HAL Id: hal-00526942https://hal.archives-ouvertes.fr/hal-00526942

Submitted on 17 Oct 2010

HAL is a multi-disciplinary open accessarchive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come fromteaching and research institutions in France orabroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, estdestinée au dépôt et à la diffusion de documentsscientifiques de niveau recherche, publiés ou non,émanant des établissements d’enseignement et derecherche français ou étrangers, des laboratoirespublics ou privés.

Fast Detection of Vibrio species potentially pathogenicfor mollusc

Estela Pérez Lago, Teresa Pérez Nieto, Rosa Farto Seguín

To cite this version:Estela Pérez Lago, Teresa Pérez Nieto, Rosa Farto Seguín. Fast Detection of Vibrio speciespotentially pathogenic for mollusc. Veterinary Microbiology, Elsevier, 2009, 139 (3-4), pp.339.�10.1016/j.vetmic.2009.06.035�. �hal-00526942�

Accepted Manuscript

Title: Fast Detection of Vibrio species potentially pathogenicfor mollusc

Authors: Estela Perez Lago, Teresa Perez Nieto, Rosa FartoSeguın

PII: S0378-1135(09)00319-8DOI: doi:10.1016/j.vetmic.2009.06.035Reference: VETMIC 4489

To appear in: VETMIC

Received date: 26-2-2009Revised date: 17-6-2009Accepted date: 22-6-2009

Please cite this article as: Lago, E.P., Nieto, T.P., Seguın, R.F., Fast Detection ofVibrio species potentially pathogenic for mollusc, Veterinary Microbiology (2008),doi:10.1016/j.vetmic.2009.06.035

This is a PDF file of an unedited manuscript that has been accepted for publication.As a service to our customers we are providing this early version of the manuscript.The manuscript will undergo copyediting, typesetting, and review of the resulting proofbefore it is published in its final form. Please note that during the production processerrors may be discovered which could affect the content, and all legal disclaimers thatapply to the journal pertain.

Page 1 of 23

Accep

ted

Man

uscr

ipt

1

Fast Detection of Vibrio species potentially pathogenic for mollusc 1

2

3

Estela Pérez Lagoa, Teresa Pérez Nietoa, Rosa Farto Seguína*4

5

6

7

a* Área de Microbiología, Departamento de Biología Funcional y Ciencias de la Salud, Facultad de 8

Biología, Universidad de Vigo. Lagoas Marcosende s/n, 36310. Vigo, Spain. 9

Phone: 34 986 812 398; Fax: 34 986 812 556. E- mail: rfarto@uvigo.es10

11

* Manuscript

Page 2 of 23

Accep

ted

Man

uscr

ipt

2

Abstract12

Vibrio tasmaniensis V. splendidus and V. neptunius species were worldwide distributed and associated 13

with aquaculture and been reported as the cause of diseases in aquatic organisms. Polyphasic analyses for 14

bacterial identification are not feasible for routine diagnostic because of the time involved. The aim of 15

this study is to design three PCR primer sets that can assist with a fast detection of these species. They 16

were designed from the 16S ribosomal RNA gene, and PCR conditions were found. Each PCR test 17

successfully identified all the tested strains of each target species. The combined specificity of V. 18

tasmaniensis and V. splendidus primer sets offered the best coverage (86%) in terms of separating target 19

organisms from other related species. The primer set of V. tasmaniensis showed a lower sensitivity limit 20

(500 fg of DNA) than the V. splendidus set (1pg) and both sets gave positive amplification using 21

homogenized tissues from inoculated clams, with 102 and 104 cfu/g of clam, respectively. The primer set 22

of V. neptunius was highly specific, showing only cross-reaction with V. parahaemolyticus species from 23

44 tested species. Its sensitivity limit was 100 pg of DNA. A small number of biochemical tests were 24

proposed concurrently with the PCR to differentiate the cross-reacting bacteria. The time of detection of 25

the three tested species was reduced and the further affected animals can be diagnosed in a rapid fraction 26

of time. The detection of virulent strains of V. tasmaniensis pointed to the risk of mollusc culture 27

outbreaks.28

29

Keywords: V. tasmaniensis, V. splendidus, V. neptunius, clam, fast detection, pathogenic potential. 30

31

Page 3 of 23

Accep

ted

Man

uscr

ipt

3

Introduction32

33V. tasmaniensis, V. splendidus and V. neptunius were the predominant species found by us associated 34

with the culture of oysters and clams (Guisande et al., 2008). These species have been distributed world-35

wide and were associated with diseases in aquatic organisms in different countries. So, over the last few 36

years, V. splendidus has been mainly associated with disease in fish (both larvae and juvenile specimens)37

(Angulo et al., 1994 a, b; Santos et al., 1997; Gatesoupe et al., 1999; Thomson et al., 2005; Sitjà-38

Bobadilla et al., 2007; Reid et al., 2009), molluscs (Sugumar et al., 1998; Le Roux et al., 2002; Gay et al., 39

2004; Gómez-León et al., 2005; Garnier et al. 2007; Guisande et al., 2008) and gorgonians (Hall-Spencer40

et al., 2007). V. neptunius and V. tasmaniensis, that were species commonly considered to be non-41

pathogenic (Thompson et al., 2003a, 2003b) have been associated with disease in fish and molluscs and 42

sea cucumbers and gorgonian, respectively (Austin et al., 2005; Prado et al., 2005; Hall-Spencer et al., 43

2007; Guisande et al., 2008; Deng et al., 2009). The main reason for increasing these infections lies in 44

intensive cultures, since it contributes to concentrating the pathogenic and opportunistic species.45

V. tasmaniensis and V. splendidus are two closely related species included in the V. splendidus-related 46

group. This group shares a high level of homogeneity (Macián et al., 2001; Montes et al., 2003, 2006; Le 47

Roux et al., 2004; Thompson et al., 2005) and several molecular methods have been previously proposed 48

to differentiate between them. Guisande et al. (2008) used a combination of ribotyping and sequencing of 49

16S rRNA gene, while Thompson et al. (2005) suggested the analysis of the three loci recA, rpoA, pyrH50

and Le Roux et al. (2004) the gyrB gene. The combination of genotypic and phenotypic analyses was also 51

previously reported for the identification of the V. neptunius species (Thompson et al., 2003a; Guisande et 52

al., 2008). Neither of these techniques is feasible for routine diagnostic laboratories. 53

The design of molecular methods for fast detection of pathogenic Vibrio species would be essential for 54

improving industrial culture production. Specific PCR primers that amplify gene coding for bacterial 16S 55

rRNA have been widely used as a target showing useful results (Saulnier et al., 2000; Oakey et al., 2003; 56

Avendaño-Herrera et al., 2004).57

The aim of this study is to evaluate the specificity and sensitivity of three PCR primer sets designed from 58

the 16S rDNA sequence to assist with a fast detection of V. tasmaniensis, V. splendidus and V. neptunius 59

Page 4 of 23

Accep

ted

Man

uscr

ipt

4

species by using colonies obtained from a laboratory collection. The usefulness of the PCR tests was 60

evaluated on homogenized tissues from experimentally inoculated clams. In addition, the risk of 61

outbreaks and virulence of V. tasmaniensis on Venerupis rhomboides was estimated. 62

Material and Methods63

Bacterial strains 64

The Vibrio strains used in this study are shown in Table 2. Several strains were previously associated 65

with Galician aquaculture, were isolated from mollusc and turbot and were identified by phenotypic 66

ribotyping and 16S rRNA sequence analysis (Farto et al., 2003, 2006; Montes et al., 2006; Guisande et 67

al., 2008). Other type and reference strains were obtained from various culture collections and maintained 68

in the laboratory.69

The original Vibrio strains were grown in tryptic soy broth (Cultimed, Barcelona, Spain) 70

supplemented with 2% (w/v) NaCl (Panreac) (TSB-2) and 15% (v/v) of glycerol (Panreac, Madrid, Spain) 71

at 22 ºC for 48 h and stored at –80 ºC. Freeze-dried pure cultures of Vibrio strains (Table 2) were 72

routinely cultivated on tryptic soy agar (Cultimed) supplemented with 2% (w/v) NaCl (Panreac, 73

Barcelona, Spain) (TSA-2) at 22 ºC for 48 h. Aeromonas, Pseudomonas and Tenacibaculum strains were 74

cultivated and conserved as was reported for the Spanish collection of type culture (CECT).75

Selection of target priming sequences76

A pair of oligonucleotide probes for each species, V. tasmaniensis (VTS and VT), V. splendidus 77

(VTS and VS) and V. neptunius (VN1 and VN2) were selected by us and synthesized by Invitrogen (UK). 78

The sequence, position and size are shown in Table 1. 79

The sequences of variable regions of the 16S rRNA genes of Vibrio strains in this study were 80

determined, aligned and compared with all available bacterial 16S rRNA sequences in order to search for 81

specific target sites. Previously reported 16S sequences from V. tasmaniensis, V. splendidus, V. neptunius82

and other Vibrionaceae species were extracted from GenBank. 83

PCR optimization and primers specificity 84

The DNA was amplified from colonies of each strain with the pair of primers of each species: VTS/VT; 85

VTS/VS; VN1/VN2, firstly using 30 cycles and an annealing temperature of 55 ºC. The 100 µL PCR-86

Page 5 of 23

Accep

ted

Man

uscr

ipt

5

reaction mixture contained sterile distilled water, dNTP mix (25 mM each; Invitrogen), 200 ng of each 87

primer set (Invitrogen) and 5 u/µL of Taq DNA polymerase (Bioline, UK). Amplification was performed 88

in a Techgene Thermal cycle (Techne, UK). The protocol was 94 ºC for 4 min, followed by 30 cycles of 89

94ºC for 30 sec, 55 ºC for 1 min, 72 ºC for 2 min, with a final extension of 72 ºC for 7 min. PCR 90

amplified fragments were purified on Microspin columns (Amersham Pharmacia Biotech, UK) and 91

visualized in 1% agarose gel and staining with ethidium bromide; a molecular mass marker (digoxigenin-92

labelled λ phage digested with HindIII; Invitrogen) was also added. 93

A temperature gradient assay (Eppendorf mastercycler gradient) was conducted for optimization and 94

specificity, for each primer set. The annealing temperature interval assayed for V. tasmaniensis and V. 95

splendidus was 65-75 ºC, and 48-62 ºC for V. neptunius. Amplification was conducted by using the 96

standard conditions described above, except that 40 cycles for V. neptunius were used. 97

The most favoured conditions and the maximum specific temperature were considered to be those which, 98

in combination, showed high reproducibility over a number of replicate tests and showed an amplified 99

product from each species tested and as few (if any) of the other species tested. These PCR assays were 100

repeated three times with several strains to ensure reproducibility. 101

The specificity of these probes was evaluated by using 12, 8 and 7 strains of V. tasmaniensis, V. 102

splendidus and V. neptunius respectively and between 56 to 85 strains belonging to 42 other species103

(Table 2). In addition, colonies re-isolated from inoculated clams (Ven. rhomboides) for strains of V. 104

tasmanienisis (see experimental infections section) were tested for specificity. The re-isolated colonies 105

from clams of V. splendidus and V. neptunius species were obtained by us in a previous work (Guisande 106

et al., 2008). 107

Sensitivity assays108

The sensitivity of primers VTS/VT (V. tasmaniensis), VTS/VS (V. splendidus) and VN1 and VN2 (V. 109

neptunius) was determined with DNA from different strains (Tables 3, 4). The genomic DNA was firstly 110

amplified from colonies with the eubacterial universal primers to 16S rRNA gene (9-25 forward and 111

1493-1513 reverse), reported by Paster et al. (1988), by using the conditions described in the previous 112

section. The purified PCR products (0.75 µL) were used as a template in amplification with each tested 113

Page 6 of 23

Accep

ted

Man

uscr

ipt

6

primer set and the conditions were the most specific for each one (see results). The purified PCR 114

amplified fragments were adjusted to 1 nanogram and the DNA was serially diluted in 10mM Tris-1Mm 115

EDTA buffer (TE) buffer up to 1 femtogram. Each dilution was tested for the PCR amplification and the 116

lowest amount of DNA with a positive amplification in most tested strains for each species was chosen as 117

the sensitivity limit. 118

The usefulness of the PCR tests was also assayed using homogenized tissue from experimentally 119

inoculated clams with the type strains of V. tasmaniensis (LMG 20012) or V. splendidus (ATCC 33125). 120

The experiment was performed with healthy clams of Ven. rhomboides. Before starting the experiment, 121

the clams were kept as described below (experimental infections). Cells from each strain were inoculated 122

into 15 mL of TSB-2 for 24h at 22 ºC, with shaking at 100 rpm. The growth was adjusted by absorbance 123

determination at 590 nm and the number of cells was estimated by plating each dilution onto TSA-2 and 124

counting the colony forming units (cfu). The concentration was serially diluted in sterilized seawater and125

bacteria at levels ranging from 108 to 101 cfu/mL were inoculated in clams. Ten mL of each bacterial 126

dilution was added to each tank containing 100 mL (final volume) of sterile sea water and 5 clams, and 127

was kept 1 h at 18 ºC, with shaking at 100 rpm. Clams were subsequently weighed and homogenized in 128

10 mL of sterile sea water with a stomacher (Laboratory blender stomacher 80, Seward). The genomic 129

DNA was extracted from 1.5 mL of homogenized clams by using TRIzol Reagent protocol (Invitrogen) 130

and 0.75 µL was used as a template for PCR reaction, using the primers of V. tasmaniensis (VTS/VT) and 131

V. splendidus (VTS/VS). Conditions for PCR amplification were the most specific for each primer set 132

(see results). 133

The lowest number of cells inoculated that gave a positive amplification using DNA of homogenized134

tissues was chosen as the level of detection in vivo, which was expressed as number of cfu/g of clams.135

The colonies re-isolated from homogenized tissues of inoculated clams were used as positive control and 136

their identification was carried out by PCR (using directly the primer sets VTS/VT, VTS/VS) and 137

biochemical tests (Guisande et al. 2008). Bath challenged clams with 100 mL of sterile seawater were 138

processed as above, and were used as a negative control.139

140

Page 7 of 23

Accep

ted

Man

uscr

ipt

7

Experimental infections141

Bacterial cultures from 5 sequenced strains of V. tasmaniensis associated with the mollusc culture were 142

selected from our previous work (Guisande et al. 2008) for experimental infections in healthy clams (Ven. 143

rhomboides). The clams were kept for 5 days in tanks, with aerated filtered (0.2 m) seawater at 18 ºC, 144

and a salinity level of 33‰ before experiments were completed. The infections were performed as 145

described previously (Guisande et al. 2008). Briefly, a group of 20 clams per assay was used for each 146

strain and control and kept in different tanks. The cfu of each bacterial suspension (incubated for 24 h at 147

22 ºC on TSB-2) were estimated by plating onto TSA-2 and were added to each tank (containing 540 mL 148

of sterile sea water) the final dose used being between 106 - 107 cfu/mL per bath. Each group of 20 clams 149

was bath challenged for 3 h in non-circulating seawater conditions, transferred to empty tanks for 1 h and, 150

finally, to the tanks containing aerated filtered seawater at 18 ºC. All the clams were monitored for 151

mortality over a 14 day period. Bath challenged clams with 600 mL of sterile seawater were used as a 152

negative control. Samples from clam tissues were taken from all dead clams and, after the 14-day period, 153

from all live clams and spread on TSA-2 (at 22 ºC for 48 h). Identification of suspicious re-isolated 154

colonies was carried out by PCR using directly the primer set VTS/VT, and biochemical tests (Guisande 155

et al. 2008). The re-isolation rate was expressed as percentage of dead clams from which the major type 156

of colony re-isolated from tissues was the inoculated strain.157

All the animal experiments were performed according to the law approved by the Spanish Ethical 158

Committee (Royal Decree 1201/2005, 10th October, on the protection of animals for experimentation and 159

other scientific purposes; Boletín Oficial del Estado (Official State Gazette of Spain), BOE 21 October 160

2005; pp. 34.367-34.391).161

Results162

Selection of target priming sequences163

The variable regions of 16S sequences were selected for primer design comparing all the sequences 16S 164

from several strains of V. tasmaniensis, V. splendidus, V. neptunius and the other Vibrionaceae species, 165

tested in this study, from the GenBank. Two variable regions were observed at regions corresponding to 166

the Escherichia coli 16S sequence bases 99-113 and 443-460 for V. neptunius. A unique variable region 167

Page 8 of 23

Accep

ted

Man

uscr

ipt

8

with identity in 9 bases for V. tasmaniensis (position 475-496) and V. splendidus (position 482-503) was 168

found (Table 1). A common region for V. tasmaniensis and V. splendidus in positions 76-95 was also 169

selected since it was the most specific for these species and also the region that most differs from other 170

Vibrio species. 171

Amplification of colonies with the primers of V. tasmaniensis (VTS/VT), V. splendidus (VTS/VS) and V. 172

neptunius (VN1/VN2), produced amplicons of 420 bp, 427 bp and 361 bp, respectively (Fig. 1).173

PCR optimization and primer specificity174

An annealing temperature of 55 ºC was firstly selected by using the nearest-neighbour model (Tinoco et 175

al., 1971) for the three primer sets tested. Under these conditions, positive amplicons from several tested176

species with the pair of primers of primers VTS/VT (52 positive strains from 62 strains) and VTS/VS (48177

positive strains from 62 strains) were obtained. The primers of V. neptunius were also non-specific since a 178

positive amplification was found with 32 strains from 114 tested strains.179

The temperature gradient assay showed that 72 ºC was the annealing temperature necessary to obtain the 180

maximum specificity with the pair of primers VTS/VT of V. tasmaniensis and the pair of primers 181

VTS/VS of V. splendidus. This temperature also gave high reproducible results for V. tasmaniensis182

(reproducibility rate 93%; the repeated results were obtained in 15 strains form 16 tested strains) and V. 183

splendidus primers (100%; 16/16 tested strains). The pair of primers VTS/VT of V. tasmaniensis gave a 184

positive result with all the tested strains (12) of V. tasmaniensis and also with several (14) strains of the V. 185

splendidus-related species (V. cyclitrophicus, V. kanaloae, V. lentus, V. pomeroyi and V. splendidus) and 186

also with V. aestuarianus species. Amplification products were not obtained from the other 54 strains, 187

most of which are included in other species (Table 2). The pair of primers VTS/VS showed a positive 188

amplification with all tested strains (8) of V. splendidus, and also with several (11) strains of the V. 189

splendidus-related species (V. crassostreae, V. kanaloae, V. lentus, V. pomeroyi and V.tasmaniensis). 190

Amplification products were not obtained from the other 61 strains, most of which are included in other 191

species (Table 2). 192

An annealing temperature of 60 ºC and 40 cycles were necessary to obtain the maximum specificity with 193

the pair of primers VN1/VN2 of V. neptunius. A reproducibility rate of 100 % (15/15) was obtained. The 194

Page 9 of 23

Accep

ted

Man

uscr

ipt

9

7 tested strains of V. neptunius gave a positive amplification and a cross-reacting with V. 195

parahaemolyticus strains (5) was found. The other strains (100) included in different species showed a 196

negative amplification (Table 2).197

Each pair of primers gave a positive amplification with strains of V. tasmaniensis, V. splendidus and V. 198

neptunius species re-isolated from inoculated clams, used for specificity assays, respectively.199

All PCRs carried out have shown definitive positive or negative results with all tested species (45) of this 200

study. A high number of strains from different origins were analyzed showing a high reproducibility. 201

Identical results of amplification were shown with the three pairs of primers when the two different 202

thermal cycles were used (Eppendorf mastercycler gradient and Techgene Thermal cycle) using the same 203

Taq polymerase and reactives. Thus a reproducible PCR was confirmed.204

Sensitivity assays205

The sensitivity of three primer sets is shown in Tables 3 and 4. These results indicated that the sensitivity206

limit of the pair VTS/VT was 500 fg of DNA for V. tasmaniensis strains and 1pg for V. splendidus. An 207

identical level of sensitivity as V. tasmaniensis was shown by the tested strains of V. lentus, V. pomeroyi208

and V. kanaloae. 209

The level of sensitivity showed by the pair of primers VTS/VS was 1 pg of DNA for V. splendidus and 10 210

pg for V. tasmaniensis. Other tested strains of those species and Vibrio splendidus-related species were 211

unable to be separated at 500 fg of DNA. 212

Positive reactions with the pair of primers VN1/VN2 were found at 1 pg, 10 pg and 100 pg of DNA with 213

both V. neptunius and V. parahaemolyticus species.214

DNA from inoculated strains LMG 20012 and ATCC 33125 were detected by PCR with both primer sets 215

(V. tasmaniensis and V. splendidus) applied on homogenized clam tissues. A different detection capacity216

was found. The lowest number of cells inoculated necessary for detection of LMG 20012 DNA using V.217

tasmaniensis primers, was 2.4x102 (cfu/g of clam). A higher dose was necessary for detection of this 218

DNA with the primers of V. splendidus (2.1x103 cfu/g of clam). The DNA from strain of V. splendidus 219

(ATCC 33125) was detected with a similar number of cells with both pair of primers (3.4x104 cfu/g of 220

clam and 2.8x104 cfu/g of clam for VTS/VT and VTS/VS primers, respectively).221

Page 10 of 23

Accep

ted

Man

uscr

ipt

10

A positive amplification from colonies re-isolated from homogenized tissues of clams used as positive 222

control was found by using the primer sets VTS/VT and VTS/VS, respectively. 223

Experimental infections224

The inoculated strains caused mortalities between 20 and 95% in clams and their re-isolation from dead 225

clams as a pure component was between 13 and 72%. In the rest of the dead clams, the inoculated strains 226

were re-isolated as mixed cultures. The highest mortality (90%) and re-isolation rate (72%) was shown by 227

1, from 5 strains tested of V. tasmaniensis that was inoculated with 1.6 x 107 cfu/mL. A clear association 228

between the mortality and the re-isolation rate was not found in the others. A low or absent re-isolation of 229

inoculated strains was obtained from the survivor clams. Clinical signs were not recorded. Neither 230

mortality nor re-isolation from clam tissues was recorded in the negative control group. All the inoculated 231

strains were successfully amplified by using the primer set VTS/VT. 232

Discussion233

V. tasmaniensis was related to disease in cold-water coral and sea cucumbers (Hall-Spencer et al., 2007;234

Deng et al., 2009) but not associated with mollusc culture. The five experimentally inoculated strains of 235

V. tasmaniensis assayed in this study caused mortality and were able to colonize the tissues of Ven. 236

rhomboides, their pathogenic potential being confirmed. Since our strains were isolated from healthy 237

reproductive oysters, this is the first report associating this species with induced disease in clams. These 238

results point to the risk of mollusc culture outbreaks in this species, as was previously reported for V. 239

splendidus and V. neptunius species as detailed in the Introduction. These species were also frequently 240

associated with diseases in other aquatic organisms in different countries and were the predominant 241

species found by us associated with the mollusc culture (see introduction). A rapid diagnostic for a 242

prophylactic approach is particularly important since aquaculture is highly vulnerable to the impact of 243

infectious diseases. The development of genomic methods appeared to be an important alternative for a 244

rapid detection of bacteria because of the time involved by using a polyphasic analysis when the isolates 245

are closely related taxonomically (Le Roux et al., 2004; Thompson et al., 2005; Guisande et al., 2008). In 246

our study, three PCR primer sets and the PCR optimization assays were designed in order to assist with a 247

Page 11 of 23

Accep

ted

Man

uscr

ipt

11

fast detection of V. tasmaniensis, V. splendidus and V. neptunius species as an indication of good culture 248

conditions.249

We found that the VTS/VT and VTS/VS primers detected V. tasmaniensis and V. splendidus strains on 250

tissues from experimentally inoculated clams. The usefulness of the technique was shown with the251

sensitivity limit, using DNA, necessary to obtain positive results for each species (500 fg to 1 pg). This 252

low amount of DNA is found in natural tissues corresponding, at least, with 2.4x102 and 2.8x104 (cfu/g of 253

clam) of V. tasmaniensis and V. splendidus, respectively, since they were the number of inoculated cells 254

required to be detected in vivo. 255

These results showed also the usefulness of applying the primers directly to the total DNA extracted from 256

the homogenized tissues from natural populations. Similar values were previously reported for other 257

bacteria (González et al., 2003) and the sensitivity limit achieved is sufficient to detect these two species, 258

on natural mixed populations, in cultured clams. This means that the detection of these bacteria can be 259

made in a short fraction of time and without the requirement of a previous culture. Although the260

sensitivity limit of VTS/VT primers was higher than that of VTS/VS primers if the cfu/g of clam261

achieved is 104, the isolation of the bacteria is needed for a closer identification of species. 262

A positive cross-reactivity between several strains of V. tasmaniensis and V. splendidus and others such 263

as V. splendidus-related or V. aestuarianus species was also found using the VTS/VT and the VTS/VS 264

primers in the specificity experiments. So, these PCR primer sets were partially specific for the tested 265

species, as could be expected when analysing the designed primers. Comparing all the sequences 16S 266

extracted from the GenBank, a high similarity around positions previously reported as useful to design 267

priming sites for diagnostic PCRs for bacteria (Dorsch et al., 1992; Kita-Tsukamoto et al., 1993) was 268

found. Even then, they were the more acceptable regions for selecting the forward (VTS) and reverse 269

primers (VT, VS). These results confirmed the high level of homogeneity among these species. 270

In this study, combining the results of both pair of primers V. tasmaniensis (VTS/VT) and V. splendidus271

(VTS/VS) by using an annealing temperature of 72 ºC, it was possible to discriminate several V. 272

splendidus-related species as V. crassostreae and V. cyclitrophicus and also other species such as V. 273

aestuarianus. It was also possible to distinguish 4 strains of 5 tested from V. lentus, 6 of 7 tested from V.274

Page 12 of 23

Accep

ted

Man

uscr

ipt

12

pomeroyi, 1 of 3 tested from V. kanaloae, 3 of 8 tested from V. splendidus and 10 of 12 tested from V. 275

tasmaniensis. The V. splendidus-related species were previously grouped in an identical cluster with at 276

least 90% DNA-DNA hybridization, recA, rpoA, pyrH and gyrB genes sequence similarity (Macián et al., 277

2001; Le Roux et al., 2004; Thompson et al., 2005). Although V. splendidus-related species have also 278

shown little variation in 16S rRNA sequences (Le Roux et al., 2002; Thompson et al., 2003c; Montes et 279

al., 2003, 2006), combining the results of both pairs of primers, the separation of all tested strains was 280

86%, a higher percentage than those achieved by using each pair of primers by separated (VTS/VT: 68%; 281

VTS/VS: 77%). These results show the usefulness of this criterion for detecting these highly related 282

species. 283

Using conventional phenotypical tests obtained by us for the strains tested in this study (Farto et al., 2003; 284

Montes et al., 2003; Guisande et al., 2004) V. tasmaniensis can be differentiated from V. kanaloae, V. 285

lentus and V. splendidus, using the acetate as sole carbon source since it was positive for V. tasmaniensis 286

and negative for the others. The production of acid from cellobiose and use as sole carbon source of 287

tartrate and tryptophan can be used for the separation of V. kanaloae, V. lentus and V. splendidus288

(cellobiose negative only for V. kanaloae; tartrate positive only for V. splendidus; tryptophan positive 289

only for V. kanaloae). However, although we can use degradation of esculin, crystal violet, use as sole 290

carbon source of citrate and -hemolysis for separation of V. pomeroyi from all other V. kanaloae, V. 291

lentus and V. splendidus, we can not discriminate this species from V. tasmaniensis, comparing the 92 292

phenotypical tests previously reported by us (Guisande et al., 2004). Further studies are needed for 293

selecting other new phenotypical tests in order to distinguish between these two species. These results 294

also support the little variation found by using molecular analyses (Macián et al., 2001; Montes et al., 295

2003, 2006; Le Roux et al., 2004; Thompson et al., 2005). Therefore, the combination of PCR and 296

biochemical tests allowed for the separation of 97% of tested V. splendidus-related strains. All these 297

results showed that PCR assists in reducing the number of biochemical tests and time, required for 298

separate V. splendidus-related species. 299

The two variable regions observed in positions 99-113 and 443-460 of sequence 16S from V. neptunius 300

made it possible to select a pair of highly specific primers, since 95,5% of tested species was 301

Page 13 of 23

Accep

ted

Man

uscr

ipt

13

distinguished by using an annealing temperature of 60 ºC. The only species with positive cross-reaction 302

was V. parahaemolyticus, which is surprising since it is not phylogenetic closely related to V. neptunius303

(Thompson et al., 2005). Comparisons of the region including the two priming sites of V. neptunius and 304

V. parahaemolyticus, showed a high level of similarity between them. 305

Four biochemical tests can discriminate between these two species: arginine dihydrolase (ADH) and -306

hemolysis that were positive for V. neptunius and negative for V. parahaemolyticus and ornithine 307

decarboxylase (LDC) and production of acid from galactose that were negative por V. neptunius and 308

positive for V. parahaemolyticus (Montes et al., 1999; Guisande et al., 2004). Although we did not 309

identify V. parahaemolyticus associated with molluscan culture in Galicia (Guisande et al., 2008), we 310

previously reported their association with turbot culture (Montes et al., 2006). The number of biochemical 311

tests required to separate these two species is low and the identification time could be reduced further if 312

suspect colonies were tested using biochemical tests concurrently with the PCR. 313

The primer sets and PCR assays designed improve the fast detection of V. tasmaniensis, V. splendidus 314

and V. neptunius species. The combined sensitivity of PCR and biochemical tests offered the best 315

coverage in terms of separating V. tasmaniensis and V. splendidus from V. splendidus-related species and 316

V. neptunius from V. parahamolyticus. V. tasmaniensis is a potential risk of molluscan culture outbreaks 317

and the time of detection of this species was reduced. All these results make it possible to diagnose 318

affected animals in a short fraction of time. 319

320

Page 14 of 23

Accep

ted

Man

uscr

ipt

14

Acknowledgments321

This work was supported by grants PGIDIT00MAR2002PR and PGIDIT02RMA30102PR from the 322

Xunta de Galicia (Regional Government of Galicia). The authors wish to thank J. Montes for kindly 323

providing bacterial isolates and F. Mallo for providing the thermal cycle for temperature gradient assays. 324

325

Page 15 of 23

Accep

ted

Man

uscr

ipt

15

References326

Angulo, L., López, J.E., Vicente, J.A., 1994a. Epizootic outbreaks by a protozoan and bacterium in reared 327

turbot, Scophthalmus maximus (L.). Bull. Eur. Ass. Fish Pathol. 14, 39-40.328

Angulo, L., López, J.E., Vicente, J.A., Saborido, A.M. 1994b. Haemorrahagic areas in the mouth of 329

farmed turbot, Scophthalmus maximus (L.). J. Fish Dis. 17, 163-169.330

Avendaño-Herrera, R., Magariños, B., Toranzo, A.E., Beaz, R., Romalde, J.L., 2004. Species-specific 331

polymerase chain reaction primer set for the diagnosis of Tenacibaculum maritimum infection. Dis. 332

Aquat. Org. 62, 75-83.333

Austin, B., Austin, D., Sutherland, R., Thompson, F., Swings J., 2005. Pathogenicity of vibrios to 334

rainbow trout (Oncorhynchus mykiss, Walbaum) and Artemia nauplii. Environ Microbiol. 7, 1488-1495.335

Deng, H., He Ch., Zhou, Z, Liu, Ch., Tan, K., Wang, N., Jiang, B., Gao, X., Liu, W., 2009. Isolation and 336

pathogenicity of pathogens from skin ulceration disease and viscera ejection syndrome of the sea 337

cucumber Apostichopus japonicus. Aquaculture 287, 18–27.338

Dorsch, M., Lane, D., Stackebrandt, E., 1992. Towards a phylogeny of the genus Vibrio based on 16S 339

rRNA sequences. Int. J. System. Bacteriol. 42, 58-63.340

Farto, R., Armada, S.P., Montes, M., Guisande, J.A., Pérez, M.J., Nieto, T.P. , 2003. Vibrio lentus341

associated with diseased wild octopus (Octopus vulgaris). J. Invertebr. Pathol. 83, 149-156.342

Farto, R., Armada, S.P., Montes, M., Pérez, M.J., Nieto, T.P., 2006. Presence of a letal protease in the 343

extracellular products of Vibrio splendidus-V.lentus related extrains. J. Fish Dis. 29, 1-7. 344

Garnier, M., Labreuche, Y., Garcia, C., Robert, M., Nicolas, J.L., 2007. Evidence for the involvement of 345

pathogenic bacteria in summer mortalities of the pacific oyster Crassostrea gigas. Microbial Ecology 53, 346

187-196.347

Gatesoupe, F.J., Lambert, C., Nicolas, J.L., 1999. Pathogenicity of Vibrio splendidus strains associated 348

with turbot larvae, Scophthalmus maximus. J. Appl. Microbiol. 87, 757-763.349

Page 16 of 23

Accep

ted

Man

uscr

ipt

16

Gay, M., Berthe, F.C.J., Le Roux, F., 2004. Screening of Vibrio isolates to develop and experimental 350

infection model in the Pacific oyster Crassostrea gigas. Dis. Aquat. Org. 59, 49-56.351

Gómez-León, J., Villamil, L., Lemos,M.L., Novoa, B., Figueras, A., 2005. Isolation of Vibrio 352

alginolyticus and Vibrio splendidus from aquacultured carpet shell clam (Ruditapes decussates) larvae 353

associated with mass mortalities. Appl. Environ. Microbiol. 71, 98-104.354

González, S.F., Osorio, C.R., Santos, Y., 2003. Development of a PCR- based meted for the detection of 355

Listonella anguillarum in fish tissues and blood samples. Dis. Aquat. Org. 55, 109-115.356

Guisande, J.A., Montes, M., Farto, R., Armada, S.P., Pérez, M.J., Nieto, T.P., 2004. A set of tests for the 357

phenotypic identification of culturable bacteria associated with Galician bivalve mollusc production. J. 358

Shellfish Res. 23, 599-609.359

Guisande, J.A., Lago, E.P., Prado, S., Nieto, T.P., Farto, R., 2008. Genotypic diversity of culturable 360

Vibrio species associated with the culture of oysters and clams in Galicia and screening of their 361

pathogenic potential. J. Shellfish Res. 27, 801-809. 362

Hall-Spencer, J.M., Pike, J., Munn, C.B., 2007. Diseases affect cold-water corals too: Eunicella 363

verrucosa (Cnidaria: Gorgonacea) necrosis in SW England. Dis. Aquat. Org. 76, 87-97.364

Kita-Tsukamoto, K., Oyaizu, H., Nanba, K., Simidu, U., 1993. Phylogenetic relationships of marine 365

bacteria, mainly members of the family Vibrionaceae, determined on the basis of 16S rRNA sequences. 366

Int. J. System. Bacteriol., 43, 8-19.367

Le Roux, F., Gay, M., Lambert, C., Waechter, M., Poubalanne, S., Chollet, B., Nicolas, J.L., Berthe, F., 368

2002. Comparative analysis of Vibrio splendidus-related strains isolated during Crassostrea gigas369

mortality events. Aquat. Living Resour. 14, 251-258.370

Le Roux, F., Gay, M., Lambert, C., Nicolas, J.L., Gouy, M., Berthe, F., 2004. Phylogenetic study and 371

identification of Vibrio splendidus-related strains based on gyrB gene sequences. Dis. Aquat. Org. 58, 372

143-150.373

Page 17 of 23

Accep

ted

Man

uscr

ipt

17

Macián, M.C., Ludwig, W., Aznar, R., Grimont, P.A.D., Schleifer, K.H., Garay, G., Pujalte, M.J., 2001. 374

Vibrio lentus sp. nov., isolated from Mediterranean oysters. Int. J. System. Evol. Microbiol. 51, 1449–375

1456.376

Montes, M., Pérez M.J., Nieto, T.P., 1999. Numerical taxonomy of Gram negative, facultative anaerobic 377

bacteria isolated from skin of turbot (Scophthalmus maximus) and surrounding water. Syst. Appl. 378

Microbiol. 22, 604–618.379

Montes, M., Farto, R., Pérez, M.J., Nieto, T.P., Larsen, J.L., Christensen, H., 2003. Characterization of 380

Vibrio strains isolated from turbot (Scophthalmus maximus) culture by phenotypic analysis, ribotyping 381

and 16S rRNA gene sequence comparison. J. Appl. Microbiol. 95, 693-703.382

Montes M., Farto, R., Pérez, M.J., Armada S.P., Nieto, T.P., 2006. Genotypic diversity of Vibrio isolates 383

associated with turbot (Scophthalmus maximus) culture. Res. Microbiol., 157, 487-495.384

Oakey, H.J., Levy, N., Bourne, D.G., Cullen, B., Thomas, A., 2003. The use of PCR to aid in the rapid 385

identification of Vibrio harveyi isolates. J. Appl. Microbiol. 95, 1293-1303.386

Paster, B.J., Dewhirst, F.E., 1988. Phylogeny of Campylobacter, Wolinellas, Bacteroides gracilis, and 387

Bacteroides ureolyticus by 16S ribosomal ribonucleic acid sequencing. Int. J. System. Bacteriol. 38, 56-388

62.389

Prado, S., Romalde, J.L., Montes, J, Barja, J.L., 2005. Pathogenic bacteria isolated from disease outbreaks 390

in shellfish hatcheries. First description of Vibrio neptunius as an oyster pathogen. Dis. Aquat. Org. 67, 391

209-215. 392

Reid, H.I., Treasurer, J.W., Adam, B., Birkbeck, T.H., 2009. Analysis of bacterial populations in the gut 393

of developing cod larvae and identification of Vibrio logei, Vibrio anguillarum and Vibrio splendidus as 394

pathogens of cod larvae. Aquaculture 288, 36–43.395

Santos, Y., Pazos, F., Núñez, S., Toranzo, A.E., 1997. Antigenic characterization of Vibrio anguillarum-396

related organisms isolated from turbot and cod. Dis. Aquat. Org. 28, 45-50.397

Page 18 of 23

Accep

ted

Man

uscr

ipt

18

Saulnier, D., Avarre, J.C., Le Moullac, G., Ansquer, D., Levy, P., Vonau, V., 2000. Rapid and sensitive 398

PCR detection of Vibrio penaeicida, the putative etiological agent of Syndrome 93 in New Caledonia. 399

Dis. Aquat. Org. 40, 109-115.400

Sitjà-Bobadilla, A., Pujalte, M.J., Bermejo, A., Garay, E., Álvarez-Pellitero, P., Pérez-Sánchez, J., 2007. 401

Bacteria associated with winter mortalities in laboratory-reared common dentex (Dentex dentex L.). 402

Aquac. Res., 38, 733-739.403

Sugumar, G., Nakai, T., Hirata, Y., Matsubara, D., Muroga, K., 1998. Vibrio splendidus biovar II as the 404

causative agent of bacillary necrosis of Japanese oyster Crassostrea gigas larvae. Dis. Aquat. Org. 33, 405

111-118.406

Thompson, F.L., Li, Y., Gómez-Gil, B., Thompson, C.C., Hoste, B., Vandemeulebroecke, K., Rupp, G.S., 407

Pereira, A., De Bem, M.M., Sorgeloos, P., Swings, J., 2003a. Vibrio neptunius sp. nov., Vibrio408

brasiliensis sp. nov. and Vibrio xuii sp. nov., isolated from the marine aquaculture environment (bivalves, 409

fish, rotifers and shrimps). Int. J. System. Evol. Microbiol. 53, 245-252.410

Thompson, F.L., Thompson, C.C., Swings, J., 2003b. Vibrio tasmaniensis sp. nov., isolated from Atlantic 411

salmon (Salmo salar L.). System. Appl. Microbiol. 26, 65-69.412

Thompson, F.L., Thompson, C.C., Li, Y., Gómez-Gil, B., Vandengberghe, J., Hoste, B., Swings, J., 413

2003c. Vibrio kanaloae sp. nov., Vibrio pomeroyi sp. nov., and Vibrio chagasii sp. nov., from sea water 414

and marine animals. Int. J. System. Evol. Microbiol. 3, 753-759.415

Thomson, R., Macpherson, H.L., Riaza, A., Birkbeck, T.H., 2005. Vibrio splendidus biotype 1 as a cause 416

of mortalities in hatchery-reared larval turbot, Scophthalmus maximus (L.). J. Appl. Microbiol. 49, 243-417

250.418

Tinoco, Jr.I., Uhlenbech O.C., Levine, M.D., 1971. Estimation of secondary structure in ribonucleic 419

acids. Nature 230, 263-367.420

Page 19 of 23

Accep

ted

Man

uscr

ipt

1

Fig.1 λ – the fragment sizes of the digoxigenin-labelled marker digested

with Hin dIII shown in bp; A- V. tasmaniensis LMG 20012 at 72 °C of

annealing temperature (417 bp); B- V. splendidus ATCC 33125 at 72 °C

(427 bp); C- V. neptunius LMG 20536 at 60 °C (361 bp)

λ A B C

564

125

23222027

bp

23.130

Figure

Page 20 of 23

Accep

ted

Man

uscr

ipt

1

Table 1. Primers used in PCR1

2

Primer Sequence

Common primer of V. tasmaniensis and V. splendidus

76-95f (VTS) 5’ GAGCGGAAACGACACTAACA 3’ (20 bp)a

Primer of V. tasmaniensis

475-496r (VT) 5’ GCAGCTATTAACTACACACCCT 3’ (22 bp)

Primer of V. splendidus

482-503r (VS) 5’ AAGAGATAGCGCTATTAACGCT 3’ (22 bp)

Primer of V. neptunius

99-113f (VN-1)443-460r (VN-2)

5’ AAAGCCTTCGGGTGG 3’ (15 bp)5’ ACACCACCTTCCTCACTG 3’ (18 bp)

a, primer size; in black shared region by both primers; f, forward,; r, reverse34

Table

Page 21 of 23

Accep

ted

Man

uscr

ipt

2

Table 2. Results of amplifications from colonies of tested species by using the primers of V. 5

tasmaniensis, V. splendidus and V. neptunius6

Tested speciesaAmplificationb

VTS/VT VTS/VS VN1/VN2

72 ºC 72 ºC 60 ºCAeromonas salmonicida subsp. salmonicida (CECT 894T; 1 LCS) NT NT 0/2Photobacterium damselae subsp. damselae (ATCC 33539 T) 0/1 0/1 0/1Photobacterium damselae subsp. piscicida (ATCC 17911) NT NT 0/1Pseudomonas anguilliseptica (CECT 899T) NT NT 0/1Tenacibaculum maritumum (CECT 4276) NT NT 0/1Vibrio aestuarianus (ATCC 35048T; 1 LCS) 1/2 0/2 0/2V. albensis (LMG 4406T) 0/1 0/1 0/1V. alginolyticus (CECT 521T; CECT 586; CAIM 342) 0/1 0/1 0/3V. anguillarum (NCIMB 571; ATCC 43307; CECT 522) 0/2 0/2 0/3V. campbellii (CECT 523) 0/1 0/1 0/1V. chagassii (LMG 21353T) 0/1 0/1 0/1V. cincinnatiensis (LMG 7891T) 0/1 0/1 0/1V. coralliilyticus (LMG 20984T) NT NT 0/1V. costicola (LMG 6460) 0/1 0/1 0/1V. crassostreae (LMG 22240T) 0/1 1/1 0/1V. cyclitrophicus (LMG 21359T; CAIM 547) 1/1 0/1 0/2V. diazotrophicus (LMG 7893T) 0/1 0/1 0/1V. fischeri (LMG 4414T; 3 LCS) 0/2 0/2 0/4V. fluvialis (LMG 7894T) 0/1 0/1 0/1V. furnissii (LMG 7910T) 0/1 0/1 0/1V. halioticoli (3 LCS) NT NT 0/3V. ichthyoenteri (CAIM 597T; 3 LCS) 0/3 0/3 0/4V. kanaloae (LMG 20539T; CAIM 546; 1 LCS) 2/3 2/3 0/3V. lentus (CECT 5293; 4 LCS) 4/5 1/5 0/5V. mediterranei (LMG 11258T; 2 LCS) 0/2 0/2 0/3V. metschnikovii (ATCC 7708) 0/1 0/1 0/1V .mytili (CECT 632) 0/1 0/1 0/1V. neptunius (LMG 20536T; 6 LCS ) 0/4 0/4 7/7V. nereis (LMG 3895T) 0/1 0/1 0/1V. ordalii (CECT 582) 0/1 0/1 0/1V. orientalis (CECT 629) 0/1 0/1 0/1V. pacinii (LMG 19999T) 0/1 0/1 0/1V. parahaemolyticus (CECT 588; CECT 5306; CAIM 58; 2 LCS) 0/1 0/1 5/5V. pelagius (LMG 3897T) 0/1 0/1 0/1V. pomeroyi (LMG 20537T; CAIM 739; 5 LCS) 1/7 5/7 0/7V. proteolyticus (LMG 3772T) 0/1 0/1 0/1V. salmonicida (CECT 4195) 0/1 0/1 0/1V. scophthalmi (10 LCS) 0/3 0/3 0/10V. shilonii (LMG 19703T) NT NT 0/1V. splendidus (ATCC 33125T; LMG 16751; 7 LCS) 5/8 9/8 0/8V. superstes (CAIM 904T; 1 LCS) 0/1 0/1 0/1V. tapetis (CECT 4600T) 0/1 0/1 0/1V. tasmaniensis (LMG 20012T; CAIM 759; 10 LCS) 12/12 2/12 0/12V. tubiashii (LMG 10936T) 0/1 0/1 0/1V. vulnificus (CECT 897; CAIM 611) 0/2 0/2 0/2

a,The LCS, laboratory collection strains from T.P. Nieto´s private collection and recorded in Farto et al. (2003; 2006), Montes et al. (2006), 7and Guisande et al. (2008); ATCC, American Type Culture Collection, University Boulevard, Manassas, Virginnia (U.S.A.); CAIM, 8Collection of Aquatic Important Microorganisms, Mazatlán Unit for Aquaculture and Environmental Management, Mazatlán (Sinaloa9México); CECT, Colección Española de Cultivos Tipo, Valencia (Spain); LMG, Laboratorium voor Microbiologie, Universiteit, Gent, 10Belgium (EU); NCIMB, National Collection of Industrial and Marine Bacteria, Aberdeen (UK); b, primer tested at annealing temperature of 1172 ºC and 60 ºC; Number of positive strains/number of total tested strains; NT: not tested12

13

Page 22 of 23

Accep

ted

Man

uscr

ipt

3

Table 3. Sensitivity of V. tasmaniensis and V. splendidus primers by using the DNA from colonies1415

Strains

Amplification by PCR

VTS/VTa VTS/VSb

10pgc 1pg 500fg 1fgd 10pg 1pg 500fg

V. tasmaniensisLMG 20012CAIM 759 5 LCS + (7/7) + (7/7) + (7/7) + (0/7) + (6/7) + (2/7) + (1/7)

V. splendidusATCC 33125LMG 16751 3 LCS + (5/5) + (3/5) + (0/5) NT + (4/5) + (4/5) + (2/5)

V.lentusP58 CECT 5293 + (2/2) + (2/2) + (1/2) NT + (1/2) + (1/2) + (1/2)

V.pomeroyiLMG 205371 LCS + (2/2) + (2/2) + (2/2) NT + (2/2) + (2/2) + (2/2)

V. kanaloaeLMG 205391 LCS + (2/2) + (2/2) + (2/2) NT + (2/2) + (2/2) + (2/2)

16a, primers of V. tasmaniensis; b, primers of V. splendidus; c, Amount of tested DNA: picograms and femtograms; d, 17

the pair of primers VTS/VS were not tested with 1fg; NT: not tested; in brackets No. of positive strains/total number 18

of tested strains.19

20

Page 23 of 23

Accep

ted

Man

uscr

ipt

4

Table 4. Sensitivity of V. neptunius primers by using the DNA from colonies212223

Strains Amplification by PCR

100pga 10pg 1pg 500fg

V. neptuniusLMG 20536; 2 LCS + (3/3) + (2/3) + (1/3) + (0/3)

V. parahaemolyticusCECT 5306; CECT 588; CAIM 58 + (3/3) + (2/3) + (1/3) + (0/3)

a, Amount of tested DNA: picograms and femtograms; in brackets No. of positive strains/total number of 24

tested strains.25

26