fee schedule for brokerage accounts - j.p. morgan · investment products and services are offered...
TRANSCRIPT
34
Please read carefully
This schedule contains information about the fees and charges that apply to your account and your transactions. Please note that fees and other information are subject to change without notice.
ANNUAL ACCOUNT FEES
Brokerage Account1 $50.00 – How to avoid this fee: Be a Chase Private Client, $25,000+ in combined investment balances, transact a commissionable trade in a calendar year, $50,000+ Chase Deposit Balance
Retirement Brokerage Account (IRAs and SEPs)1 $30 – How to avoid this fee: Be a Chase Private Client, $10,000+ in combined investment balances, $25,000+ Chase Deposit Balance
ADMINISTRATIVE
FEES
Brokerage Account Transfer/Termination Fee $75
Confirm Postage/Handling1 $3 per confirm – This fee does not apply to Chase Private Clients or paperless clients.
Overnight/Express Mail $10 per item – This fee does not apply to Chase Private Clients.
Wire Transfer2 $25 per wire – This fee does not apply to Chase Private Clients.
Late Payment/Cash Due Interest JPMS Base Lending Rate + 2.5%
Stop Payments $30 per item – This fee does not apply to Chase Private Clients.
Check Returns $12 per check – This fee does not apply to Chase Private Clients.
Pre-Payment Advance Before Trade Settles Margin interest
Alternative Investment Administration3 $250 per investment, per year – This fee does not apply to Chase Private
Clients.
PHYSICAL CERTIFICATE FEES
Legal Transfers $25 per certificate – This fee does not apply to Chase Private Clients.
Safekeeping $10 per position, per month – This fee does not apply to Chase Private Clients.
All the above fees will be charged either to your linked bank account or brokerage account.
Other fees and costs, including fees intended to offset fees charged by regulatory bodies and costs for foreign currency transactions, foreign clearing charges and safekeeping may apply.
As of June 2020
Fee Schedule for Brokerage Accounts
INVESTMENT AND INSURANCE PRODUCTS ARE: • NOT FDIC INSURED • NOT INSURED BY ANY FEDERAL GOVERNMENT AGENCY • NOT A DEPOSIT OR OTHER OBLIGATION OF, OR GUARANTEED BY,
JPMORGAN CHASE BANK, N.A., OR ANY OF ITS AFFILIATES • SUBJECT TO INVESTMENT RISKS, INCLUDING POSSIBLE LOSS OF THE PRINCIPAL AMOUNT INVESTED
© 2020 JPMorgan Chase & Co. | JPMFEE 6.2020
Note: Additional foreign security fees may be charged as incurred from agent banks. 1 Fees do not apply to managed accounts. Other exclusions may apply. 2 This fee does not apply to internal wire transfers. 3 Includes limited partnerships, private equity funds, hedge funds, REITs, etc.
Investment products and services are offered through J.P. Morgan Securities LLC (JPMS), a registered broker-dealer and investment advisor, member of FINRA and SIPC. Annuities are made available through Chase Insurance Agency, Inc. (CIA), a licensed insurance agency, doing business as Chase Insurance Agency Services, Inc. in Florida. JPMS, CIA and JPMorgan Chase Bank, N.A., are affiliated companies under the common control of JPMorgan Chase & Co. Products not available in all states.
35
Please read carefully
This schedule contains information about the fees and charges that apply to your account and your transactions. Please note that fees and other information are subject to change without notice.
OPTIONS1
Premium Price Fee per contract
$0.01–$0.49 $1.00 per contract
$0.50–$0.99 $2.00 per contract
$1.00 and over $4.00 per contract
Minimum commission of $25.00
All the above fees will be charged either to your linked bank account or brokerage account.
Other fees and costs, including fees intended to offset fees charged by certain regulatory bodies and costs for foreign currency transactions, foreign clearing charges and safekeeping may apply.
As of June 2020
Commission Schedule for Brokerage Accounts
STOCKS & ETFS VIA CHASE.COM $0 per trade
FIXED INCOME
Fixed income securities are typically purchased on principal basis and are subject to a markup (if you are a
buyer) or markdown (if you are a seller) charged by J.P. Morgan. Transactions involving municipal securities
in which J.P. Morgan cannot determine a fair price may be charged a commission as opposed to a markup
or markdown. Your advisor can provide you with the markup, markdown or commission charged on fixed
income securities.
UNIT INVESTMENT TRUSTS AND VARIABLE INSURANCE
Read your prospectus for complete details regarding the sales loads, surrender charges and other fees for such products. There are no additional transaction fees applied for purchases or redemptions of such products.
STRUCTURED NOTES For new issues, read your offering documents for complete details on the offering price, which includes a selling concession. In cases where structured products are called before maturity, fees are not rebated.
MUTUAL FUNDS2
Read your prospectus for complete details regarding the sales load, redemption fees and other fees for such products. There are no additional transaction fees applied for purchases or redemptions of such products.
MARGIN Speak with your J.P. Morgan Advisor for current rates.
STOCKS & EXCHANGE-TRADED FUNDS
AsAsAsAsAsAsAsAsAsAs f f f f f f f f f f f JuJuJuJuJuJu 2 2 2 2 2 2 2 2 2 2 2 2 2 2020202020202020202020202020200000000000000AsAsAsAsAsAsAsAsAsAsAsAsAsAsAsAsAs o o o o o o o o o o o o o o o of f f f f f f f f f f f JuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJunenenenenenenenenenenenenenenenene 2 2 2 2 2 2 2 2 2 2 2 2 2020202020202020202020202020202020200000000000000000AsAsAsAsAsAsAsAsAsAsAsAsAsAs o o o o o o o of f f f f f f f f JuJuJuJuJuJuJuJuJuJuJuJunenenenene 2 2 2 2 2 2 20202020202020202020202020202000000000000AsAsAsAsAsAsAsAsAsAsAsAsAsAsAsAsAs o o o o o o o o o o o o o o of f f f f f f f JuJuJuJuJuJuJuJuJunenenenenenenenenenenenenenenene 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2020202020202020202020202020202020200000000000000000AsAsAsAsAsAsAsAsAsAsAsAsAsAsAs o o o o o o o o o of f f f f f f JuJuJuJuJuJuJuJuJunenenenenenenenenenenenenenene 2 2 2 2 2 2 2 2 2 2 2 2 202020202020202020202020202020202000000000AsAsAsAsAsAsAsAsAsAsAsAsAsAsAsAsAsAs o o o o o o o o o o o o o o of f f f f f f f f f f JuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJunenenenenenenenenenenenenenenenenene 2 2 2 2 2 2 2 2 2 2 2 2 2 2 20202020202020202020202020202020202020000000000000000AsAsAsAsAsAsAsAsAsAsAsAsAsAsAsAs o o o o o o o o o o o o of f f f f f f f JuJuJuJuJuJuJuJuJuJuJuJuJunenenenenenenenenenenene 2 2 2 2 2 2 2 2 20202020202020202020202020200000000000000
iiiiiiiiiiii iiiiiiiiiii hhhhhhhhhh ddddddddddd lllllllllll ffffffffffffff kkkkkkkkkkCCCCCCCCCCCCCCC iiiiiiiiiiiii iiiiiiiiiiiii SSSSSSSSSSSSSSS hhhhhh dddddd llllll fffffffffff BBBBBBBBBBBBB kkkkk AAAAAAAAAAAAA tttttttttCC iiiiiii iiiiiii SS hhhhhh dddddd llllll ffffffff B kkkkk A tCCCCCCCCCCCCCCCooooooooooommmmmmmmmmmmmmmmmmmmmmmmmmmmiiiiisssssssssssssssssssssssiiiiioooooooooooonnnnnnnnnn SSSSSSSSSSSSSSScccccccccchhhhhhhhhhhhheeeeeeeeeeeeeddddddddddduuuuuuuuulllllleeeeeeeeeee ffffffffooooooooooorrrrrrrrrrr BBBBBBBBBBBBBrrrrrrrrrrroooooooooookkkkkkkkkeeeeeeeeeeeerrrrrrrrrrraaaaaaaaaaaaaaggggggggggggeeeeeeeeeeeee AAAAAAAAAAAAAAcccccccccccccccccccccccccoooooooooooouuuuuunnnnnnnnnnnttttttttttssssssssssssCCCCCCCCCCCCC i i SSSSSSSSSSSSSSS hhhhhh dddddd llllll ffff BBBBBBBBBBBBBB kkkkk AAAAAAAAAAA ttttCCCCCCCCCCCCCCooooooooooooooommmmmmmmmmmmmmmmmmmmmmmmmmmmmmiiiiissssssssssssssssssssssssssssssiiiiioooooooooooooonnnnnnnnnnnnnnn SSSSSSSSSSSSSccccccccccccccchhhhhhhhhhhhhhheeeeeeeeeeeeeeeddddddddddddddduuuuuulllllleeeeeeeeeeeeeee ffffffffooooooooooooooorrrrrrrrrrrrrrr BBBBBBBBBBBBBrrrrrrrrrrrrrroooooooooooooookkkkkkkkkkkkkkeeeeeeeeeeeeeeerrrrrrrrrrrrrrraaaaaaaaaaaaaaagggggggggggggeeeeeeeeeeeeeee AAAAAAAAAAAAAAAccccccccccccccccccccccccccccoooooooooooooouuuuuunnnnnnnnnnnnnntttttttttsssssssssssssssCCCCCCCCCCoooooooooommmmmmmmmmmmmmmmmmmmmmmmmiiiiissssssssssssssssssiiiiiooooooooonnnnnnnnn SSSSSSScccccccchhhhhhhhhhhheeeeeeeeeedddddddddduuuuuulllllleeeeeeeeee ffffooooooooooorrrrrrrrrrrr BBBBBBBBrrrrrrrroooooooooookkkkkkkkkkkeeeeeeeerrrrrrrraaaaaaaaaaggggggggggggeeeeeeee AAAAAAAAAccccccccccccccccccooooooouuuuuunnnnnnnnnnnttttsssssssssCCCCCCCCCCCCooooooooooooooommmmmmmmmmmmmmmmmmmmmmmmmmmmmmiiiisssssssssssssssssssssssssssiiiiooooooooooooooonnnnnnnnnnnnn SSSSSSSSSSSSSccccccccccccccchhhhhhhhhhhhhheeeeeeeeeeeeeeeddddddddddddddduuuuuulllllleeeeeeeeeeeeeee ffffooooooooooooooorrrrrr BBBBBBBBBBBBBBrrrroooooooooooooookkkkkkkkkkkkkkeeeeeeeeeeeeeeerrrrrraaaaaaaaaagggggggggggggggeeeeeeeeeeeeeee AAAAAAAAAAAAAAccccccccccccccccccccccccccccccooooooooooooooouuuuuunnnnnnnnnnnnnttttsssssssssssssssCCCCCCCCoooooooooommmmmmmmmmmmmmmmmmmmmmmmmmiiiissssssssssssssiiiioooooooonnnnnnnnn SSSSSSSccccccchhhhhhhhhheeeeeeeeeeeddddddddddduuuuuulllllleeeeeeeeeee ffffooooooooooorrrrrr BBBBBBrrrroooooooooookkkkkkkeeeeeeeeeerrrrrraaaaaaagggggggggggeeeeeeeeee AAAAAAAAAAAccccccccccccoooooooooouuuuuunnnnnnnnnnnttttsssssssCCCCCCCCooooooooooooommmmmmmmmmmmmmmmmmmmmiiiissssssssssssssssssssssssssssiiiioooooooooooooonnnnn SSSSSSSSSSSSSSScccccccccchhhhhhhheeeeeeeeeeeeeeeddddddddduuuuuulllllleeeeeeeeeeeeeee ffffoooooooooooooorrrrrr BBBBBBBBBBBBBBrrrroooooooooooookkkkkkkkkkkkkkkeeeeeeeeeeeeeeerrrraaaaaaaaaaaagggggggggggggggeeeeeeeeeeeeeee AAAAAAAAAAAAAAAcccccccccccccccccccccccooooooooooooouuuuuunnnnnttttsssssssssssssssCCCCCCoooooooooooommmmmmmmmmmmmmmmmmmmmiiiisssssssssssssssiiiioooooooooonnnnn SSSSSSSSSSScccccchhhhhhhheeeeeeeeeddddddduuuuuulllllleeeeeeee ffffooooooooooorrrrrr BBBBBBBrrrrooooooooooookkkkkkkkkkeeeeeeeeerrrraaagggggggggggeeeeeeeeeeee AAAAAAAAAccccccccccoooooooooouuuuuunnnnnttttssssssssCCCCCCCCCCCCCCCooooooooooooooommmmmmmmmmmmmmmmmmmmmiiiissssssssssssssssssssssssssssiiiiooooooooooooonnnnn SSSSSSSSSSSSScccccccccchhhhhhhheeeeeeeeeeeeeeddddddddduuuuuulllllleeeeeeeeeeeeee ffffooooooooooooooorrrrrr BBBBBBBBBBBBBBrrrroooooooooooooookkkkkkkkkkkkkkkeeeeeeeeeeeeeerrrraaaaaaaaaaaaaaagggggggggggggggeeeeeeeeeeee AAAAAAAAAAAAAAAccccccccccccccccccccccccooooooooooooooouuuuuunnnnnttttsssssssssssssssCCCCooooooommmmmmmmmmmmmmmmmmmmmiiiisssssssssssssssssiiiioooooonnnnn SSSSSSScccchhhhhhhheeeeddddddduuuuuulllllleeee ffffoooooorrrrrr BBBBBBBBrrrroooooookkkkkkkkkkkeeeerrrraaaaaaaaaaaagggggggggggggeeeee AAAAAAAAAAccccccccccooooooouuuuuunnnnnttttsssssssCCCCCCCCCCCCCCooooooooooooooommmmmmmmmmmmmmmmmmmmmiiiisssssssssssssssssssssssssssiiiiooooooooooooooonnnnn SSSSSSSSSSccccccccccccchhhhhhhheeeeeeeeeeeeeeddddddddddddddduuuuuuuuuuulllllleeeeeeeeeeeeeee ffffooooooooooooooorrrrrr BBBBBBBBBBBBBrrrroooooooooooooookkkkkkkkkkkkkkkeeeeeeeeeeeeeerrrraaaaaaaaaaaaaggggggggggggggeeeeeeeeeeeeeee AAAAAAAAAAAAAAAccccccccccccccccccccccccccccooooooooooooooouuuuuuuuuuuunnnnnttttssssssssssssssCCCCCCCCCoooooooooommmmmmmmmmmmmmmmmmmmmiiiissssssssssssssiiiioooooooonnnnn SSSScccccchhhhhhhheeeeeeeddddddddduuuuuulllllleeeeeee ffffoooooooooorrrrrr BBBBBBrrrrooooooooookkkkkkkkkkkeeeeeeerrrraaaaaaaaagggggggggeeeeeeeee AAAAAAAccccccccccccccoooooooooouuuuuunnnnnttttssssssssCCCCCCCCCCCCCCCoooooooooooooommmmmmmmmmmmmmmmmmmmmiiiisssssssssssssssssssssssssssssiiiiooooooooooooooonnnnn SSSSSSSSSSSSSSccccccccccccccchhhhhhhheeeeeeeeeeeeeeedddddddddddddduuuuuuuuuuuuuuulllllleeeeeeeeeeeeeee ffffooooooooooooooorrrrrr BBBBBBBBBBBBBrrrroooooooooooooookkkkkkkkkkkkkeeeeeeeeeeeeeeerrrraaaaaaaaaaaaaaagggggggggggggggeeeeeeeeeeeeeee AAAAAAAAAAAAAAAccccccccccccccccccccccccccccccooooooooooooooouuuuuuuuuuuuuuunnnnnttttttttttttsssssssssssssssCCCCCCCoooooooommmmmmmmmmmmmmmmmmmmmiiiisssssssssssssiiiioooooooooonnnnn SSSSSccccccchhhhhhhheeeeeeddddddddduuuuuuuulllllleeeeee ffffooooooooorrrrrr BBBBBBBBBrrrroooooooookkkkkkkkkkeeeeeerrrraaaaaaaaggggggggggeeeee AAAAAAAAAAcccccccccccccooooooouuuuuuuuunnnnnttttttsssssssCCCCCCCCCCCCCCCoooooooooooooommmmmmmmmmmmmmmmmmmmmmmmmmmmiiiiiissssssssssssssssssssssssssssiiiiiioooooooooooooonnnnnnnnn SSSSSSSSSSSSSSccccccccccccccchhhhhhhhhhhheeeeeeeeeeeeeeddddddddddddddduuuuuuuuuuuuuuulllllllllleeeeeeeeeeeeeee fffffffooooooooooooorrrrrrrrrr BBBBBBBBBBBBrrrrrrrooooooooooooookkkkkkkkkkeeeeeeeeeeeeeeerrrrrrraaaaaaaaaaaaaagggggggggggggggeeeeeeeeeeeeee AAAAAAAAAAAAccccccccccccccccccccccccccccooooooooooooooouuuuuuuuuuuuuuunnnnnnnntttttttttttttttsssssssssssssssCCCCCCoooooooooommmmmmmmmmmmmmmmmmmmmiiiissssssssssssssssiiiioooooooonnnnn SSSSSSSSSSccccccchhhhhhhhhheeeeeeeeeeddddddddduuuuuuuuuulllllleeeeeeeeee fffffooooooooooorrrrrrr BBBBBBBBBrrrrroooooooooookkkkkkkkkkkeeeeeeeeerrrraaaaaaaaaggggggggggeeeeeeeeee AAAAAAAAAAccccccccccccccccccoooooooouuuuuuuuuunnnnnntttttttsssssssssggggggggggggggggggggggggggggggggggggggggggggggggggggg
STOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & & & EXCEXCEXCEXCEXCEXCEXCHANHANHANGE-GE-GE-GE-GE-GE-GE-TRATRATRADEDDEDDED FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & & & & & & & EXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCHANHANHANHANHANHANHANHANHANHANHANHANHANHANHANGE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-TRATRATRATRATRATRATRATRATRATRATRATRATRATRATRADEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDED FU FU FU FU FU FU FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & & EXCEXCEXCEXCEXCEXCEXCEXCEXCEXCHANHANHANHANHANHANHANHANHANHANHANGE-GE-GE-GE-GE-GE-GE-GE-GE-TRATRATRATRATRATRATRATRADEDDEDDEDDEDDEDDEDDED FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & & & & & & & & EXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCHANHANHANHANHANHANHANHANHANHANHANHANHANHANHANGE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-TRATRATRATRATRATRATRATRATRATRATRATRATRATRATRADEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDED FU FU FU FU FU FU FU FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & EXCEXCEXCEXCEXCEXCEXCEXCEXCEXCHANHANHANHANHANHANHANHANHANHANHANHANHANGE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-TRATRATRATRATRATRATRATRATRATRATRATRATRADEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDED FU FU FU FU FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & & & & & EXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCHANHANHANHANHANHANHANHANHANHANHANHANHANHANHANGE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-GE-TRATRATRATRATRATRATRATRATRATRATRATRATRATRADEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDEDDED FU FU FU FU FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & EXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCEXCHANHANHANHANHANHANHANHANHANHANHANHANHANHANGE-GE-GE-GE-GE-GE-GE-TRATRATRATRATRATRATRATRATRATRATRADEDDEDDEDDEDDEDDEDDEDDEDDEDDED FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDS
$0 $0 $0 $0 tradeSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & & & & & & & ETFETFETFETFETFETFETFETFETFETFETFETFS VS VS VS VS VS VS VS VS VS VS VS VS VS VS VIA IA IA IA IA IA IA IA IA IA CHACHACHACHACHACHACHACHACHACHACHACHACHACHACHASE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.COMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOM $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 perperperperperperperperperperperperperperperperper tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tradeadeadeadeadeadeadeadeadeadeadeadeadeadeadeade$0 $0 $0 $0 $0 $0 tradeadeadeSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & & & & & & & & ETFETFETFETFETFETFETFETFETFETFETFETFS VS VS VS VS VS VS VS VS VS VS VS VS VS VS VIA IA IA IA IA IA IA IA IA IA IA IA IA IA IA CHACHACHACHACHACHACHACHACHACHACHACHACHACHACHASE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.COMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOM $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 perperperperperperperperperperperperperperperperperperperper tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tradeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & ETFETFETFETFETFETFETFS VS VS VS VS VS VS VS VS VS VS VS VIA IA IA IA IA IA IA CHACHACHACHACHACHACHACHACHACHACHACHACHASE.SE.SE.SE.SE.SE.COMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOM $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 perperperperperperperperperperperperperperperperper tr tr tr tr tr tr tr tr tr tr tr tr tr tr tradeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & & & & & & & & ETFETFETFETFETFETFETFETFETFETFETFS VS VS VS VS VS VS VS VS VS VS VS VS VS VS VIA IA IA IA IA IA IA IA IA IA IA IA IA IA IA CHACHACHACHACHACHACHACHACHACHACHACHACHACHACHASE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.COMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOM $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 perperperperperperperperperperperperperperperperperperper tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tradeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeade STOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOSTOCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKSCKS & & & & & & & & & ETFETFETFETFETFETFETFS VS VS VS VS VS VS VS VS VS VS VS VIA IA IA IA IA IA IA IA IA IA CHACHACHACHACHACHACHACHACHACHACHACHACHACHACHASE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.SE.COMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOMCOM $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 $0 perperperperperperperperperperper tr tr tr tr tr tr tr tr tr tradeadeadeadeadeadeadeadeadeadeadeadeadeadeadeade$0 $0 $0 $0 $0 $0 $0 $0 $0 $0 perperper$0 $0 $0 $0 perperper
FixFixFixFixFixFixFixFixFixFixFixFixFixFixed ed ed ed ed ed incincincincincincincincincome securitiitiitiitiitiitiitiitiitiitiitiitiitiities are ty ty ty ty ty typicpicpicpicpicpicpicpicpicpicpicpicallallallallallallallallally purchashashashashased ed ed ed ed ed ed on pripripripripripripripriprincincincincincincincincincipalpalpalpalpal basbasbasbasbasis is is is is is is is is is is is andandandandand are subjubjubjubjubjubjubjubjubjubjectectectectectectectectect to to to to to to to to to a markupkupkupkup (i (i (i (i (i (i (i (i (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf yf you are a FixFixFixFixFixFixFixFixFixFixFixFixFixFixFixFixFixed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed incincincincincincincincincincincincincincincincincincincomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeome se se se se se se se se se se se se se se se se se se securcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcuritiitiitiitiitiitiitiitiitiitiitiitiitiitiitiitiities es es es es es es es es es es es es es es es es es es areareareareareareareareareareareareareareareareareareare ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty typicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicallallallallallallallallallallallallallallallallallally py py py py py py py py py py py py py py py py py py purcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurchashashashashashashashashashashashashashashashashashashased ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed on on on on on on on on on on on on on on on on on on on pripripripripripripripripripripripripripripripripriprincincincincincincincincincincincincincincincincincincipalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpal basbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasis is is is is is is is is is is is is is is is andandandandandandandandandandandandandandandandandandand ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are se se se se se se se se se se se se se se se se se se subjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjectectectectectectectectectectectectectectectectectectect to to to to to to to to to to to to to to to to to to to a a a a a a a a a a a a a a a a a a marmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkup (i (i (i (i (i (i (i (i (i (i (i (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf you ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou areareareareareareareareareareareareareareareareareareare a a a a a a a a a a a a a a a a a a a FixFixFixFixed ed ed ed ed income securitiitiitiitiitiities are ty ty ty typicallallallallallallally purchashashased ed ed ed on principalpalpalpal basbasbasis andandand are subjubjubjectectectectect to to to to to to a markupkupkup (i (i (i (i (i (i (i (i (if yf yf yf you are a FixFixFixFixFixFixFixFixFixFixFixFixFixFixFixFixFixed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed incincincincincincincincincincincincincincincincincomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeome se se se se se se se se se se se se se se se se se securcurcurcurcurcurcurcurcurcurcurcurcurcurcurcuritiitiitiitiitiitiitiitiitiitiitiities es es es es es es es es es es es es es es es es es es areareareareareareareareareareareareareareareareareareare ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty typicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicallallallallallallallallallallallallallallallallallally py py py py py py py py py py py py py py py py py py purcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurchashashashashashashashashashashashashashashashashashashased ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed on on on on on on on on on on on on on on on on on on on pripripripripripripripripripripripripripripripripripriprincincincincincincincincincincincincincincincincincincincipalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpal basbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasis is is is is is is is is is is is is is is is is andandandandandandandandandandandandandandandandandandand ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are se se se se se se se se se se se se se se se se se se subjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjectectectectectectectectectectectectectectectectectect to to to to to to to to to to to to to to to to to to a a a a a a a a a a a a a a a a a marmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkup (i (i (i (i (i (i (i (i (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf you ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou areareareareareareareareareareareareareareareareareareare a a a a a a a a a a a a a a a a FixFixFixFixFixFixFixFixFixFixFixFixFixed ed ed ed ed ed ed ed ed ed ed ed incincincincincincincomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeome se se se se se se se se se se se se se se securcurcurcurcurcurcurcurcurcurcuritiitiitiitiitiitiitiities es es es es es es es es es es es es es areareareareareareareareareareareareare ty ty ty ty ty ty ty ty ty ty ty ty typicpicpicpicpicpicpicpicpicpicpicpicallallallallallallallallallallallallallallally py py py py py py py py py py py purcurcurcurcurcurcurcurcurcurchashashashashashashashashashashashashashashased ed ed ed ed ed ed ed ed ed ed on on on on on on on on on on on on pripripripripripripripripripripriprincincincincincincincincipalpalpalpalpalpalpalpalpalpalpalpalpal basbasbasbasbasbasbasbasbasbasbasbasbasbasbasis is is is is is is is is andandandandandandandandandandandandandandand ar ar ar ar ar ar ar ar ar ar are se se se se se se se se se se se se se se se subjubjubjubjubjubjubjubjubjubjubjubjectectectectectectectectectectectectect to to to to to to to to to to a a a a a a a a marmarmarmarmarmarmarmarmarmarmarmarmarmarmarkupkupkupkupkupkupkupkupkupkupkupkupkupkupkup (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf yf yf yf yf you ou ou ou ou ou ou ou ou ou ou areareareareareareareareareareareareareare a a a a a a a a a a a FixFixFixFixFixFixFixFixFixFixFixFixFixed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed incincincincincincincincincincincincincincincincincincincomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeome se se se se se se se se se se se se se se se se se securcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcuritiitiitiitiitiitiitiitiitiitiitiitiitiitiitiitiitiitiities es es es es es es es es es es es es es es es es es es areareareareareareareareareareareareareareareareareare ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty typicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicallallallallallallallallallallallallallallallallallally py py py py py py py py py py py py py py py purcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurchashashashashashashashashashashashashashashashashashashased ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed on on on on on on on on on on on on on on on on on on pripripripripripripripripripripripripripripripriprincincincincincincincincincincincincincincincincincincipalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpal basbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasis is is is is is is is is is is is is is is is andandandandandandandandandandandandandandandandandand ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are se se se se se se se se se se se se se se se se se se subjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjubjectectectectectectectectectectectectectectectectectectect to to to to to to to to to to to to to to to to to to to a a a a a a a a a a a a a a a a a a marmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkup (i (i (i (i (i (i (i (i (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf yf yf yf yf you ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou areareareareareareareareareareareareareareareareareareare a a a a a a a a a a a a a a a a a FixFixFixFixFixFixFixFixFixFixFixed ed ed ed ed ed ed ed ed ed ed ed ed ed ed incincincincincincincincincincincincincincomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeome se se se se se se se se se se se se se se se securcurcurcurcurcurcurcurcurcurcurcurcurcuritiitiitiitiitiitiitiitiitiitiitiitiitiitiitiities es es es es es es es es es es es es es areareareareareareareareareareareareareareare ty ty ty ty ty ty ty ty ty ty ty ty ty typicpicpicpicpicpicpicpicpicpicpicpicpicpicpicpicallallallallallallallallallallallallallally py py py py py py py py py py py purcurcurcurcurcurcurcurcurcurcurcurcurcurchashashashashashashashashashashashashashashased ed ed ed ed ed ed ed ed ed ed ed ed ed ed on on on on on on on on on on on on on on pripripripripripripripripripripripripripripripriprincincincincincincincincincincincincincincincincipalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpalpal basbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasbasis is is is is is is is is is is is andandandandandandandandandandandandandandandandandand ar ar ar ar ar ar ar ar ar ar ar ar are se se se se se se se se se se se se se se se subjubjubjubjubjubjubjubjubjubjubjubjectectectectectectectectectectectectectectectectectect to to to to to to to to to to to to to to to to a a a a a a a a a a a a a a a marmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkup (i (i (i (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf you ou ou ou ou ou ou ou ou ou ou ou ou areareareareareareareareareareareareareareareareare a a a a a a a a a a a a a a a
buybuybuybuybuyer)er)er)er)er)er)er)er) rkdrkdrkdrkdrkdrkdrkdrkdrkdrkd (i (i (i (i (i (i (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf y selselselselselsellerlerlerlerlerlerlerlerler) c) c) c) c) c) c) c) c) c) charharharharhargedgedgedgedgedgedgedged by by by by by J.P. Mor . T tiotiotiotiotiotiotio invinvinvinvinvinvinvinvinvinvolvolvolvolvolvolvolvolvolvolvinginginginginginginginging nicnicnicnicnicnicnicnicipaipaipaipaipaipaipaipal sl sl sl sl s ritritritritritritritritritiesiesiesiesiesiesbuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuyer)er)er)er)er)er)er)er)er)er)er)er)er)er)er)er)er)er)er) or or or or or or or or or or or or or or or or or or ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma markdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdownownownownownownownownownownownownownownownownownownown (i (i (i (i (i (i (i (i (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf you ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou areareareareareareareareareareareareareareareareareare a a a a a a a a a a a a a a selselselselselselselselselselselselselselselselselsellerlerlerlerlerlerlerlerlerlerlerlerlerlerlerlerlerlerler) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) charharharharharharharharharharharharharharharharharhargedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedged by by by by by by by by by by by by by by by by by by by J. J. J. J. J.P. P. P. P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorgangangangangangangangangangangangangangangangangangangan. T. T. T. T. T. T. T. T. Tranranranranranranranranranranranranranranranranranransacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsactiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotions ns ns ns ns ns ns ns ns ns ns ns ns ns ns ns ns ns invinvinvinvinvinvinvinvinvinvinvinvinvinvinvinvinvinvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvinginginginginginginginginginginginginginginginginginging mu mu mu mu mu mu mu mu mu mu mu mu mu mu mu mu mu municnicnicnicnicnicnicnicnicnicnicnicnicnicnicnicnicnicipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipal sl sl sl sl sl sl sl sl sl sl sl sl sl sl sl sl secuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuritritritritritritritritritritritritritritritritritritiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesbuybuybuyer)er)er)er)er) rkdrkdrkdrkdrkdrkdrkd (i (i (i (i (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf y selselselsellerlerlerlerlerler) c) c) c) c) charharhargedgedgedgedged by by by J. J. J. J.P. P. P. P. P. P. MorMorMorMorMorMorMor . T. T. T. T. T tiotiotiotiotiotiotiotiotio invinvinvinvinvinvinvinvolvolvolvolvolvolvolvinginginginginginginging nicnicnicnicnicnicnicipaipaipaipaipaipaipaipal sl sl sl s ritritritritritritritritritritiesiesiesiesiesbuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuyer)er)er)er)er)er)er)er)er)er)er)er)er)er)er)er)er)er) or or or or or or or or or or or or or or or or or or ma ma ma ma ma ma ma ma ma ma ma ma ma ma markdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdownownownownownownownownownownownownownownownownownownown (i (i (i (i (i (i (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf you ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou areareareareareareareareareareareareareareareareareareare a a a a a a a a a a a a a a a selselselselselselselselselselselselselselselselselselsellerlerlerlerlerlerlerlerlerlerlerlerlerlerlerlerler) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) charharharharharharharharharharharharharharharharhargedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedged by by by by by by by by by by by by by by by by by by by J. J. J. J. J. J. J. J. J. J. J.P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorgangangangangangangangangangangangangangangangangangangan. T. T. T. T. T. T. T. Tranranranranranranranranranranranranranranranranransacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsactiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotions ns ns ns ns ns ns ns ns ns ns ns ns ns ns invinvinvinvinvinvinvinvinvinvinvinvinvinvinvinvinvinvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvinginginginginginginginginginginginginginginginginging mu mu mu mu mu mu mu mu mu mu mu mu mu municnicnicnicnicnicnicnicnicnicnicnicnicnicnicnicnicnicnicipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipal sl sl sl sl sl sl sl sl sl sl sl sl sl sl sl sl secuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuritritritritritritritritritiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesies buybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuyer)er)er)er)er)er)er)er)er) or or or or or or or or or or ma ma ma ma ma ma ma ma ma ma ma markdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdownownownownownownownownownownownownownownownownown (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf yf yf yf you ou ou ou ou ou ou ou ou ou ou ou areareareareareareareareareareareareareare a a a a a selselselselselselselselselselselselsellerlerlerlerlerlerlerlerlerlerlerler) c) c) c) c) c) c) c) c) charharharharharharharharharhargedgedgedgedgedgedgedgedgedgedgedgedgedgedgedged by by by by by by by by by by by by by by J. J. J. J.P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMorMorMorMorMorMorMorgangangangangangangangangangangangan. T. T. T. T. Tranranranranranranranranransacsacsacsacsacsacsactiotiotiotiotiotiotiotiotiotiotiotiotiotions ns ns ns ns ns ns invinvinvinvinvinvinvinvinvinvinvinvinvinvinvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvinginginginginginginginginging mu mu mu mu mu mu mu mu mu mu mu municnicnicnicnicnicnicnicnicnicipaipaipaipaipaipaipaipaipaipaipaipaipaipal sl sl sl sl sl sl sl secuecuecuecuecuecuecuecuecuecuecuecuecuecuecuritritritritritritritritritiesiesiesiesiesiesiesiesiesiesiesiesiesbuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuyer)er)er)er)er)er)er)er)er)er)er)er)er)er)er)er)er)er) or or or or or or or or or or or or or or or or or or or ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma markdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdownownownownownownownownownownownownownownownownownownown (i (i (i (i (i (i (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf yf you ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou areareareareareareareareareareareareareareareareareareare a a a a a a a a a a a a a a a a a a selselselselselselselselselselselselselselselselselselsellerlerlerlerlerlerlerlerlerlerlerlerlerlerlerlerlerlerler) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) c) charharharharharharharharharharharharharharharharharharhargedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedged by by by by by by by by by by by by by by by by by by by J. J. J. J. J. J. J. J. J. J. J. J. J. J. J. J. J.P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorgangangangangangangangangangangangangangangangangangangan. T. T. T. T. T. T. T. T. T. T. T. T. T. T. T. Tranranranranranranranranranranranranranranranranranranransacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsactiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotions ns ns ns ns ns ns ns ns ns ns ns ns ns ns ns ns invinvinvinvinvinvinvinvinvinvinvinvinvinvinvinvinvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvinginginginginginginginginginginginginginginginginginging mu mu mu mu mu mu mu mu mu mu mu mu mu mu mu mu mu mu municnicnicnicnicnicnicnicnicnicnicnicnicnicnicnicnicnicipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipaipal sl sl sl sl sl sl sl sl sl sl sl sl sl sl sl sl sl secuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuritritritritritritritritritritritritritritritritritiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesiesies buybuybuybuybuybuybuybuybuybuybuybuybuybuybuybuyer)er)er)er)er)er)er)er)er)er)er)er) or or or or or or or or or or or ma ma ma ma ma ma ma ma ma ma ma ma ma ma markdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdrkdownownownownownownownownownownownownownownownownown (i (i (i (i (i (i (i (if yf yf yf yf yf yf yf yf yf yf yf yf you ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou areareareareareareareareareareareareareareare a a a a a a a a a a a a a a selselselselselselselselselselselselselselsellerlerlerlerlerlerlerlerlerlerlerlerlerlerler) c) c) c) c) c) c) c) c) c) c) c) charharharharharharharharharharharharharhargedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedgedged by by by by by by by by by by by by by by by by J. J. J. J. J. J. J. J. J. J. J. J.P. P. P. P. P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorgangangangangangangangangangangangangangangangangan. T. T. T. T. T. T. T. T. T. T. Tranranranranranranranranranranranranransacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsacsactiotiotiotiotiotiotiotiotiotiotiotiotiotiotions ns ns ns ns ns ns ns ns ns ns invinvinvinvinvinvinvinvinvinvinvinvinvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvolvinginginginginginginginginginginginginging mu mu mu mu mu mu mu mu mu mu mu municnicnicnicnicnicnicnicnicnicnicnicnicnicipaipaipaipaipaipaipaipaipaipaipaipaipal sl sl sl sl sl sl sl sl sl sl sl sl sl secuecuecuecuecuecuecuecuecuecuecuecuecuecuecuecuritritritritritritritritritritritiesiesiesiesiesiesiesiesiesiesiesiesies FIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXED ED ED ED ED ED ED ED ED ED ED ED ED ED ED INCINCINCINCINCINCINCINCINCINCINCINCINCINCINCOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOME
buybuybuyer) (if yf yf y ) c gedgedgedgedgedgedged by by gangangangangangangan inginginginginging ipaipaipaFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXED ED ED ED ED ED ED ED ED ED ED ED ED ED ED INCINCINCINCINCINCINCINCINCINCINCINCINCINCOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOME in in in in in in in in in in in in in in in whiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhich ch ch ch ch ch ch ch ch ch ch J.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.P. M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. Morgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgan an an an an an an an an an an an an an an an cancancancancancancancancancancancancancancancancancannotnotnotnotnotnotnotnotnotnotnotnotnotnotnotnot de de de de de de de de de de de de de de de deterterterterterterterterterterterterterterterterterminminminminminminminminminminminminminminminminminmine ae ae ae ae ae ae ae ae ae ae ae ae ae ae a fa fa fa fa fa fa fa fa fa fa fa fa fa fa fair ir ir ir ir ir ir ir ir ir ir ir pripripripripripripripripripripripripripripripriprice ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce maymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymay be be be be be be be be be be be be be be ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargargargargarged ed ed ed ed ed ed ed ed ed ed ed ed ed a ca ca ca ca ca ca ca ca ca ca ca ca ca ca commommommommommommommommommommommommommommommommommommissississississississississississississississionionionionionionionionionionionionionionionionionion as as as as as as as as as as as as as as as op op op op op op op op op op op op op op op op opposposposposposposposposposposposposposposposposposposposed ed ed ed ed ed ed ed ed ed ed ed ed ed ed to to to to to to to to to to to to to to a ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma markarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkup up up up up up up up up up up up up up up up FIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXED ED ED ED ED ED ED ED ED ED ED ED ED INCINCINCINCINCINCINCINCINCINCINCINCINCOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXED ED ED ED ED ED ED ED ED ED ED ED ED ED ED INCINCINCINCINCINCINCINCINCINCINCINCINCINCINCOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOME in in in in in in in in in in in in in in in whiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhich ch ch ch ch ch ch ch ch ch ch ch ch ch ch J.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.P. M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. Morgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgan an an an an an an an an an an an an an an an an an an cancancancancancancancancancancancancancancancancancannotnotnotnotnotnotnotnotnotnotnotnotnotnotnotnotnotnot de de de de de de de de de de de de de de de de de de deterterterterterterterterterterterterterterterterterterminminminminminminminminminminminminminminminminminminmine ae ae ae ae ae ae ae ae ae ae ae ae ae ae ae ae ae ae a fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fair ir ir ir ir ir ir ir ir ir ir ir pripripripripripripripripripripripripripripripripriprice ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce maymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymay be be be be be be be be be be be be be be be be be be be ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargargargargarged ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed a ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca commommommommommommommommommommommommommommommommommommommissississississississississississississississississississionionionionionionionionionionionionionionionionionionion as as as as as as as as as as as as as as as as as as as op op op op op op op op op op op op op op op op opposposposposposposposposposposposposposposposposposposposed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed to to to to to to to to to to to to to to to to to a ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma markarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkup up up up up up up up up up up up up up up up up FIXFIXFIXFIXFIXFIXFIXFIXFIXFIXFIXED ED ED ED ED ED ED ED INCINCINCINCINCINCINCINCINCINCINCINCOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOMEOME in in in in in in in in in in in whiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhich ch ch ch ch ch ch ch ch ch ch J.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.P. M. M. M. M. M. M. M. M. M. M. M. Morgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgan an an an an an an an an an an an an an an an an an cancancancancancancancancancancancancancancannotnotnotnotnotnotnotnotnotnotnotnotnotnotnotnot de de de de de de de de de de de de deterterterterterterterterterterterterterterterterterminminminminminminminminminminminminminmine ae ae ae ae ae ae ae ae ae ae ae ae ae ae a fa fa fa fa fa fa fa fa fa fa fa fair ir ir ir ir ir ir ir ir ir pripripripripripripripripripripripripripriprice ce ce ce ce ce ce ce ce ce ce ce ce ce maymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymay be be be be be be be be be be be be be be be ch ch ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargargargarged ed ed ed ed ed ed ed ed ed ed ed ed ed ed a ca ca ca ca ca ca ca ca ca ca ca ca commommommommommommommommommommommommommommissississississississississississississississionionionionionionionionionionionionion as as as as as as as as as as as as as as as as op op op op op op op op op op op opposposposposposposposposposposposposposposposposed ed ed ed ed ed ed ed ed ed ed ed to to to to to to to to to a ma ma ma ma ma ma ma ma ma ma ma ma ma ma markarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkup up up up up up up up up up up up in in in in in in whiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhich ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch J.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.PJ.P. M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. M. Morgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgan an an an an an an an an an an an an an an an an an an cancancancancancancancancancancancancancancancancancancannotnotnotnotnotnotnotnotnotnotnotnotnotnotnotnotnotnotnot de de de de de de de de de de de de de de de de de de deterterterterterterterterterterterterterterterterterterterminminminminminminminminminminminminminmine ae ae ae ae ae ae ae ae ae ae ae ae ae ae ae ae ae a fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fair ir ir ir ir ir pripripripripripripripripripripripripripripripriprice ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce maymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymay be be be be be be be be be be be be be be be be be be be ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargargargarged ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed a ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca commommommommommommommommommommommommommommommommommommississississississississississississississississississionionionionionionionionionionionionionionionionionionion as as as as as as as as as as as as as as as as as as op op op op op op op op op op op op op op op op op opposposposposposposposposposposposposposposposposposposposed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed to to to to to to to to to to to to to to to to to to to a ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma markarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkup up up up up up up up up up up up up up up up in in in in in in whiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhiwhich ch ch ch ch ch ch ch ch ch ch J.PJ.PJ.PJ.PJ.PJ.PJ.PJ.P. M. M. M. M. M. M. M. M. M. M. M. M. Morgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgan an an an an an an an an an an an an an an cancancancancancancancancancancancannotnotnotnotnotnotnotnotnotnotnotnot de de de de de de de de de de de deterterterterterterterterterterterminminminminminminminminminminminminmine ae ae ae ae ae ae ae ae ae ae ae a fa fa fa fa fa fa fa fa fa fa fa fair ir ir ir ir ir pripripripripripripripripripriprice ce ce ce ce ce ce ce ce ce ce maymaymaymaymaymaymaymaymaymaymaymaymaymaymaymaymay be be be be be be be be ch ch ch ch ch chargargargargargargargargargargargargargargargargargarged ed ed ed ed ed ed ed a ca ca ca ca ca ca ca ca commommommommommommommommommommommommommommommommississississississississississississississionionionionionionionionionionionion as as as as as as as as as as as as as as op op op op op op op op op opposposposposposposposposposposposposposposed ed ed ed ed ed ed ed to to to to to to to to to to to to a ma ma ma ma ma ma ma ma ma ma ma ma markarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkup up up up up up up up up up up ch J.P. Morgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgorgan an an cannot deter e a fa pripripripriprice maymaymaymaymaymaymaymaymaymay be chargargargargargargargargargargargargarged a commission as op op op opposposposposed to a markup up up up ch J.P. Morgorgorgorgorgorgorgorgorgorgorgorgorgan an an cannot deter e a fa pripriprice maymaymaymaymaymay be chargargargargargargargargargarged a commission as op op opposposposed to a markup up up
markdokdokdokdokdokdokdokdokdown. Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Your advadvadvadvadvadvadvadvadvisoisoisoisoisoisoisoisoisoisoisoisoisoiso providvidvidvidvidvidvidvidvidvidvide you witwitwitwitwitwitwitwitwitwitwitwitwitwitwitwith th th th th th th th the he he he kupkupkupkupkup, m, markarkarkarkdowdowdowdowdowdowdow ississississississississississississississionionionionionionionionion ch ch ch ch charged ed ed ed ed ed ed on fixfixfixfixfixfixfixfixfixfixfixfixfixfixfixfixfixed ed ed ed ed ed or or or or or or or or or or or or or or or or or or or marmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarkdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdown.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn. Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Your ur ur ur ur ur ur ur ur ur ur ur ur ur ur ur ur ur advadvadvadvadvadvadvadvadvadvadvadvadvadvadvadvadvadvadvisoisoisoisoisoisoisoisoisoisoisoisoisoisoisoisoisoisoisor cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr can an an an an an an an an an an an an an an an an an an proproproproproproproproproproproproproproproproproproprovidvidvidvidvidvidvidvidvidvidvidvidvidvidvidvidvidvide ye ye ye ye ye ye ye ye ye ye ye ye ye ye ye ye ye ye you ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou witwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwith th th th th th th th th th th th th th th th th the he he he he he he he he he he he he he he he he he he marmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkup, m, m, m, m, m, m, m, m, m, m, m, m, m, m, m, m, m, m, markarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdown on on on on on on on on on on on on on on on on on on or cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr commommommommommommommommommommommommommommommommommommommissississississississississississississississississississionionionionionionionionionionionionionionionionionion ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargargargargarged ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed on on on on on on on on on on on on on on on on on on on fixfixfixfixfixfixfixfixfixfixfixfixfixfixfixfixfixfixfixed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed or or or or or or or or or or or or or marmarmarmarmarmarmarmarmarmarmarkdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdown.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn. Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Your ur ur ur ur ur ur ur ur ur ur ur ur ur ur advadvadvadvadvadvadvadvadvadvadvadvadvadvadvisoisoisoisoisoisoisoisoisoisoisoisoisor cr cr cr cr cr cr cr cr cr cr cr cr can an an an an an an an an an an an an proproproproproproproproproproproproprovidvidvidvidvidvidvidvidvidvidvidvidvidvide ye ye ye ye ye ye ye ye ye ye ye you ou ou ou ou ou ou ou ou ou ou ou ou witwitwitwitwitwitwitwitwitwitwitwitwitwith th th th th th th th th th th th the he he he he he he he he he he he he marmarmarmarmarmarmarmarmarmarmarmarmarkupkupkupkupkupkupkupkupkupkupkupkupkup, m, m, m, m, m, m, m, m, m, m, m, markarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkdowdowdowdowdowdowdowdowdowdowdowdowdowdown on on on on on on on on on on on on or cr cr cr cr cr cr cr cr cr cr cr cr commommommommommommommommommommommissississississississississississississionionionionionionionionionionionionion ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargarged ed ed ed ed ed ed ed ed ed on on on on on on on on on on on on on on fixfixfixfixfixfixfixfixfixfixfixfixfixfixfixed ed ed ed ed ed ed ed ed ed ed ed ed or or or or or or or or or or or or or or or or or marmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarkdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdown.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn. Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Your ur ur ur ur ur ur ur ur ur ur ur ur ur ur ur ur advadvadvadvadvadvadvadvadvadvadvadvadvadvadvadvadvadvadvisoisoisoisoisoisoisoisoisoisoisoisoisoisoisoisoisoisoisor cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr can an an an an an an an an an an an an an an an an an an proproproproproproproproproproproproproproproproproproprovidvidvidvidvidvidvidvidvidvidvidvidvidvidvidvidvidvidvide ye ye ye ye ye ye ye ye ye ye ye ye ye ye ye ye ye ye you ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou ou witwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwith th th th th th th th th th th th the he he he he he he he he he he he he he he he marmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkupkup, m, m, m, m, m, m, m, m, m, m, m, m, m, markarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkarkdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdown on on on on on on on on on on on on on on on on on on or cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr commommommommommommommommommommommommommommommommommommommissississississississississississississississississississionionionionionionionionionionionionionionionionionionion ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargargargargarged ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed on on on on on on on on on on on on on on on on on on on fixfixfixfixfixfixfixfixfixfixfixfixfixfixfixfixfixfixed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed or or or or or or or or marmarmarmarmarmarmarmarmarmarmarmarmarmarmarmarkdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdokdown.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn.wn. Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Your ur ur ur ur ur ur ur advadvadvadvadvadvadvadvadvadvadvadvadvadvadvadvadvisoisoisoisoisoisoisoisoisoisoisoisoisoisor cr cr cr cr cr cr can an an an an an an an an an an an an an proproproproproproproproproproproprovidvidvidvidvidvidvidvidvidvidvidvidvidvidvide ye ye ye ye ye ye ye ye ye ye ye ye ye ye you ou ou ou ou ou ou ou ou ou ou ou witwitwitwitwitwitwitwitwitwitwitwitwitwitwith th th th th th th the he he he he he he he he he he he he marmarmarmarmarmarmarmarmarmarmarmarmarmarkupkupkupkupkupkupkupkupkupkupkupkupkupkupkup, m, m, m, m, m, m, m, m, markarkarkarkarkarkarkarkarkarkarkarkarkarkdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdowdown on on on on on on on on on on on or cr cr cr cr cr cr cr cr commommommommommommommommommommommississississississississississississississississississionionionionionionionionionionionionion ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargarged ed ed ed ed ed ed ed ed ed ed ed ed ed on on on on on on on on on on fixfixfixfixfixfixfixfixfixfixfixfixfixed ed ed ed ed ed ed ed ed ed ed ed or or or or or marmarmarmarmarmarkdokdokdokdokdokdokdown.wn.wn.wn. Yo Yo Yo Yo Yo Your ur ur ur advadvadvadvadvadvadvisoisoisoisoisoisoisoisoisor cr cr cr cr can an an an an an proproproproproproproproprovidvidvidvidvide ye ye ye ye ye ye ye ye ye ye ye ye ye you ou ou ou ou ou witwitwitwith th th th th th th the he he he he he he marmarmarmarmarmarmarkupkupkupkupkupkupkup, m, m, m, m, m, m, m, m, m, markarkarkarkarkarkarkarkarkdowdowdowdowdowdowdown on on on on on on on or cr cr cr cr cr cr cr commommommommommommommommississississississississionionionionionion ch ch ch ch ch ch chargargargargargargargargargargargargargargargargargarged ed ed ed ed ed ed ed ed on on on on on on fixed ed ed ed ed ed ed or or or or marmarmarmarmarmarmarkdokdokdokdokdokdown.wn.wn. Yo Yo Yo Your ur ur advadvadvadvadvadvadvadvadvisoisoisoisoisoisoisoisoisor cr cr cr can an an an an an proproproproproproprovidvidvidvide ye ye ye ye ye ye ye ye you ou ou ou ou ou ou witwitwith th th th th the he he he he marmarmarmarmarmarmarkupkupkupkupkupkup, m, m, m, m, markarkarkarkarkarkarkdowdowdowdowdowdowdown on on on on or cr cr cr cr cr commommommommommississississississississionionionion ch ch ch ch chargargargargargargargargargargargargarged ed ed ed ed ed ed ed ed on on on on fixed ed ed ed ed ed ed
incincincincincincincincincincincinc itiitiitiitiitiitiitiitiitiitiitiitiitiitiitiitiitiincincincincincincincincincincincincincincincincincincincomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeome se se se se se se se se se se se se se se se se se securcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcuritiitiitiitiitiitiitiitiitiitiitiitiitiitiitiities.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.incincincinc itiitiitiitiitiitiitiitiitiitiitiitiitiincincincincincincincincincincincincincincincincomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeome se se se se se se se se se se se se se se se se se securcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcuritiitiitiitiitiitiitiitiitiities.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es. incincincincincincincincincincomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeome se se se se se se se se se se se se se securcurcurcurcurcurcurcurcurcuritiitiitiitiitiitiitiitiitiities.es.es.es.es.es.es.es.es.es.es.es.es.incincincincincincincincincincincincincincincincincomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeome se se se se se se se se se se se se se se se se securcurcurcurcurcurcurcurcurcurcurcurcurcurcurcurcuritiitiitiitiitiitiitiitiitiitiitiitiitiitiitiitiities.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es. incincincincincincincincincincincincincomeomeomeomeomeomeomeomeomeomeomeomeomeomeomeome se se se se se se se se se se se se se se se securcurcurcurcurcurcurcurcurcurcurcurcurcuritiitiitiitiitiitiitiitiitiitiitiities.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.
UNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIT IT IT IT IT IT IT IT IT IT IT IT IT IT INVENVENVENVENVENVENVENVENVENVENVENVENVENVENVESTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMENTENTENTENTENTENTENTENTENTENTENTENTENTENT TR TR TR TR TR TR TR TR TR TR TR TR TR TRUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTS AS AS AS AS AS AS AS AS AS AS AS AS AS AS AND ND ND ND ND ND ND ND ND ND ND ND ND ND ReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaRead yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yourourourourourourourourourourourourourourour pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr prospospospospospospospospospospospospospospospospospospectectectectectectectectectectectectectectectectus us us us us us us us us us us us us us us forforforforforforforforforforforforforforforforforforforfor co co co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls ls regregregregregregregregregregregregregregregregregardardardardardardardardardardardardardardardardardardardinginginginginginginginginginginginginginginginginginginging th th th th th th th th th th th th th th th th th th the se se se se se se se se se se se se se salealealealealealealealealealealealealealeales ls ls ls ls ls ls ls ls ls ls ls ls ls loadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoads, s, s, s, s, s, s, s, sursursursursursursursursursursursursursursurrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenderderderderderderderderderderderderderderderderder ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargarges es es es es es es es es es es es es es andandandandandandandandandandandandandandandandand ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot otherherherherherherherherherherherherherherherherher fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es forforforforforforforforforforforforforforforforforforfor su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch UNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIT IT IT IT IT IT INVENVENVENVENVENVENVENVENVENVENVENVENVENVENVESTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMENTENTENTENTENTENTENTENTENTENTENTENTENTENT TR TR TR TR TR TR TR TR TR TR TR TR TRUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTS AS AS AS AS AS AS AS AS AS AS AS AS AS AS AND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaRead yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yourourourourourourourourourourourourourourourourourourourour pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr prospospospospospospospospospospospospospospospospospospospospectectectectectectectectectectectectectectectectectectectectus us us us us us us us us us us us us us us us us forforforforforforforforforforforforforforforforforforfor co co co co co co co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls regregregregregregregregregregregregregregregregregregregregardardardardardardardardardardardardardardardardardardardardinginginginginginginginginginginginginginginginginginging th th th th th th th th th th th th th th th the se se se se se se se se se se se se se se se se se se se salealealealealealealealealealealealealealealealealealealeales ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls loadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoads, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, sursursursursursursursursursursursursursursursursursursursurrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenderderderderderderderderderderderderderderderderderderderder ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargargargargargarges es es es es es es es es es es es es es es es es es es es andandandandandandandandandandandandandandandandandandandand ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot otherherherherherherherherherherherherherherherherherherherher fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es es forforforforforforforforforforforforforforforforforforfor su su su su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch UNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIT IT IT IT IT IT INVENVENVENVENVENVENVENVENVENVENVENVESTMSTMSTMSTMSTMSTMSTMSTMENTENTENTENTENTENTENTENTENTENT TR TR TR TR TR TR TR TR TR TR TRUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTS AS AS AS AS AS AS AND ND ND ND ND ND ND ND ND ND ND ND ReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaRead yd yd yd yd yd yd yd yd yd yd yd yd yd yourourourourourourourourourourourourourourour pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr prospospospospospospospospospospospospospospospospospospectectectectectectectectectectectectectectectectectus us us us us us us us us us us us forforforforforforforforforforforforforforforforforfor co co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls regregregregregregregregregregregregregregregregregregardardardardardardardardardardardardardardardinginginginginginginginginginginginginginginging th th th th th th th th th th th the se se se se se se se se se se se se se salealealealealealealealealealealealealeales ls ls ls ls ls ls ls ls ls ls loadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoads, s, s, s, s, s, s, s, s, s, sursursursursursursursursursursursursursursursurrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenderderderderderderderderderderderderderderderderder ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargarges es es es es es es es es es es es es es es es andandandandandandandandandandandandandandandandandandandand ot ot ot ot ot ot ot ot ot ot ot ot otherherherherherherherherherherherherherherherherher fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es forforforforforforforforforforforforforforfor su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch UNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIUNIT IT IT IT IT IT IT INVENVENVENVENVENVENVENVENVENVENVESTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMENTENTENTENTENTENTENTENTENTENTENT TR TR TR TR TR TR TR TR TR TR TR TR TRUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTS AS AS AS AS AS AS AS AS AS AS AS AS AS AS AND ND ND ND ND ND ND ND ND ND ND ND ND ND ReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaRead yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yourourourourourourourourourourourourourourourourourourour pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr prospospospospospospospospospospospospospospospospospospospospectectectectectectectectectectectectectectectectectectectectus us us us us us us us us us us us us us us us us us us forforforforforforforforforforforforforforforforforforforfor co co co co co co co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls ls ls regregregregregregregregregregregregregregregregregregregregardardardardardardardardardardardardardardardardardardardinginginginginginginginginginginginginginginginginginging th th th th th th th th th th th th th th the se se se se se se se se se se se se se se se se se se salealealealealealealealealealealealealealealealealeales ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls loadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoads, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, sursursursursursursursursursursursursursursursursursursurrenrenrenrenrenrenrenrenrenrenrenrenrenrenrenderderderderderderderderderderderderderderderder ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargargargargargargargargarges es es es es es es es es es es es es es es es es es es andandandandandandandandandandandandandandandandandandandand ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot otherherherherherherherherherherherherherherher fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es es forforforforforforforforforforforforforforforforforforforfor su su su su su su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch UNIUNIUNIUNIUNIUNIUNIUNIUNIUNIT IT IT IT IT IT INVENVENVENVENVENVENVENVESTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMSTMENTENTENTENTENTENTENTENTENT TR TR TR TR TR TR TR TRUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTUSTS AS AS AS AS AS AS AS AS AS AS AND ND ND ND ND ND ND ND ND ND ND ReaReaReaReaReaReaReaReaReaReaReaReaRead yd yd yd yd yd yd yd yd yd yd yd yourourourourourourourourourourourourour pr pr pr pr pr pr pr pr pr pr pr pr prospospospospospospospospospospospospospospospospospectectectectectectectectectectectus us us us us us us us us us forforforforforforforforforforforfor co co co co co co co co co co co co complmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteete de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls regregregregregregregregregregregregregardardardardardardardardardardardardardardardinginginginginginginginginginginginging th th th th th th th the se se se se se se se se se se salealealealealealealealealealealeales ls ls ls ls ls ls loadoadoadoadoadoadoadoadoadoadoadoadoadoadoads, s, s, s, s, s, sursursursursursursursursursurrenrenrenrenrenrenrenrenrenderderderderderderderderderderderderder ch ch ch ch ch ch ch ch ch ch ch ch chargargargargargargargargargargargargarges es es es es es es es es es es es es andandandandandandandandandandandandandand ot ot ot ot ot ot ot ot ot ot ot otherherherherherherherherherher fe fe fe fe fe fe fe fe fees es es es es es es es es es es es forforforforforforforforforforforforforfor su su su su su su su su su su such ch ch ch ch ch ch ch ch d yd yd yd yd yd yd yd yd y pr pr pr prosposposposposp mplmplmplmplmpl regregregregregregregregregregregregregregregregreg inginginginginginginginginginginginginging s, s, s, s, s, s, s, argargargargargargargargargargargargargargargargargducducducducducducts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Th ddiddiddiddiddiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnal tr tr tr tr tr actactactactactactactionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe lielielielielielielielielielielied fd fd fd fd fd fd fd fd fd fd fd fd f chachachacha demdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptipti of of of of of of of of of of of of ch ch ch ch ch ch ducducducducducducducts.ts.ts.ts.ts.d yd yd yd yd y pr pr prosposposp mplmplmpl regregregregregregregregregregregregreg inginginginginginginginginginginging s, s, s, s, s, s, argargargargargargargargargargargargargarg
VARVARVARVARVARVARVARVARVARVARVARVARVARVARVARIABIABIABIABIABIABIABIABIABIABIABIABIABIABIABLE LE LE LE LE LE LE LE LE LE LE LE INSINSINSINSINSINSINSINSINSINSINSINSINSINSINSURAURAURAURAURAURAURAURAURAURAURAURAURAURAURANCENCENCENCENCENCENCENCENCENCENCENCENCENCENCE proproproproproproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Th Th Th Th Th Th Th Th Th Thereereereereereereereereereereereereereereereereereereereere ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne no ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao addiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnal tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr transansansansansansansansansansansansansansansansansansansansactactactactactactactactactactactactactactactactactactactactionionionionionionionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es appappappappappappappappappappappappappappappappappappappapplielielielielielielielielielielielielielielielielielielied fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd for or or or or or or or or or or or or or or or or or or or purpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurchachachachachachachachachachachachachachachachachachasessessessessessessessessessessessessessessessessessesses or or or or or or or or or or or or or or or or or or or re re re re re re re re re re re re re re re re re re re redemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptionsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsons of of of of of of of of of of of of of of of of of of of of su su su su su su su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch proproproproproproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.VARVARVARVARVARVARVARVARIABIABIABIABIABIABIABIABIABIABIABLE LE LE LE LE LE LE INSINSINSINSINSINSINSINSINSINSINSURAURAURAURAURAURAURAURAURAURAURAURAURANCENCENCENCENCENCENCENCENCENCENCE producducducducts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th There are no addiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotionalnalnalnalnal tr tr tr tr transactactactactactactactionionionionionionion fe fe fe fe fe fe fees applielielielielielielied fd fd fd fd fd fd fd fd fd for purchachachases or redemdemdemdemdemptiptiptiptiptiptiptiptiptiptions of of of of of of of such ch ch ch producducducducducts.ts.ts.ts.ts.ts.VARVARVARVARVARVARVARVARVARVARVARVARVARVARVARIABIABIABIABIABIABIABIABIABIABIABIABIABIABIABLE LE LE LE LE LE LE LE LE LE LE INSINSINSINSINSINSINSINSINSINSINSINSINSINSINSURAURAURAURAURAURAURAURAURAURAURAURAURAURAURANCENCENCENCENCENCENCENCENCENCENCENCENCENCENCE proproproproproproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Th Thereereereereereereereereereereereereereereereereere ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne no ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao addiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnal tr tr tr tr tr transansansansansansansansansansansansansansansansansansansactactactactactactactactactactactactactactactactactactionionionionionionionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es es appappappappappappappappappappappappappappappappappappappapplielielielielielielielielielielielielielielielielielielielied fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd for or or or or or or or or or or or or or or or or or purpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurchachachachachachachachachachachachachachachachachachachachasessessessessessessessessessessessessessessessessessesses or or or or or or or or or or or or or or or or or or or or re re re re re re re re re re re re re re re re re re redemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptionsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsons of of of of of of of of of of of of of of of of of of su su su su su su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch proproproproproproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. VARVARVARVARVARVARVARVARVARVARVARVARVARVARIABIABIABIABIABIABIABIABIABIABIABIABLE LE LE LE LE INSINSINSINSINSINSINSINSINSINSINSINSURAURAURAURAURAURAURAURAURAURAURAURAURAURANCENCENCENCENCENCENCENCENCE proproproproproproproproproproproproproproducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Th Thereereereereereereereereereere ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne no ao ao ao ao ao ao ao ao ao ao ao ao addiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnalnalnal tr tr tr tr tr transansansansansansansansansactactactactactactactactactionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es appappappappappappappappappappappappappapplielielielielielielielielielielielielielielied fd fd fd fd fd fd fd fd fd for or or or or or or or or or or purpurpurpurpurpurpurpurpurpurpurpurpurchachachachachachachachachachachachachachasessessessessessessessessessessessessesses or or or or or or or or or or or or or re re re re re re re re re re re redemdemdemdemdemdemdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptionsonsonsonsonsonsonsonsonsonsonsonsonsons of of of of of of of of of of of of su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch proproproproproproproproproproproproproproproducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.VARVARVARVARVARVARVARVARVARVARVARVARVARVARVARIABIABIABIABIABIABIABIABIABIABIABIABIABIABIABLE LE LE LE LE LE INSINSINSINSINSINSINSINSINSINSINSINSINSINSURAURAURAURAURAURAURAURAURAURAURAURAURAURAURANCENCENCENCENCENCENCENCENCENCENCENCENCENCE proproproproproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Th Thereereereereereereereereereereereereereereereereere ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne ne ne no ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao addiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnal tr tr tr tr tr tr tr tr tr tr tr tr transansansansansansansansansansansansansansansansansansansansactactactactactactactactactactactactactactactactactactactactionionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es appappappappappappappappappappappappappappappappappappapplielielielielielielielielielielielielielielielied fd fd fd fd fd fd fd fd fd fd fd fd fd fd for or or or or or or or or or or or or or purpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurchachachachachachachachachachachachachachachachachachachachasessessessessessessessessessessessessessessessessessesses or or or or or or or or or or or or or or or re re re re re re re re re re re re re re redemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptionsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsons of of of of of of of of of of of of of of of of su su su su su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch proproproproproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. VARVARVARVARVARVARVARVARVARVARVARVARVARVARIABIABIABIABIABIABIABIABIABIABIABIABIABLE LE LE LE INSINSINSINSINSINSINSINSINSURAURAURAURAURAURAURAURAURAURAURAURAURAURANCENCENCENCENCENCENCENCENCENCE proproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Th Thereereereereereereereereereereere ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne no ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao addiddiddiddiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnalnalnalnalnalnalnal tr tr tr tr tr tr tr transansansansansansansansansansansansansansansansansactactactactactactactactactactactactactactactactactionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es appappappappappappappappappappappappappappappappappapplielielielielielielielielielielied fd fd fd fd fd fd fd fd fd fd fd fd for or or or or or or or or or or or purpurpurpurpurpurpurpurpurpurpurpurpurpurchachachachachachachachachachachachachachachachachasessessessessessessessessessessessessessessesses or or or or or or or or or or or or or or re re re re re re re re re redemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptionsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsons of of of of of of of of of of of of of of su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch proproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.
ForForForForForForForFor w iw iw iw iw iw iw iw iw iw iw iw iw iw iw i ad ad ad ad ad ad ad ad ad ffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffefferinrinrinrinrinrinrinrinrinrinrinrinrinrinring dg dg dg dg dg dg dg dg d ts ts ts ts ts ts ts forforforforforforforforforforforforforforforforfor mplmplmplmplmplmplmplmpleteeteeteeteeteeteete de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls thethethethethethethethethethethethe of of of of of of of of of of of of of of of offerferferferferferferferferferferferferferferferferferinginginginginginginginginginginginging iceiceiceiceiceiceiceiceiceiceiceiceice hichichichichichichichichichichichich ih ih ih ih ih ih ih ih ih ih ih ih ih inclnclnclnclnclnclncludeudeudeudeudeudeudeudeudeForForForForForForForForForForForForForForForForFor ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne new iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw issussussussussussussussussussussussussussussussussussussues,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es, re re re re re re re re re re re re re re re re re re re read ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad youyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyour or or or or or or or or or or or or or or or or or or offeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffefferinrinrinrinrinrinrinrinrinrinrinrinrinrinrinrinrinrinring dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg docuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocumenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenments ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts forforforforforforforforforforforforforforforforforforfor co co co co co co co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls on on on on on on on on on on on on on on on on on on on on thethethethethethethethethethethethethethethethethethethethe of of of of of of of of of of of of of of of of of of offerferferferferferferferferferferferferferferferferferferferinginginginginginginginginginginginginginginginginginginging pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr priceiceiceiceiceiceiceiceiceiceiceiceiceiceiceiceiceiceiceice, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, whichichichichichichichichichichichichichichichichichich ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih inclnclnclnclnclnclnclnclnclnclnclnclnclnclnclnclnclnclnclncludeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudes as as as as as as as as as as as as as as as as as as as aForForForForFor new issues, read ad ad ad ad your offeffeffeffeffeffeffeffering dg dg dg documents ts ts ts ts forforforforforfor complmplmplmpleteeteeteeteete de de de detaitaitaitails ls ls ls ls on thethethethethethethethethe of of of offerferferferfering price, whichichich ih ih inclnclncludeudeudeudeudes aForForForForForForForForForForForForForForForForForForForFor ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne new iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw issussussussussussussussussussussussussussussussussussussussues,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es, re re re re re re re re re re re re re re re re re read ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad youyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyour or or or or or or or or or or or or or or or or or offeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffefferinrinrinrinrinrinrinring dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg docuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocumenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenments ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts forforforforforforforforforforforforforforforforforforforfor co co co co co co co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls on on on on on on on on on on on on on on on on on on on on thethethethethethethethethethethethethethethethethethethethe of of of of of of of of of of of of of of of of of of of offerferferferferferferferferferferferferferferferferferinginginginginginginginginginginginginginginginginginging pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr priceiceiceiceiceiceiceiceiceiceiceiceiceiceiceiceiceiceice, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, whichichichichichichichichichichichichichichich ih ih ih ih ih ih ih ih ih ih inclnclnclnclnclnclnclnclnclnclnclnclnclnclnclnclnclnclncludeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudes as as as as as as as as as as as as as as as as as as as a ForForForForForForForForForForForForForForForFor ne ne ne ne ne ne ne ne ne ne ne ne new iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw iw issussussussussussussussussussussussussussussussussussussues,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es, re re re re re re re re re re re read ad ad ad ad ad ad ad ad ad ad ad ad ad ad youyouyouyouyouyouyouyouyouyouyouyouyouyouyouyour or or or or or or or or or offeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffefferinrinrinrinrinrinrinring dg dg dg dg dg dg dg dg dg dg dg dg dg dg docuocuocuocuocuocuocuocuocuocuocuocuocuocuocumenmenmenmenmenmenmenmenmenmenmenmenmenmenments ts ts ts ts ts ts ts ts ts ts ts ts ts ts forforforforforforforforforforforfor co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls on on on on on on on on on on on on on thethethethethethethethethethethethethethethe of of of of of of of of of of of offerferferferferferferferferferferferferinginginginginginginginginginginginginginginging pr pr pr pr pr pr pr pr pr pr pr priceiceiceiceiceiceiceiceiceiceiceiceiceiceice, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, whichichichichichichichichichichich ih ih ih ih ih ih ih ih ih inclnclnclnclnclnclnclnclnclnclnclnclnclnclncludeudeudeudeudeudeudeudeudeudeudeudeudeudeudes as as as as as as as as as as as as as as as as as as aSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUREUREUREUREUREUREUREUREUREUREUREUREURED ND ND ND ND ND ND ND ND ND ND NOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTESSSSSSSSSS
ForForForForForForForForForForForForForForForForForFor ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne new iw iw iw iw iw iw iw iw iw iw iw iw issussussussussussussussussussussussussussussussussussussues,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es, re re re re re re re re re re re re re re re re re read ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad ad youyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyour or or or or or or or or or or or or or or or or offeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffefferinrinrinrinrinrinrinrinrinrinrinrinring dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg dg docuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocumenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenments ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts forforforforforforforforforforforforforforforforforfor co co co co co co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls on on on on on on on on on on on on on on on on on on thethethethethethethethethethethethethethethethethethethethe of of of of of of of of of of of of of of of of of offerferferferferferferferferferferferferferferferferferferinginginginginginginginginginginginginginginginginginginging pr pr pr pr pr pr pr pr pr pr pr pr pr priceiceiceiceiceiceiceiceiceiceiceiceiceiceiceiceiceiceice, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, w, whichichichichichichichichichichichichichichich ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih inclnclnclnclnclnclnclnclnclnclnclnclnclnclnclnclnclncludeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudes as as as as as as as as as as as as as as as as as as a ForForForForForForForForForForForForForFor ne ne ne ne ne ne ne ne ne ne ne new iw iw iw iw iw iw iw iw iw issussussussussussussussussussussussussussues,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es,es, re re re re re re re re re re re read ad ad ad ad ad ad ad ad ad ad ad ad ad youyouyouyouyouyouyouyouyouyouyouyouyouyouyouyouyour or or or or or or or or offeffeffeffeffeffeffeffeffeffeffeffeffefferinrinrinrinrinrinrinring dg dg dg dg dg dg dg dg dg dg dg dg docuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocuocumenmenmenmenmenmenmenmenmenmenmenmenmenmenments ts ts ts ts ts ts ts ts ts ts ts ts ts ts forforforforforforforforforforforforforforfor co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls on on on on on on on on on on on on on on thethethethethethethethethethethethethethethe of of of of of of of of of of offerferferferferferferferferferferferferferinginginginginginginginginginginginging pr pr pr pr pr pr pr pr pr pr priceiceiceiceiceiceiceiceiceiceiceiceiceiceice, w, w, w, w, w, w, w, w, w, w, w, w, w, w, whichichichichichichichichichichichich ih ih ih ih ih ih ih ih ih ih ih inclnclnclnclnclnclnclnclnclnclnclnclnclncludeudeudeudeudeudeudeudeudeudeudeudeudeudeudeudes as as as as as as as as as as as as as as as a STRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUREUREUREUREUREUREUREUREUREUREUREUREUREUREURED ND ND ND ND ND ND ND ND ND ND ND ND ND NOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTESSSSSSSSSSSSSSS selselselselselselselselselselselselselselselselselselsellinlinlinlinlinlinlinlinlinlinlinlinlinlinlinlinlinlinling cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg conconconconconconconconconconconconconconconconconconconcessessessessessessessessessessessessessessessessessionionionionionionionionionionionionionionionionionionion. I. I. In cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn caseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseases ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws wherherherherherherherherherherherherherherherherherherherhere se se se se se se se se se se se se se se se strutrutrutrutrutrutrutrutrutrutrutrutrutrutrutrutrutrutrutructuctuctuctuctuctuctuctuctuctuctuctuctuctuctuctucturedredredredredredredredredredredredredredredredredredredred pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr produoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoductsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctscts ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce callallallallallallallallallallallallallallallallalled ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed befbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbeforeoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreore ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma maturturturturturturturturturturturturturturturturturturturturityityityityityityityityityityityityityityityityityityity, f, f, f, f, f, f, f, f, f, f, f, f, f, f, f, f, f, feeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseesees ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne not ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot rebrebrebrebrebrebrebrebrebrebrebrebrebrebrebrebrebateateateateateateateateateateateateateateateateated. d. d. d. d. d. d. d. d. d. d. d. d. d. d. d. d. d. STRSTRSTRSTRSTRSTRSTRSTRSTRUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUREUREUREUREUREUREUREUREUREUREURED ND ND ND ND ND ND ND ND ND NOTEOTEOTEOTEOTEOTEOTEOTEOTEOTESSSSSSSS selselselselselsellinlinlinlinlinlinlinlinlinlinlin ionionionionionion herherherherher trutrutructuctucturedredredredredredredredred oduoduoduoduoduoduoduoduoductsctscts allallallallallallallallalled ed ed ed ed befbefbefbefbefbefbefbefbefbef turturturturityityityityityityityity, f, f, f, f, f, f, f, f, f, f, f, f ot ot ot rebrebrebrebateateated. d. d. d. d. d. d. d. d. STRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUREUREUREUREUREUREUREUREUREUREUREUREUREUREURED ND ND ND ND ND ND ND ND ND ND ND ND ND ND NOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTESSSSSSSSSSSSSSS selselselselselselselselselselselselselselselselselselselsellinlinlinlinlinlinlinlinlinlinlinlinlinlinlinling cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg conconconconconconconconconconconconconconconconconconconconcessessessessessessessessessessessessessessessessessessessessionionionionionionionionionionionionionionionionionionion. I. I. In cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn caseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseases ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws wherherherherherherherherherherherherherherherherherherherhere se se se se se se se se se se se se se se se se se se strutrutrutrutrutrutrutrutrutrutrutrutrutrutructuctuctuctuctuctuctuctuctuctuctuctuctuctuctuctuctucturedredredredredredredredredredredredredredredredredredredred pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr produoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoductsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctscts ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce callallallallallallallallallallallallallalled ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed befbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbeforeoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreore ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma maturturturturturturturturturturturturturturturturturityityityityityityityityityityityityityityityityityityity, f, f, f, f, f, f, f, f, f, feeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseesees ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne not ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot rebrebrebrebrebrebrebrebrebrebrebrebrebrebrebrebrebateateateateateateateateateateateateateateateateateateateated. d. d. d. d. d. d. d. d. d. d. d. d. d. d. STRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRUCTUCTUCTUCTUCTUCTUCTUCTUCTUREUREUREUREUREUREUREUREUREURED ND ND ND ND ND ND ND ND ND NOTEOTEOTEOTEOTEOTEOTEOTEOTESSSSSSS selselselselselselselselselselselselselselselsellinlinlinlinlinlinlinlinlinlinlinlinling cg cg cg cg cg cg cg cg cg cg cg conconconconconconconconconconconconconconconconconconcessessessessessessessessessessessessessessessessionionionionionionionionionionionionionionionion. I. I. In cn cn cn cn cn cn cn cn cn cn cn cn cn cn caseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseases ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws wherherherherherherherherherherherherherherherherherhere se se se se se se se se se se se se strutrutrutrutrutrutrutrutrutrutrutrutrutrutructuctuctuctuctuctuctuctuctuctuctucturedredredredredredredredredredredredredredredred pr pr pr pr pr pr pr pr pr pr pr pr pr produoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoductsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctscts ar ar ar ar ar ar ar ar ar ar ar ar ar are ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce callallallallallallallallallallallallalled ed ed ed ed ed ed ed ed ed ed ed ed ed ed befbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbeforeoreoreoreoreoreoreoreoreoreoreoreoreoreoreore ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma maturturturturturturturturturturturturturturturturturturityityityityityityityityityityityity, f, f, f, f, f, f, f, feeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseesees ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne not ot ot ot ot ot ot ot ot ot ot ot ot rebrebrebrebrebrebrebrebrebrebrebrebrebrebateateateateateateateateateateateateateateateated. d. d. d. d. d. d. d. d. d. STRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUREUREUREUREUREUREUREUREUREUREUREUREUREURED ND ND ND ND ND ND ND ND ND ND ND ND ND NOTEOTEOTEOTEOTEOTEOTEOTEOTEOTESSSSSSSSSS selselselselselselselselselselselselselselselselselselselsellinlinlinlinlinlinlinlinlinlinling cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg cg conconconconconconconconconconconconconconconconconconconconcessessessessessessessessessessessessessessessessessessessessionionionionionionionionionionionionionionionionionionionion. I. I. I. I. I. I. I. I. I. I. I. I. I. I. In cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn caseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseaseases ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws wherherherherherherherherherherherherherherherherherherhere se se se se se se se se se se se se se se se se se se se strutrutrutrutrutrutrutrutrutrutrutrutrutrutrutrutrutrutrutructuctuctuctuctuctuctuctuctuctuctuctuctuctuctuctuctuctucturedredredredredredredredredredredredredredredredredredredred pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr produoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoduoductsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctsctscts ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce ce callallallallallallallallallallallallallallallallalled ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed ed befbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbefbeforeoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreore ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma ma maturturturturturturturturturturturturturturturturturturturityityityityityityityityityityityityityityityityityityity, f, f, f, f, f, f, f, f, f, f, f, f, f, f, feeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseesees ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne not ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot rebrebrebrebrebrebrebrebrebrebrebrebrebrebrebrebrebrebrebateateateateateateateateateateateateateateateateateateateated. d. d. d. d. d. d. d. d. d. d. d. d. d. d. d. d. d. d. STRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRSTRUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUCTUREUREUREUREUREUREUREUREUREUREUREUREURED ND ND ND ND ND ND ND ND ND ND ND ND ND NOTEOTEOTEOTEOTEOTEOTEOTEOTEOTEOTESSSSSSSSS selselselselselselselselselselselselselselsellinlinlinlinlinlinlinlinlinling cg cg cg cg cg cg cg cg cg cg cg cg conconconconconconconconconconconconconconconconconconcessessessessessessessessessessessionionionionionionionionionionionionionionionion. I. I. In cn cn cn cn cn cn cn cn cn cn cn caseaseaseaseaseaseaseaseaseaseaseaseaseaseases ws ws ws ws ws ws ws ws ws ws ws ws ws ws ws wherherherherherherherherherherherhere se se se se se se se se strutrutrutrutrutrutrutrutrutrutrutrutructuctuctuctuctuctuctuctuctuctuctuctucturedredredredredredredredredredredredredred pr pr pr pr pr pr pr pr pr pr produoduoduoduoduoduoduoduoduoduoduoduoduoductsctsctsctsctsctsctsctsctsctsctsctscts ar ar ar ar ar ar ar ar ar are ce ce ce ce ce ce ce ce callallallallallallallalled ed ed ed ed ed ed ed ed ed befbefbefbefbefbefbefbefbefbefbefbefbefbefbefbeforeoreoreoreoreoreoreoreoreoreoreoreoreoreore ma ma ma ma ma ma ma ma ma ma ma maturturturturturturturturturturturturityityityityityityityityityityityityityity, f, f, feeseeseeseeseeseeseeseeseeseesees ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne not ot ot ot ot ot ot ot ot ot ot ot ot ot ot rebrebrebrebrebrebrebrebrebateateateateateateateateateateateateateateateateated. d. d. d. d. d. d. d. sel g cg cg cg cg cg cg cg cg cg cg cg cg cg concession. In cases where structured pr pr pr pr pr pr pr pr products are called before maturityityityityityityityityityityity, f, f, fees are not rebated. sel g cg cg cg cg cg cg cg cg cg cg cg concession. In cases where structured pr pr pr products are called before maturityityityityityityity, f, f, fees are not rebated.
ReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaRead yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yourourourourourourourourourourourourourourourourourourourour pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr prospospospospospospospospospospospospospospospospospospospospectectectectectectectectectectectectectectectectectectectus us us us us us us us us us us us us us us us us us forforforforforforforforforforforforforforforforforforforfor co co co co co co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls regregregregregregregregregregregregregregregregregregregregardardardardardardardardardardardardardardardardardardardinginginginginginginginginginginginginginginginginginginging th th th th th th th th th th th th th th th th th th th the se se se se se se se se se se se se se se se se se se salealealealealealealealealealealealealealealealealealeales ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls loadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoad, r, r, r, r, r, r, r, r, r, r, r, r, r, r, r, r, redeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedemptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptionionionionionionionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es es andandandandandandandandandandandandandandandandandandand ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot otherherherherherherherherherherherherherherherherherherherher fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es es forforforforforforforforforforforforforforforforforforforfor su su su su su su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch Read yd yd yd yd yd yd yd yd y ectectect forforforforforforforforforforforfor mplmplmplmplmplmplmplmpleteeteete de de de de de de de de detaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ardardardardardardardinginginginginginginginginging th th th th th th th alealealealealealealeales ls ls ls ls ls ls ls loadoadoadoadoadoadoadoad edeedeedeedeedeedemptmptmptionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe andandandandandand ot ot ot otherherherher fe fe fe fe fe fe fe fe fe fe fe fe forforforforforforforforforforforforforfor ch ch ch ReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaRead yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yourourourourourourourourourourourourourourourourourourourour pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr prospospospospospospospospospospospospospospospospospospospospectectectectectectectectectectectectectectectectectectectectus us us us us us us us us us us us us us us us us us us us forforforforforforforforforforforforforforforforforforfor co co co co co co co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls regregregregregregregregregregregregregregregregregregregregardardardardardardardardardardardardardardardardardardardardinginginginginginginginginginginginginginginginginginginging th th th th th th th th th th th th th th th th the se se se se se se se se se se se se se se se se se se salealealealealealealealealealealealealealealealealealealeales ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls loadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoad, r, r, r, r, r, r, r, r, r, r, redeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedemptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptionionionionionionionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es andandandandandandandandandandandandandandandandandandandand ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot otherherherherherherherherherherherherherherherherherherherher fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es es forforforforforforforforforforforforforforforforforforforfor su su su su su su su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaRead yd yd yd yd yd yd yd yd yd yd yd yourourourourourourourourourourourourourourourour pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr prospospospospospospospospospospospospospospospospospospectectectectectectectectectectectectectectus us us us us us us us us us us us forforforforforforforforforforforforforforforfor co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls regregregregregregregregregregregregregregregregregregardardardardardardardardardardardardardardardardardinginginginginginginginginginginginginginging th th th th th th th th th th th the se se se se se se se se se se se se salealealealealealealealealealealealealealealealeales ls ls ls ls ls ls ls ls ls ls loadoadoadoadoadoadoadoadoadoadoadoadoadoadoad, r, r, r, r, r, r, r, r, r, r, redeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedemptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptionionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es andandandandandandandandandandandandandandandandand ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot otherherherherherherherherherherherherherherherherher fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es forforforforforforforforforforforforforforfor su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaReaRead yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yd yourourourourourourourourourourourourourourourourourourourour pr pr pr pr pr pr pr pr pr pr pr pr pr pr pr prospospospospospospospospospospospospospospospospospospospospectectectectectectectectectectectectectectectectectectectectus us us us us us us us us us us us us us us us us us us us forforforforforforforforforforforforforforforforforforfor co co co co co co co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteeteeteeteeteeteeteeteeteeteeteete de de de de de de de de de de de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls regregregregregregregregregregregregregregregregregregregregardardardardardardardardardardardardardardardardardardardardinginginginginginginginginginginginginginginginginginginging th th th th th th th th th th th th th th th the se se se se se se se se se se se se se se se se se se se salealealealealealealealealealealealealealealealealealeales ls ls ls ls ls ls ls ls ls ls ls ls ls ls ls loadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoad, r, r, r, r, r, r, r, r, r, r, r, r, r, r, redeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedeedemptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptmptionionionionionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es andandandandandandandandandandandandandandandandandandand ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot ot otherherherherherherherherherherherherherherherherherher fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es es forforforforforforforforforforforforforforforforforfor su su su su su su su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ReaReaReaReaReaReaReaReaReaReaReaReaReaRead yd yd yd yd yd yd yd yd yd yd yd yourourourourourourourourourourourourourourour pr pr pr pr pr pr pr prospospospospospospospospospospospospospospospectectectectectectectectectectectectus us us us us us us us us forforforforforforforforforforforforfor co co co co co co co co co co co co co complmplmplmplmplmplmplmplmplmpleteeteeteeteeteeteete de de de de de de de de detaitaitaitaitaitaitaitaitaitaitaitaitails ls ls ls ls ls ls ls regregregregregregregregregregardardardardardardardardardardardardinginginginginginginginginginginging th th th th th th th the se se se se se se se se se salealealealealealealealealealeales ls ls ls ls ls ls ls ls loadoadoadoadoadoadoadoadoadoadoadoadoadoadoadoad, r, r, r, r, redeedeedeedeedeedeedeedeedeedemptmptmptmptmptmptmptmptmptmptmptionionionionionionionionionionionion fe fe fe fe fe fe fe fees es es es es es es es andandandandandandandandandandandandandand ot ot ot ot ot ot ot ot ot ot ot ot otherherherherherherherher fe fe fe fe fe fe fe fees es es es es es forforforforforforforforforforforforfor su su su su su su su su su su such ch ch ch ch ch ch ch ch ch MUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTUALUALUALUALUALUALUALUALUALUALUALUALUAL FU FU FU FU FU FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDS22222222222222
d yd yd yd yd yd yd yd y pr pr pr prosposposposposp mplmplmplmplmpl regregregregregregregregregregregregreg inginginginginginginginginginginginginginging , r, r, r, r mptmptmptmptmptducducducducducducts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Th Th Th Th ddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnal tr tr tr tr tr tr tr actactactactactactactionionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe lielielielielielielielielielied fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd f chachachacha demdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptiptiptiptiptipti of of of of of of of of of of of of of of ch ch ch ch ducducducducducducducts.ts.ts.ts.ts.ts.ts.222222d yd yd yd yd yd y pr pr prosposposp mplmplmpl regregregregregregregregregregreg inginginginginginginginginginging , r, r, r, r mptmptmpt
MUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTUALUALUALUALUALUALUALUALUALUALUALUALUALUALUAL FU FU FU FU FU FU FU FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDS2222222222222 proproproproproproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Th Th Th Th Th Th Th Th Th Th Th Thereereereereereereereereereereereereereereereereereereereere ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne no ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao addiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnal tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr transansansansansansansansansansansansansansansansansansansansactactactactactactactactactactactactactactactactactactactactionionionionionionionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es es appappappappappappappappappappappappappappappappappappappapplielielielielielielielielielielielielielielielielielielielied fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd for or or or or or or or or or or or or or or or or or or or purpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurchachachachachachachachachachachachachachachachachachachachasessessessessessessessessessessessessessessessessessessesses or or or or or or or or or or or or or or or or or or or or re re re re re re re re re re re re re re re re re re re redemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptionsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsons of of of of of of of of of of of of of of of of of of of of su su su su su su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch proproproproproproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.MUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTUALUALUALUALUALUALUALUALUALUALUALUAL FU FU FU FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDS2222222222 producducducducducts.ts.ts.ts.ts.ts. Th Th Th Th Th Th There are ne n ddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotionalnalnalnalnalnalnal tr tr tr tr tr actactactactionionion fe fe fe fe fe fees es lielielielielied fd fd fd fd fd fd fd fd for or chachachachacha or or re redemdemdemdemdemptiptiptiptiptipti of of of of of such ch ch ch ch ducducducducducts.ts.ts.ts.ts.ts.ts.MUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTUALUALUALUALUALUALUALUALUALUALUALUALUALUALUAL FU FU FU FU FU FU FU FU FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDS proproproproproproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Th Thereereereereereereereereereereereereereereereereereereereere ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne ne ne ne no ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao ao addiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnal tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr transansansansansansansansansansansansansansansansansansansansactactactactactactactactactactactactactactactactactactactactionionionionionionionionionionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es es es es es es es es appappappappappappappappappappappappappappappappappappappapplielielielielielielielielielielielielielielielielielielied fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd for or or or or or or or or or or or or or or or or or or or purpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurchachachachachachachachachachachachachachachachachachachachasessessessessessessessessessessessessessessessessessessesses or or or or or or or or or or or or or or or or or or or re re re re re re re re re re re re re re re re re redemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptiptionsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsons of of of of of of of of of of of of of of of of of of of of su su su su su su su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch ch proproproproproproproproproproproproproproproproproproproproducducducducducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. MUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTMUTUALUALUALUALUALUALUALUALUALUALUALUAL FU FU FU FU FU FU FU FU FU FUNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDSNDS proproproproproproproproproproproproproducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Thereereereereereereereereereereereereereere ar ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne no ao ao ao ao ao ao ao ao ao ao ao ao ao addiddiddiddiddiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnalnalnalnalnalnalnal tr tr tr tr tr transansansansansansansansansansansansansansansactactactactactactactactactactactactactactactionionionionionionionionionionionionion fe fe fe fe fe fe fe fees es es es es es es es es appappappappappappappappappappappappappapplielielielielielielielielielielielied fd fd fd fd fd fd fd fd fd fd fd fd for or or or or or or or or or or or purpurpurpurpurpurpurpurpurpurpurpurchachachachachachachachachachachachachasessessessessessessessessessessessessesses or or or or or or or or or or re re re re re re re re re redemdemdemdemdemdemdemdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptionsonsonsonsonsonsonsonsonsonsonsonsonsonsons of of of of of of of of of of of of of su su su su su su su su su su such ch ch ch ch ch ch proproproproproproproproproproproproproducducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.proproproproproproproproproproproproproproducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Thereereereereereereereereereereereere ar ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne no ao ao ao ao ao ao ao ao ao ao ao ao addiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnal tr tr tr tr tr tr tr tr tr transansansansansansansansansansansansansansactactactactactactactactactactactactactactactactactionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es appappappappappappappappappappappappappappappappapplielielielielielielielielielielielied fd fd fd fd fd fd fd fd fd for or or or or or or or purpurpurpurpurpurpurpurpurpurpurpurpurpurpurpurchachachachachachachachachachachachachachachachachachasessessessessessessessessessessessessessesses or or or or or or or or re re re re re re re re re re re re redemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptiptiptiptiptionsonsonsonsonsonsonsonsonsonsonsons of of of of of of of of of of of su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch proproproproproproproproproproproproproproducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. proproproproproproproproproproproproproproducducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts. Th Th Th Th Th Th Th Thereereereereereereereereereereereere ar ar ar ar ar ar ar ar ar ar are ne ne ne ne ne ne ne ne ne ne ne ne no ao ao ao ao ao ao ao ao ao ao ao ao ao addiddiddiddiddiddiddiddiddiddidditiotiotiotiotiotiotiotiotiotiotiotiotiotionalnalnalnalnalnalnalnalnalnalnalnalnalnalnalnal tr tr tr tr tr tr tr tr tr tr transansansansansansansansansansansansansansactactactactactactactactactactactactactactactactactactionionionionionionionionionion fe fe fe fe fe fe fe fe fe fe fe fe fees es es es es es es es es es es es es appappappappappappappappappappappappappappappappapplielielielielielielielielielielielied fd fd fd fd fd fd fd fd fd fd for or or or or or or or purpurpurpurpurpurpurpurpurpurpurpurpurpurpurchachachachachachachachachachachachachachachachachachasessessessessessessessessessessessessessesses or or or or or or or or re re re re re re re re re re re re redemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemdemptiptiptiptiptiptiptiptiptiptiptiptiptionsonsonsonsonsonsonsonsonsonsonsonsons of of of of of of of of of of of su su su su su su su su su su su su su such ch ch ch ch ch ch ch ch ch ch proproproproproproproproproproproproproproducducducducducducducducducducducducducducts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.
SpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeak ak ak ak ak ak ak witwitwitwitwitwitwitwitwitwitwitwitwitwitwitwith yh yh yh yh yh y J. J. J. J. J.P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMor Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Advisvisvisvisvisvisvisvisvisvisvisvis forforforforforforforforforforforforforforforforforfor nt nt nt nt nt nt ratratratratratratMARMARMARMARMARMARMARMARMARMARMARMARMARMARMARGINGINGINGINGINGINGINGINGINGINGINGINGINGIN SpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak witwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwith yh yh yh yh yh yh yh yh yh yh yh yh yh yh yh yh yh yh yourourourourourourourourourourourourourourourourourourourour J. J. J. J.P. P. P. P. P. P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorgangangangangangangangangangangangangangangangangangangangan Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Advisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisor or or or or or or or or or or or or or or or or or or or forforforforforforforforforforforforforforforforforforfor cu cu cu cu cu cu cu cu cu cu cu cu cu cu cu cu cu cu cu currerrerrerrerrerrerrerrerrerrerrerrerrerrerrerrerrerrerrerrent nt nt nt nt nt nt nt nt nt nt nt nt nt nt nt nt nt ratratratratratratratratratratratratratratratratratrates.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.SpeSpeSpeSpeSpeSpeSpeSpeSpeak ak ak ak witwitwitwitwitwitwith yh yh y J. J. J. J.P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMor Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Advis forforforforforfor nt nt nt nt nt ratratratratratMARMARMARMARMARMARMARMARMARMARMARMARMARMARMARGINGINGINGINGINGINGINGINGINGINGINGINGINGINGIN SpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak witwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwith yh yh yh yh yh yh yh yh yh yh yh yh yh yh yh yh yh yh yh yourourourourourourourourourourourourourourourourourourour J. J. J. J. J. J. J. J. J. J. J. J. J. J. J.P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorgangangangangangangangangangangangangangangangangangangangan Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Advisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisor or or or or or or or or or or or or or or or or or or forforforforforforforforforforforforforforforforforforfor cu cu cu cu cu cu cu cu cu cu cu cu cu cu cu cu cu currerrerrerrerrerrerrerrerrerrerrerrerrerrerrerrerrerrent nt nt nt nt nt nt nt nt nt nt nt ratratratratratratratratratratratratratratratratratratratrates.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.MARMARMARMARMARMARMARMARMARMARMARMARMARMARMARGINGINGINGINGINGINGINGINGINGINGINGINGINGIN SpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak witwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwitwith yh yh yh yh yh yh yh yh yh yh yh yh yh yh yourourourourourourourourourourour J. J. J. J.P. P. P. P. P. P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorgangangangangangangangangangangangangangangangangangan Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Advisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisor or or or or or or or or forforforforforforforforforforforfor cu cu cu cu cu cu cu cu cu cu cu currerrerrerrerrerrerrerrerrerrerrerrent nt nt nt nt nt nt nt nt ratratratratratratratratratratratratratrates.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.MARMARMARMARMARMARMARMARMARMARMARMARMARMARMARGINGINGINGINGINGINGINGINGINGINGINGINGINGIN SpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeak ak ak ak ak ak ak ak ak ak ak ak ak ak ak ak witwitwitwitwitwitwitwitwitwitwitwitwith yh yh yh yh yh yh yh yh yh yh yh yh yh yh yh yourourourourourourourourourourourourourourourour J. J. J. J. J. J. J. J. J. J. J. J. J.P. P. P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorgangangangangangangangangangangangangangangangangangangangan Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Advisvisvisvisvisvisvisvisvisvisvisvisvisvisvisvisor or or or or or or or or or or or or or forforforforforforforforforforforforforforforfor cu cu cu cu cu cu cu cu cu cu cu cu cu cu cu currerrerrerrerrerrerrerrerrerrerrerrerrerrerrent nt nt nt nt nt nt nt nt nt nt ratratratratratratratratratratratratratratratratratrates.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es.es. MARMARMARMARMARMARMARMARMARMARMARMARMARGINGINGINGINGINGINGINGINGINGIN SpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeak ak ak ak ak ak ak ak ak ak ak ak ak witwitwitwitwitwitwitwitwitwitwitwitwith yh yh yh yh yh yh yh yh yh yh yh yourourourourourourourourourourourourourour J. J. J. J. J. J. J. J. J. J.P. P. P. P. P. P. P. P. P. P. MorMorMorMorMorMorMorMorMorMorMorMorMorMorMorMorgangangangangangangangangangangangangangangangangangan Ad Ad Ad Ad Ad Ad Ad Ad Ad Ad Advisvisvisvisvisvisvisvisvisvisvisvisvisvisor or or or or or or or or or or or or forforforforforforforforforforforforfor cu cu cu cu cu cu cu cu cu cu cu cu cu currerrerrerrerrerrerrerrerrerrerrerrerrent nt nt nt nt nt nt nt nt nt ratratratratratratratratratratratratratratratrates.es.es.es.es.es.es.es.es.es.es.es.es.es.
1% of principal
Minimum commission of $25.00
INVESTMENT AND INSURANCE PRODUCTS ARE:
• NOT FDIC INSURED • NOT INSURED BY ANY FEDERAL GOVERNMENT AGENCY • NOT A DEPOSIT OR OTHER OBLIGATION OF, OR GUARANTEED BY, JPMORGAN CHASE BANK, N.A., OR ANY OF ITS AFFILIATES • SUBJECT TO INVESTMENT RISKS,
INCLUDING POSSIBLE LOSS OF THE PRINCIPAL AMOUNT INVESTED
1 Options are not suitable for all investors.
2 Investors should carefully consider the investment objectives and risks, as well as charges and expenses of the mutual fund before investing. To obtain a prospectus, contact your Investment Representative or visit the fund company’s website. The prospectus contains this and other information about the mutual fund. Read the prospectus carefully before investing.