Research ArticleExpression of Helicobacter pylori hspA Gene inLactococcus lactis NICE System and ExperimentalStudy on Its Immunoreactivity

Xiao-Juan Zhang1 Shu-Ying Feng2 Zhi-Tao Li2 and Yan-Ming Feng3

1Department of Pathogen Biology Medical College Henan University of Science and Technology Luoyang 471003 China2Department of Immunology Medical College Henan University of Science and Technology Luoyang 471003 China3Department of Epidemiology Medical College Henan University of Science and Technology Luoyang 471003 China

Correspondence should be addressed to Xiao-Juan Zhang gjfzxj0921gmailcom

Received 5 May 2014 Accepted 3 March 2015

Academic Editor Spiros D Ladas

Copyright copy 2015 Xiao-Juan Zhang et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

AimThe aimof this studywas to develop an oral Lactococcus lactis (L lactis) vaccine againstHelicobacter pylori (H pylori)MethodsAfter L lactis NZ3900pNZ8110-hspA was constructed growth curves were plotted to study whether the growth of recombinantL lactis was affected after hspA was cloned into L lactis and whether the growth of empty bacteria empty plasmid bacteria andrecombinant L lactis was affected by different concentrations of Nisin SDS-PAGE andWestern blot were adopted respectively todetect the HspA expressed by recombinant L lactis and its immunoreactivity ResultsThere was no effect observed from the growthcurve after exogenous gene hspA was cloned into L lactis NZ3900 different concentrations of Nisin did not affect the growth ofNZ3900 and NZ3900pNZ8110 while different concentrations of Nisin inhibited the growth of NZ3900pNZ8110-hspA except 10ngmL Nisin No HspA strip was observed from SDS-PAGE Western blot analysis showed that HspA expressed by recombinantbacteria had favorable immunoreactivity Conclusion The growth of recombinant L lactis was suppressed even though a smallamount of HspA had been induced to express Therefore recombinant L lactis only express HspA which was not suitable to be oralvaccine against Helicobacter pylori

1 Introduction

Helicobacter pylori (H pylori) is a spiral and motile Gram-negative bacterium which colonizes the human stomachmucosa and is the main cause of a range of gastric andduodenal diseases including chronic gastritis stomach andduodenal ulcers MALT lymphoma and gastric adenocar-cinoma and it is considered as the second most frequentcause of cancer death worldwide [1 2] H pylori is alsothe pathogenic microorganism which has relationship withdiabetes mellitus coronary artery disease thrombocytopenicpurpura and so on [3ndash5] Heat shock proteins (Hsp) ofH pylori play important roles in H pylori adhesion togastric epithelial assembling of urease enzyme subunit andstimulating the body to produce an immune response at thesame time they are the main immunogens ofH pylori HspAis the main functional unit of Hsp and it locates bacterial

surface is relatively conservative and has immunogenicityso it is an important candidate vaccine antigen of H pylori

Lactococcus lactis (L lactis) is a Gram-positive non-invasive nonpathogenic and food-grade bacterium and isgenerally recognized as safe (GRAS) which has been used inthe food industry for production of fermented milk productsfor many years Because of its genetic accessibility and easymaneuverability L lactis has been extensively used as alive delivery vehicle of heterologous proteins [6ndash8] Nisin-controlled expression (NICE) system is the most effectivefood-grade inducible expression system As induction signalNisin has been successfully applied to a variety of strainsincluding Lactococcus Lactobacillus Streptococcus and Ente-rococcus [9 10]

To develop an oral vaccine againstH pylori in the presentstudy hspA gene was cloned from H pylori MEL-Hp27 andsequenced Then hspA gene was inserted into the vector

Hindawi Publishing CorporationGastroenterology Research and PracticeVolume 2015 Article ID 750932 6 pageshttpdxdoiorg1011552015750932

2 Gastroenterology Research and Practice

pNZ8110 and electrotransformed into L lactis NZ3900 Theimmunoreactivity of HspA expressed by recombinant Lacto-coccus bacteria was identified by western blot analysis

2 Materials and Methods

21 Microorganism Plasmid and Growth Conditions Thestrain of H pylori MEL-Hp27 was separated from a clinicalatrophic gastritis patient of Zhengzhou city China L lactisNZ3900 and the E coli-L lactis shuttle vector pNZ8110 werepurchased from NIZO food research L lactis NZ3900 wasgrown inM17medium (Difco USA) supplementedwith 05glucose (GM17) at 30∘C MC1061 was grown in LB broth(Oxoid UK) at 37∘CWhen necessary antibiotics were addedto culturemedium at the following concentrations ampicillin(100 120583gmL) and chloramphenicol (10 120583gmL)

22 PCR of hspA Gene The hspA gene was amplified byPCR in the presence of MEL-Hp27 genomic DNA and NcoI-forward primer 51015840-catgccatgggcatgaagtttctacca-31015840 and XbaI-reverse primer 51015840-cggtctagattagtgttttttgtgatc-31015840 NcoIXbaIrestriction endonuclease sites were underlined To constructthe translational fusion expression the four base pairs ATGGof NcoI restriction endonuclease sites under the SD domainof pNZ8110 nisA promoter were added to the forward primerTwo base pairs GC were added to keep the reading frameinvariant PCR was carried out under the following condi-tions 30 cycles of denaturation at 94∘C for 1min annealingat 55∘C for 1min and extension at 72∘C for 1min

23 Construction of the Recombinant NZ3900pNZ8110-hspAThe hspA gene was inserted into the Escherichia coli- (E coli-)Lactococcus lactis (L lactis) shuttle vector pNZ8110 and therecombinant plasmid was transformed into MC1061 usingthe method of calcium chloride The transformants wereselected on LB plates containing 10 120583gmL chloramphenicolIdentification of the transformants was operated by PCR ofthe hspA gene digested by NcoI and XbaI and subjected toDNA sequencing Then the plasmid of pNZ8110-hspA waselectrotransformed into L lactis NZ3900 and the transfor-mants were selected on GM17 plates containing 10 120583gmLchloramphenicol

24 Influence of hspAGene on theGrowth of Recombinant Lac-tococcus lactis NZ3900 was transferred into the 10mLGM17liquid medium according to 1 25 (vv) NZ3900pNZ8110and NZ3900pNZ8110-hspA were transferred respectivelyinto the 10mL GM17 liquid medium containing 10 120583gmLchloramphenicol according to 1 25 (vv) Each tube wasmixed at interval of 1 hour tomeasure the absorbanceA600 ofbacteria Growth curves of NZ3900 NZ3900pNZ8110 andNZ3900pNZ8110-hspA were plotted with incubation time asthe abscissa and A600 as the vertical axis

25 Influence of Nisin Concentration on the Growth ofRecombinant Lactococcus lactis NZ3900pNZ8110-hspA wastransferred respectively into 7 tubes of 10mL GM17 liquidmedium containing 10 120583gmL chloramphenicol according to1 25 (vv) then Nisin stock solution was added to a final

4500bp3000 bp2000 bp

1200 bp800 bp500bp

200 bp

Figure 1 PCR product of MEL-Hp hspA gene (1) (2) PCR productof hspA gene from Hp genome (3) DNA ladder

concentration of 0 ngmL 10 ngmL 20 ngmL 40 ngmL60 ngmL 80 ngmL and 100 ngmL Each tube was mixed atinterval of 1 hour tomeasure the absorbanceA600 of bacteriaGrowth curves of NZ3900pNZ8110-hspA were plotted withincubation time as the abscissa and A600 as the verticalaxis Both NZ3900 and NZ3900pNZ8110 were operated ascontrols at the same time

26 Expression of HspA Protein in Recombinant Lactococcuslactis NZ3900pNZ8110-hspA was overnight cultured then400 120583L of which was transferred respectively into 2 tubesof 10mL GM17 liquid medium containing 10 120583gmL chlo-ramphenicol After NZ3900pNZ8110-hspA was cultured for4 hours Nisin stock solution was added respectively to thefinal concentrations 10 ngmL and 20 ngmL to induce theexpression of HspA NZ3900pNZ8110-hspA was sonicatedafter 4 hours and supernatant proteinwas collected and quan-tified using Bradford amount HspA expressed in Lactococcuslactis was detected by SDS-PAGE and Tricine SDS-PAGE

27 Detection of the Immunoreactivity of HspA Expressed byRecombinant Lactococcus lactis HspA expressed in recom-binant Lactococcus lactis was electrophoresed on a 15SDS-PAGE and then electrotransferred to the cellulosenitrate membrane The membrane was probed with a pri-mary polyclonal mice antiserum (diluted 1 50) and themembrane incubated at 37∘C for 2 h washed three timeswith TBSTween-20 (TBST) for 15min and then incubatedwith the horseradish peroxidase-linked secondary antibody(diluted 1 1000) Protein detection was visualized using theDAB western blot detection system (Tiangen China)

3 Results

31 PCR Results of hspA Gene from MEL-Hp27 Figure 1showed that the hspA gene (Genbank accession numberKJ567076) had been cloned successfully which contained 363base pairs The sequencing result showed that the sequencesof hspA gene in this experiment were correct comparedwith the sequences of MEL-Hp27 hspA (Genbank accession

Gastroenterology Research and Practice 3

4500bp3000 bp2000 bp1200 bp800 bp500bp200 bp

Figure 2 Identification of MC1061pNZ8110-hspA by PCR (1)Negative control (2) (3) (4) and (5) PCR product of hspA fromMC1061pNZ8110-hspA (6) DNA ladder

number AY295084) except the additional six base pairs asexplained in Section 22The sequence identification result ofMEL-HP27 hspA gene is as follows

atgggcatgaagtttc taccattagg agaaagggtc ttagtagaaagacttgaaga agagaacaaaaccagttcag gcatcatcat ccctgataac gctaaagaaa agcctttaatgggcgtagtcaaagcggtta gccataaaat cagcgagggt tgcaaatgcg ttaaa-gaagg cgatgtgatcgcttttggca aatacaaagg cgcagaaatc gttttagacg gcgttgaatacatggtgctagagctagaag acattctagg tattgtgggc tcaggctctt gttgtcatacaaatagtcatgaccataaac atgctaaaga gcatgaagct tgctgtcatg atca-caaaaa acactaa

32 Identification of RecombinantMC1061pNZ8110-hspA andNZ3900pNZ8110-hspA To express the HspA protein in Llactis transformant the hspA gene was inserted into the Ecoli-L lactis shuttle vector pNZ8110 and the recombinantplasmid was transformed into the E coli MC1061 Therecombinant pNZ8110-hspA was detected to be recombinedproperly with PCR (Figure 2) and digestion experiments(Figure 3) Then the recombinant pNZ8110-hspA was elec-trotransformed into L lactis NZ3900 NZ3900pNZ8110-hspA was identified by PCR and digestion experiments (notshown)

33 Influence of hspAGene on the Growth of Recombinant Lac-tococcus lactis From the growth curves (Figure 4) it could beseen that the proliferation of NZ3900 NZ3900pNZ8110 andNZ3900pNZ8110-hspA was very slow within the former 2hours then they entered the logarithmic growth phase withinthe following 6 hours After about 8 hours the growth ofbacteria got up to the plateau phase and the A600 absorbancevalue got to 20 or so The proliferation of NZ3900pNZ8110and NZ3900pNZ8110-hspA was slower than NZ3900 in thelogarithmic growth period which may be due to the result

4500bp3000 bp2000 bp1200 bp800 bp500bp

200 bp

Figure 3 Identification of the recombinant vector of pNZ8110-hspAby restriction enzyme digestion (1) pNZ8110-hspA digested byXbaI(2) pNZ8110-hspA digested by NcoI and XbaI (3) pNZ8110 digestedby XbaI (4) PCR product of hspA (5) DNA ladder

A600

22

20

18

16

14

12

10

08

06

04

02

00

0 1 2 3 4 5 6 7 8 9 10 11

t (h)

NZ3900NZ3900pNZ8110NZ3900pNZ8110-hspA

Figure 4 The growth curves of NZ3900 NZ3900pNZ8110 andNZ3900pNZ8110-hspA

of plasmid replication indicating that insertion of hspA genedid not impact the growth of recombinant Lactococcus lactis

34 Influence of Nisin Concentration on the Growth of Recom-binant Lactococcus lactis It can be seen from Figures 5(a)5(b) and 5(c) that the growth of NZ3900pNZ8110-hspAwas inhibited noticeably by different concentrations of NisinThe A600 absorbance value of NZ3900pNZ8110-hspA got to1989 in no Nisin group while in the 100 ngmL Nisin groupit only got to 1125 The growth curve showed that differentconcentrations of Nisin did not affect the growth of blankcontrol (NZ3900) and negative control (NZ3900pNZ8110)

35 Expression of HspA in Recombinant Lactococcus lactisThe expected molecular weight bands could not be observedon the SDS-PAGEgel or Tricine SDS-PAGEgel after 10 ngmL

4 Gastroenterology Research and Practice

22

20

18

16

14

12

10

08

06

04

02

00

OD

600

t (h)0 1 2 3 4 5 6 7 8 9 21 22

(0ngmL) ()(10ngmL) ()(20ngmL) ()(40ngmL) ()

(60ngmL) ()(80ngmL) ()(100ngmL) ()

(a)

22

20

18

16

14

12

10

08

06

04

02

00

OD

600

t (h)0 1 2 3 4 5 6 7 8 9 21 22

(0ngmL) ()(10ngmL) ()(20ngmL) ()(40ngmL) ()

(60ngmL) ()(80ngmL) ()(100ngmL) ()

(b)

22

20

18

16

14

12

10

08

06

04

02

00

t (h)0 1 2 3 4 5 6 7 8 9 21 22

(0ngmL) ()(10ngmL) ()(20ngmL) ()(40ngmL) ()

(60ngmL) ()(80ngmL) ()(100ngmL) ()

A600

(c)

Figure 5 (a) Influence of Nisin concentration on NZ3900 (b) Influence of Nisin concentration on NZ3900pNZ8110 (c) Influence of Nisinconcentration on NZ3900pNZ8110-hspA

or 20 ngmL Nisin induction for 4 hours indicating thatno HspA protein was expressed or the expression level wastoo low to be detected The expected molecular weightbands could not be observed in blank control (NZ3900) andnegative control (NZ3900pNZ8110)

36 Identification of the Immunoreactivity of HspA Expressedby Recombinant Lactococcus lactis It was presented inFigure 6 that the HspA expressed by L lactis transformantcould be recognized by anti-Hp serum This result indicatedthat the HspA protein expressed by L lactis transformant hadfavorable immunoreactivity

4 Discussion

H pylori is now recognized as the most widespread humanpathogen Approximately half of the worldrsquos population isinfected [11 12] A great interest in developing a vaccinationmethod to prevent infection by H pylori has been raisedgiven that immunization is always considered as the mosteconomic and efficientmeans in such a field especially for thedeveloping countries Many researchers had made a substan-tial contribution to H pylori vaccine such as protein vaccineor Salmonella vector vaccine while these vaccines could notbe optimistical because of the difficult maneuverability orgastrointestinal toxicity or insecurity [13 14]

Gastroenterology Research and Practice 5

26kD

19kD

Figure 6 Western blot reaction of HspA protein expressed byLactococcus lactis with polyclonal antibody serum to H pylori (1)Negative control (2) (3) Western blot reaction of HspA proteinto polyclonal antibody serum to H pylori (4) Prestained proteinmarker

L lactis has a number of prominent advantages that makeit a promising candidate for large scale gene expressionthe bacterium is food-grade and plasmid selection mech-anisms are available that are food-grade and self-cloningFurthermore no endotoxins or inclusion bodies are formedand sophisticated genetic tools enable easy genetic handlingFinally simple nonaerated fermentation makes direct scale-up from 1-L scale to 1000-L scale possible The commonlyused regulated expression system of L lactis is the Nisin-controlled gene expression (NICE) system [15ndash18] In recentyears L lactis has been used to express H pylori antigenprotein as live bacteria vehicle The 31015840-region (1152 bp) of thecag7 gene of Helicobacter pylori 51 strain had been expressedin Lactococcus lactis ssp MG1363 [19] The results showedthat the transformant could produce the Cag7-ct383 proteinand the Cag7-ct383 protein level in the L lactis transformantreached a maximum at the early stationary phase withoutextracellular secretion The oral administration of the Llactis transformant into mice generated anti-Cag7 antibodyin serum in five of five mice These results suggest that Llactis transformant expressing Cag7-ct383 protein may beapplicable as an oral vaccine to induce mucosal and systemicimmunity to H pylori

NICE system was used in our experiments to expressthe MEL-Hp27 UreB and HspA protein in a food-gradedelivery vehicle L lactis NZ3900 The results showed thatthe maximum yield of the UreB protein was 2726 120583g permilliliter medium and the percentage of UreB to cell extractsof the L lactis transformant got to the peak at 2019 whichwas substantial quantities of antigen expressed in L lactis[20] In this study it could be seen that the insertion ofhspA did not impact the growth of NZ3900pNZ8110-hspAand the bacterial density of NZ3900pNZ8110-hspA could getthe same value as NZ3900 and NZ3900pNZ8110 when theygrew into the plateau phase different concentrations of Nisindid not affect the growth of NZ3900 and NZ3900pNZ8110while different concentraions of Nisin significantly inhibitedthe growth of NZ3900pNZ8110-hspA except 10 ngmLNisinthe rest of concentrations of Nisin significantly inhibited thegrowth of NZ3900pNZ8110-hspA The expected molecularweight bands could not be observed on the SDS-PAGE gelor Tricine SDS-PAGE gel western blot identification resultsshowed that HspA expressed by NZ3900pNZ8110-hspA hadgood immunoreactivity From the growth curves it could beinferred that it was not because of Nisin inhibiting the growth

of NZ3900pNZ8110-hspA as inhibitory but because HspAhad not been induced to be expressed effectively in 10 ngmLNisin group while in higher concentrations of Nisin groupa small amount of exogenous expression of HspA inhibitedthe growth of NZ3900pNZ8110-hspA itself The mechanismdeserves to be further investigated

This study established the experimental foundation forconstructing the food-grade vaccine to H pylori infection

Conflict of Interests

The authors declare no conflict of interests

References

[1] S P Vyas and V Sihorkar ldquoExploring novel vaccines againstHelicobacter pylori protective and therapeutic immunizationrdquoJournal of Clinical Pharmacy andTherapeutics vol 24 no 4 pp259ndash272 1999

[2] VDe Francesco A Zullo CHassan F Giorgio R Rosania andE Ierardi ldquoMechanisms of Helicobacter pylori antibiotic resis-tance an updated appraisalrdquo World Journal of GastrointestinalPathophysiology vol 2 no 3 pp 35ndash41 2011

[3] A Pietroiusti M Giuliano A Magrini A Bergamaschi and AGalante ldquoCytotoxin-associated gene A strains of Helicobacterpylori represent a risk factor for the development of microal-buminuria in type 2 diabetesrdquo Diabetes Care vol 29 no 6 pp1399ndash1401 2006

[4] K-S Wu C-C Hsiao H-R Yu E-Y Huang W-L Mai andJ-M Sheen ldquoHelicobacter pylori infection and childhood idio-pathic thrombocytopenic purpurardquoActa Paediatrica Taiwanicavol 48 no 5 pp 263ndash266 2007

[5] F Franceschi G Niccoli G Ferrante et al ldquoCagA antigenof helicobacter pylori and coronary instability insight from aclinico-pathological study and a meta-analysis of 4241 casesrdquoAtherosclerosis vol 202 no 2 pp 535ndash542 2009

[6] P M Norton J M Wells H W G Brown A M Macphersonand R W F Le Page ldquoProtection against tetanus toxin inmice nasally immunized with recombinant Lactococcus lactisexpressing tetanus toxin fragment Crdquo Vaccine vol 15 no 6-7pp 616ndash619 1997

[7] L G Bermudez-Humaran N G Cortes-Perez F Lefevre et alldquoA novel mucosal vaccine based on live Lactococci expressingE7 antigen and IL-12 induces systemic and mucosal immuneresponses and protectsmice against humanpapillomavirus type16-induced tumorsrdquoThe Journal of Immunology vol 175 no 11pp 7297ndash7302 2005

[8] R Ramasamy S Yasawardena A Zomer G Venema J Kokand K Leenhouts ldquoImmunogenicity of a malaria parasiteantigen displayed by Lactococcus lactis in oral immunisationsrdquoVaccine vol 24 no 18 pp 3900ndash3908 2006

[9] S Pavan P Hols J Delcour et al ldquoAdaptation of the nisin-controlled expression system in Lactobacillus plantarum a toolto study in vivo biological effectsrdquo Applied and EnvironmentalMicrobiology vol 66 no 10 pp 4427ndash4432 2000

[10] E M Bryan T Bae M Kleerebezem and G M DunnyldquoImproved vectors for nisin-controlled expression in gram-positive bacteriardquo Plasmid vol 44 no 2 pp 183ndash190 2000

[11] S J Czinn ldquoHelicobacter pylori infection detection investiga-tion and managementrdquo Journal of Pediatrics vol 146 no 3 ppS21ndashS26 2005

6 Gastroenterology Research and Practice

[12] G Rossi P Ruggiero S Peppoloni et al ldquoTherapeutic vaccina-tion against Helicobacter pylori in the beagle dog experimentalmodel safety immunogenicity and efficacyrdquo Infection andImmunity vol 72 no 6 pp 3252ndash3259 2004

[13] M Pizza M M Giuliani M R Fontana et al ldquoMucosalvaccines non toxic derivatives of LT and CT as mucosaladjuvantsrdquo Vaccine vol 19 no 17ndash19 pp 2534ndash2541 2001

[14] C Xu Z-S Li Y-D Du et al ldquoConstruction of a recombinantattenuated Salmonella typhimurium DNA vaccine carryingHelicobacter pylori hpaArdquo World Journal of Gastroenterologyvol 11 no 1 pp 114ndash117 2005

[15] I Mierau andM Kleerebezem ldquo10 years of the nisin-controlledgene expression system (NICE) in Lactococcus lactisrdquo AppliedMicrobiology andBiotechnology vol 68 no 6 pp 705ndash717 2005

[16] T Maischberger I Mierau C K Peterbauer J Hugenholtzand D Haltrich ldquoHigh-level expression of Lactobocillus 120573-galactosidases in Lactococcus lactis using the food-grade nisin-controlled expression systemNICErdquo Journal of Agricultural andFood Chemistry vol 58 no 4 pp 2279ndash2287 2010

[17] A Berlec and B Strukelj ldquoLarge increase in brazzein expressionachieved by changing the plasmidstrain combination of theNICE system in Lactococcus lactisrdquo Letters in Applied Microbi-ology vol 48 no 6 pp 750ndash755 2009

[18] IMierau P Leij I van Swamet al ldquoIndustrial-scale productionand purification of a heterologous protein in Lactococcus lactisusing the nisin-controlled gene expression system NICE thecase of lysostaphinrdquo Microbial Cell Factories vol 4 article 152005

[19] S J Kim J Y Lee D Y Jun et al ldquoOral administration ofLactococcus lactis expressing Helicobacter pylori Cag7-ct383protein induces systemic anti-Cag7 immune response in micerdquoFEMS Immunology and Medical Microbiology vol 57 no 3 pp257ndash268 2009

[20] X J Zhang G C Duan R G Zhang and Q Fan ldquoOptimizedexpression of Helicobacter pylori ureB gene in the Lactococcuslactis nisin-controlled gene expression (NICE) system andexperimental study of its immunoreactivityrdquo Current Microbi-ology vol 58 no 4 pp 308ndash314 2009

Gastroenterology Research and Practice 3

4500bp3000 bp2000 bp1200 bp800 bp500bp200 bp

Figure 2 Identification of MC1061pNZ8110-hspA by PCR (1)Negative control (2) (3) (4) and (5) PCR product of hspA fromMC1061pNZ8110-hspA (6) DNA ladder

number AY295084) except the additional six base pairs asexplained in Section 22The sequence identification result ofMEL-HP27 hspA gene is as follows

atgggcatgaagtttc taccattagg agaaagggtc ttagtagaaagacttgaaga agagaacaaaaccagttcag gcatcatcat ccctgataac gctaaagaaa agcctttaatgggcgtagtcaaagcggtta gccataaaat cagcgagggt tgcaaatgcg ttaaa-gaagg cgatgtgatcgcttttggca aatacaaagg cgcagaaatc gttttagacg gcgttgaatacatggtgctagagctagaag acattctagg tattgtgggc tcaggctctt gttgtcatacaaatagtcatgaccataaac atgctaaaga gcatgaagct tgctgtcatg atca-caaaaa acactaa

32 Identification of RecombinantMC1061pNZ8110-hspA andNZ3900pNZ8110-hspA To express the HspA protein in Llactis transformant the hspA gene was inserted into the Ecoli-L lactis shuttle vector pNZ8110 and the recombinantplasmid was transformed into the E coli MC1061 Therecombinant pNZ8110-hspA was detected to be recombinedproperly with PCR (Figure 2) and digestion experiments(Figure 3) Then the recombinant pNZ8110-hspA was elec-trotransformed into L lactis NZ3900 NZ3900pNZ8110-hspA was identified by PCR and digestion experiments (notshown)

33 Influence of hspAGene on the Growth of Recombinant Lac-tococcus lactis From the growth curves (Figure 4) it could beseen that the proliferation of NZ3900 NZ3900pNZ8110 andNZ3900pNZ8110-hspA was very slow within the former 2hours then they entered the logarithmic growth phase withinthe following 6 hours After about 8 hours the growth ofbacteria got up to the plateau phase and the A600 absorbancevalue got to 20 or so The proliferation of NZ3900pNZ8110and NZ3900pNZ8110-hspA was slower than NZ3900 in thelogarithmic growth period which may be due to the result

4500bp3000 bp2000 bp1200 bp800 bp500bp

200 bp

Figure 3 Identification of the recombinant vector of pNZ8110-hspAby restriction enzyme digestion (1) pNZ8110-hspA digested byXbaI(2) pNZ8110-hspA digested by NcoI and XbaI (3) pNZ8110 digestedby XbaI (4) PCR product of hspA (5) DNA ladder

A600

22

20

18

16

14

12

10

08

06

04

02

00

0 1 2 3 4 5 6 7 8 9 10 11

t (h)

NZ3900NZ3900pNZ8110NZ3900pNZ8110-hspA

Figure 4 The growth curves of NZ3900 NZ3900pNZ8110 andNZ3900pNZ8110-hspA

of plasmid replication indicating that insertion of hspA genedid not impact the growth of recombinant Lactococcus lactis

34 Influence of Nisin Concentration on the Growth of Recom-binant Lactococcus lactis It can be seen from Figures 5(a)5(b) and 5(c) that the growth of NZ3900pNZ8110-hspAwas inhibited noticeably by different concentrations of NisinThe A600 absorbance value of NZ3900pNZ8110-hspA got to1989 in no Nisin group while in the 100 ngmL Nisin groupit only got to 1125 The growth curve showed that differentconcentrations of Nisin did not affect the growth of blankcontrol (NZ3900) and negative control (NZ3900pNZ8110)

35 Expression of HspA in Recombinant Lactococcus lactisThe expected molecular weight bands could not be observedon the SDS-PAGEgel or Tricine SDS-PAGEgel after 10 ngmL

4 Gastroenterology Research and Practice

22

20

18

16

14

12

10

08

06

04

02

00

OD

600

t (h)0 1 2 3 4 5 6 7 8 9 21 22

(0ngmL) ()(10ngmL) ()(20ngmL) ()(40ngmL) ()

(60ngmL) ()(80ngmL) ()(100ngmL) ()

(a)

22

20

18

16

14

12

10

08

06

04

02

00

OD

600

t (h)0 1 2 3 4 5 6 7 8 9 21 22

(0ngmL) ()(10ngmL) ()(20ngmL) ()(40ngmL) ()

(60ngmL) ()(80ngmL) ()(100ngmL) ()

(b)

22

20

18

16

14

12

10

08

06

04

02

00

t (h)0 1 2 3 4 5 6 7 8 9 21 22

(0ngmL) ()(10ngmL) ()(20ngmL) ()(40ngmL) ()

(60ngmL) ()(80ngmL) ()(100ngmL) ()

A600

(c)

Figure 5 (a) Influence of Nisin concentration on NZ3900 (b) Influence of Nisin concentration on NZ3900pNZ8110 (c) Influence of Nisinconcentration on NZ3900pNZ8110-hspA

or 20 ngmL Nisin induction for 4 hours indicating thatno HspA protein was expressed or the expression level wastoo low to be detected The expected molecular weightbands could not be observed in blank control (NZ3900) andnegative control (NZ3900pNZ8110)

36 Identification of the Immunoreactivity of HspA Expressedby Recombinant Lactococcus lactis It was presented inFigure 6 that the HspA expressed by L lactis transformantcould be recognized by anti-Hp serum This result indicatedthat the HspA protein expressed by L lactis transformant hadfavorable immunoreactivity

4 Discussion

H pylori is now recognized as the most widespread humanpathogen Approximately half of the worldrsquos population isinfected [11 12] A great interest in developing a vaccinationmethod to prevent infection by H pylori has been raisedgiven that immunization is always considered as the mosteconomic and efficientmeans in such a field especially for thedeveloping countries Many researchers had made a substan-tial contribution to H pylori vaccine such as protein vaccineor Salmonella vector vaccine while these vaccines could notbe optimistical because of the difficult maneuverability orgastrointestinal toxicity or insecurity [13 14]

Gastroenterology Research and Practice 5

26kD

19kD

Figure 6 Western blot reaction of HspA protein expressed byLactococcus lactis with polyclonal antibody serum to H pylori (1)Negative control (2) (3) Western blot reaction of HspA proteinto polyclonal antibody serum to H pylori (4) Prestained proteinmarker

L lactis has a number of prominent advantages that makeit a promising candidate for large scale gene expressionthe bacterium is food-grade and plasmid selection mech-anisms are available that are food-grade and self-cloningFurthermore no endotoxins or inclusion bodies are formedand sophisticated genetic tools enable easy genetic handlingFinally simple nonaerated fermentation makes direct scale-up from 1-L scale to 1000-L scale possible The commonlyused regulated expression system of L lactis is the Nisin-controlled gene expression (NICE) system [15ndash18] In recentyears L lactis has been used to express H pylori antigenprotein as live bacteria vehicle The 31015840-region (1152 bp) of thecag7 gene of Helicobacter pylori 51 strain had been expressedin Lactococcus lactis ssp MG1363 [19] The results showedthat the transformant could produce the Cag7-ct383 proteinand the Cag7-ct383 protein level in the L lactis transformantreached a maximum at the early stationary phase withoutextracellular secretion The oral administration of the Llactis transformant into mice generated anti-Cag7 antibodyin serum in five of five mice These results suggest that Llactis transformant expressing Cag7-ct383 protein may beapplicable as an oral vaccine to induce mucosal and systemicimmunity to H pylori

NICE system was used in our experiments to expressthe MEL-Hp27 UreB and HspA protein in a food-gradedelivery vehicle L lactis NZ3900 The results showed thatthe maximum yield of the UreB protein was 2726 120583g permilliliter medium and the percentage of UreB to cell extractsof the L lactis transformant got to the peak at 2019 whichwas substantial quantities of antigen expressed in L lactis[20] In this study it could be seen that the insertion ofhspA did not impact the growth of NZ3900pNZ8110-hspAand the bacterial density of NZ3900pNZ8110-hspA could getthe same value as NZ3900 and NZ3900pNZ8110 when theygrew into the plateau phase different concentrations of Nisindid not affect the growth of NZ3900 and NZ3900pNZ8110while different concentraions of Nisin significantly inhibitedthe growth of NZ3900pNZ8110-hspA except 10 ngmLNisinthe rest of concentrations of Nisin significantly inhibited thegrowth of NZ3900pNZ8110-hspA The expected molecularweight bands could not be observed on the SDS-PAGE gelor Tricine SDS-PAGE gel western blot identification resultsshowed that HspA expressed by NZ3900pNZ8110-hspA hadgood immunoreactivity From the growth curves it could beinferred that it was not because of Nisin inhibiting the growth

of NZ3900pNZ8110-hspA as inhibitory but because HspAhad not been induced to be expressed effectively in 10 ngmLNisin group while in higher concentrations of Nisin groupa small amount of exogenous expression of HspA inhibitedthe growth of NZ3900pNZ8110-hspA itself The mechanismdeserves to be further investigated

This study established the experimental foundation forconstructing the food-grade vaccine to H pylori infection

Conflict of Interests

The authors declare no conflict of interests

References

[1] S P Vyas and V Sihorkar ldquoExploring novel vaccines againstHelicobacter pylori protective and therapeutic immunizationrdquoJournal of Clinical Pharmacy andTherapeutics vol 24 no 4 pp259ndash272 1999

[2] VDe Francesco A Zullo CHassan F Giorgio R Rosania andE Ierardi ldquoMechanisms of Helicobacter pylori antibiotic resis-tance an updated appraisalrdquo World Journal of GastrointestinalPathophysiology vol 2 no 3 pp 35ndash41 2011

[3] A Pietroiusti M Giuliano A Magrini A Bergamaschi and AGalante ldquoCytotoxin-associated gene A strains of Helicobacterpylori represent a risk factor for the development of microal-buminuria in type 2 diabetesrdquo Diabetes Care vol 29 no 6 pp1399ndash1401 2006

[4] K-S Wu C-C Hsiao H-R Yu E-Y Huang W-L Mai andJ-M Sheen ldquoHelicobacter pylori infection and childhood idio-pathic thrombocytopenic purpurardquoActa Paediatrica Taiwanicavol 48 no 5 pp 263ndash266 2007

[5] F Franceschi G Niccoli G Ferrante et al ldquoCagA antigenof helicobacter pylori and coronary instability insight from aclinico-pathological study and a meta-analysis of 4241 casesrdquoAtherosclerosis vol 202 no 2 pp 535ndash542 2009

[6] P M Norton J M Wells H W G Brown A M Macphersonand R W F Le Page ldquoProtection against tetanus toxin inmice nasally immunized with recombinant Lactococcus lactisexpressing tetanus toxin fragment Crdquo Vaccine vol 15 no 6-7pp 616ndash619 1997

[7] L G Bermudez-Humaran N G Cortes-Perez F Lefevre et alldquoA novel mucosal vaccine based on live Lactococci expressingE7 antigen and IL-12 induces systemic and mucosal immuneresponses and protectsmice against humanpapillomavirus type16-induced tumorsrdquoThe Journal of Immunology vol 175 no 11pp 7297ndash7302 2005

[8] R Ramasamy S Yasawardena A Zomer G Venema J Kokand K Leenhouts ldquoImmunogenicity of a malaria parasiteantigen displayed by Lactococcus lactis in oral immunisationsrdquoVaccine vol 24 no 18 pp 3900ndash3908 2006

[9] S Pavan P Hols J Delcour et al ldquoAdaptation of the nisin-controlled expression system in Lactobacillus plantarum a toolto study in vivo biological effectsrdquo Applied and EnvironmentalMicrobiology vol 66 no 10 pp 4427ndash4432 2000

[10] E M Bryan T Bae M Kleerebezem and G M DunnyldquoImproved vectors for nisin-controlled expression in gram-positive bacteriardquo Plasmid vol 44 no 2 pp 183ndash190 2000

[11] S J Czinn ldquoHelicobacter pylori infection detection investiga-tion and managementrdquo Journal of Pediatrics vol 146 no 3 ppS21ndashS26 2005

6 Gastroenterology Research and Practice

[12] G Rossi P Ruggiero S Peppoloni et al ldquoTherapeutic vaccina-tion against Helicobacter pylori in the beagle dog experimentalmodel safety immunogenicity and efficacyrdquo Infection andImmunity vol 72 no 6 pp 3252ndash3259 2004

[13] M Pizza M M Giuliani M R Fontana et al ldquoMucosalvaccines non toxic derivatives of LT and CT as mucosaladjuvantsrdquo Vaccine vol 19 no 17ndash19 pp 2534ndash2541 2001

[14] C Xu Z-S Li Y-D Du et al ldquoConstruction of a recombinantattenuated Salmonella typhimurium DNA vaccine carryingHelicobacter pylori hpaArdquo World Journal of Gastroenterologyvol 11 no 1 pp 114ndash117 2005

[15] I Mierau andM Kleerebezem ldquo10 years of the nisin-controlledgene expression system (NICE) in Lactococcus lactisrdquo AppliedMicrobiology andBiotechnology vol 68 no 6 pp 705ndash717 2005

[16] T Maischberger I Mierau C K Peterbauer J Hugenholtzand D Haltrich ldquoHigh-level expression of Lactobocillus 120573-galactosidases in Lactococcus lactis using the food-grade nisin-controlled expression systemNICErdquo Journal of Agricultural andFood Chemistry vol 58 no 4 pp 2279ndash2287 2010

[17] A Berlec and B Strukelj ldquoLarge increase in brazzein expressionachieved by changing the plasmidstrain combination of theNICE system in Lactococcus lactisrdquo Letters in Applied Microbi-ology vol 48 no 6 pp 750ndash755 2009

[18] IMierau P Leij I van Swamet al ldquoIndustrial-scale productionand purification of a heterologous protein in Lactococcus lactisusing the nisin-controlled gene expression system NICE thecase of lysostaphinrdquo Microbial Cell Factories vol 4 article 152005

[19] S J Kim J Y Lee D Y Jun et al ldquoOral administration ofLactococcus lactis expressing Helicobacter pylori Cag7-ct383protein induces systemic anti-Cag7 immune response in micerdquoFEMS Immunology and Medical Microbiology vol 57 no 3 pp257ndash268 2009

[20] X J Zhang G C Duan R G Zhang and Q Fan ldquoOptimizedexpression of Helicobacter pylori ureB gene in the Lactococcuslactis nisin-controlled gene expression (NICE) system andexperimental study of its immunoreactivityrdquo Current Microbi-ology vol 58 no 4 pp 308ndash314 2009

4 Gastroenterology Research and Practice

22

20

18

16

14

12

10

08

06

04

02

00

OD

600

t (h)0 1 2 3 4 5 6 7 8 9 21 22

(0ngmL) ()(10ngmL) ()(20ngmL) ()(40ngmL) ()

(60ngmL) ()(80ngmL) ()(100ngmL) ()

(a)

22

20

18

16

14

12

10

08

06

04

02

00

OD

600

t (h)0 1 2 3 4 5 6 7 8 9 21 22

(0ngmL) ()(10ngmL) ()(20ngmL) ()(40ngmL) ()

(60ngmL) ()(80ngmL) ()(100ngmL) ()

(b)

22

20

18

16

14

12

10

08

06

04

02

00

t (h)0 1 2 3 4 5 6 7 8 9 21 22

(0ngmL) ()(10ngmL) ()(20ngmL) ()(40ngmL) ()

(60ngmL) ()(80ngmL) ()(100ngmL) ()

A600

(c)

Figure 5 (a) Influence of Nisin concentration on NZ3900 (b) Influence of Nisin concentration on NZ3900pNZ8110 (c) Influence of Nisinconcentration on NZ3900pNZ8110-hspA

or 20 ngmL Nisin induction for 4 hours indicating thatno HspA protein was expressed or the expression level wastoo low to be detected The expected molecular weightbands could not be observed in blank control (NZ3900) andnegative control (NZ3900pNZ8110)

36 Identification of the Immunoreactivity of HspA Expressedby Recombinant Lactococcus lactis It was presented inFigure 6 that the HspA expressed by L lactis transformantcould be recognized by anti-Hp serum This result indicatedthat the HspA protein expressed by L lactis transformant hadfavorable immunoreactivity

4 Discussion

H pylori is now recognized as the most widespread humanpathogen Approximately half of the worldrsquos population isinfected [11 12] A great interest in developing a vaccinationmethod to prevent infection by H pylori has been raisedgiven that immunization is always considered as the mosteconomic and efficientmeans in such a field especially for thedeveloping countries Many researchers had made a substan-tial contribution to H pylori vaccine such as protein vaccineor Salmonella vector vaccine while these vaccines could notbe optimistical because of the difficult maneuverability orgastrointestinal toxicity or insecurity [13 14]

Gastroenterology Research and Practice 5

26kD

19kD

Figure 6 Western blot reaction of HspA protein expressed byLactococcus lactis with polyclonal antibody serum to H pylori (1)Negative control (2) (3) Western blot reaction of HspA proteinto polyclonal antibody serum to H pylori (4) Prestained proteinmarker

L lactis has a number of prominent advantages that makeit a promising candidate for large scale gene expressionthe bacterium is food-grade and plasmid selection mech-anisms are available that are food-grade and self-cloningFurthermore no endotoxins or inclusion bodies are formedand sophisticated genetic tools enable easy genetic handlingFinally simple nonaerated fermentation makes direct scale-up from 1-L scale to 1000-L scale possible The commonlyused regulated expression system of L lactis is the Nisin-controlled gene expression (NICE) system [15ndash18] In recentyears L lactis has been used to express H pylori antigenprotein as live bacteria vehicle The 31015840-region (1152 bp) of thecag7 gene of Helicobacter pylori 51 strain had been expressedin Lactococcus lactis ssp MG1363 [19] The results showedthat the transformant could produce the Cag7-ct383 proteinand the Cag7-ct383 protein level in the L lactis transformantreached a maximum at the early stationary phase withoutextracellular secretion The oral administration of the Llactis transformant into mice generated anti-Cag7 antibodyin serum in five of five mice These results suggest that Llactis transformant expressing Cag7-ct383 protein may beapplicable as an oral vaccine to induce mucosal and systemicimmunity to H pylori

NICE system was used in our experiments to expressthe MEL-Hp27 UreB and HspA protein in a food-gradedelivery vehicle L lactis NZ3900 The results showed thatthe maximum yield of the UreB protein was 2726 120583g permilliliter medium and the percentage of UreB to cell extractsof the L lactis transformant got to the peak at 2019 whichwas substantial quantities of antigen expressed in L lactis[20] In this study it could be seen that the insertion ofhspA did not impact the growth of NZ3900pNZ8110-hspAand the bacterial density of NZ3900pNZ8110-hspA could getthe same value as NZ3900 and NZ3900pNZ8110 when theygrew into the plateau phase different concentrations of Nisindid not affect the growth of NZ3900 and NZ3900pNZ8110while different concentraions of Nisin significantly inhibitedthe growth of NZ3900pNZ8110-hspA except 10 ngmLNisinthe rest of concentrations of Nisin significantly inhibited thegrowth of NZ3900pNZ8110-hspA The expected molecularweight bands could not be observed on the SDS-PAGE gelor Tricine SDS-PAGE gel western blot identification resultsshowed that HspA expressed by NZ3900pNZ8110-hspA hadgood immunoreactivity From the growth curves it could beinferred that it was not because of Nisin inhibiting the growth

of NZ3900pNZ8110-hspA as inhibitory but because HspAhad not been induced to be expressed effectively in 10 ngmLNisin group while in higher concentrations of Nisin groupa small amount of exogenous expression of HspA inhibitedthe growth of NZ3900pNZ8110-hspA itself The mechanismdeserves to be further investigated

This study established the experimental foundation forconstructing the food-grade vaccine to H pylori infection

Conflict of Interests

The authors declare no conflict of interests

References

[1] S P Vyas and V Sihorkar ldquoExploring novel vaccines againstHelicobacter pylori protective and therapeutic immunizationrdquoJournal of Clinical Pharmacy andTherapeutics vol 24 no 4 pp259ndash272 1999

[2] VDe Francesco A Zullo CHassan F Giorgio R Rosania andE Ierardi ldquoMechanisms of Helicobacter pylori antibiotic resis-tance an updated appraisalrdquo World Journal of GastrointestinalPathophysiology vol 2 no 3 pp 35ndash41 2011

[3] A Pietroiusti M Giuliano A Magrini A Bergamaschi and AGalante ldquoCytotoxin-associated gene A strains of Helicobacterpylori represent a risk factor for the development of microal-buminuria in type 2 diabetesrdquo Diabetes Care vol 29 no 6 pp1399ndash1401 2006

[4] K-S Wu C-C Hsiao H-R Yu E-Y Huang W-L Mai andJ-M Sheen ldquoHelicobacter pylori infection and childhood idio-pathic thrombocytopenic purpurardquoActa Paediatrica Taiwanicavol 48 no 5 pp 263ndash266 2007

[5] F Franceschi G Niccoli G Ferrante et al ldquoCagA antigenof helicobacter pylori and coronary instability insight from aclinico-pathological study and a meta-analysis of 4241 casesrdquoAtherosclerosis vol 202 no 2 pp 535ndash542 2009

[6] P M Norton J M Wells H W G Brown A M Macphersonand R W F Le Page ldquoProtection against tetanus toxin inmice nasally immunized with recombinant Lactococcus lactisexpressing tetanus toxin fragment Crdquo Vaccine vol 15 no 6-7pp 616ndash619 1997

[7] L G Bermudez-Humaran N G Cortes-Perez F Lefevre et alldquoA novel mucosal vaccine based on live Lactococci expressingE7 antigen and IL-12 induces systemic and mucosal immuneresponses and protectsmice against humanpapillomavirus type16-induced tumorsrdquoThe Journal of Immunology vol 175 no 11pp 7297ndash7302 2005

[8] R Ramasamy S Yasawardena A Zomer G Venema J Kokand K Leenhouts ldquoImmunogenicity of a malaria parasiteantigen displayed by Lactococcus lactis in oral immunisationsrdquoVaccine vol 24 no 18 pp 3900ndash3908 2006

[9] S Pavan P Hols J Delcour et al ldquoAdaptation of the nisin-controlled expression system in Lactobacillus plantarum a toolto study in vivo biological effectsrdquo Applied and EnvironmentalMicrobiology vol 66 no 10 pp 4427ndash4432 2000

[10] E M Bryan T Bae M Kleerebezem and G M DunnyldquoImproved vectors for nisin-controlled expression in gram-positive bacteriardquo Plasmid vol 44 no 2 pp 183ndash190 2000

[11] S J Czinn ldquoHelicobacter pylori infection detection investiga-tion and managementrdquo Journal of Pediatrics vol 146 no 3 ppS21ndashS26 2005

6 Gastroenterology Research and Practice

[12] G Rossi P Ruggiero S Peppoloni et al ldquoTherapeutic vaccina-tion against Helicobacter pylori in the beagle dog experimentalmodel safety immunogenicity and efficacyrdquo Infection andImmunity vol 72 no 6 pp 3252ndash3259 2004

[13] M Pizza M M Giuliani M R Fontana et al ldquoMucosalvaccines non toxic derivatives of LT and CT as mucosaladjuvantsrdquo Vaccine vol 19 no 17ndash19 pp 2534ndash2541 2001

[14] C Xu Z-S Li Y-D Du et al ldquoConstruction of a recombinantattenuated Salmonella typhimurium DNA vaccine carryingHelicobacter pylori hpaArdquo World Journal of Gastroenterologyvol 11 no 1 pp 114ndash117 2005

[15] I Mierau andM Kleerebezem ldquo10 years of the nisin-controlledgene expression system (NICE) in Lactococcus lactisrdquo AppliedMicrobiology andBiotechnology vol 68 no 6 pp 705ndash717 2005

[16] T Maischberger I Mierau C K Peterbauer J Hugenholtzand D Haltrich ldquoHigh-level expression of Lactobocillus 120573-galactosidases in Lactococcus lactis using the food-grade nisin-controlled expression systemNICErdquo Journal of Agricultural andFood Chemistry vol 58 no 4 pp 2279ndash2287 2010

[17] A Berlec and B Strukelj ldquoLarge increase in brazzein expressionachieved by changing the plasmidstrain combination of theNICE system in Lactococcus lactisrdquo Letters in Applied Microbi-ology vol 48 no 6 pp 750ndash755 2009

[18] IMierau P Leij I van Swamet al ldquoIndustrial-scale productionand purification of a heterologous protein in Lactococcus lactisusing the nisin-controlled gene expression system NICE thecase of lysostaphinrdquo Microbial Cell Factories vol 4 article 152005

[19] S J Kim J Y Lee D Y Jun et al ldquoOral administration ofLactococcus lactis expressing Helicobacter pylori Cag7-ct383protein induces systemic anti-Cag7 immune response in micerdquoFEMS Immunology and Medical Microbiology vol 57 no 3 pp257ndash268 2009

[20] X J Zhang G C Duan R G Zhang and Q Fan ldquoOptimizedexpression of Helicobacter pylori ureB gene in the Lactococcuslactis nisin-controlled gene expression (NICE) system andexperimental study of its immunoreactivityrdquo Current Microbi-ology vol 58 no 4 pp 308ndash314 2009

Gastroenterology Research and Practice 5

26kD

19kD

Figure 6 Western blot reaction of HspA protein expressed byLactococcus lactis with polyclonal antibody serum to H pylori (1)Negative control (2) (3) Western blot reaction of HspA proteinto polyclonal antibody serum to H pylori (4) Prestained proteinmarker

L lactis has a number of prominent advantages that makeit a promising candidate for large scale gene expressionthe bacterium is food-grade and plasmid selection mech-anisms are available that are food-grade and self-cloningFurthermore no endotoxins or inclusion bodies are formedand sophisticated genetic tools enable easy genetic handlingFinally simple nonaerated fermentation makes direct scale-up from 1-L scale to 1000-L scale possible The commonlyused regulated expression system of L lactis is the Nisin-controlled gene expression (NICE) system [15ndash18] In recentyears L lactis has been used to express H pylori antigenprotein as live bacteria vehicle The 31015840-region (1152 bp) of thecag7 gene of Helicobacter pylori 51 strain had been expressedin Lactococcus lactis ssp MG1363 [19] The results showedthat the transformant could produce the Cag7-ct383 proteinand the Cag7-ct383 protein level in the L lactis transformantreached a maximum at the early stationary phase withoutextracellular secretion The oral administration of the Llactis transformant into mice generated anti-Cag7 antibodyin serum in five of five mice These results suggest that Llactis transformant expressing Cag7-ct383 protein may beapplicable as an oral vaccine to induce mucosal and systemicimmunity to H pylori

NICE system was used in our experiments to expressthe MEL-Hp27 UreB and HspA protein in a food-gradedelivery vehicle L lactis NZ3900 The results showed thatthe maximum yield of the UreB protein was 2726 120583g permilliliter medium and the percentage of UreB to cell extractsof the L lactis transformant got to the peak at 2019 whichwas substantial quantities of antigen expressed in L lactis[20] In this study it could be seen that the insertion ofhspA did not impact the growth of NZ3900pNZ8110-hspAand the bacterial density of NZ3900pNZ8110-hspA could getthe same value as NZ3900 and NZ3900pNZ8110 when theygrew into the plateau phase different concentrations of Nisindid not affect the growth of NZ3900 and NZ3900pNZ8110while different concentraions of Nisin significantly inhibitedthe growth of NZ3900pNZ8110-hspA except 10 ngmLNisinthe rest of concentrations of Nisin significantly inhibited thegrowth of NZ3900pNZ8110-hspA The expected molecularweight bands could not be observed on the SDS-PAGE gelor Tricine SDS-PAGE gel western blot identification resultsshowed that HspA expressed by NZ3900pNZ8110-hspA hadgood immunoreactivity From the growth curves it could beinferred that it was not because of Nisin inhibiting the growth

of NZ3900pNZ8110-hspA as inhibitory but because HspAhad not been induced to be expressed effectively in 10 ngmLNisin group while in higher concentrations of Nisin groupa small amount of exogenous expression of HspA inhibitedthe growth of NZ3900pNZ8110-hspA itself The mechanismdeserves to be further investigated

This study established the experimental foundation forconstructing the food-grade vaccine to H pylori infection

Conflict of Interests

The authors declare no conflict of interests

References

[1] S P Vyas and V Sihorkar ldquoExploring novel vaccines againstHelicobacter pylori protective and therapeutic immunizationrdquoJournal of Clinical Pharmacy andTherapeutics vol 24 no 4 pp259ndash272 1999

[2] VDe Francesco A Zullo CHassan F Giorgio R Rosania andE Ierardi ldquoMechanisms of Helicobacter pylori antibiotic resis-tance an updated appraisalrdquo World Journal of GastrointestinalPathophysiology vol 2 no 3 pp 35ndash41 2011

[3] A Pietroiusti M Giuliano A Magrini A Bergamaschi and AGalante ldquoCytotoxin-associated gene A strains of Helicobacterpylori represent a risk factor for the development of microal-buminuria in type 2 diabetesrdquo Diabetes Care vol 29 no 6 pp1399ndash1401 2006

[4] K-S Wu C-C Hsiao H-R Yu E-Y Huang W-L Mai andJ-M Sheen ldquoHelicobacter pylori infection and childhood idio-pathic thrombocytopenic purpurardquoActa Paediatrica Taiwanicavol 48 no 5 pp 263ndash266 2007

[5] F Franceschi G Niccoli G Ferrante et al ldquoCagA antigenof helicobacter pylori and coronary instability insight from aclinico-pathological study and a meta-analysis of 4241 casesrdquoAtherosclerosis vol 202 no 2 pp 535ndash542 2009

[6] P M Norton J M Wells H W G Brown A M Macphersonand R W F Le Page ldquoProtection against tetanus toxin inmice nasally immunized with recombinant Lactococcus lactisexpressing tetanus toxin fragment Crdquo Vaccine vol 15 no 6-7pp 616ndash619 1997

[7] L G Bermudez-Humaran N G Cortes-Perez F Lefevre et alldquoA novel mucosal vaccine based on live Lactococci expressingE7 antigen and IL-12 induces systemic and mucosal immuneresponses and protectsmice against humanpapillomavirus type16-induced tumorsrdquoThe Journal of Immunology vol 175 no 11pp 7297ndash7302 2005

[8] R Ramasamy S Yasawardena A Zomer G Venema J Kokand K Leenhouts ldquoImmunogenicity of a malaria parasiteantigen displayed by Lactococcus lactis in oral immunisationsrdquoVaccine vol 24 no 18 pp 3900ndash3908 2006

[9] S Pavan P Hols J Delcour et al ldquoAdaptation of the nisin-controlled expression system in Lactobacillus plantarum a toolto study in vivo biological effectsrdquo Applied and EnvironmentalMicrobiology vol 66 no 10 pp 4427ndash4432 2000

[10] E M Bryan T Bae M Kleerebezem and G M DunnyldquoImproved vectors for nisin-controlled expression in gram-positive bacteriardquo Plasmid vol 44 no 2 pp 183ndash190 2000

[11] S J Czinn ldquoHelicobacter pylori infection detection investiga-tion and managementrdquo Journal of Pediatrics vol 146 no 3 ppS21ndashS26 2005

6 Gastroenterology Research and Practice

[12] G Rossi P Ruggiero S Peppoloni et al ldquoTherapeutic vaccina-tion against Helicobacter pylori in the beagle dog experimentalmodel safety immunogenicity and efficacyrdquo Infection andImmunity vol 72 no 6 pp 3252ndash3259 2004

[13] M Pizza M M Giuliani M R Fontana et al ldquoMucosalvaccines non toxic derivatives of LT and CT as mucosaladjuvantsrdquo Vaccine vol 19 no 17ndash19 pp 2534ndash2541 2001

[14] C Xu Z-S Li Y-D Du et al ldquoConstruction of a recombinantattenuated Salmonella typhimurium DNA vaccine carryingHelicobacter pylori hpaArdquo World Journal of Gastroenterologyvol 11 no 1 pp 114ndash117 2005

[15] I Mierau andM Kleerebezem ldquo10 years of the nisin-controlledgene expression system (NICE) in Lactococcus lactisrdquo AppliedMicrobiology andBiotechnology vol 68 no 6 pp 705ndash717 2005

[16] T Maischberger I Mierau C K Peterbauer J Hugenholtzand D Haltrich ldquoHigh-level expression of Lactobocillus 120573-galactosidases in Lactococcus lactis using the food-grade nisin-controlled expression systemNICErdquo Journal of Agricultural andFood Chemistry vol 58 no 4 pp 2279ndash2287 2010

[17] A Berlec and B Strukelj ldquoLarge increase in brazzein expressionachieved by changing the plasmidstrain combination of theNICE system in Lactococcus lactisrdquo Letters in Applied Microbi-ology vol 48 no 6 pp 750ndash755 2009

[18] IMierau P Leij I van Swamet al ldquoIndustrial-scale productionand purification of a heterologous protein in Lactococcus lactisusing the nisin-controlled gene expression system NICE thecase of lysostaphinrdquo Microbial Cell Factories vol 4 article 152005

[19] S J Kim J Y Lee D Y Jun et al ldquoOral administration ofLactococcus lactis expressing Helicobacter pylori Cag7-ct383protein induces systemic anti-Cag7 immune response in micerdquoFEMS Immunology and Medical Microbiology vol 57 no 3 pp257ndash268 2009

[20] X J Zhang G C Duan R G Zhang and Q Fan ldquoOptimizedexpression of Helicobacter pylori ureB gene in the Lactococcuslactis nisin-controlled gene expression (NICE) system andexperimental study of its immunoreactivityrdquo Current Microbi-ology vol 58 no 4 pp 308ndash314 2009

6 Gastroenterology Research and Practice

[12] G Rossi P Ruggiero S Peppoloni et al ldquoTherapeutic vaccina-tion against Helicobacter pylori in the beagle dog experimentalmodel safety immunogenicity and efficacyrdquo Infection andImmunity vol 72 no 6 pp 3252ndash3259 2004

[13] M Pizza M M Giuliani M R Fontana et al ldquoMucosalvaccines non toxic derivatives of LT and CT as mucosaladjuvantsrdquo Vaccine vol 19 no 17ndash19 pp 2534ndash2541 2001

[14] C Xu Z-S Li Y-D Du et al ldquoConstruction of a recombinantattenuated Salmonella typhimurium DNA vaccine carryingHelicobacter pylori hpaArdquo World Journal of Gastroenterologyvol 11 no 1 pp 114ndash117 2005

[15] I Mierau andM Kleerebezem ldquo10 years of the nisin-controlledgene expression system (NICE) in Lactococcus lactisrdquo AppliedMicrobiology andBiotechnology vol 68 no 6 pp 705ndash717 2005

[16] T Maischberger I Mierau C K Peterbauer J Hugenholtzand D Haltrich ldquoHigh-level expression of Lactobocillus 120573-galactosidases in Lactococcus lactis using the food-grade nisin-controlled expression systemNICErdquo Journal of Agricultural andFood Chemistry vol 58 no 4 pp 2279ndash2287 2010

[17] A Berlec and B Strukelj ldquoLarge increase in brazzein expressionachieved by changing the plasmidstrain combination of theNICE system in Lactococcus lactisrdquo Letters in Applied Microbi-ology vol 48 no 6 pp 750ndash755 2009

[18] IMierau P Leij I van Swamet al ldquoIndustrial-scale productionand purification of a heterologous protein in Lactococcus lactisusing the nisin-controlled gene expression system NICE thecase of lysostaphinrdquo Microbial Cell Factories vol 4 article 152005

[19] S J Kim J Y Lee D Y Jun et al ldquoOral administration ofLactococcus lactis expressing Helicobacter pylori Cag7-ct383protein induces systemic anti-Cag7 immune response in micerdquoFEMS Immunology and Medical Microbiology vol 57 no 3 pp257ndash268 2009

[20] X J Zhang G C Duan R G Zhang and Q Fan ldquoOptimizedexpression of Helicobacter pylori ureB gene in the Lactococcuslactis nisin-controlled gene expression (NICE) system andexperimental study of its immunoreactivityrdquo Current Microbi-ology vol 58 no 4 pp 308ndash314 2009