History of Genetic Manipulation:Recombinant DNA Technology

Chapter 3Spring 2005Fall 2008

• Electrophoresis is a molecular technique that separates nucleic acids and proteins based on

Size and

+-+Charge+-+

DNA is a negatively charged molecule and therefore is attracted to positive charges.

Agarose provides a matrix through which DNA molecules migrate.

• Size – larger molecules move through the matrix slower than small molecules • Concentration – the higher the concentration of agarose, the better the separation of small fragments

How to make an agarose gel….• Weigh out a specified amount of agarose powder.

• Add the correct amount of buffer.

• Dissolve the agarose by boiling the solution.

• Pour the gel in a casting tray.

• Wait for the gel to polymerize.

Recombinant DNA technologyRecombinant DNA technology

Techniques that allows DNA to be combined from different sources; also called gene or DNA splicing

• Vector – DNA source which can replicate and is used to carry foreign genes or DNA fragments.

Lambda phagePlasmid

Recombinant DNA – A vector that has taken up a foreign piece of DNA.

Restriction enzyme – an enzyme which binds to DNA at a specific base sequence and then cuts the DNA.

• Restriction enzymes are named after the bacteria from which they were isolated.

a. Bacteria use restriction enzymes to “chop up” foreign viral DNA.

Recognition site – specific base sequence on DNA where a restriction enzyme binds.

a. All recognition sites are palindromes, which means they read the same way forward and backward.

(example: RACECAR or GAATTC CTTAAG

b. Each restriction enzyme has its own unique recognition site.

• After cutting up a long piece of DNA, you can run the samples on an agarose gel.

a. The smaller fragments migrate further than the longer fragments.

b. The bands are compared to standard DNA of known sizes. This is often called a DNA marker, or a DNA ladder.

http://207.207.4.198/pub/flash/4/4.html

After analyzing your results, you draw a restriction map of the cut sites.

a. A restriction map is a diagram of DNA showing the cut sites of a series of restriction enzymes.

Restriction enzymes cut in the middle of the recognition site.

a. When restriction enzymes cut down the middle of the sequence, blunt ends are generated.

Example: GATC GA + TC CTAG CT AG

b. When restriction enzymes cut in a zig zag pattern, sticky ends are generated.

Example: GAATTC G + AATTC

CTTAAG CTTAAG G

i. Sticky ends are very useful because if two different pieces of DNA are cut with the same restriction enzyme, the overhanging sticky ends will complementarily base pair, creating a recombinant DNA molecule.

ii. DNA ligase will seal the nick in the phosphodiester backbone.

Model OrganismsModel Organisms

E. coli –grows rapidly (20 min generation time), easy to work with, easy to transform, normally not pathogenic, and inexpensive

Bacterial Transformation – bacteria take up and express foreign DNA, usually a plasmid.

•Plasmid – circular piece of DNA

Steps of Bacterial Transformation

1. Choose a bacterial host.a. E.coli is a model organism.

i. Well studied

ii. No nuclear membranes

iii.Has enzymes necessary for replication

DNA/

Chrom.

Steps of Bacterial Transformation

2. Choose a plasmid to transform.a. Characteristics of a useful plasmid.

i. Single recognition site

• Plasmid only cuts in one place, so this ensures that the plasmid is reformed in the correct order.

ii. Origin of replication

• Allows plasmid to replicate and make copies for new cells.

iii. Marker genes

• Identifies cells that have been transformed.

gene for antibiotic resistance – bacteria is plated on media

with an antibiotic, and only bacteria that have taken up a

plasmid will grow

gene that expresses color – bacteria that have taken up a

recombinant plasmid are a different color than bacteria

that have taken up a NONrecombinat vector.

Steps of Bacterial Transformation

3. Prepare bacterial cells for transformation of plasmid.a. Treat with calcium chloride, which allows plasmid to

pass through bacterial cell walls. This is the most common method.

b. Electroporation - brief electric pulse

c. Directly inject plasmid into bacterial cell.

Steps of Bacterial Transformation

4. Plate transformation solution on appropriate media.a. Contains nutrients for bacteria.

b. Contains antibiotic to distinguish transformed bacteria from NONtransformed bacteria.

5. Incubate plates overnight.a. E.coli grows in the human body,

and is therefore incubated at

body temperature (37°C)

6. Analyze plates.

http://www.sumanasinc.com/webcontent/animations/content/plasmidcloning.html

CosmidsCosmids

Contain cos ends of lambda DNA, a plasmid origin of replication, and genes for antibiotic resistance, but most of the viral genes have been removed

Replicate a low copy no. plasmid

Bacterial Artificial Chromosomes

Bacterial Artificial Chromosomes

Large, low-copy-number plasmids, present as one to two copies in bacterial cells that contain genes encoding the F-factor.

BACs can accept DNA inserts in the 100- to 300 kb range

Widely used in the Human Genome Project.

Yeast Artificial ChromosomesYeast Artificial Chromosomes

Small plasmids grown in e. coli and introduced into yeast cells.

Minature verision of a eukaryotic chromosomeContains an origin of replication, selectable markers, two

telemeres, and a centromere that allows for replication of the YAC and segregation into daughter cells

Used to clone 200 kb to 1 million bases in sizeUsed in the Human Genome Project

Expression VectorsExpression Vectors

Contain a promoter for max synthesis of mRNA which is translated into protein

However it is not always possible to express a functional protein in bacteria

Doesn’t process (fold) the protein properlyDegrades the mRNA, or the protein is lethal to the bacteria

Viruses (SV40) can be used as expression vectors in mammalian cells (variations of SV40 have been used in gene therapy)

How Do You Identify and Clone a Gene of Interest? Build a LibraryHow Do You Identify and Clone a Gene of Interest? Build a Library

A collection of cloned DNA fragments from a particular organism contained within bacteria or viruses as the host

Can be saved for relatively long period of timeScreened to pick out different genes of interestTwo types are used:

Genomic library and complementary DNA (cDNA) libraryHow are they made? (know figure 3.6)

http://www.sumanasinc.com/webcontent/animations/content/dnalibrary.html

Rarely is an entire gene is cloned in one piece, even in a cDNA library

When small pieces of a gene are cloned, scientists sequence these pieces and look for sequence overlaps

Overlapping fragments of DNA can be pieced together like a puzzle in a reconstruct the full-length gene

Look for start and stop codons in the sequenced pieces is one way to predict if the entire gene has been pieced together

An example of DNA “walking” strategy

Chromosome WalkingChromosome Walking

POLYMERASE CHAIN REACTION

"PCR has transformed molecular biology through vastly extending the capacity to identify, manipulate and reproduce DNA. It makes abundant what was once scarce -- the genetic material required for experimentations."

• The purpose of PCR is to amplify small amounts of DNA to produce enough for analysis.

Reaction Requirements

• Template – starting amount of DNA

• Target – segment of DNA you wish to amplify

Reaction Requirements• Primers – short pieces of single stranded DNA

that binds to the template DNA. Allows DNA polymerase to to attach and begin replication.

3’-TACGACCCGGTGTCAAAGTTAGCTTAGTCA-5’

5’-ATGCTGGGCCACAGTTTCAATCGAATCAGT-3’

5’-ATGCT-3’ 3’-AGTCA-5’

Reaction Requirements• Polymerase – attaches nucleotides to the

template.

• Taq polymerase is extracted from bacteria that live in hot springs, so they remain active at temperatures up to 90°C.

3’-TACGACCCGGTGTCAAAGTTAGCTTAGTCA-5’5’-ATGCTGGGCCACAGTTT-3’

5’-ATGCTGGGCCACAGTTTCAATCGAATCAGT-3’ 3’- AAGTTAGCTTAGTCA-5’

Reaction Requirements

• Magnesium – required for DNA polymerase to work

• Nucleotides – needed to make new DNA segments

• Buffer – maintain constant pH

• Thermocycler – machine that cycles through required temperatures

STEPS:1. Heat samples to 90°C for a minute or so to

separate double stranded template DNA.

STEPS:2. Drop temperature to around 50 or 60°C to

allow primers to anneal.

STEPS:3. Maintain temperature at 70°C for a minute or

two to allow the polymerase to elongate the new DNA strands.

4. Repeat denaturation, annealing, and synthesis steps over and over and over.

http://www.sumanasinc.com/webcontent/animations/content/pcr.html

* PCR amplification is logarithmic, meaning the number of copies is doubled with every cycle.

2n

Cloning by PCR Cloning by PCR

Review figure 3.9You need to know some of the sequences of what you

are interested in cloning as PCR requires primersSince thermostable polymerases add an A to the 3’ end

–use a T vector for cloning (contain single-stranded thymine nucleotide at each end which can complementary base pair with overhanging adenine nucleotides)

Human Genome ProjectHuman Genome Project

               

Francis Collins Craig Venter

Who owns your DNA?

Automated Sequencing

G labeled with blue dye

A labeled with red dye

T labeled with green dye

C labeled with black dye

http://www.ncbi.nih.gov/Genbank/genbankstats.html

Medicine

                                    

Evolutionary Biology

                                        

The Genome is mapped….Now what??????Now what??????

<>

Southern Blotting

• Developed by Edward Southern.

• Hybridization technique in which a DNA probe binds to DNA.

• Used to determine if a specific DNA sequence is present in a sample or where a band containing a specific sequence is located on a gel.

Procedure for Southern Blotting

1. Cut genomic DNA with restriction enzymes and run on an agarose gel.

Procedure for Southern Blotting

2. Transfer DNA to a nylon membrane.

Procedure for Southern Blotting

3. Hybridize a DNA probe to specific sequences on the membrane.

• The probe will only bind if it is complementary to the DNA sequence.

GATCCGCTATGTGGGCTGACGGCGATACAC

Procedure for Southern Blotting

4. You will only visualize bands where the probe has hybridized to the DNA.

Chromosomal Location and Gene Copy Number

Chromosomal Location and Gene Copy Number

Southern Blotting- combine restriction enzyme digest+gel electrophoresis, transfer to a blot and incubate with a labeled DNA or RNA probe to locate a specific site on DNA (figure 3.15)

Northern Blotting- Isolate RNA, separate by size, transfer to a blot, and identify a specific RNA using a labeled probe (figure 3.16)

Western Blotting-separate proteins by size, transfer to a blot, identify with labeled antibody

http://learn.genetics.utah.edu/units/biotech/microarray/