Upload File

fig.1.8

17
Fig.1.8 DNA STRUCTURE 5’ 3’ Antiparallel DNA strands Hydrogen bonds between bases DOUBLE HELIX 5’ 3’

Upload: roger

Post on 14-Jan-2016

24 views

Category:

Documents


0 download

Report

Tags:

DESCRIPTION

DNA STRUCTURE. DOUBLE HELIX. 3’. 5’. 5’. 3’. Antiparallel DNA strands. Hydrogen bonds between bases. Fig.1.8. HOW TO DEFINE A GENE? (there are many descriptions...). - sequence of DNA essential for specific function - codes for protein. or structural RNA. ATG. TAA. DNA. 3’. 5’. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Fig.1.8

Fig.1.8

DNA STRUCTURE

5’ 3’

Antiparallel DNA strands

Hydrogen bonds between bases

DOUBLE HELIX

5’3’

Page 2: Fig.1.8

- sequence of DNA essential for specific function- codes for protein or structural RNA

UTRs - untranslated regions which flank the coding sequence in a mRNA

(so in transcribed region)

“structural” gene

ATG TAA5’

3’

3’

5’

Gene + flanking regulatory sequences

5’ 3’

DNA

RNAAUG UAA

Where is transcription initiation site?

Transcription & RNA processing

Where is translation initiation site?

promoter?

HOW TO DEFINE A GENE? (there are many descriptions...)

Page 3: Fig.1.8

5’

3’3’

5’

Intron - non-coding sequences removed from pre-RNA (by splicing)

Exon - sequences that remain in mature RNA (mostly coding)

Eukaryotic (but not prokaryotic) genes usually contain introns

ATG TAA

mRNA

“Exon 1” Exon 2

Intron 1 Intron 2

“Exon 3”DNA

5’ 3’

5’ UTR 3’ UTRcoding region

Exon 1 Exon 2 Exon 3

Nomenclature “problem”: • Textbooks (& papers) often show only coding sequences as exons, but first exon includes 5’UTR and last exon includes 3’UTR

• Dilemma because often the positions of RNA ends are not known or tissue-specific differences

• Introns can also occur within UTR regions

Page 4: Fig.1.8

Mercer Nat Rev Genet 10: 155, 2009

Example of human pax6 gene

Lines: intronsBars: exons

Where would the initiation and stop codons be?

What does the bent arrow signify? Tall bars: coding exonsShort bars: non-coding exons

Page 5: Fig.1.8

1. Human genes:

Intron length: typically ~200 nt to > 10 kb

Number per gene: several to dozens…

Tennyson, Klamut & Worton (1995) “The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced” Nat Genet.9:184-90

Extreme example:

< 5% have introns- mostly in tRNA genes (intron length ~ 20-30 nt)

(vs. mammals where >95% genes have introns)

dystrophin gene (~2400 kb) with ~78 introns!!

Exon length: typically 100 - 200 nt

3. Yeast genes:

…and in ribosomal protein genes (intron length ~ 100-500 nt)

Genes-within-genes!

Other genes are sometimes located within long introns! … in same or opposite orientation (see Practice set #1, question 4)

2. Plant genes:

Intron density similar to animals, but shorter length: typically 100 - 300 nt

Page 6: Fig.1.8

Golovnina et al. BMC Evol Biol 2005

Structure of NF2 (neurofibromatosis type II) gene in various animals

What features of this gene are different among these animals?

Page 7: Fig.1.8

5’ …gatcgctctataggaggtgc ATGCAATGG…3’5’…ATAGGACAT

3’…TATCCTGTA ctagcgagatatcctccacg TACGTTACC…5’

What are N-terminal sequences of proteins encoded by genes 1 and 2?

But neighbouring operons might be in opposite orientation in genome

Gene 2Gene 1

Gene A Gene B Gene C- polycistronic mRNA, but each gene has its own start and stop codons

Aside: My examples will often show unrealistically short sequences

See also Practice question #2

Bacterial genes are often organized in operons with short intergenic spacers

Page 8: Fig.1.8

Adachi & Lieber Cell 109: 807, 2002

bidirectional promoter ?

Presence of genes located close together but encoded on opposite strands is sometimes also seen in eukaryotic genomes

Where would promoter(s) for genes 1 and 2 be located?

Gene 2

Gene 1

Page 9: Fig.1.8

RNA structure

Alberts Fig.6.4

RNA synthesized in 5’ to 3’ directionwith antiparallel DNA strand as template

5’

3’

Fig.1.11

Features of RNA vs. DNA

RNA synthesis

Template strand

5’ 3’ “Coding strand”

mRNA has same sequence as coding strand (except U instead of T)

Page 10: Fig.1.8

Fig.1.12

RNA content of a cell

snRNAs (small nuclear) - role in splicing

snoRNA (small nucleolar) - role in methylation of rRNAs

miRNA (microRNAs) & siRNA (short interfering RNAs) - role in regulation of expression of individual genes

small regulatory RNAssmall non-coding (nc) regulatory RNAs are

also present in bacteria sRNAs

Page 11: Fig.1.8

Fig.1.13

RNA processing in eukaryotes

- presence of long introns (& short exons) can make finding genes in eukaryotic DNA sequences difficult

- may be alternative splicing pathways so more than one protein generated from one gene (Discussed later, Chapter 6)

Page 12: Fig.1.8

- can deduce amino acid sequence of protein from nt coding sequence

… using genetic code table

“standard code”

Link between transcriptome & proteome

Genetic codeMediated by tRNAs(codon-anticodon)

Fig.1.20Fig.1.2 See Practice question #1

Page 13: Fig.1.8

- in research papers DNA usually shown as single-stranded with coding strand in 5’ to 3’ orientation (left to right)

PROTEIN-CODING GENES

5’ …. AUG GGA UUG CCC GCC …. 3’

3’ .… TAC CCT AAC GGG CGG …. 5’

5’ …. ATG GGA TTG CCC GCC …. 3’ “coding strand”DNA

“template strand”

mRNA

… so genetic code table can be used directly

divided into triplets (codons)

Page 14: Fig.1.8

Alberts Fig. 6-50

Amino acid one-letter abbreviation often used instead of 3-letters

Translationterminationcodons

Initiationcodon

Remember that although AUG is the standard initiation codon, there can also be AUG triplets within an ORF,

… specifying internal Met residues in the protein

And when analyzing DNA data obtained in the lab, initiation codon might be located outside the sequenced region

Page 15: Fig.1.8

Examples of deviation from the standard genetic code in mitochondria and microbes

Table 1.3

Page 16: Fig.1.8

PROTEIN SEQUENCE & STRUCTURE

Different proteins can be generated from single precursor polypeptide

Fig.13.24

through post-translational events

…so can have larger proteome (set of proteins) than predicted fromnumber of genes in genome

Fig.1.17

Page 17: Fig.1.8

Latin word “cis” means "on the same side as”

5’ 3’

Trans-acting factor: protein (or RNA) that binds to cis-element to control gene expression

Cis-acting element: DNA (or RNA) sequences near a gene, that are important for its expression

3’ 5’

ATG TAA

Cis-elements can actually be quite far away from genes they control in intergenic spacers (ENCODE project) and within introns

DNA


D) Trunk = Belly. 2 E) Wing Regions of the Wing: Brachium, Antebrachium, Manus Fig. 1.8 in Podulka et al. 2004

Europcr2014 1.8

Moodle 1.8

LANÇAMENTOS LONAFLEX 2º Semestre 2015 Pastilhas e ... · livina 1.6 / 1.8 16v livina grand 1.8 16v livina grand s 1.8 16v livina grand sl 1.8 16v livina s 1.6 / 1.8 16v livina sl

Hoofdstuk 1.8

1.8 AUDITORIAS.doc

IGCSE Physics 0625/62 Paper 6 Alternative to Practical Feb ... (0625)/2020...6 UCLES 2020 0625/62/F/M/20 (e) Fig. 1.8 On Fig. 1.8, draw an arrow showing the correct line of sight for

1.8 FigurasPlanas

Mineralogy Petrology - tankonyvtar.hu · fold rotational axis, that is unique to the other axes (Fig. 1.8.). Classes of this system are pyramid, dipyramid, trapezohedron, dihexagonal

FIG.1 FIG.2 FIG.3. Fig.4Fig.5Fig.6 Fig.7 Fig.8 Fig 9 Fig.10 Fig.11 Fig.12

mycook 1.8

LM1117 1.8

LED : 362 (Fig. 2) 1.0 . (Fig. 4) (Fig. 6) (Fig. 7) (Fig.9 ... · LED : 362 (Fig. 2) "1.0" . (Fig. 4) (Fig. 6) (Fig. 7) (Fig.9) 2. (Fig. 3) (Fig. 5) (Fig. 8) (Fig. 10) C€FCRoHSZ

1.8/1.9MHz Super-Compact Dipole Antenna CD160-x · PDF fileSpecification ・Feature CD160 Jr CD160 CD160-5 CD160L CD160L-5 Frequency 1.8 ~ 1.9MHz 1.8 - 1.9 MHz 1.8 - 1.9 MHz 1.8 -

Fig. 1.8 Levels of Organization. Cellular Level of Organization the basic unit of life Cells are semi-autonomous. –increasing differentiation / decreasing

 · 2019. 5. 21. · FN1664-E FN1664SP-E FIG. 7 FIG. 8 FIG. 9 FIG. 10 FIG. 11 FIG. 12a FIG. 12b FIG. 13 FIG. 14 FIG. 15 FIG. 16 FIG. 17 FIG. 18 FIG. 19 FIG. 20 FIG. 21 5 BOSTITCH

Marketing Society Excellence Awards Long Term …...Fig 1.8: Domino’s Customer Segmentation Source: Domino’s/Arena Media (2012) This identified 'Family Feasters' (parents with

Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 Fig. 9

Bijendra Public School | +2 Level CBSE Day cum Boarding ......The cytoplasm is stained light blue. Fig. 1.7 Human cheek cells Fig. 1.8 Spirogyra in a pond Fig. 1.9 Spirogyra under

Universal LED, Ø 1.8 mm Tinted Diffused Miniplast Package · Fig. 3 - Relative Luminous Intensity vs. Angular Displacement Fig. 4 - Forward Current vs. Forward Voltage Fig. 5 - Forward

Algebra 1.8

1.8. histograma

NUEVA CHEVROLET TRACKER - Chevrolet Sitio Oficial · chevrolet.com.pe NUEVA CHEVROLET TRACKER. 1.8 LS MT 2WD 1.8 LT MT 2WD 1.8 LT AT FULL AWD MOTOR Cilindrada (L) 1.8 DOHC 1.8 DOHC

1.8 hlajenje

Manual de utilizare motocoasa pe roti · Fig. cg Fig. DI Fig. CIO Fig. Fig. 7 Fig. 8 . Fig. DB Fig. D4 Fig. El Fig. Fl Fig. E-2 Fig. F2 . Fig. F4 Fig. F5 Fig. G Fig. H Fig. F-3 Fig

GB 1800114819-centrale vapeur express.qxd:Mise en page 1 ......1/4 fig.1 fig.2 fig.3 fig.5 fig.6 fig.7 fig.13 fig.10 fig.14 fig.11 fig.15 fig.17 fig.18 fig.19 fig.21 fig.22 fig.9 fig.4

Home page | BOA Bicocca Open Archive - 1. …...carichi masticatori a livello dell’interfaccia osso impianto. Fig.1.8 - Rappresentazione FEM di un impianto posizionato nell’osso

Figure 1.8

Parts of Lakhimpur District, Assamcgwb.gov.in/AQM/NAQUIM_REPORT/Assam/Lakhimpur.pdf · 2018-10-04 · Fig. 1.6: Geomorphological Map of the study area, Lakhimpur District, Assam 1.8

TuneECU 1.8

Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7

Section 1.8

FIG Meeting Agenda June 7, 2017 6:00pm - 7:30pm...Jun 07, 2017  · 30 External Features - Outdoor 1.9 1.5 1.8 1.8 31 External Features - Athletic 1.8 32 External Features - Playground

India - Relief Features · Terai region, fine alluvial plain regions are found. Fig : 1.7 Cross Section of Northern Platau, the Gangetic plain, and the Himalaya’s Fig 1.8 : A Village

Springboard 1.8