4/UAS-Hsp70 ;UAS-RNAiAppl /+ (I).
Figure 3.3.5: Genetic interaction study of Drosophila Appl mutant with ubiquitin ligases. (A-C) Eye micrograph control flies: GMR-GAL4/+
RNAi(A) and GMR-GAL4˃UAS-Appl (B). (C-D) Eye micrograph of Appl flies when ubiquitin ligase park was overexpressed in GMR-
RNAiGAL4/UAS-Park;UAS-Appl /+ (C) and neur in GMR-GAL4/UAS-RNAiNeur;UAS-Appl /+ (D). (E-F) Eye micrograph of Appl flies when
ubiquitin ligases were downregulated in GMR-GAL4/+; UAS-RNAi 25 RNAi 11Appl /Park (E) and in GMR-GAL4/+; UAS-Appl /Neur (F). (A'-
Figure 3.3.6A: Over-expression of molecular chaperones and ubiquitin ligases improves aging in Drosophila while down regulation reduces the longevity in flies. (A-B) Survialship assay of Appl flies when molecular chaperones were over-expressed (A) and down regulated (B). (C-D) Survialship assay of Appl flies when ubiquitin ligase (park) was over-expressed (C) and ubiquitin ligase Sina was down regulated (D). The graph clearly suggests that overexpression of molecular chaperone and ubiquitin ligases improve longevity in Drosophila while its down regulation reduces longevity in Drosophila.
AnnualREPORT 2014
3.4 Cell Biology:
Cell death and signaling in cancer:
Principal Investigator:
Dr. Chandramani Pathak (Assistant Professor)
Research Fellows:
Mr. Kishu Ranjan (ICMR-SRF)
Mr. Bhargav N. Waghela (DST- INSPIRE)
Ms Anupama Sharma (CSIR-SRF)
Ms Suhashini Dhumale (JRF - DST SERB Project)
Ms. Kavita Shirsath ((JRF – DBT-NNT Project)
Ms. Vineeta Mishra ((Ph.D. Student)
Our major focus is to understand the cell death and
inflammatory signaling pathways activated during
physiological and pathological conditions.
Programmed cell death (PCD) is a physiological
process that is responsible for removal of
unwanted cells during embryonic development,
tissue homeostasis; immune cell maturation and
e l iminat ion of pathogen in fec ted ce l l s .
Dysregulation of PCD leads to many diseases like
neurodegeneration, cancer, inflammatory and
metablic disorders.
Apoptosis is one of the most important mechanism
of cell death. The cells of multi-cellular organisms
have the inherent capacity to undergo death by a
highly organized manner mechanism known as
programmed cell death or apoptosis. This highly
regulated cellular process is utilized during
embryonic development or upon tissue injury or
disturbance of tissue homeostasis. Thus, apoptosis
is a key regulatory mechanism for regulating
various physiological events including eliminating
the unwanted cells and defence against infections
and maintaining the homeostasis of normal
tissues. Alteration in apoptosis not only contributes
to the promotion of malignancy but can also
enhance drug resistance in response to anti-cancer
therapies. Therefore, regulation of apoptosis
during pathological conditions is important for
AnnualREPORT 2014
therapeutic intervention.
Apoptosis and inflammation are two closely
related processes of multi-cellular organism.
Inflammation is one of the spontaneous cellular
responses which may have dual effects. Under
some conditions it may activate host immune
defences, while under others in rest, it may induce
opposite effects. Acute inflammation is the innate
immune response that leads to adaptive immunity;
but when it becomes chronic it increases the risk to
develop several diseases including cancer,
cardiovascular diseases, diabetes and neurological
disorder. Several lines of the evidences support the
assumption that inflammation plays an important
role in the progression of malignancy by providing
tumor micro environment. Thus, elevation of
inflammatory mediators and inhibition of
apoptosis contributes cell proliferation and
survival in cancer. Therefore, regulation of
apoptosis and inflammatory mediators might be
important for critical targets in both prevention and
therapy. Towards this aim we are focusing our
research on regulation of apoptosis and
inflammation in cancer.
The major objectives of our research group are:
1. Find out a new molecular target and
explore cellular mechanism which can
control activation of inf lammatory
mediators and cell proliferation in cancer.
2. Induction of apoptosis in cancer cells by
modulating the apoptotic signaling.
3. Apoptotic potential of nanoparticulate anti-
cancerous molecules.
Project 1: Crosstalk of FADD and cFLIP in
regulation of death receptor mediated apoptosis
Fas-associated death domain protein (FADD) is an
adaptor protein molecule which plays a crucial role
in transducing the apoptotic signals. FADD
provides docking site for hemophilic interaction,
oligomerization and autocatalytic processing to
activation or regulation of downstream apoptotic
signaling. The Death Domain (DD) of FADD
interacts with DD of the death receptors and Death
Effector Domain (DED) allows recruitment of
DEDs containing carrying proteins like pro-
caspase-8/ 10, which in turn initiates the formation
of a death inducing signalling complex (DISC) to
further progression of death receptor signalling for
apoptosis. The death receptor mediated apoptosis
is effectively regulated by anti-apoptotic protein
cFLIP, which is structurally similar to procaspase-8
and -10 but lacks cysteine residue for autocatalytic
activity. Thus, FADD and cFLIP both are important
component for cel l death and survival .
Disregulated expression of FADD and cFLIP is
associated with inhibition of apoptosis and other
signalling for cell death which leads to progression
of malignancy (Figure 3.4.1). Moreover, elevated
intracellular level of cFLIP competitively excludes
the binding of procaspase-8 to the death effector
domain (DED) of FADD at the DISC, thus blocking
the activation of death receptor signalling of
apoptosis. In the present study we have explored
the crosstalk of FADD and cFLIP in regulation of
death receptor mediated apoptosis (Figure 3.4.2).
The aim of present study was investigating the
cross talk between cFLIP and FADD for regulation
of cell death and survival. Our findings reveal that
low endogenous level of FADD doesn't provide a
sufficient binding platform to caspase-8/10 at the
DISC. Interestingly, overexpression of FADD in
HEK293T and MCF-7 cells down regulates
expression of cFLIP. Moreover, selective
knockdown of cFLIP using siRNA promotes cell
death. Further, knockdown of cFLIP during FADD
over expressed conditions showed rapid loss of
mitochondrial integrity with simultaneous release
of cytochrome c and activation caspase cascade
for apoptosis along with further inactivation of
PARP through its cleavage. Collectively, our data
Figure 3.4.1: Role of FADD in cell proliferation
Figure 3.4.2: Involvement of FADD and cFLIP in regulation of death
receptor mediated apoptosis
Project 2: Apoptotic potential of nanoparticulate
anti-cancerous molecules.
Recent advances in Nanotechnology have paved
way for therapeutic potential using different
strategies and pharmacological manipulation.
More importantly, recent reports highlight that
nanoparticulate drugs may contribute as a novel
target for drug delivery for treatment of cancer.
Nanoparticle based therapy might be able to
AnnualREPORT 2014
suggest that aberrant expression of cFLIP and
FADD promote cell survival and inhibit apoptotic
cell death. Taken together, these results suggest
that gaining insights into the regulatory
mechanisms of FADD and cFLIP in death receptor
mediated cell death might open up a way towards
a novel approach for therapeutic intervention of
cancer.
improve the therapeutic index of anti-cancer drugs
for treatment of cancer. We also focusing our
research on nano-particle based drug delivery and
evaluating their apoptotic potential in human
cancer cells using dendrimers as a delivery tools.
Dendrimers are nano-sized, radially symmetric,
well-defined, homogeneous and monodisperse
consisting of tree-like branched structure. These
highly branched three-dimensional structures
provide a high degree of surface functionality and
versatility for improved drug delivery. Dendrimes
have been reported to have functional diversity
but its inherent toxicity limits its application for
therapeutic intervention. As the free functional
groups on the surface contribute to its toxicity, the
surface engineering of dendrimers can lead to its
improved properties, especially in the context of
biomedical applications.
Project 3: Nano particulate drug conjugate for
drug delivery in cancer cells
Several studies have suggested that poor
bioavailability of anti-cancer drug is due to its early
biotransformation and metabolism. To overcome
such limitations, several approaches have been
used to improve its therapeutic efficacy. In present
study, we conjugated the curcumin with
biodegradable polymer PLGA to improve its
stability and bioavailability. Conjugation of
polymeric nanoparticles with ligands or molecules
could also enable drug delivery in a spatially and
temporally controlled manner, which may further
enhance the therapeutic efficacy of drugs and
reduce their toxicity. Here, we have conjugated the
curcumin with PLGA through an ester bond
formation at a phenolic hydroxyl group of
curcumin that might result in an increase in its
stability. We speculated that ester linkage at the
phenolic group on curcumin would be hydrolyzed
by cytosolic esterases, thereby releasing native
Figure 3.4.3: Anti-proliferative and apoptotic potential of curcumin-
PLGA conjugate.
3.5 Bioinformatics and Structural Biology :
Principal Investigators:
Dr. Desh Deepak Singh (Associate Professor)
Dr. Anju Pappachan (Assistant Professor)
Research fellows:
Mr. Manoj Kumar (ICMR SRF)
Mr. Radheyshyam (CSIR-SRF)
Mr. Dhaval Patel (Technical Assistant- DISC)
Mr. Kunal Shah (Trainee-DISC)
Ms. Bhumi Patel (Project JRF)
Ms. Nupur Shah (Project JRF)* (Left during the
period)
Mr. Prakash Kulkarni (Project JRF)
Project 1: Characterization of Leishmanial surface
AnnualREPORT 2014
curcumin gradually inside the cells, can elicit its
activity. The results showed that curcumin-PLGA
conjugate efficiently inhibits cell proliferation and
cell survival in human colon carcinoma cells as
compared to native curcumin. Additionally,
curcumin conjugated with PLGA shows improved
cellular uptake and exhibits controlled release at
physiological pH as compared to native curcumin.
proteins
Leishmaniasis is one of the most significant
neglected tropical diseases, with 350 million
people in 88 countries worldwide living at risk with
few therapeutic options. Surface virulence factors
on Leishmania parasite are important for the host-
pathogen interaction. Characterizations of the
following surface proteins are ongoing:
Hypothetical Protein:
LinJ.27.2200 is a 130 amino acid long protein
having Pleckstrin homology domain (PH domain).
This domain can bind Phosphatidylinositol lipids
w i th in b io log i ca l membranes ( such as
Phosphatidylinositol (3,4,5)-trisphosphate and
phosphatidylinositol (4,5)-bisphosphate), and
proteins such as the β,γ-subunits of heterotrimeric
G proteins, and protein kinase C. PH domains play
a role in recruiting proteins to different
membranes, thus targeting them to appropriate
cellular compartments or enabling them to interact
with other components of the signal transduction
pathways. This family of proteins remains
uninvestigated in kinetoplastids.
We have cloned this gene (LinJ.27.2200) in
pET15b vector(Fig.3.5.1A) and confirmed
through sequencing. Overexpression was
achieved insoluble form in Rossetta(DE3) strain
with 1mM IPTG as inducing agent and SDS-PAGE
analysis shows a band corresponding to 15kDa.
Soluble protein was purified through Ni-NTA his-
tag aff inity chromatography.(Fig.3.5.1B)
Bioinformatics analysis and modeling using I-
TASSER program confirms the loop-helix-sheet
structure.
Figure 3.5.1: Cloning & Expression of Hypothetical Protein
Surface Antigen Like Protein (SALP)
Genome sequence of many Leishmania species
indicated the presence of genes encoding a
number of surface antigen like proteins (SALPs)
and their translated protein sequences contains
LRR repeats as well as LRR like receptor kinases,
which could probably act as potential vaccine
candidates in future. However, not much
information is currently available regarding these
SALPs due to lack of proper structural and
functional characterization of these proteins. From
L. donovani gene DB (gene database), one out of
eight surface antigen like protein (SALP) gene
possessing LRR receptor like kinase motif was
selected for the present study.
Genomic DNA of L. donovani was obtained
from IICB, Kolkata, India.
Forward and reverse primers
(F-NdeI: GATCATATGATGGCCTTTGTCGTGTACGTC
and R-BamHI: GATGGATCCCTATTGATGGGGGCCCTGCA)
were designed based on the available nucleotide
sequences of salp (gi|398011094) at NCBI
GenBank with addition of specific restriction sites.
A 690 bp long salp gene was PCR amplified.
Double digested (NdeI,BamHI) PCR product of
salp was ligated to similarly digested pET15b
expression vector. Positive clones were confirmed
through colony PCR, restriction digestion and
(A)
(B)
AnnualREPORT 2014
nucleotide sequencing. Protein induction trials
with 0.25 mM to 2 mM IPTG at 16 to 37°C for 4 h to
overnight were carried out.
Project 2: Functional and Structural studies on
adhesion proteins from Lactobacillus spp.
Adhesion proteins like mucin binding protein,
f ibronectin, Glyceraldehyde 3-phosphate
dehydrogenase (GAPDH) from L. acidophilus
were chosen for the present study.
GAPDH is an intracellularly located enzyme, a
housekeeping enzyme essential for glycolysis,
which has also been identified on the outer surface
of several pathogens, including a group of
streptococci, Staphylococcus epidermis and
Staphylococcus aureus, also in pathogenic fungi
and parasites such as Candida albicans and
Schistosoma mansoni. In case of Lactobacilli sp
besides its metabolic functions, GAPDH undergo
'moonlighting' when they are exposed on the
bacterial surface, developing additional functions.
LA 318 GAPDH is found to adhere human colonic
mucin. However, it is not known why the GAPDH
exists on the cell surface without a conventional N-
terminal signal peptide. The secretion and
anchoring mechanisms of GAPDH on the bacterial
surface have not been characterized.
Crystallization and preliminary data analysis for
GAPDH - LBA0698
The gene for Lactobacillus GAPDH has been
cloned in PET vectors and the expressed
recombinant protein was set up for crystallization.
Crystallization trials were carried out with 2-10
mg/ml protein, at different pH range (7.0-8.0) in
60-well terasaki plates (Grenier, Germany) using
under oil micro batch technique. Trial conditions
were prepared using commercially available
crystallization screens Crystal screen, Crystal
screen 2 and Index Screen (Hampton Research,
USA). The protein was crystallized using 10% w/v
Figure 3.5.2 (A) Diffraction image of GAPDH. (B) Crystal of
L.acidophilus GAPDH grown using 10% w/v Polyethylene glycol
1,000, 10% w/v Polyethylene glycol 8,000 as precipitant.
(A)
(B)
AnnualREPORT 2014
Polyethylene glycol 1000, 10% w/v Polyethylene
glycol 8000 as precipitant. Crystals were mounted
in nylon loops (Hampton research, USA) dragged
briefly through paraffin oil. No separate
cryoprotectant was used. Data were collected at
103K using a Cu-Kα X-ray beam generated by X-
ray generator, a Rigaku FR-E+ (Fig.3.5.2) and was
processed using iMosflm (Powell HR et al., 2013).
X-ray diffraction data was collected to 2.3 Å
resolution and structure solution is ongoing.
Project 3: Characterization of plant lectins
Beta Glucosidase Aggregating Factor (BGAF) from
Sorghum bicolor
Beta Glucosidase plays a very important role in
plant defense by converting the sugar moieties into
secondary metabolites which go and fights with the
infection. These beta glucosidases are very
vulnerable to proteolytic degradation by proteases
released by infecting organisms.
Beta Glucosidase Aggregative factors are a
chimeric lectin. BGAF contains N-terminal dirigent
domain (disease response gene) and C-terminal
jacalin like lectin domain. As name suggests they,
aggregate beta Glucosidase in plants and prevent
them from proteolytic degradation by proteases
released by infecting organisms. Lectin domain is
involved with binding with Beta Glucosidase while
N-terminal dirigent domain is responsible for the
dimerization of BGAF molecule, which is very
important step in aggregation of beta glucosidase.
Biophysical characterization of BGAF and lectin
domain of BGAF:
Circular dichorism spectroscopy and fluorescence
spectroscopy were used to characterize purified
BGAF. Circular dichorism spectroscopy gave an
insight into the secondary as well as tertiary
structure of BGAF and effect of carbohydrate
binding on the structure of BGAF. Circular
dichorism data shows BGAF mostly consist of anti
paral le l β sheets , which is in l ine wi th
b i o i n fo r ma t i c s ana l y s i s . F l uo re s cence
spectroscopy experiments gave the dissociation
constant of carbohydrates with BGAF. Data from
these experiments supports data obtained from
hemagglutination experiments. Dissociation
constant of N-Acetyl D galactose amine with -5BGAF was Kd= 6.3X10 M and there was a blue
shift which suggest that upon binding of N-Acetyl D
galactose amine there is a change in BGAF
structure. (Fig.3.5.3)
Figure 3.5.3: (A)Fluorescence quenching studies on BGAF with N-
acetyl –D- galactosamine (B) Kd (dissociation constant ) of BGAF
with N-acetyl –D- galactosamine Kd= 6.3X10-5 M
Project 4: Characterization of Leishmanial
metabolic pathway proteins (Dr.Anju Pappachan)
Characterizations of purine salvage pathway
enzymes from Leishmania donovani using
bioinformatics tools:
Xanthine Phosphoribosyltransferase (XPRT) is a
unique enzyme that recycles xanthine from the
degradation products of nucleotide metabolism
and forms xanthine monophosphate. XPRT lacks
a mammalian counterpart and is, therefore, a
potential target for antiparasitic therapy. A virtual
screening of the model with XMP analogues,
existing anti-leishmanial drugs, anti-leishmanial
HGPRT compounds & anti-leishmanial natural is
(A)
(B)
AnnualREPORT 2014
being carried out.Cyclic GMP & Guanosine 2',3'-
cyclophosphorothioate, that inhibit both
Leishmanial HGPRT and XPRT can be potent
drug candidates.
Table 3.5.1 has a list of XMP analogues showing
better binding affinity to L. Donovani XPRT.
Compound BindingAffinities(kcal/Mol)
XMP -6.9
Xanthosine -6.7
ZINC03869461 -8
ZINC04097050 -7.9
ZINC13507793 -7.8
ZINC13436564 -7.8
ZINC53684323 -7.6
ZINC04533545 -7.6
ZINC03869462 -7.5
ZINC03869459 -7.5
ZINC15521877 -7.5
ZINC03869964 -7.4
ZINC03869964 -7.4
Table 3.5.1 Screening of XMP and XMP analogs with L.
donovaniXPRT.
Homology Modeling of L. donovani Adenylate
Kinase:
Homology model of L. donovani Adenylate kinase
was generated using the program I-TASSER
(Figure 3.5.1.6). The model had a reliable C-score
(1.31) and PROCHECK statistics. The model was
generated using the following structures as
templates- Adenylate kinase domain from Bacillus
subt i l is , Adenylate kinase from Baci l lus
stereothermophilus, Adenylate kinase from
Plasmodium falciparam, Adenylate kinase from
Figure 3.5.4: Homology model of LDAK shown with its active sites
Figure 3.5.5: Superposition of LDAK homology model and Human
AK2A (PDB ID: 2C9Y)
The program Align was used to superpose various
human adenylate kinase structures over
Leishmania donovani Adenylate kinase model.
The LdAK model was used as a fixed co-ordinate
while other human AK models were used as
moving co-ordinate sets. In order to find the
maximum deviation in amino acids of different
AnnualREPORT 2014
Burkholderia pseudomallei, Adenylate kinase
from Bacillus globisporus which share 44% , 42% ,
45% , 47% , 42% sequence identity respectively
with L. donovani Adenylate kinase amino acid
sequence. The human homolog structure of
adenylate kinase (PDB ID: 2C9Y) was compared
with homology model of LDAK using chimera tool.
The RMSD value for the Human AK2A and LDAK
is 1.140 Aº. The comparison of these two
structures shows presence of 91 similar amino acid
residues within the different domains.
Figure 3.5.6 PCR amplification of L . donovani recombinant
glucokinase gene.
Figure 3.5.7 SDS-PAGE electrophoresis of L.donovani glucokinase.
Project 5 – Bioinformatics tools & database
resources
The department is a distributed information sub
centre (DISC) of DBT. Under this we have
developed and are maintaining the following
databases and bioinformatics tools.
A. Bioinformatics tools:
i) GluD: A program to find distance between
sugar in glycoproteins.
ii) Protanno: Automated HMM and Sequence
Homology Based Protein Annotation.
iii) ANN/SVM tool: Artificial intelligence based
tool for annotation of adhesins from tritryps.
iv) ALU finder: For annotation of Alu elements.
B. Database &resources:
i) Adhesin database: A comprehensive database
and knowledge point for adhesionclass of
proteins.
ii) Plant pathology database: Plant-Patho
Database is a database of important plants and
crops which contains expertly curated
biological information of plants and related
disease and pathogen along with certain
virulence factors and genes with their
molecular and biological aspects.
iii) Plant lectin database: A web based database &
classification of plant lectins based on protein
domains, fold, sugar specificity and domain
architecture along with its structural &
crystallization information.
domains within LdAK and other Human AK
structures. The graph of RMSD C-alpha values of
Human AK was ploted against amino acids of
LDAK model. There was no residues corresponds
to the Gly32, Met53, Gly56, Asp158. The
maximum deviation was seen in the NMP binding
domain and LID domain of LdAK homology
model.
Characterization of Leishmanial Kinases from
central carbon metabolism pathway:
Carbon metabolic pathways like glycolysis and
gluconeogenesis play crucial roles in the ATP
supply and synthesis of glycoconjugates like LPG,
important for the viability and virulence, of the
human-pathogenic stages of Leishmania spp. We
have identified a few kinases like glucokinase,
hexokinase and glycerokinase for fur ther
functional and structural characterization.
Glucokinase is an enzyme that facilitates
phosphorylation of glucose to glucose-6-
phosphate. Glucokinase has an important role in
regulation of glucose metabolism. L.donovani
glucokinase was cloned and purified by Nickel
affinity chromatography. (Fig.3.5.6 and 3.5.7)
AnnualREPORT 2014
3.6 Environmental Science
Principal Investigator:
Dr. Dhiraj Naik (Assistant Professor, Group head)
Research Fellows:
Dr. Usha Joshi (DBT project- Research Associate)
Mr. Harengiri Gosai (DST Project JRF)
Ms. Twinkle Solanki (DST Project JRF)
Ms. Shilpa Rajpurohit (DST project assistant-II)
Ms. Divya Patel (DBT Project JRF)
Mr. Haresh Panseriya (DBT Technical Assistant)
Mr. Jigar Thakar (DBT Field Assistant)
Ms. Priyanka Patel (DBT Field Assistant)
Project 1: Potential for Carbon Sequestration in
Grassland and Afforested Ecosystem using
Molecular and Eddy Covariance Techniques
Project Summary:
Productivity in semiarid grasslands is mainly
controlled by precipitation, which comes as
stochastic events varying in amount, intensity and
frequency. High seasonal and interannual
variability of precipitation could be enhanced by
future changes in climate, imposing new
challenges for ecologists to elucidate the role of
arid lands as carbon (C) sinks or C sources as well
as the mechanisms controlling C and water fluxes
at short and long temporal scales, in particular to
predict how these ecosystems will respond to future
scenarios of climate change. Also, high growth
yielding perennial grasses are currently considered
as an emerging biofuel and bioenergy plants.
Perennial grass bio-fuels may contribute to long-
term carbon sequestration in soils, thereby
providing a broad range of environmental
benefits. To quantify those benefits, the carbon
balance was investigated over two perennial grass
bio-fuel crops – Napier (Pennisetum glaucum×
Pennisetum purpureum), guinea (Panicum
maximum) and a mixture of native perennial
grasses (Cenchrus ciliaris, C. setigerus and
Chrysopogon fulvus) in Gandhinagar, Gujarat
during the establishment phase of the perennial
grasses (2013–2014). In this study, net ecosystem
carbon exchange (NEE) measurements were
carried out in a semiarid plantation grassland in
Gujara t wi th the goa l to e luc idate the
envi ronmenta l contro ls of NEE and i t s
components (gross ecosystem exchange, GEE,
and ecosystem respiration, Re), and their indirect
effect by ecosystem functional changes, to finally
quantify their effect on the annual C balance of this
grassland ecosystem. Photosynthetic photon flux
density and air temperature were the main drivers
of GEE and Re, respectively, at diel time scale, but
both of them were modulated seasonally by soil
water availability. Even though precipitation was
the main factor explaining interannual NEE
variability, differences in amount and frequency
between years modified the response of the
grassland to precipitation. This study shows some
advances in the knowledge of semiarid grasslands
functioning and its response to climate variability.
Establishment of the grassland ecosystem:
The study area is grassland established in the
campus area of Indian Institute of Advanced
Research, Gandhinagar. The site is located on the
bank of Sabarmati river at an elevation of 63.7
meter, at a ongitude 23˚8'57.8” N and latitude
72˚40'19.9” E. The site is characterized by sandy
loamy soil with a relative humidity (RH) 60 to 65%.
The topography of the site is flat terrain which is
very suitable for establishing the Eddy covariance
technique. Annual temperature variation of the site
is from 19 to 42 °C with average rainfall of 803.4
mm. Total area of the site is 350 m × 210 m which
is divided in 36 plots each with the dimension of
58m × 35m. Each plot is named as R1P1, R1P2
and so on. The site was previously having the
vegetation like small trees, shrubs, perennial
AnnualREPORT 2014
legumes and annual grasses. The site was
dominated by Prosopis julifera, Acacia nilotica and
Jatropha curcas and was used for grazing. These
plants were removed using excavators and manual
labors for establishing the grassland on the site.
The plants were removed completely in order to
introduce the grasses at the site (Figure 3.6.1).
Figure 3.6.1 showing the status of the study site after removal of
vegetation and before establishing the grassland.
All the plots were planted with variety of perennial
grasses (Figure 3.6.2). The grasses selected for
plantation are having high economical and
ecological importance. Plantation was carried out
step wise using pit's method. The method involves
digging pits of 60-120 cm in diameter, with a depth
of 30 -60 cm and a spacing of 75 -100 cm from one Figure 3.6. 2: Pit plantation method and Established grassland of
study area
AnnualREPORT 2014
pit to the next. Fertilizer was implemented into each
pit and mixed with the topsoil. The cut stem
cuttings were then buried 10 cm dip into the pit
which was then covered with soil (Figure 3.6.2).
The grasses used for establishing grassland are CO-
3 CO-4 (from Pondicherry), IGFRI-6 and IGFRI-10 ,
(from IGFRI, Jhansi) varieties of Pennisetum
purpureum (Napier grass), BG-1 and BG-2
varieties of Megathyrsus maximum (Guineagrass),
Cenchrus ciliaris (CC) (from Bundelkhand IGFRI,
Jhansi) and Chrysopogon fluvus. 7 plots were
planted with CO-3 6 plots were planted with CO-4, ,
6 plots were planted IGFRI-6 and 5 plots were
planted IGFRI-10 varieties of Napier grass. 4 plots
were planted with BG-1 and 4 plots were planted
with BG-2 varieties of Guinea grass. 2 plots were
planted with Cenchrus and 2 with Chyrsopogon
grass. Plantation was carried step wise on different
days. Table 3.6.1 shows the details of distribution
of various varieties of grasses in the sub-plots. Two
times urea fertilizer treatment was also given for
stimulating growth of grasses.
Table 3.6.1. Plantation design of study area
CO-3
R1P1
IGFRI-10
R2P1
BG-2
R3P1
BG-1
R4P1
CO-4
R5P1
IGFRI-6
R6P1
CO-4
R1P2
BG-1
R2P2
IGFRI-6
R3P2
IGFRI-10
R4P2
CO-3
R5P2
BG-2
R6P2
IGFRI-6
R1P3
CO-4
R2P3
CO-3
R3P3
BG-2
R4P3
BG-1
R5P3
CO-3
R6P3
IGFRI-10
R1P4
BG-2
R2P4
BG-1
R3P4
CO-4
R4P4
IGFRI-6
R5P4
CO 3
R6P4
CC
R1P5
IGFRI-6
R2P5
IGFRI-10
R3P5
CO-3
R4P5
CF
R5P5
CO-4
R6P5
CF
R1P6
CO-3
R2P6
CO-4
R3P6
IGFRI-6
R4P6
IGFRI-10
R5P6
CC
R6P6
Napier Hybrids: CO-3, CO-4, IGFRI-6, IGFRI-10; Guinea grass Varieties: BG-1BG-2;
Other: Chrysophogon fulvus (CF), Cenchrus ciliaris (CC)
Installation of Eddy Covariance System:
Eddy covariance (EC) system was successfully
installed on metal tower with adjustable height up
to 30 feet. Apart from the regular Eddy sensors
(CO /H O analyzers, 3D Sonic anemometer and 2 2
temperature and humidity sensors); sensors
required for energy budgeting and modeling
carbon and energy fluxes viz. photosynthetically
active radiation (PAR), pyranometer, net
radiometer, soil heat flux, soil temperature, soil
moisture sensors and digital rain gauge were also
installed. The data quality of all the sensors was
analyzed and optimization of the placement and
orientation of the sensors have been conducted.
EC measurements have been taken in the site
before the development of grassland to quantify
the sequential changes in C and energy fluxes with
the development and biomass increment of the
grassland. The EC raw data analysis was analyzed
by Eddy Pro software (LICOR, Licoln, USA). The
eddy covariance technique was used for
measuring the fluxes of CO and H O between the 2 2
ecosystem and the atmosphere using various
instruments. In this study, the instruments were
placed 2.5 m above the ground which are fixed on
the tower. Since the study area is grassland, the
measurements of fluxes are made near to the
ground surface which was performed at 10 Hz
(Wohlfahrt et al, 2012). The fetch area of the tower 2is 100m . Measurement of wind speed in the three
components (u; v; w) was performed by a CSAT3
three-dimensional sonic anemometer (Campbell
Scientific, Inc.), while CO and H O vapour air 2 2
densities were measured by a LI-7500 open-path
infrared gas analyzer (LI-COR, Inc.). Eddy fluxes
were obtained by computing the mean covariance
between vertical wind velocity and CO and H O 2 2
densities with a half-hour time step (Baldocchi
2003). Along with eddy covariance system,
various sensors are deployed for measuring the
var ious meteorological and radiometr ic
measurements. Air (T ) and soil (T ) temperature air soil
were measured respectively by a HMP45 (Vaisala
Inc.) and with temperature probes type therm107
AnnualREPORT 2014
(Campbell Scientific, Inc.) at different depths. Soil
water content (SWC) was assessed with soil water
reflectometers using model CS616 (Campbell
Scientific, Inc.). Soil heat flux was measured by
HFP01 plates (Hukseflux) which was also
measured at different depths. Net radiation was
measured using a NR Lite2 (Kipp and Zonen
Corp.) net-radiometer. Photosynthetically active
radiation (PAR) was assessed by a LI-190 (LI-
COR, Inc.). Digital tipping rain gauge was also
installed for measuring the precipitation. Data
obtained by these sensors was stored in SUTRON
data logger which was retrieved in the form of
biomet data. This data was father analyzed for
observing the diurnal and seasonal changes in the
energy fluxes.
Results:
The first objective of this study is to quantify the
growing season NEE of grassland ecosystems
using EC techniques. The second objective is to
test the hypothesis that semi arid ecosystem acts as
a carbon sink at night during growing season.
Figure 3.6.3: Figure showing relationship between Vapour Pressure
Deficit (VPD) and NEE
The grassland ecosystem was photosynthetically
active during all parts of the year and PPFD was
having control over NEE as can be observed by
strong positive correlation between NEE and
PPFD (Figure 3.6.4). This indicates that
assimilation of carbon is light dependent.
Day time NEE varied from -28.43 to 21.14 2
µmol/m /s during the study period (Figure 3.6.5). It
was observed that NEE showed more negative
values during the growing period, i.e. in monsoon.
No much variation in NEE values was observed
during the season or monsoon and summer as
evident from the figure. Night time NEE also
showed similar pattern of NEE and the values were
more negative during growing season of the study
period (Figure 3.6.6).
Figure 3.6.5: Figure showing day time variation in NEE during the
measurement period
AnnualREPORT 2014
Figure 3.6.4: Figure showing relationship between Photoactive
Photon Flux Density (PPFD) and NEE
Figure 3.6.6: Figure showing night time variation in NEE during the
measurement period
The main objective of this study was to find out
whether the given ecosystem is acting as a source
or sink of the carbon. If the cumulative NEE values
are negative that the given ecosystem is acting as a
sink where as positive values indicated that it is
acting as a soure of carbon. According to Figure
3.6.7 the plantation grassland is acting as sink of
the carbon during the entire study period. It is
evident that highest values are observed during the
months of monsoon indicating positive influence
of growing season on NEE.
Figure 3.6.7: Figure showing the variation in cumulative NEE during
the measurement period
The eddy-covariance technique provides a direct
measure of the energy exchange and various other
fluxes which can be diurnal to decadal in time
frame. This can be achieved by measuring Energy
Figure 3.6.8 Energy budget closure in different seasons
The results showed that EBC was highest during
the monsoon season while least for summer
season. There appears to be a moderate seasonal 2pattern in energy balance closure, with r values
varying from 0.918 to 0.993 being least in summer
season and highest in monsoon season (Figure
3.6.8). Poor energy balance closure (i.e., greater
underestimation of turbulent) in dry conditions has
been noted in a number of other studies. The
higher correlation in monsoon season is due to the
fact that soil moisture is a good conductor of heat
AnnualREPORT 2014
Balance closure (EBC). It also provides a very good
insight of Energy partitioning, particularly between
latent and sensible heat, and also determines the
water vapor and heat content of the atmosphere
(Dirmeyer, 1994; Seth and Giorgi, 1996). Besides,
for any EC measurement studies the degree of
EBC is very important aspect in order to check the
accuracy of the system (Barr, 2006). The degree of
EBC varies in different seasons due to various
atmospheric characteristics. Therefore, this study
has been conducted for a grassland ecosystem in
which seasonal effect of energy balance closure
was estimated.
Figure 3.6.9: Diurnal variation in Biomet-meterological variables of
eddy covariance system installed in plantation grassland
Photosynthetic photon flux density (PPFD) varied
substantially in various seasons (Figure 3.6.9).
PPFD were higher in the month of June i.e., in the
summer season of the year. The values gradually 2decreased to upto 225µmol/m /s in the month of
July, i.e. in the monsoon season. During winter
season it showed moderate values which again 2increased up to 548.13 µmol/m /s during the
month of April of 2014. Global radiation showed
the higher values during the Month of April of both
the years while it showed drastic decreased during
the monsoon season for which the cloudy
atmosphere was responsible (Figure 3.6.9).
which improves the energy partitioning of the
system.
At the site, considerable wind flows were from the
west where oasis croplands were distributed and
hence, EC measurement may be impacted.
Biomet data was analyzed for the period of almost
one year starting from March 2013 to April 2014.
Average of 5 minute was carried out in order to
analyze the diurnal variation in various
parameters. Whereas for observing the seasonal
variation weekly means of the variables were taken
into account.
Diurnal and seasonal variation in Energy flux
analysis and other biometerological data analysis:
Soil water content (SWC) of the study area was
measured at three different depths. It was observed
that the SWC varied with different depth of the soil.
Soil water content varied drastically in various time
of the year (Figure 3.6.9). SWC was higher at lower
depths of the soil while it decreased with increased
depth. It was lower in winter season and summer
season due to dry atmosphere during this time,
while it showed higher values in rainy season due
to precipitation at that time. It was also measured at
three depths of soil. However, it showed almost
similar values for all the three depths. It showed
profound seasonal variation with the highest
values of the soil temperature were observed
during the month of April of both the years being
around 36 ºC, whereas the lower values were
observed during the month of January 2014 which
is winter season of the year (Figure 3.6.10).
As it is evident from the Figure 3.6.9 the air
temperature (Ta) showed substantial variation
during various season. Ta was higher during the
summer season and lower during the winter
season. The lowest values were observed in the
month of January of year 2014. Relative humidity
was highest during the monsoon season due to
atmospheric condition. However, it decreased
during the dry season of the year i.e. winter and
summer. Precipitation was observed during the
season of monsoon i.e. from months July to
September. There was a very less value of net
radiation during the month of March which was
then almost constant for entire study period (Figure
3.6.10). All Biomet variables showed significant
AnnualREPORT 2014
Figure 3.6.10: Seasonal variation in Biomet-meteorological variables
of eddy covariance system installed in plantation grassland
seasonal variation.
Soil water content showed great variation all three
depths of the soil. SWC at higher depth from the
soil showed maximum variation wherein it
achieved pick at around 18.00 hr of the day,
whereas no much variation was observed in SWC
at lower depths of the soil (Figure 3.6.9). PPFD, Rg
and Rn was showing maximum values at midday.
It started increasing at 4.00 hr in the morning and
decreased at 17.00 hr of the day. Highest RH was
observed at night at around 03.00 hr (Figure
3.6.5). It was least at 12.00 hr of the day due to
high temperature. It started decreasing at around
04.00 hr of the morning and started increasing at
around 14.00 hr in the afternoon (Figure 3.6.5). It
AnnualREPORT 2014
was observed that precipitation was evenly
distributed during whole diurnal cycle being
highest during night hours at around 23.00 hrs
(Figure 3.6.5).
In this study, net ecosystem carbon exchange
(NEE) measurements were carried out in a
semiarid plantation grassland in Gujarat with the
goal to elucidate the environmental controls of
NEE and its components (gross ecosystem
exchange, GEE, and ecosystem respiration, Re),
and their indirect effect by ecosystem functional
changes, to finally quantify their effect on the
annual C balance of this grassland ecosystem.
Photosynthetic photon flux density and air
temperature were the main drivers of GEE and Re,
respectively, at diel time scale, but both of them
were modulated seasonally by soil water
availability. Even though precipitation was the
main factor explaining interannual NEE variability,
differences in amount and frequency between
years modified the response of the grassland to
precipitation. This study shows some advances in
the knowledge of semiarid grasslands functioning
and its response to climate variability.
Project 2: Carbon Sequestration Potential of
Albizzia lebbeck in intercropping and co-
cultivation with economic crops and plant growth
promoting microorganism
Source of funding- DST, New Delhi
Project Summary:
· Biomass allocation studies have shown that
the native agroforestry tree species such as
Azadirachta indica, Albizzia lebbeck and
Ailanthus excelsa has higher potential of
carbon storage capacity as compared to
other species. Age- and size-dependent
responses on biomass allocation were
observed. The older plantation showed
higher carbon storage capacity as
compared to younger one.
· The diurnal measurement of soil respiration
under different vegetation sites showed
clear diurnal patterns. Highest respiration
rates were observed under direct sunlight
followed by shade and lowest in drier area
as compared to wet areas of vegetation.
· Eddy covariance measurement of CO and 2
energy fluxes showed that the plantation
forest sites is very sensitive to changes in
environmental parameters, of which
precipitation pattern has the largest
influence on the next CO fluxes of the 2
vegetation. The preliminary data show the
tree vegetation is carbon sink during the dry
season.
· Ni t rogen fe r t i l i za t ion s tud ies and
nonstructural carbon allocations will be
carried out in coming season which will
help us in understanding the role of mobile
carbon reserves in tree carbon capacity.
3.7 Medicinal Chemistry
Principal Investigators:
Dr. Satyendra Mishra- Assistant Professor
Dr. Roli Mishra- Asssiatnt Professor (Part time)
3.7.1 Description of research work
The Department of Chemistry was established this
year. The department offers a vibrant atmosphere
to students and faculty to nurture the spirit of
scientific inquiry and to pursue cutting-edge
research in a highly encouraging environment. The
research focus of this newly established
department will be on new synthetic methodology,
Ionic liquid and its applications, synthesis of
bioactive small molecules, drug designing,
supramolecular, peptide and peptidomimetics,
AnnualREPORT 2014
nano chemistry, oligonucleotides chemistry and
computational chemistry. The department has
sophisticated instruments like, rotary evaporator,
HPLC and GC. A more specialized laboratory for
studies in chemistry is in the process of
development.
Two faculty members have joined the department
and their research interests are given below.
Dr. Satyendra Mishra
The group will be focussing on the development of
new methods and strategies in organic synthesis,
natural products synthesis, synthesis of small
bioactive molecule and its analogs, therapeutic
development for cancer and neurodegenerative
disorders, peptidomimetics,bio-organic /medicinal
chemistry.
Another thrust area of interest is synthesis of
natural occurring bio-active molecule and its
analogs to improve their potency. Specifically,
emphasis is on improving their aqueous solubility,
bioavaibility and stability.
Dr. Roli Mishra
B r o a d re s e a r c h i n t e re s t s a re p e p t i d e
&glycopeptides chemistry; supramolecular
chemistry and dendrimers chemistry, synthesis of
peptide based chiral ionic liquids and their physio-
chemical properties, synthesis of modified
oligonucleotides and its biophysical and biological
applications, synthesis of bioconjugate of bioactive
molecules for therapeutic uses viz. anticancer
agents, antibacterial agents.
Our main aim is to develop a peptide chiral ionic
liquid (PCILs) and its application in various
organic synthesis as alternative media and/or
catalyst and to improve the stability of drug and
peptides.
4. LIST OF PUBLICATIONS
The research finding were published in international peer reviewed indexed journals. The list of
publication placed below.
4.1 Research publications:-
1. Pooja Patel and Rajani Nadgauda. Development of Simple, Cost Effective Protocol for
Micropropagation of Tylophora indica (Burm f.) Merill., an Important Medicinal Plant. European
Journal of Medicinal Plant; 4(11): 1356-1366, 2014.
2. Neeraj Jain, Ganesh B. Patil, Poonam Bhargava, Rajani S. Nadgauda. In Silico Mining of EST-
SSRs in Jatropha curcas L. towards Assessing Genetic Polymorphism and Marker Development
for Selection of High Oil Yielding Clones. American Journal of Plant Sciences; 5: 1521-1541,
2014.
3. Santosh Kumar, Rajani Nadgauda (2014). Control of Morphological Aberrations in Somatic
Embryogenesis of Commiphora wightii (Arnott) Bhandari (Family: Burseraceaea) Through
Secondary Somatic Embryogenesis. Proc. Natl. Acad. Sci., India, Sect. B Biol. Sci., 1-10,
doi:10.1007/s40011-014-0347-2.
4. Shukla AK, Pargya P, Singh HC, Tiwari AK, Patel D K, Abdin MZ and Chowdhuri DK. Heat shock
protein-70 (HSP70) suppresses paraquat-induced neurodegeneration by inhibiting JNK and
Caspase-3 activation in Drosophila model of Parkinson’s disease. Plos One, 9(6): 1-6, 2014.
5. Chandramani Pathak, Rajiv Ranjan Singh, Saurabh Yadav, Neha Kapoor, Varshiesh Raina,
Sarika Gupta, Avadhesha Surolia (2014) Evaluation of Benzothiophenecarboxamides as
analgesics and anti-inflammatory agents. IUBMB Life, 66 (3):201-211.
4.2 Book Chapters:-
· Ashima Bhardwaj*, Kittappa Vinothkumar, Neha Rajpara, Priyabrata Mohanty and Kutar
BMRNS (2014) Therapeutic Limitations due to Antibiotic Drug Resistance: Road to Alternate
Therapies. Frontiers in Anti-Infective Drug DiscoveryBentham Science Publishers.
4.3 Presentations:-
4.3.1 Invited Lectures:
· Dr. Ashima Bhardwaj. Molecular mechanisms of multidrug resistance in Vibrio spp.: Glimpses of
work at IIAR. Invited lecture at Orientation programme for fresh M. Sc students (Microbiology, nd
Biochemistry and Biotechnology), Institute of Science, Nirma University, Ahmedabad. 2 July,
2014.
· Dr. Ashima Bhardwaj. Never ending battle between microbes and mankind: Our wits versus their thgenes. Invited lecture for 29 Refresher Course: Biosciences and Bio-Engineering at UGC-
thAcademic Staff College, Vallbh Vidyanagar, Anand. 11 June, 2014.
· Dr. Ashima Bhardwaj. Invincible multidrug resistant bugs: our experience with vibrios. Invited th
lecture for 29 Refresher Course: Biosciences and Bio-Engineering at UGC-Academic Staff th
College, Vallabh Vidyanagar, Anand. 11 June, 2014.
· Dr. Ashima Bhardwaj*, Panel member in brain storming session on “Antibiotic resistance
AnnualREPORT 2014
AnnualREPORT 2014
mechanisms” on International conference on Host- Pathogen Interaction, Hyderabad. 12-15
July, 2014.
· Dr. Anand K. Tiwari. Basic and advancement in Microscopy during workshop on “Cell & th th
Molecular Biology” at Central University of Tripura from 20 -26 March, 2014.
· Dr. Anand K. Tiwari. Drosophila as a model organism for Genetics & Developmental Biology
studies at M.H. Degree College, Jaunpur, Uttar Pradesh, 2014.
· Dr. Anju Pappachan. Minute marvels of molecular architecture- a case study on Sesbania Mosaic
Virus. In UGC sponsored one day seminar on condensed matter physics (CMP-2014) and short rd thterm training school on x-ray diffraction techniques (3 to 8 March, 2014) A part of the
celebration of International Year of Crystallography
4.3.2 Oral presentations
· Divyesh Patel, Dipeeka Mandaliya, Omkar Naik and Reena Agrawal-Rajput. Syk Inhibition In
Fine Tuning The Cytokine Orchestra During Antifungal Immunity. Immunocon 2014, MKU,
Madurai, 2014.
· Nupur Shah and Anju Pappachan. “Cloning, Expression, Modelling and Crystallization Trials of
Adenylate Kinase from Leishmania donovani.” National seminar on Crystallography and national
workshop on CADD, Department of Physics Sardar Patel university, Vallabh Vidyanagar,
September 1-3,2014.
. Uttekar B. & Tiwari AK. Revealing the role of Molecular Chaperone and Ubiquitin Proteasome
System in Alzheimer's Disease using Drosophila melanogaster as a model organism” organized by
Burdaman University, Kolkatta, November 21-23, 2014.
4.3.3 Poster Presentations
· Ashima Bhardwaj*, Neha Rajpara, Priyabrata Mohanty, Kutar BMRNS, Kittappa Vinothkumar
and Aneri Shah. Invincible Microbes and their Antibiotic resistance Mechanisms: Out wits versus
their Genes; International conference on Host- Pathogen Interaction, Hyderabad, 12-15 July,
2014.
· Divyesh Patel, Dipeeka Mandaliya, Manthan Patel and Reena Agrawal Rajput.
(2014).Cytoplasmic Signaling Inhibition in Dendritic Cells Fine Tune T-Cells Outcome during
Antifungal Immunity. Emerging trends in Biochemistry, MSU, Baroda.
· Manthan Patel, Divyesh Patel, Dipeeka Mandaliya, and Reena Agrawal-Rajput. (2014).
Berberine Inhibits Cancer Cell Stemness and Induces Neuronal Differentiation. Emerging trends
in Biochemistry, MSU, Baroda.
· Gaikwad S. and Rajput RA. (2014). TLR4 Antagonism Attenuates Neuroinflammation and
Prevents Microglial Neurotoxicity via Inhibition of NF-kB and JNK/p38 MAPK Pathways in LPS
Activated BV-2 Microglia”. International Conference on Current Perspectives in Drug Discovery,
Development and Therapy, at Ramanbhai Patel College of Pharmacy, Changa, Anand.
· Sagar Gaikwad and Reena Agrawal Rajput. (2014). TLR4 Inhibition Confers Neuroprotection
During LPS and Amyloid Induced Neuroinflammation and Neurotoxicity. Immunocon 2014,
MKU, Madurai
· RadheyShyam Kaushal “Cloning and Expression of a Unique Protein having C-type Lectin
Domain from Leishmaniadonovani” International Conference on Host-Pathogen Interactions
(ICHPI), National Institute of Animal Biotechnology (NIAB), Hyderabad, India, 12-15 July, 2014.
AnnualREPORT 2014
· Manoj Kumar “Understanding the Role of Proteophosphoglycan 3 (PPG3) in Leishmania
donovani During Host-pathogen Interaction Through Structural Characterization” International
Conference on Host-Pathogen Interactions (ICHPI), National Institute of Animal Biotechnology
(NIAB), Hyderabad, India, 12-15 July, 2014.
· Patel D, Pappachan A, Singh D.D. Expression, Purification and Structural Characterization of
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from Lactobacillus acidophilus;
International Symposium-cum-Workshop Frontiers of Structural Biology new advances in x-ray
diffraction and cryo - electron microscopy, INSA, Regional Center for Biotechnology, New Delhi.
December 15 - 17, 2014.
· Shah K, Pappachan A, Singh D.D. Cloning, Purification and Characterization of β Glucosidase
Aggregating factor (BGAF) from Sorghum bicolor ; International Symposium-cum-Workshop
Frontiers of Structural Biology New advances in x-ray diffraction and cryo-electron microscopy,
INSA, Regional Center for Biotechnology, New Delhi. December 15 - 17, 2014.
· Patel B, Patel D,Singh D.D.,Pappachan A. Bioinformatic and Biophysical Characterization of
Xanthine phosphoribosyltransferase (XPRT)-a Potential Drug Target from Leishmania donovani;
International Symposium-cum-Workshop Frontiers of Structural Biology new advances in x-ray
diffraction and cryo-electron microscopy, INSA, Regional Center for Biotechnology, New Delhi.
December 15 - 17, 2014.
· Foram Vaidya, Rakesh Sharma and Chandramani Pathak (2014). Anticancer Activity of
Curcumin Encapsulated Pluronic Block Co-polymer. National Conference on Herbal Drug
Research: Opportunities and Challenges. 5-7 November, B.V. Patel Education Trust and B.V. Patel
PERD Centre, Ahmedabad, Gujarat, India.
· Chandramani Pathak and Kishu Ranjan (2014). Pivotal Role of FADD in the Regulation of Anti-
apoptotic Regulators cFLIP and NF-kB to Promote Apoptosis. XXXVIII All India Cell Biology
Conference & International Symposium on Cellular Response to Drugs, Dec.10-12, 2014, CDRI,
Lucknow.
· Kavita Shirsath, Bhargav Waghela, Anupama Sharma and Chandramani Pathak (2014). A Novel
Drug Delivery System: PAMAM Dendrimer- Gallic Acid Conjugate Substantiates Enhanced th
Apoptotic Effect and Sustained Release in Cancer Cells. 5 International Conference on Stem
Cells and Cancer (ICSCC-2014): Proliferation, Differentiation and Apoptosis. 8-10 Nov, JNU,
New Delhi, India.
· Kishu Ranjan, Shubita Tripathi, Chandramani Pathak (2014). A Novel Function of Fas Associated
Death Domain in Non-inflammatory Activation of IL1β and IL-18. International Conference on
Host Pathogen Interactions, July 12-15, NIAB Hyderabad.
· Anupama Sharma, Bhargav N. Waghela and Chandramani Pathak (2014). Evaluation of in vitro
Cytotoxicity and Apoptotic Cell Death by Surface Modified Dendrimers in human lung carcinoma
cells. International conference on Chemical Biology, CSIR-IICT, Hyderabad.
5. AWARDS
· Best Poster Award. Foram Vaidya, Rakesh Sharma and Chandramani Pathak (2014). Anticancer
Activity of Curcumin Encapsulated Pluronic Block Co-polymer. National Conference on Herbal
Drug Research: Opportunities and Challenges. 5-7 November, B.V. Patel Education Trust and
B.V. Patel PERD Centre, Ahmedabad, Gujarat, India.
AnnualREPORT 2014
6. HUMAN RESOURCE DEVELOPMENT
6.1 Academic Activities
The following programs were initiated at UIAR during the academic year 2014-15.
6.1. 1Undergraduate program
Undergraduate programs offering the following degrees were offered by the University
· B.Sc. Biotechnology· B.Sc. Physics· B.Sc. Chemistry· B.Sc. Computer Sciences
There were 42 students enrolled for B.Sc. Biotechnology, 17 students for B.Sc. Physics, 31 students for B.Sc. Chemistry and 07 students for B.Sc. Computer Sciences. Choice based credit system is followed at UIAR where students have the freedom to choose various subjects according to their interest. Elective subjects like social sciences, law, economics, money banking and finance and commerce were also offered for the students.
6.1.2 Postgraduate program
The University will be initiating courses for M.Sc. Biotechnology and M.Sc. Life sciences from the next academic year.
6.1.3 PhD program
The University PhD program has been initiated. Currently 7 students are registered with Pune University and 4 students are registered with MS University, Baroda for PhD. Many of the students have received independent funding from agencies like CSIR, ICMR etc.
6.2 External funded research fellowships
Sr.No. Name of Student Project Investigator Funding
agency
Position
1 Mr. Priyabrat Mohanti Dr. Ashima Bhardwaj
ICMR SRF
2 Mr. Kishu Ranjan Dr. Chandramani Pathak
ICMR SRF
3 Mr.Manoj Kumar Dr. Desh Deepak Singh
ICMR SRF
4 Ms. Kshama Jain Dr. Reena Rajput CSIR JRF 5 Mr. Braj Mohan Dr. Ashima
Bhardwaj
CSIR SRF
6 Mr. RadheyShyam Kaushal
Dr. Desh Deepak Singh
CSIR SRF
AnnualREPORT 2014
8 Mr.Bhargav Waghela Dr. Chandramani
Pathak DST INSPIRE
JRF
9 Ms. Komal Panchal Dr. Anand Tiwari DST INSPIRE
JRF
10 Ms.Neha Rajpara Dr. Ashima Bhardwaj
ICMR SRF
11 Dr. Debashree Sengupta Dr. Dhiraj Naik DBT RA
12 Mr.Vinothkumar Kittappa
Dr. Ashima Bhardwaj
ICMR SRF
7 Ms. Anupama Sharma Dr. Chandramani
PathakCSIR SRF
6.3 Trainee:a. Florika Patel, Jalpa Patel (Sardar Patel University, Anand) and Forum Vaidya (Veer Narmad
South Gujrat University) pursued their dissertation training with Dr. Chandramani Pathak, Department of Cell Biology
b. Kesha Patel (Sardar Patel University, Anand) and Jery Joy (IISER, Trivendrum) did their dissertation training with Dr. Anand Tiwari, Department of Developmental Biology.
6.4 Training programsa. A students training program on Genetics and Developmental Biology was conducted by the
th thDepartment of Developmental Biology from 13 January to 17 January, 2014.b. A teachers training program on Genetics, Cell and Developmental Biology, funded by Cell
nd thBiology Society, India, was organized by the Department of Developmental Biology from 2 to 6 June, 2014.
c. A hand on training program on Bioinformatics “Docking and Molecular Dynamics” was th th
organized by the Department of Bioinformatics and Structural Biology from 12 to 14 November, 2014.
AnnualREPORT 2014
7. FINANCIALS7.1 Income and Expenditure Statement
st stThe income and expense for the financial year 2013-14 (1 April, 2013 to 31 March, 2014) is placed
below:
Particulars Amount(In Rs) Particulars Amount (In Rs.)
INDIRECT EXPENSES INDIRECT INCOMES
Administrative Exp. 4,39,938.00 Education Income 8,08,580.00
Canteen 2,72,760.00 Hostel Income 2,82,196.00
Conference and Meeting
2,49,545.00 Grant for Research Staff Salary
34,91,120.00
Depreciation 1,80,803.00 Interest from Bank 3,767.00
Electricity Expense 27,71,219.00 Misc. Income 40.00
Office Expense 2,01,914.00
45,85,703.00Total
Repair and Maintenance
12,33,386.00
Salary From Grant 34,91,120.00
Salary & Wages 97,79,274.00
Travelling Exp. 7,43,125.00
Advertisement Exp. 5,82,041.00
Bank Charges 1,260.00
Building Rent Expense
12,00,000.00
Consultation Fees Exp.
1,04,150.00
Lab Expense-Institute
2,02,839.00
Misc. Expense 1,425.00
Postage & Courier 28,607.00
Staff Welfare Expense
53,744.00
Stationary and Printing
46,647.00
Telephone and Internet Exp.
5,17,664.00
Excess of expenditure over income
1,75,15,758.00
Total
2,21,01,461.00
Total
2,21,01,461.00
AnnualREPORT 2014
Balance sheet 1-Apr-2013 to 31-Mar-2014
Capital account University Corpus Grant 1,69,94,983.00
1,69,94,983.00
Fixed assets : Lab infrastructure Software
92,947.00
1,09,600.00
2,02,547.00
Loans (Liability)
Current liabilities
Puri Foundation For Education In India
12,22,570.00
12,22,570.00
Current assets: Loan &Advances (Asset) Cash-in-hand Bank accounts
4,01,339.00
254.00
97,595.00
4,99,248.00
Excess of Expenditure over income: Opening Balance Current Period
1,75,15,758.00
1,75,15,758.00
Total
Total 1,82,17,553.00 1,82,17,553.00
Liabilities
Assets
Amount (In Rs.)
Amount (In Rs.)
AnnualREPORT 2014
No
1
Dectins and inflammasomes in Aspergillus fumigatus specific immune response DBT Govt. of India Dr.Reena Rajput 2820000
2
Potential for carbon sequestration in grassland afforested ecosystem using molecular and Eddy covariance techniques
DBT Govt. of India
Dr.Dhiraj Naik
7236400
3
Carbon sequestration of Albizzia lebbeck and plant groth promoting microorganism DST Govt. of India Dr.Dhiraj Naik 3423400
4
Unraveling the mechanism underlying quinolone resistance in multi drug resistant clinical isolates of Vibrio and Shigella species from India
GSBTM
Dr.Ashima Bhardwaj
1999980
5
6
Study of multidrug resistance in clinical isolates of Shigella Spp.
ICMR Govt. of India
Dr.Ashima Bhardwaj
2694126
Targeting the mitochondria dependent and independent apoptotic signaling by nano particulate drug conjugate to induce apoptosis in cancer cells
DBT Govt. of India
Dr.Chandramani Pathak
4927316
7
Program support for School of Biological Sciences and Biotechnology DBT Govt. of India Dr.R Nadgauda 46099000
8
Unraveling the cross talk between inflammation and apoptosis focusing to regulation of inflammatory mediators and apoptosis in cancer
DBT Govt. of India
Dr.Chandramani Pathak
2536000
9
Establishment of distributed information sub center (DISC) at Indian Institute of Advanced Research Gandhinagar DBT Govt. of India Dr.Desh Deepak Singh 5145800
Title of ProjectSr.No.
Sponsoring agency Project Leader Amount in Rs.
AnnualREPORT 2014 7.2 Research grants:
The scientists have written independent research grants and have been awarded the following projects. Some of these projects have been successfully completed during the year.
AnnualREPORT 2014
10 Investigating the functional relationship of RAGE
SERB,DBT Govt. of India
Dr.Chandramani Pathak
2030000
11 Effect of antibodies on ROS gen
Dr.Rochika Singh
2464000
12 GSBTM financial assistance programme GSBTM Dr.Neeraj Jain 1915800
13 FADD protein in cancer cells
ICMR Govt. of India
Dr.Chandramani Pathak
785930
14
Structural and functional characterization of unique pathway proteins from Leishmania donovani
Science and Engineering Research Board, Govt. of India Dr.Anju Pappachan 2400000
15
Neuroprotective effects of Toll like receptor 4 antagonists and signaling inhibitors in LPS induced neuronal insults
DBT Govt. of India
Dr.Reena Rajput
2520000
16 Reprogramming of immune cell to neuron GSBTM Dr.Reena Rajput 1999480
17 Role of heat shock protein during eye development in Drosophila
Science and
Engineering Research Board, Govt. of India
Dr.Anand Krishna Tiwari
1645000
18
To study the role of ubiquitin proteosome system and molecular chaperon 70 in the progression of Alzheimer’s disease using Drosophila melanogaster as a model
DST Govt. of India
Dr.Anand Krishna Tiwari
698480
19 Cloning and structural studies of kinases from Leishmania donovani DBT Govt. of India Dr.Anju Pappachan 1580000
20 Studies on purine salvage pathway from L. donovani
DBT Govt. of India
Dr.Anju Pappachan
2192800
21 Teachers Training Programme 2014
-15
Dr.Anand Krishna Tiwari
35000
22 TLR5 Mediated T Regulation in Cholara DBT Govt. of India Dr.Reena Rajput 2535000
23
Travel Grant CICS-INSA Dr.Anju Pappachan 20000
Total
9,97,03,512