fig.1.8
DESCRIPTION
DNA STRUCTURE. DOUBLE HELIX. 3’. 5’. 5’. 3’. Antiparallel DNA strands. Hydrogen bonds between bases. Fig.1.8. HOW TO DEFINE A GENE? (there are many descriptions...). - sequence of DNA essential for specific function - codes for protein. or structural RNA. ATG. TAA. DNA. 3’. 5’. - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/1.jpg)
Fig.1.8
DNA STRUCTURE
5’ 3’
Antiparallel DNA strands
Hydrogen bonds between bases
DOUBLE HELIX
5’3’
![Page 2: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/2.jpg)
- sequence of DNA essential for specific function- codes for protein or structural RNA
UTRs - untranslated regions which flank the coding sequence in a mRNA
(so in transcribed region)
“structural” gene
ATG TAA5’
3’
3’
5’
Gene + flanking regulatory sequences
5’ 3’
DNA
RNAAUG UAA
Where is transcription initiation site?
Transcription & RNA processing
Where is translation initiation site?
promoter?
HOW TO DEFINE A GENE? (there are many descriptions...)
![Page 3: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/3.jpg)
5’
3’3’
5’
Intron - non-coding sequences removed from pre-RNA (by splicing)
Exon - sequences that remain in mature RNA (mostly coding)
Eukaryotic (but not prokaryotic) genes usually contain introns
ATG TAA
mRNA
“Exon 1” Exon 2
Intron 1 Intron 2
“Exon 3”DNA
5’ 3’
5’ UTR 3’ UTRcoding region
Exon 1 Exon 2 Exon 3
Nomenclature “problem”: • Textbooks (& papers) often show only coding sequences as exons, but first exon includes 5’UTR and last exon includes 3’UTR
• Dilemma because often the positions of RNA ends are not known or tissue-specific differences
• Introns can also occur within UTR regions
![Page 4: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/4.jpg)
Mercer Nat Rev Genet 10: 155, 2009
Example of human pax6 gene
Lines: intronsBars: exons
Where would the initiation and stop codons be?
What does the bent arrow signify? Tall bars: coding exonsShort bars: non-coding exons
![Page 5: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/5.jpg)
1. Human genes:
Intron length: typically ~200 nt to > 10 kb
Number per gene: several to dozens…
Tennyson, Klamut & Worton (1995) “The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced” Nat Genet.9:184-90
Extreme example:
< 5% have introns- mostly in tRNA genes (intron length ~ 20-30 nt)
(vs. mammals where >95% genes have introns)
dystrophin gene (~2400 kb) with ~78 introns!!
Exon length: typically 100 - 200 nt
3. Yeast genes:
…and in ribosomal protein genes (intron length ~ 100-500 nt)
Genes-within-genes!
Other genes are sometimes located within long introns! … in same or opposite orientation (see Practice set #1, question 4)
2. Plant genes:
Intron density similar to animals, but shorter length: typically 100 - 300 nt
![Page 6: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/6.jpg)
Golovnina et al. BMC Evol Biol 2005
Structure of NF2 (neurofibromatosis type II) gene in various animals
What features of this gene are different among these animals?
![Page 7: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/7.jpg)
5’ …gatcgctctataggaggtgc ATGCAATGG…3’5’…ATAGGACAT
3’…TATCCTGTA ctagcgagatatcctccacg TACGTTACC…5’
What are N-terminal sequences of proteins encoded by genes 1 and 2?
But neighbouring operons might be in opposite orientation in genome
Gene 2Gene 1
Gene A Gene B Gene C- polycistronic mRNA, but each gene has its own start and stop codons
Aside: My examples will often show unrealistically short sequences
See also Practice question #2
Bacterial genes are often organized in operons with short intergenic spacers
![Page 8: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/8.jpg)
Adachi & Lieber Cell 109: 807, 2002
bidirectional promoter ?
Presence of genes located close together but encoded on opposite strands is sometimes also seen in eukaryotic genomes
Where would promoter(s) for genes 1 and 2 be located?
Gene 2
Gene 1
![Page 9: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/9.jpg)
RNA structure
Alberts Fig.6.4
RNA synthesized in 5’ to 3’ directionwith antiparallel DNA strand as template
5’
3’
Fig.1.11
Features of RNA vs. DNA
RNA synthesis
Template strand
5’ 3’ “Coding strand”
mRNA has same sequence as coding strand (except U instead of T)
![Page 10: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/10.jpg)
Fig.1.12
RNA content of a cell
snRNAs (small nuclear) - role in splicing
snoRNA (small nucleolar) - role in methylation of rRNAs
miRNA (microRNAs) & siRNA (short interfering RNAs) - role in regulation of expression of individual genes
small regulatory RNAssmall non-coding (nc) regulatory RNAs are
also present in bacteria sRNAs
![Page 11: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/11.jpg)
Fig.1.13
RNA processing in eukaryotes
- presence of long introns (& short exons) can make finding genes in eukaryotic DNA sequences difficult
- may be alternative splicing pathways so more than one protein generated from one gene (Discussed later, Chapter 6)
![Page 12: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/12.jpg)
- can deduce amino acid sequence of protein from nt coding sequence
… using genetic code table
“standard code”
Link between transcriptome & proteome
Genetic codeMediated by tRNAs(codon-anticodon)
Fig.1.20Fig.1.2 See Practice question #1
![Page 13: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/13.jpg)
- in research papers DNA usually shown as single-stranded with coding strand in 5’ to 3’ orientation (left to right)
PROTEIN-CODING GENES
5’ …. AUG GGA UUG CCC GCC …. 3’
3’ .… TAC CCT AAC GGG CGG …. 5’
5’ …. ATG GGA TTG CCC GCC …. 3’ “coding strand”DNA
“template strand”
mRNA
… so genetic code table can be used directly
divided into triplets (codons)
![Page 14: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/14.jpg)
Alberts Fig. 6-50
Amino acid one-letter abbreviation often used instead of 3-letters
Translationterminationcodons
Initiationcodon
Remember that although AUG is the standard initiation codon, there can also be AUG triplets within an ORF,
… specifying internal Met residues in the protein
And when analyzing DNA data obtained in the lab, initiation codon might be located outside the sequenced region
![Page 15: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/15.jpg)
Examples of deviation from the standard genetic code in mitochondria and microbes
Table 1.3
![Page 16: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/16.jpg)
PROTEIN SEQUENCE & STRUCTURE
Different proteins can be generated from single precursor polypeptide
Fig.13.24
through post-translational events
…so can have larger proteome (set of proteins) than predicted fromnumber of genes in genome
Fig.1.17
![Page 17: Fig.1.8](https://reader035.vdocuments.mx/reader035/viewer/2022062409/568148bb550346895db5d70d/html5/thumbnails/17.jpg)
Latin word “cis” means "on the same side as”
5’ 3’
Trans-acting factor: protein (or RNA) that binds to cis-element to control gene expression
Cis-acting element: DNA (or RNA) sequences near a gene, that are important for its expression
3’ 5’
ATG TAA
Cis-elements can actually be quite far away from genes they control in intergenic spacers (ENCODE project) and within introns
DNA