expression of gaba receptors in human scleraeprints.qut.edu.au/68604/2/emily_mcdonald_thesis.pdf ·...
TRANSCRIPT
Emily F. McDonald: GABA Receptors in Human Sclera
Expression of GABA Receptors in Human Sclera
Emily McDonald (nee Shanahan)
BSc (BmedSc), Hons (Microbiol)
The School of Optometry and Vision Science, Faculty of Health,
Vision Improvement Domain, Institute of Health and Biomedical
Innovation,
Queensland University of Technology
A thesis submitted in fulfilment of the requirements for the
Degree of Master of Applied Science (Research)
2014
Emily F. McDonald: GABA Receptors in Human Sclera
ii
Keywords
Choroid
Cultured Human Scleral Cells
Eye
Flow Cytometry
Gamma‐Aminobutyric Acid (GABA)
GABA Receptors
Immunohistochemistry
mRNA
Reverse‐Transcriptase Polymerase Chain Reaction
Retina
Retinal Pigment Epithelium
Sclera
Emily F. McDonald: GABA Receptors in Human Sclera
iii
Abstract
Background: Myopia, colloquially known as short‐sightedness, is a common refractive error
and is caused by elongation of the globe, i.e. axial elongation. Myopia, although
predominantly caused by excessive elongation, can be associated with optical alterations.
The sclera must expand to allow for this increase in size and, ultimately, must grow, or
remodel, for myopia to develop. It has been found that ‐aminobutyric acid (GABA), a
retinal neurotransmitter, influences eye growth and, accordingly, refractive development. In
the chick model of myopia, GABA antagonists have been shown to inhibit experimental
myopia and have been proposed as having a promising clinical role in the myopia treatment.
Although the mechanism for this effect is unknown, it has been recently shown that GABA
receptors are located in chick sclera, cornea and retinal pigment epithelium (RPE). It is well
known that there are GABA receptors present in the retina, including that of humans, and
that GABA is used as a retinal transmitter; however, not much is known about GABA in
other ocular tissues. The aim of this study was to determine the presence or absence of
GABA receptors in human scleral tissue and cultured human scleral cells, as well as
choroidal/RPE and retinal tissue.
Methods: Human ocular tissues were obtained from six donor eyes from the Queensland Eye
Bank. Three linked experiments were undertaken (i) immunohistochemistry (IHC) on
human scleral sections, (ii) reverse‐transcriptase polymerase chain reaction (RT‐PCR) of
ocular tissues, and (iii) RT‐PCR and flow cytometry (Dominici et al.) of cultured scleral cells.
(i) IHC was undertaken on human scleral tissue from one donor using antibodies raised
against three different GABA receptor subunits previously shown to be expressed in human
retinal tissue – GABAA Alpha 1, GABAC Rho 1, and GABAC Rho 2. As representative of the
GABAB receptor, the following antibody was also included: GABAB R2. The antibodies were
applied to the scleral sections taken from the four quadrants of the eye – superior, inferior,
medial, and lateral. The tissue required bleaching due to the presence of melanocytes. (ii)
Following isolation of total ribonucleic acid (RNA), RT‐PCR was undertaken to determine
gene expression of all known GABA receptor subunits on human scleral tissue (n=3 eyes),
choroid/RPE tissue (n=2 eyes), and retinal tissue (n=2 eyes). (iii) Scleral cells were cultured
using standard techniques utilising DMEM and FBS and passaged three times. RT‐PCR was
performed (n=2 eyes) and scleral cells were subsequently characterised using FC; the cells
were labelled with cell surface markers CD31, CD34, CD44, CD45, CD73, CD90, CD105,
GABAA‐α1, GABAB‐2, GABR‐R1, and GABR‐R2.
Results: Findings from the IHC of the scleral sections (i) were inconclusive due to
background staining. This may be due, at least in part, to the bleaching step (necessary due
to the presence of melanocytes) which increased the basophilia of the tissue. An alternative
strategy was to look at which GABA receptor genes were expressed. The gene expression
component of the project (ii) revealed the presence of several GABA receptor subunits in all
of the ocular tissues tested, including the cultured scleral cells (iii). The three scleral donors
yielded positive RNA results for GABA subunits representing GABAA and GABAC receptors
using RT‐PCR. The cultured scleral cells similarly revealed the presence of GABAA and
GABAC receptor subunits and were additionally positive for GABAB. The choroid/RPE and
retinal samples were also positive for GABAA and GABAC receptor subunits; one of the
retinal donors also yielded a positive result for GABAB. FC showed that the scleral‐derived
cells grown as fibroblasts were mesenchymal stromal cells.
Emily F. McDonald: GABA Receptors in Human Sclera
iv
Significance: This study is the first to show that GABA receptor gene expression was
observed in human sclera, human cultured mesenchymal stromal cells, and the combined
choroid/RPE. This finding has important implications for future research, including the role
of GABA in refractive development and myopia. Knowledge of the complete profile of
GABA receptor expression would identify which might be more specific targets for
treatment of myopia. Furthermore, other ocular functions mediated by these receptors are
yet to be determined.
Emily F. McDonald: GABA Receptors in Human Sclera
v
TABLE OF CONTENTS
KEYWORDS .................................................................................................................................... II
ABSTRACT..................................................................................................................................... III
LIST OF TABLES ....................................................................................................................... VIII
LIST OF FIGURES .......................................................................................................................... X
ABBREVIATIONS, ACRONYMS, & SYMBOLS ................................................................. XII
STATEMENT OF ORIGINAL AUTHORSHIP .................................................................... XIV
STRUCTURE OF THESIS ......................................................................................................... XIV
ACKNOWLEDGEMENTS ........................................................................................................ XV
1 LITERATURE REVIEW ............................................................................................................ 1
1.1 INTRODUCTION ............................................................................................................................................ 1
1.2 BRIEF OVERVIEW OF THE EYE ....................................................................................................................... 3
1.3 MYOPIA: DEFINITION, EPIDEMIOLOGY, & POSSIBLE CAUSES ..................................................................... 4
1.4 THE PROPOSED MYOPIA SIGNALLING CASCADE: WHERE THE SCLERA IS THOUGHT TO FIT IN ................ 5
1.4.1 Neural Retina: Generates Primary Signal for Myopia Development? .................................... 6
1.4.2 Retinal Pigment Epithelium: Signal Relay in the Control of Eye Growth? .............................. 8
1.4.3 Choroid: Responsible for Fluid Regulation ............................................................................ 10
1.4.4 Sclera: Responsible for Controlling Eye Dimensions ............................................................. 11
1.5 ‐AMINOBUTYRIC ACID ............................................................................................................................. 11
1.5.1 ‐Aminobutyric Acid Receptors – GABAA, GABAB, and GABAC .............................................. 12
1.5.2 ‐Aminobutyric Acid as a Piece in the Myopia Puzzle: GABA in Eye Growth ........................ 17
1.5.3 ‐Aminobutyric Acid within the Human Eye ......................................................................... 17
1.5.4 ‐Aminobutyric Acid in Animal Models ................................................................................. 18
1.5.5 ‐Aminobutyric Acid in Fibroblasts of other Tissues ............................................................. 21
1.5.6 Pharmacological Factors Affecting Eye Growth in Animal Models ...................................... 22
1.6 HUMAN SCLERA ......................................................................................................................................... 22
1.6.1 Gross Structure & Function of Sclera .................................................................................... 23
1.6.2 Composition of the Sclera ..................................................................................................... 24
1.6.3 Collagen ................................................................................................................................ 26
1.6.4 Elastin ................................................................................................................................... 26
1.6.5 Enzymes ................................................................................................................................ 26
1.6.6 Scleral Fibroblasts ................................................................................................................. 29
1.6.7 Glycoproteins ........................................................................................................................ 30
1.6.8 Growth Factors ..................................................................................................................... 30
Emily F. McDonald: GABA Receptors in Human Sclera
vi
1.6.9 Proteoglycans ....................................................................................................................... 30
1.6.10 Other Receptor Types known to be Present in Human Sclera ............................................ 32
1.6.11 Factors Affecting Human Scleral Structure & Function ...................................................... 34
1.7 SUMMARY ................................................................................................................................................... 35
1.8 RESEARCH AIMS ......................................................................................................................................... 37
2 MATERIALS AND METHODOLOGY ............................................................................... 38
2.1 HUMAN RESEARCH ETHICS ISSUES ............................................................................................................ 38
2.2 EYE COLLECTION ....................................................................................................................................... 38
2.3 PREPARATION FOR MICROTOMY ............................................................................................................... 39
2.4 MICROTOMY ............................................................................................................................................... 40
2.5 PRELIMINARY WORK: H&E AND BLEACHING OPTIMISATION ................................................................. 40
2.6 IMMUNOHISTOCHEMISTRY: EXPERIMENT #1 ............................................................................................. 43
2.7 CELL CULTURING & FLOW CYTOMETRY: EXPERIMENT #2 ........................................................................ 43
2.8 ANALYSIS OF GABA RECEPTOR GENE EXPRESSION IN OCULAR TISSUES AND CELLS: EXPERIMENT #3. 44
2.8.1 Primer Design ....................................................................................................................... 44
2.8.2 RNA Isolation and Reverse‐Transcription ............................................................................. 47
2.8.3 RT‐PCR Amplification of GABA Receptors ............................................................................. 49
3 RESULTS ................................................................................................................................... 51
3.1 IMMUNOHISTOCHEMISTRY: EXPERIMENT #1 ............................................................................................. 51
3.2 FLOW CYTOMETRY: EXPERIMENT #2 .......................................................................................................... 53
3.3 ANALYSIS OF GABA RECEPTOR GENE EXPRESSION IN OCULAR TISSUES AND CELLS: EXPERIMENT #3. 56
3.3.1 RT‐PCR Amplification of GABA Receptors ............................................................................. 56
4 DISCUSSION ........................................................................................................................... 60
4.1 SUMMARY OF FINDINGS ............................................................................................................................. 60
4.2 LIMITATIONS OF IMMUNOHISTOCHEMISTRY ............................................................................................. 60
4.3 POLYMERASE CHAIN REACTION METHODOLOGICAL ISSUES ................................................................... 61
4.4 GABA RECEPTORS IN SCLERA ................................................................................................................... 61
4.5 GABA RECEPTORS IN RETINAL PIGMENT EPITHELIUM & CHOROID ....................................................... 62
4.6 GABA RECEPTORS IN RETINA ................................................................................................................... 62
4.7 LIMITATIONS OF FLOW CYTOMETRY.......................................................................................................... 63
4.8 RELEVANCE TO MYOPIA ............................................................................................................................ 63
4.9 LIMITATIONS .............................................................................................................................................. 64
4.10 REAL WORLD IMPLICATIONS ................................................................................................................... 65
4.11 FUTURE DIRECTIONS ................................................................................................................................ 65
4.12 CONCLUSION ............................................................................................................................................ 67
Emily F. McDonald: GABA Receptors in Human Sclera
vii
REFERENCES/BIBLIOGRAPHY ................................................................................................ 68
APPENDIX ONE: ANIMAL STUDIES – BACKGROUND .................................................. 90
APPENDIX TWO: GROSS ANATOMY OF HUMAN SCLERA .......................................... 92
APPENDIX THREE: GEL RESULTS.......................................................................................... 95
APPENDIX FOUR: GABA RECEPTOR GENE SEQUENCING ......................................... 129
APPENDIX FIVE: GENOME MAPS ........................................................................................ 136
Emily F. McDonald: GABA Receptors in Human Sclera
viii
LIST OF TABLES
Table 1.1: Known functions of the RPE as compiled by Strauss in 2005 (Strauss, 2005).......... . 9
Table 1.2: Characteristics of the three GABA receptor types: GABAA, GABAB, and GABAC.. 16
Table 1.3: Summaries of notable papers utilising GABA in animal studies......... ..................... 17
Table 1.4: Ocular tissues – human and animal – found to have GABA receptors present...... 20
Table 1.5: Main biochemical constituents present in human sclera......... ................................... 25
Table 1.6: Known functions of MMPs......... .................................................................................... 27
Table 1.7: Known MMPs and their associated substrate specificity......... .................................. 28
Table 1.8: Receptor types observed in human sclera.......... .......................................................... 33
Table 1.9: Location of muscarinic receptors in ocular and non‐ocular tissues. ......................... 33
Table 1.10: Key functions of receptors present in human sclera. ................................................ 34
Table 2.1: Donor characteristics; information supplied from the QEB. ..................................... 38
Table 2.2: Individual primers (and expected product size) for each gene, including all known
transcript variants where applicable and represented by a ʹVʹ in the gene name,
representing a GABA receptor subunit. .................................................................................. 46
Table 2.3: Annealing temperatures for primers following exposure of all cells and tissues to
three different annealing ranges. ............................................................................................. 47
Table 2.4: Results from NanoDrop. ................................................................................................. 49
Table 3.1: Raw data analysis obtained from FC for human scleral stromal cells. .................... 55
Table 3.2: The results for each of the GABA receptor subunit genes as demonstrated by PCR.
....................................................................................................................................................... 58
Table A1: Recent examples of animal models used for myopia research. ................................. 91
Table A2: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952. ........... 95
Table A3: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953. ........... 97
Table A4: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952. ........... 99
Table A5: RT‐PCR results for mesenchymal stromal cells obtained from donors 6952 & 6953.
..................................................................................................................................................... 101
Table A6: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953. ......... 103
Table A7: RT‐PCR results for choroid/RPE, retina, and mesenchymal stromal cells obtained
from donors 6952 & 6953. ........................................................................................................ 104
Emily F. McDonald: GABA Receptors in Human Sclera
ix
Table A8: RT‐PCR results for choroid/RPE, retina, sclera, and mesenchymal stromal cells
obtained from donors 6952 & 6953. ....................................................................................... 106
Table A9: RT‐PCR results for sclera obtained from donor 6952. .............................................. 108
Table A10: RT‐PCR results for sclera obtained from donor 6953. ............................................ 109
Table A11: RT‐PCR results for sclera obtained from donor 6954. ............................................ 110
Table A12: RT‐PCR results for sclera obtained from donors 6952, 6953, & 6954. ................... 111
Table A13: RT‐PCR results for sclera obtained from donors 6952, 6953, & 6954. ................... 113
Table A14: RT‐PCR results for choroid/RPE obtained from donor 6952. ................................ 115
Table A15: RT‐PCR results for choroid/RPE & retina obtained from donors 6952 & 6953. .. 116
Table A16: RT‐PCR results for retina obtained from donor 6953. ............................................ 118
Table A17: RT‐PCR results for retina, choroid/RPE, sclera, and mesenchymal stromal cells
obtained from donor 6952. ...................................................................................................... 119
Table A18: RT‐PCR results for choroid/RPE ‐ donor 6953 ‐ & retina ‐ donor 6952. ............... 121
Table A19: RT‐PCR results for choroid/RPE & retina obtained from donors 6952 & 6953. .. 123
Table A20: RT‐PCR results for retina, choroid/RPE, sclera, mesenchymal stromal cells
obtained from donor 6952. ...................................................................................................... 125
Table A21: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953. ....... 127
Table A22: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952. ....... 128
Table A23: Relevant Blast results obtained from the AGRF for each product representative of
potential positive results for GABA receptor genes. ........................................................... 130
Emily F. McDonald: GABA Receptors in Human Sclera
x
LIST OF FIGUREs
Figure 1.1: Leading causes of visual loss in Australia (Baird et al., 2010).. .................................. 1
Figure 1.2: A pictorial representation of the human eye (Atchison and Smith, 2000) ................ 4
Figure 1.3: An emmetropisation model depicting the visual signalling cascade (Young, 2010)
......................................................................................................................................................... 6
Figure 1.4: The different layers of the retina and the cells associated with each of these layers
(Yang, 2004) ................................................................................................................................... 7
Figure 1.5: Chemical structure of ‐aminobutyric acid (Ng et al., 2011) .................................... 11
Figure 1.6: Structure of the GABAA receptor. ................................................................................. 13
Figure 1.7: Structure of the GABAB receptor (Enna, 2007) ........................................................... 14
Figure 1.8: Pharmacological differences between GABAA and GABAC receptors (Gottesmann,
2002, Bormann, 2000) ................................................................................................................. 15
Figure 1.9: Model illustrating the likely molecular structure – based on current knowledge –
of the ECM of the mammalian sclera (McBrien and Gentle, 2003) ...................................... 24
Figure 1.10: Proposed model of the role of scleral myofibroblast cells in the biochemical and
biomechanical remodelling that facilitates myopia development (McBrien et al., 2009). 29
Figure 1.11: Diagrammatic representation of the scleral remodelling that underpins myopia
development (McBrien et al., 2009). ......................................................................................... 35
Figure 2.1: Photograph (taken by EFM) of a typical eye specimen showing length of the optic
nerve and visible veins .............................................................................................................. 39
Figure 2.2: Scleral map highlighting superior, inferior, nasal, and temporal regions in
relation to the optic nerve (Elsheikh et al., 2010). .................................................................. 40
Figure 2.3: Illustration demonstrating how the eye cups were dissected .................................. 40
Figure 2.4: Overview of scleral tissue structure, including demonstration of melanocytes in
deeper sclera, from donor 6397L to determine integrity of tissue and basic structures
using H&E. .................................................................................................................................. 41
Figure 2.5: Bleaching optimisation results observed for donor 6397L (tissue taken from
lateral region). ............................................................................................................................. 42
Figure 3.1: IHC – SMA – performed on donor 6397L (sections taken from inferior region)....52
Figure 3.2: IHC – GABAA Alpha 1 – performed on donor 6397L (sections taken from inferior
region). ......................................................................................................................................... 53
Emily F. McDonald: GABA Receptors in Human Sclera
xi
Figure 3.3: Shown above is the percentage of live scleral‐derived stromal cells (passage 3)...55
Figure A1: Animal models depicting the processes involved during induced‐hyperopia
myopic defocus (portrayed on the left) and induced‐myopia hyperopic defocus
(portrayed on the right) (Rymer and Wildsoet, 2005) ........................................................... 90
Figure A2: Some of the major muscles surrounding the eyeball; shown are the relative
positions of the insertions of the horizontal and vertical rectus muscles (Maza et al.,
2012).............................................................................................................................................. 92
Figure A3: The insertions of the superior oblique and inferior oblique muscles (Maza et al.,
2012).............................................................................................................................................. 92
Figure A4: Vascular supply to the globe, highlighting the relationships between the internal
carotid, ophthalmic, central retina, long posterior ciliary, short posterior ciliary, anterior
ciliary, and lacrimal arteries (Maza et al., 2012) ..................................................................... 93
Figure A5: Sites of perforation of the sclera by the long and short posterior ciliary arteries,
the short posterior ciliary veins, and the inferior and superior vortex veins (Maza et al.,
2012).............................................................................................................................................. 93
Figure A6: The relationships between the lacrimal, vortex, short posterior ciliary, inferior
ophthalmic, retinal, supraorbital, and superior ophthalmic veins (Maza et al., 2012) ..... 94
Figure A7: The relationships, shown as a transverse section of the globe, between the short
posterior ciliary, long posterior ciliary, and anterior ciliary arteries and short posterior
ciliary, anterior ciliary, and vortex veins (Maza et al., 2012) ................................................ 94
Emily F. McDonald: GABA Receptors in Human Sclera
xii
ABBREVIATIONS, ACRONYMS, & SYMBOLS
α Alpha
Delta
Epsilon
Gamma
Pi
Theta
AGRF Australian Genome Research Facility
AL Axial Length
APC Allophycocyanin
BMC [3H]Bicuculline Methochloride
BP Base Pair
BSA Bovine Serum Albumin
CACA cis‐4‐Aminocrotonic Acid
CAMP cis‐2‐(aminomethyl)Cyclopropane‐1‐carboxylic Acid
cAMP Cyclic Adenosine Monophosphate
cDNA Complementary Deoxyribonucleic Acid
CNS Central Nervous System
DAB 3,3‐Diaminobenzidine
dNTP Deoxyribonucleotide Triphosphate
ECM Extracellular Matrix
EST Expressed Sequence Tag
FBS Fetal Bovine Serum
FC Flow Cytometry
FITC Fluorescein Isothiocyanate
GABA ‐Aminobutyric Acid
GABARAP GABAA Receptor‐Associated Protein
GABA‐T GABA Transaminase
GABAA GABAA Receptor α Subunit
GABRB GABAA Receptor β Subunit
GABRB3 GABAA Receptor β3 Subunit
GABRG GABAA Receptor Subunit GABRE GABAA Receptor Subunit GABRD GABAA Receptor Subunit GABRQ GABAA Receptor Subunit GABRP GABAA Receptor Subunit GABBR GABAB Receptor
GABRR GABAC Receptor Subunit GAD Glutamic Acid Decarboxylase
GAG Glycosaminoglycan
GAPDH Glyceraldehyde‐3‐Phosphate Dehydrogenase
I4AA Imidazole‐4‐Acetic Acid
IGF Insulin‐like Growth Factor
IHBI Institute of Health and Biomedical Innovation
IHC Immunohistochemistry
IL‐1β Interleukin‐1β
Emily F. McDonald: GABA Receptors in Human Sclera
xiii
IOP Intraocular Pressure
M1 – M5 Muscarinic Receptor Subtypes 1‐5
MMP Matrix Metalloproteinase
mRNA Messenger Ribonucleic Acid
NE Norepinephrine
NGF Nerve Growth Factor
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction
PDGF Platelet‐Derived Growth Factor
PE Phycoerythrin
PG Proteoglycan
QEB Queensland Eye Bank
QEI Queensland Eye Institute
QUT Queensland University of Technology
RNA Ribonucleic Acid
RPE Retinal Pigment Epithelium
RT‐PCR Reverse‐Transcriptase PCR
SLRP Small Leucine‐Rich Proteoglycans
SMA Smooth Muscle Actin
TACA trans‐4‐Aminobut‐2‐enoic acid
TAMP trans‐2‐Aminomethylcyclopropanecarboxylic Acid
TGF Transforming Growth Factor
THIP 4,5,6,7,‐Tetrahydroisoxazolo[5,4‐c]pyridine‐3‐ol
TNF‐α Tumour Necrosis Factor‐α
TPMPA 1,2,5,6‐Tetrahydropyridine‐4‐yl)methylphosphinic Acid
VIP Vasoactive Intestinal Peptide
Emily F. McDonald: GABA Receptors in Human Sclera
xiv
Statement of original authorship
The work contained in this thesis has not been previously submitted for a degree or diploma
in any other higher education institution. To the best of my knowledge and belief, the thesis
contains no material previously published or written by another person except where due
reference is made.
QUT Verified Signature
..................................................................................................................
Emily F. McDonald
February 28th 2014
‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐
Structure of thesis
This Thesis has the following structure:
Chapter 1 – Literature Review
Chapter 2 – Materials and Methodology
Chapter 3 – Results
Chapter 4 – Discussion
Emily F. McDonald: GABA Receptors in Human Sclera
xv
Acknowledgements
Katrina Schmid, thank you for teaching me how to be an independent researcher. I
appreciate your constructive and expert feedback on the drafts of this thesis.
Damien Harkin, I would like to thank you for your guidance throughout the histological
components of this project. Your passion for histology is inspiring. I agree – SMA is a rather
photogenic antibody.
Sally‐Anne Stephenson, I really appreciate your time, availability, and guidance throughout
the gene expression component of this project. Of course, I must mention my gratitude for
your muscles; without them, I would not have been able to extract RNA from the fibrous
scleral tissue. That was one of the best days in the lab for sure.
Neil Richardson, thank you for all the constructive discussions and the hours you have spent
in the lab guiding me through immunohistochemistry. Your easy‐going, encouraging
approach made the transition back into the world of science that much easier.
Laura Bray, I want to thank you for always being available – including at the lab bench.
Most notably, thank you for the hours spent on flow cytometry. On a personal note, your
friendship is truly invaluable and I would not be where I am without your support along the
way.
Tom Hogerheyde, thank you for teaching me the gene expression techniques. The
painstaking hours you put in were greatly appreciated.
Mark Woolf, without you pushing me I would not have taken on the project in the first place
and I am grateful. Thank you for your support.
To all my IHBI friends – you know who you are. My Masters experience would not have
been the same without each and every one of you. Thank you for your individual
contributions and I am looking forward to seeing you all enjoy success in your own fields.
Emily F. McDonald: GABA Receptors in Human Sclera
xvi
Neil Tindale and Anne Roiko, I am forever indebted to both of you for the scientific
foundation and mentorship you provided me with during my years at USC.
On a personal note, I would like to thank my husband, Pete. You are my rock and none of
this would have been possible without you. I dedicate my thesis to you.
Emily F. McDonald
Emily F. McDonald: GABA Receptors in Human Sclera
1
1 literature review
1.1 Introduction
Myopia, or short‐sightedness, is the most common refractive disorder (Young et al., 2007,
Tan et al., 2010, Young et al., 2003, Fredrick, 2002, Leo and Young, 2011) affecting
approximately 25% of the world population (Pan et al., 2012). The reasons behind the high
prevalence of myopia are currently obscure (Nickla and Wallman, 2010, Bloom et al., 2010,
Hammond et al., 2004, Brand et al., 2007) but its public health and economic impact is
considerable (Young et al., 2007, Baltussen et al., 2009, Kleinstein et al., 2003, Jones et al.,
2007, Rose et al., 2008b, Yang et al., 2009, Paluru et al., 2004). The impact of refractive errors
in Australia is significant (refer to Figure 1.1).
Figure 1.1: Leading causes of visual loss in Australia (Baird et al., 2010). Refractive error
correctable with spectacles is a significant contributing factor.
Myopia is predominantly caused by an elongated axial length (AL) of the globe (McBrien
and Gentle, 2003, Summers Rada et al., 2006). Less commonly, myopia is caused by the eyeʹs
optics; for example, a too powerful cornea or crystalline lens (Flitcroft, 2012). The sclera
must expand to allow for this increase in size and, ultimately, must grow, or remodel, for
myopia to develop (Young et al., 2004, Summers Rada and Hollaway, 2011, Barathi and
Beuerman, 2011, McBrien et al., 2006, Moring et al., 2007, Choo, 2003). Due to the location of
the retina and the sclera, the retinal signal must be transmitted to the sclera via the retinal
pigment epithelium (RPE) and choroid (Rymer and Wildsoet, 2005, Crewther, 2000). It is
generally considered that the retina is the primary controller of eye growth (Wallman and
Emily F. McDonald: GABA Receptors in Human Sclera
2
Winawer, 2004). Evidence for this is the fact that when hemifield diffusers are used to form‐
deprive only half of the eye, only the half of the eye that was deprived elongates (Wallman et
al., 1987). Regional modifications to eye shape could not be produced via a signal sent from
the brain to the eyes.
The choroid and RPE have thus been implicated in eye growth control processes. It is
thought that the choroid might participate in refractive adjustment as a slow accommodative
mechanism: animal studies have demonstrated that the choroid is capable of increasing its
thickness in response to myopic defocus (Wallman et al., 1995) and thinning in response to
hyperopic defocus (Wildsoet and Wallman, 1995) The RPE is believed to play a critical role
in ocular growth regulation and the basis for this understanding is due to the fact that the
RPE separates the retina (the source of growth‐regulating signals) from the choroid and
retina and, accordingly, is involved in their growth regulation (Rymer and Wildsoet, 2005,
Crewther, 2000). Evidence suggests that RPE cells both synthesise and secrete many kinds of
cytokines (Tanihara et al., 1997). During negative lens treatment in chicks, insulin‐like
growth factor‐1 (IGF‐1) was observed to increase and IGF‐1 receptors were up‐regulated in
RPE, as well as in choroid and fibrous sclera (Penha et al., 2011). Chick RPE has been shown
to have β‐adrenoceptors, vasoactive intestinal peptide (VIP) receptors, α1‐adrenoceptors,
dopamine receptors, and muscarinic acetylcholine receptors (Rymer and Wildsoet, 2005).
It has been found that ‐aminobutyric acid (GABA), a retinal neurotransmitter, influences
eye growth and, accordingly, refractive development (Stone et al., 2003, Leung et al., 2005).
In the chick animal model of myopia, GABA antagonists have been shown to inhibit
experimental myopia (Chebib et al., 2009b) and have been proposed as having a ʺpromising
clinical role in the regulation of ocular growth including the treatment of myopia” (Leung et
al., 2005). Although the mechanism for this effect is unknown, it has been recently shown
that, in addition to the retina [human: (Davanger et al., 1991, Crooks and Kolb, 1992, Vardi
and Sterling, 1994, Gussin et al., 2011); chick: (Hering and Kröger, 1996, Albrecht and
Darlison, 1995)], GABA receptors are located in chick sclera (Cheng et al., 2011), chick cornea
(Cheng et al., 2012), and chick RPE (Cheng et al., In Press).
This project will determine if the three main GABA receptor sub‐types – GABAA, GABAB,
and GABAC [GABAC is actually a subset of GABAA (Bormann, 2000)] – are present or absent
Emily F. McDonald: GABA Receptors in Human Sclera
3
in the human sclera. These receptor sub‐types were chosen as they constitute all known
GABA subtypes. Although previous studies have highlighted the influence of GABA on eye
growth and localisation of GABA receptors in chick sclera (Cheng et al., 2011, Leung et al.,
2005), no study has been undertaken involving human scleral tissue. A relatively recent
paper (Watson and Young, 2004) commented that it is surprising that the human sclera
remains such an under‐researched structure. The sclera had previously been thought to be
essentially inert (McBrien and Gentle, 2003) but it is now recognised that the sclera is a
dynamic tissue, capable of altering its composition and properties ‐ its rigidity and thickness
‐ in response to its visual environment (Summers Rada, 2006) and thus potentially playing a
role(s) in the onset and development of myopia (Watson and Young, 2004, Wang et al., 2011).
1.2 Brief Overview of the Eye
The eye (shown in Figure 1.2) is a nearly spherical organ consisting broadly of three layers:
1) the external layer formed by the cornea and sclera; 2) the intermediate layer divided into
two parts: the iris‐ciliary body anteriorly and the choroid posteriorly; 3) and the internal
layer consisting of the retina (Mitra et al., 2005). The eye is structurally limited by the cornea
and sclera (Ayoub, 2008). The iris controls, through automatic adjustment, the amount of
light entering the eye (Bogdanov, 2000). The ciliary body functions to produce components
of the aqueous humour (Fischer and Reh, 2003). The choroid is a thin, vascularised sheath
located between the sclera and the retina (Kiilgaard and Jensen, 2005). The retina, a
membrane containing an array of photoreceptor cells called rods and cones, converts light
energy into electrical signals (Bogdanov, 2000). The photoreceptors convert light energy to
electrical activity and transmit nerve impulses to the brain via the optic nerve (Bogdanov,
2000).
Emily F. McDonald: GABA Receptors in Human Sclera
4
Figure 1.2: A pictorial representation of the human eye (Atchison and Smith, 2000).
1.3 Myopia: Definition, Epidemiology, & Possible Causes
Myopia (derived from the Greek words myein, meaning ‘to shut’ and ōps, meaning ‘eye’; i.e.,
to squint) is typically due to axial elongation of the vitreous chamber – ‘axial myopia’
(McBrien and Gentle, 2003, Summers Rada et al., 2006). ‘Axial elongation’ refers to
elongation of the eye in the axial direction; in myopia, the eye expands more axially than it
does equatorially (Atchison et al., 2004). The elongation process creates a mismatch between
the refractive power and length of the eye, the visual image of distant objects is formed in
front of the photoreceptor plane, and negative spectacle lenses are required to optically
correct the resultant image blur (Lundström et al., 2009, McBrien and Gentle, 2003,
Benavente‐Perez, 2006, Leo and Young, 2011, Metlapally and McBrien, 2008, Chen et al.,
2011). The refractive distribution of neonatal eyes is normal; over a period of approximately
six months, eyes emmetropise and, during this time, visual feedback is used to adjust
refraction to eliminate neonatal errors (Candy et al., 2009).
Myopia is considered to be a leading cause of visual impairment (Gilmartin, 2004, Fredrick,
2002, Majava et al., 2007). Severe cases of myopia, or high myopia, can lead to premature
cataracts, glaucoma, retinal detachment, and macular degeneration (Young, 2004, Saw et al.,
2005). Low myopia is observed around an AL of 24 mm, or 0 ‐ ‐6 dioptres, and high myopia
is observed around an AL of 30 mm, or greater than ‐6 dioptres (Meng et al., 2011). The
precise cause(s) or mechanism(s) triggering the axial elongation observed in myopia are still
unknown (Atchison et al., 2004, Shelton and Summers Rada, 2009, Tan et al., 2010, Wang et
Emily F. McDonald: GABA Receptors in Human Sclera
5
al., 2011); myopia is regarded as a multifactorial, complex disorder (Chen et al., 2011). The
main conundrum concerns the fact that not all eyes develop myopia although being exposed
to comparable visual environments (Lundström et al., 2009).
Suggested causes and/or contributing factors include both genetic (refer to Baird et al., 2010
for a summary of myopia candidate genes) and environmental, such as education,
metabolism, and physical and outdoor activity (Chen et al., 2003, Yang et al., 2009, Fredrick,
2002, Paget et al., 2008, Hornbeak and Young, 2009, Jacobi and Pusch, 2010). For example,
myopia is more common in children who have myopic parents (Jones et al., 2007, Jones‐
Jordan et al., 2010, Liang et al., 2004) and the refractive errors of identical twins are similar
(Lyhne et al., 2001, Dirani et al., 2008). It is suggested that myopic children spend more time
indoors doing nearwork and less time outdoors than non‐myopic children (Khader et al.,
2006, Rose et al., 2008b, Rose et al., 2008a).
A recent genome‐wide association study (Kiefer et al., 2013) featuring 45,771 participants
identified 22 significant associations (20 of which were novel). The candidate genes were
identified as follows: DLX1, PABPCP2, PDE11A, PRSS56, ZBTB38, BMP3, KCNQ5, LAMA2,
SFRP1, TOX, TJP2, KCNMA1, RGR, LRRC4C, DLG2, RDH5, ZIC2, BMP4, GJD2, RASGRF1,
RBFOX1, and SHISA6. The most recent evidence is stronger for environmental causes
and/or contributing factors than for genetic (Lougheed, 2014, Goldschmidt and Jacobsen,
2014). It has also been suggested that myopia might develop either as a result of form‐
deprivation (Mathur et al., 2009), altered release of certain neurotransmitters and growth
factors (Yang et al., 2009, Raviola and Wiesel, 2007), diet (Charman, 2011, Mutti and Marks,
2011, Cordain et al., 2002), or relative peripheral hyperopia, where the abnormal axial
growth of the eye is caused by the peripheral image lying behind the retina (Mathur et al.,
2009, Mutti et al., 2007).
1.4 The Proposed Myopia Signalling Cascade: Where the Sclera is thought to fit in
Due to the fact that the retina directly processes visual information, it has also been
suggested that it is the most likely candidate to generate the primary signal for myopia
development (Wallman, 1993). This potential process, initiated by a visual stimulus and
resulting in a cascade of events through the different layers of the eye, is depicted in Figure
1.3 shown below (Young, 2010). As shown in Figure 1.3, when the AL of the eye is shorter
Emily F. McDonald: GABA Receptors in Human Sclera
6
than the focal plane, hyperopic defocus (1) occurs on the retina unless fully cleared by
accommodation (9). Hyperopic defocus reduces the amplitude of responses of retinal
neurons (2); in turn, the communication of signals (3) through the RPE and (4) choroid is
altered. The resulting communication to the sclera produces (5) altered gene expression in
fibroblasts. Eventually, remodelling of the scleral extracellular matrix (ECM) occurs (6),
increasing the creep rate of the sclera (7), which increases the axial elongation rate of the eye
(8). The amount of defocus is reduced as the axial elongation moves the retina closer to the
focal plane. Responses increase with reduced retinal defocus and, in turn, alter
communication to the sclera. Finally, scleral remodelling is altered such that both the creep
rate is decreased and axial elongation is slowed. The following section addresses the
functional anatomy and potential roles of the retina, RPE, choroid, and sclera in the
proposed visually‐driven signalling pathway. As the focus of this project is on the sclera, it
is particularly important to briefly highlight that, as the sclera forms the structural outer coat
of the eye, in conjunction with the choroid, it controls the location of the retina (Young,
2010).
Figure 1.3: An emmetropisation model depicting the visual signalling cascade (Young, 2010).
The cascade of events involves the retina, RPE, choroid, and sclera.
1.4.1 Neural Retina: Generates Primary Signal for Myopia Development?
The neural retina (refer to Figure 1.4 for a pictorial representation of the retinal layers),
approximately 100‐200 μm thick, is responsible for processing all incoming visual signals
(Massey, 2005). The retinal layer, a thin sheet at the back of the eye responsible for
converting light associated with visual image into action potentials that are sent to the brain,
contains six discrete populations of cells: photoreceptors (rod and cones), horizontal cells
(lateral interneurons), bipolar cells (vertical connections), amacrine cells (lateral
interneurons), ganglion cells (output neurons), and interplexiform cells (Massey, 2005).
The human retina contains a number of neurotransmitters and neuropeptides, such as
dopamine, glycine, substance P, and somatostatin (Tornqvist and Ehinger, 1988); the
Emily F. McDonald: GABA Receptors in Human Sclera
7
prevailing retinal neurotransmitter molecules implicated in influencing eye growth
regulation are dopamine (Schaeffel et al., 1995, Wallman, 1993), muscarinic acetylcholine (Lin
et al., 2009, McBrien et al., 2001b), glucagon (Fischer et al., 1999), and VIP (Tornqvist and
Ehinger, 1988, Rymer and Wildsoet, 2005). Refer to Flitcroft (2012) for a recent review
summarising current knowledge on the role of the retina in the control of eye growth. The
next innermost layer of the eye is the RPE. The following section outlines the functional
anatomy of the RPE and its potential role in the local signalling cascade mediating myopia.
Figure 1.4: The different layers of the retina and the cells associated with each of these layers
(Yang, 2004). GABAergic neurons are shown in blue. GABA is typically involved in the
lateral pathways involving horizontal and amacrine cells.
There is substantial evidence from animal studies to support the role of the retina in the
regulation of ocular growth. For example, if the optic nerve is severed or the action
potentials in it blocked, form‐deprivation myopia is unaffected (Norton et al., 1994, Troilo et
al., 1987, Wildsoet and Pettigrew, 1988). In addition, lens compensation occurs, although
with some differences (Wildsoet, 2003, Wildsoet and Wallman, 1995). It has been observed
in studies that use diffusers or negative lenses that cover only half of the retina, only the
covered half of the eye exhibits myopia; in contrast, if positive lenses are used to cover half
Emily F. McDonald: GABA Receptors in Human Sclera
8
of the retina, only the covered half exhibits inhibited eye growth (Diether and Schaeffel,
1997, Hodos and Kuenzel, 1984, Wallman et al., 1987).
1.4.2 Retinal Pigment Epithelium: Signal Relay in the Control of Eye Growth?
The RPE, classically described as a polarised epithelial monolayer of cells, is sandwiched
between the retina and the choroid; due to its location, the RPE is thought to play a crucial
role in relaying signals between the retina and choroid (Rymer and Wildsoet, 2005,
Crewther, 2000). Refer to Table 1.1 for a list of functions of the RPE.
Emily F. McDonald: GABA Receptors in Human Sclera
9
Table 1.1: Known functions of the RPE as compiled by Strauss in 2005 (Strauss, 2005). The
RPE is responsible for a diverse array of functions, including light absorption, transportation,
nutrient absorption, phagocytosis, and secretion.
Functions of RPE Reference(s)
Absorbs the light energy focused by the lens on the retina (Bok, 1993, Boulton and
Dayhaw‐Barker, 2001)
Transports ions, water, and metabolic end products from the
subretinal space to the blood
(Dornonville de la Cour,
1993, Hamann, 2002,
Marmor, 1999, Miller and
Edelman, 1990, Steinberg,
1985, Crewther, 2000)
Absorbs nutrients such as glucose, retinol, and fatty acids from the
blood and delivers these nutrients to photoreceptors
(Strauss, 2005)
Enables exchange of retinal between the photoreceptors and the RPE;
this is important as photoreceptors are unable to reisomerise all‐
trans‐retinal, formed after photon absorption, back into 11‐cis‐
retinal. Therefore, retinal is transported to the RPE, reisomerised to
11‐cis‐retinal and transported back to the photoreceptors: this
process is known as the ‘visual cycle of retinal’.
(Strauss, 2005, Baehr et al.,
2003, Besch et al., 2003,
Thompson and Gal, 2003,
Booij et al., 2010)
Stabilises ion composition in the subretinal space, which is essential
for the maintenance of photoreceptor excitability
(Dornonville de la Cour,
1993, Steinberg, 1985,
Steinberg et al., 1983, Booij et
al., 2010)
Phagocytosis of shed photoreceptor outer segments; the outer
segments of the photoreceptors are digested, and essential
substances, such as retinal, are recycled and returned to the
photoreceptors to rebuild light‐sensitive outer segments from the
base of the photoreceptors.
(Bok, 1993, Finnemann,
2003, Gal et al., 2000,
Strauss, 2005, Strauss et al.,
1998, Wistow et al., 2002,
Booij et al., 2010)
Secretes a variety of growth factors helping to maintain the structural
integrity of choriocapillaris endothelium and photoreceptors
(Strauss, 2005)
Plays an important role in the establishing the immune privilege of the
eye by secreting immunosuppressive factors
(Ishida et al., 2003, Streilein
et al., 2002)
The RPE is critical to communication occurring between the retina and the rest of the eye.
Due to its central location within the outer layers of the eye, it is thought that the RPE may
act as a signal relay in the control of eye growth (Crewther, 2000). In their review paper,
Rymer & Wildsoet (2005) suggested that, aside from the presence of ion transporters and
signal receptors, the RPE, lying between the signal source (retina) and its target (the sclera
and choroid) may play a critical role based on location alone. In addition, Rymer & Wildsoet
(2005) highlighted three retinal neurotransmitters, dopamine, VIP, and glucagon, that have
been linked to eye growth regulation. As the RPE secretes growth factors into the choroid
targeting both the choroid and sclera, it is thought that the concentration and activity of
these growth factors might be modulated by fluid transport across the RPE (Crewther, 2000,
Rymer and Wildsoet, 2005). The next section addresses the functional anatomy and potential
role of the choroid in the myopia signalling cascade.
Emily F. McDonald: GABA Receptors in Human Sclera
10
1.4.3 Choroid: Responsible for Fluid Regulation
The term choroid is derived from the Greek words for “membrane” and “form”; the choroid
(the middle tunic of the eye) is a vascularised and pigmented tissue attached to the sclera by
strands of connective tissue (Guyer et al., 2005). The choroidal circulation demonstrates one
of the highest rates of blood flow – millilitres/minute/gram – in the human body (Alm and
Bill, 1973, Alm and Bill, 1987, Torczynski, 1987); more than 70% of all the blood in the globe
at any one time can be found in the choriocapillaris (Parver et al., 1980, Rohen, 1964), one of
the layers of the choroid. From the most superficial to the deepest, the four layers of the
choroid are termed the suprachoroid or suprachoroidea: a transitional zone between the
choroid and sclera containing elements of both, stroma: extravascular tissue, choriocapillaris:
a highly anastomosed network of capillaries, and Bruch’s membrane: a complex 5‐laminar
structure (Guyer et al., 2005, Nickla and Wallman, 2010). In terms of composition, the
choroid is comprised of blood vessels, melanocytes, fibroblasts, resident immunocompetent
cells and supporting collagenous and elastic connective tissue (Nickla and Wallman, 2010).
In humans, the choroid is approximately 200 μm in width at birth and decreases to
approximately 80 μm by the age of 90 (Ramrattan et al., 1994). Choroidal thickness is
diurnally modulated: the choroid is thickest at about midnight and thinnest at noon
(Papastergiou et al., 1998, Nickla et al., 1998). It is believed that this process is driven by a
circadian oscillator as the rhythm free‐runs in constant darkness (Nickla, 2006).
The main functions of the choroid are three‐fold: 1) thermoregulation via heat dissipation, 2)
nourishment of the RPE and retina up to the outer aspect of the inner nuclear layer, and 3)
producing the visible pigmentation of the fundus (Guyer et al., 2005). In addition, the
choroid secretes growth factors, adjusts the position of the retina by changes in choroidal
thickness, and plays an important role in the drainage of the aqueous humour from the
anterior chamber, via the uveoscleral pathway (Nickla and Wallman, 2010) [approximately
35% of the drainage in humans (Alm and Nilsson, 2009)]. A recent paper (Summers, 2013)
outlined the role of the choroid in ocular growth and the development of refractive errors as
follows: 1) the choroid can act on neighbouring tissues through growth factors, 2) choroidal
gene expression and thickness can be influenced by visual stimuli, 3) the choroid, in
response to visual stimuli, secretes scleral growth factors, and 4) choroidal RALDH2 activity
and retinoic acid synthesis have been linked to modulation of scleral remodelling.
Emily F. McDonald: GABA Receptors in Human Sclera
11
1.4.4 Sclera: Responsible for Controlling Eye Dimensions
Finally, the outermost layer is the sclera. As the sclera is thought to control the dimensions
of the eye, it is important to assess the potential role of the sclera in the visually‐driven
signalling pathway. Essentially, the sclera controls the location of the retina as it forms the
structural outer layer of the eye (Young, 2010). In the context of the myopic eye, the
resultant thinning of the sclera during elongation is attributed to tissue remodelling and not
simply passive stretching (Choo, 2003). The sclera will be covered in greater detail –
including gross structure, function and biochemistry – in Section 1.6.
1.5 ‐Aminobutyric Acid
Neurotransmitters can be divided into two sub‐groups: inhibitory and excitatory (Wilson
and Cowan, 1972). GABA (the chemical structure shown in Figure 1.5) is an important
inhibitory neurotransmitter present in the central nervous system (CNS), which includes the
retina (Krogsgaard‐Larsen et al., 1997, Chebib et al., 2009b, Enz and Cutting, 1999, Barnard et
al., 1998). GABA was first discovered over 60 years ago in the mammalian CNS (Roberts and
Frankel, 1950). The neurotransmitter is most highly concentrated in the substantia nigra,
basal ganglia, hypothalamus, the periaqueductal grey matter, and the hippocampus (van der
Zeyden et al., 2008). In the mammalian brain, GABA‐releasing synapses are the principle
source of inhibition and glutamate‐releasing synapses are the principle excitatory
transmitters (Ben‐Ari, 2002); GABA and glutamate only differ by a single carboxyl group
(Waagepetersen et al., 2007). Approximately 90% of all synaptic neurotransmission in the
CNS is mediated by GABA and glutamate (Schousboe and Waagepetersen, 2003,
Waagepetersen and Schousboe, 2009) and at least one‐third of all CNS neurons utilise GABA
as their primary neurotransmitter (Vithlani et al., 2011). GABAergic transmission requires
both a synthesising enzyme – glutamic acid decarboxylase, or GAD – and a degradative
enzyme – GABA transaminase, otherwise known as GABA‐T (Waagepetersen et al., 2007,
Yazulla, 2010).
Figure 1.5: Chemical structure of ‐aminobutyric acid (Ng et al., 2011).
Emily F. McDonald: GABA Receptors in Human Sclera
12
The role and significance of GABA receptors in non‐neuronal human tissue is obscure.
Recent research using tissue obtained from mice found GABAA receptor protein in the
following non‐neuronal sites: renal medulla, cortex, heart, left ventricle, aorta, and pancreas
(Tyagi et al., 2007). GABAA receptor protein has also been found to be present in human,
rabbit, and rat kidney tissue (Sarang et al., 2001). Future studies determining the role and
significance of GABA receptors in non‐neuronal tissues, including sclera, would help in
piecing together the big picture of myopia and would shed some light on potential
pharmaceutical intervention.
1.5.1 ‐Aminobutyric Acid Receptors – GABAA, GABAB, and GABAC
GABA is a highly flexible molecule; it can attain many low‐energy conformations that bind
to three pharmacologically and physiologically distinct GABA receptors: GABAA, GABAB,
and GABAC (Figure 1.6, Figure 1.7, & Table 1.2). GABAC is, more recently, known as
GABAA0r (Barnard et al., 1998, Leung et al., 2005, Bormann, 2000); the change in
nomenclature classifies the ‐containing GABA receptors as a specialised set of GABAA
receptors that are insensitive to both bicuculline and benzodiazepines (Bormann, 2000).
Generally, GABAA and GABAB receptors are defined by their respective sensitivities to
bicuculline and baclofen; GABAC receptors are a pharmacologically distinct group – they do
not respond to either drug (Bowery, 1989, Johnston, 1996, Bormann and Feigenspan, 1995,
Cherubini and Strata, 1997, Bormann, 2000); see Figure 1.8.
Emily F. McDonald: GABA Receptors in Human Sclera
13
A)
B)
C)
Figure 1.6: Structure of the GABAA receptor. [Figure (A) taken from (Enna, 2007); Figures (B)
and (C) taken from (Akk et al., 2007).]
(A) Pentameric structure of GABAA receptor showing five representative subunits – in this
case, 2x α subunits, 2x β subunits, and 1x 2 subunit (Enna, 2007). Also shown are unique
binding sites for each subunit. The binding sites for GABA are sandwiched between the α
and β subunits. Ionotropic GABAA receptors are fast‐acting, ligand‐gated chloride channels
Emily F. McDonald: GABA Receptors in Human Sclera
14
(Sieghart, 2006); GABA receptor activation causes an influx of chloride ions (Waagepetersen
et al., 2007). The membrane topography of GABAC receptors is assumed to be very similar to
that of GABAA (Bormann, 2000). However, GABAC receptors are composed exclusively of (1‐3) subunits (Bormann, 2000). (The two P symbols at the bottom of the diagram represent
protein kinase.)
(B) A single subunit of the GABAA receptor (Akk et al., 2007). This image is focusing on the
topography of the subunits; M1‐M4 represents individual transmembrane domains. The
transmembrane domain coloured grey – M2 – forms an important part of the chloride
channel (Akk et al., 2007).
(C) Top‐down view of the pentameric structure of the GABAA receptor (Akk et al., 2007).
Figure 1.7: Structure of the GABAB receptor (Enna, 2007).
Metabotropic GABAB receptors produce slow and prolonged inhibitory responses; GABAB
receptors are coupled indirectly via proteins to either calcium or potassium channels (Bettler
and Tiao, 2006). Postsynaptically, stimulation of GABAB receptors causes an efflux of
potassium ions (Waagepetersen et al., 2007); presynaptically, GABAB receptors regulate
calcium channels and thereby cause inhibition of transmitter release (Olsen and Betz, 2006).
It is important to note that the GABAB receptor is an obligate heterodimer: the receptor is
only functional when both the GABAB R1 isoform and the GABAB R2 isoform are co‐
expressed in the same cell (Pierce et al., 2002).
Emily F. McDonald: GABA Receptors in Human Sclera
15
a)
b)
Figure 1.8: Pharmacological differences between GABAA and GABAC receptors (Gottesmann,
2002, Bormann, 2000).
(A) The GABAA receptor has binding sites for barbiturates, benzodiazepines, and
neurosteroids and GABA responses are blocked by bicuculline (competitively) and by
picrotoxin (non‐competitively) (Gottesmann, 2002, Bormann, 2000).
(B) The GABAC receptor is activated by CACA, antagonised by TPMPA, and blocked by
picrotoxinin (Gottesmann, 2002, Bormann, 2000).
Emily F. McDonald: GABA Receptors in Human Sclera
16
Table 1.2: Characteristics of the three GABA receptor types: GABAA, GABAB, and GABAC.
GABAA Receptor GABAB Receptor GABAC (or GABAA0R)
Receptor
Reference(s)
Category Ligand‐gated ion channel G‐protein coupled
receptor (to either calcium
or potassium channels)
Ligand‐gated ion channel (Emberger et al., 2000, Enz and Cutting, 1999,
Johnston, 1996, Ben‐Ari et al., 2007, Kumar et
al., 2008, Vithlani et al., 2011)
Subunits α1‐6, β1‐3, 1‐3, , , , & GBR1 & GBR2 1‐3 (Bormann, 2000, Krogsgaard‐Larsen et al.,
1997, Fritschy et al., 2004, Emberger et al.,
2000, Enz and Cutting, 1999, Schousboe and
Waagepetersen, 2008, Stone et al., 2003, Ben‐
Ari et al., 2007, MacDonald et al., 2007,
Vithlani et al., 2011)
Agonists I4AA
Isoguvacine
Isonipecotic acid
Muscimol
TACA
TAMP (weak)
THIP
Baclofen CACA
CAMP
Muscimol (partial)
TACA
TAMP
(Bormann, 2000, Krogsgaard‐Larsen et al.,
1997, Schousboe and Waagepetersen, 2008)
Antagonists BMC
Gabazine
Picrotoxin
Phaclofen
Saclofen
I4AA
Isoguvacine (weak)
Picrotoxin
THIP (weak)
TPMPA
(Bormann, 2000, Krogsgaard‐Larsen et al.,
1997, Enz and Cutting, 1999)
Desensitisation Strong Variable Weak (Bormann, 2000, Mutneja et al., 2005)
Modulator(s) Barbiturates
Benzodiazepines
Ethanol
Neurosteroids
Triazolopyridazines
‐‐‐ Zinc? (Bormann, 2000, Emberger et al., 2000,
Kaneda et al., 2000)
BMC – [3H]bicuculline methochloride; CACA – cis‐4‐aminocrotonic acid; CAMP – cis‐2‐(aminomethyl)cyclopropane‐1‐carboxylic acid; I4AA – imidazole‐4‐acetic acid; TACA –
trans‐4‐aminobut‐2‐enoic acid; TAMP – trans‐2‐aminomethylcyclopropanecarboxylic acid; THIP – 4,5,6,7,‐tetrahydroisoxazolo[5,4‐c]pyridine‐3‐ol; TPMPA – and (1,2,5,6‐
tetrahydropyridine‐4‐yl)methylphosphinic acid.
Emily F. McDonald: GABA Receptors in Human Sclera
17
1.5.2 ‐Aminobutyric Acid as a Piece in the Myopia Puzzle: GABA in Eye Growth
GABA antagonists have been found to influence ocular growth in chick models of myopia
(Stone et al., 2003, Leung et al., 2005) and, in association with inhibition of myopia
development in chicks, facilitate learning and memory in mice (Chebib et al., 2009b). One
key study (Stone et al., 2003) demonstrated that GABA plays a modulatory role during eye
growth and refractive development. Refer to Table 1.3 for a summary of papers addressing
the use of GABA in animal models.
Table 1.3: Summaries of notable papers utilising GABA in animal studies. GABA
antagonists were found to inhibit both form‐deprivation myopia and normal eye
development.
Reference(s) Background Finding
(Stone et al.,
2003)
White leghorn chicks received daily intravitreal
injections of agonists or antagonists to GABAA
and GABAC Rho receptor subtypes. Results
following the injection period were determined
using refractometry, ultrasound, and callipers.
Antagonists to GABAA and
GABAC Rho receptor
subtypes inhibited both
form‐deprivation myopia
and the development of eyes
with normal visual input.
(Leung et al.,
2005)
Gallus domesticus chicks received regular (days 4, 7
& 10) intravitreal injections of two antagonists –
bicuculline and TPMPA – to GABAA and
GABAC Rho receptor subtypes. Measurements
following the trial period were taken using
ultrasound, streak retinoscopy, and micrometer
screw gauges.
Two antagonists – bicuculline
and TPMPA – to GABAA
and GABAC Rho receptor
subtypes inhibited both
form‐deprivation myopia
and normal eye
development.
(Chebib et al.,
2009b)
Red‐Rhode Island White cross cockerels were fitted
monocularly with a ‐15D spectacle lens and
received daily intravitreal injections of cis‐3‐
ACPBPA or trans‐3‐ACPBPA, GABAC
antagonists. Measurements were taken using
streak retinoscopy and A‐scan ultrasonography.
Mice received intra‐peritoneal injections of cis‐3‐
ACPBPA or trans‐3‐ACPBPA and, following the
injection period, were subjected to the Morris
Water Maze to determine potential effects of the
above‐mentioned drugs on learning and
memory capability.
Antagonists to GABAC – cis‐3‐
ACPBPA and trans‐3‐
ACPBPA – were found to
both inhibit myopia
development in chicks and
facilitate learning and
memory in mice.
1.5.3 ‐Aminobutyric Acid within the Human Eye
The human retina contains all three GABA receptor subtypes (Qian and Ripps, 2009). The
majority of the mammalian retinal cells found to express GABA are the amacrine cells
(Nguyen‐Legros et al., 1997, Davanger et al., 1991, Crooks and Kolb, 1992). GABAC is
expressed predominantly in the retina on bipolar cells of every subtype (Qian and Ripps,
2009). In the retina, GABA shares functional pathways with dopamine and acetylcholine,
Emily F. McDonald: GABA Receptors in Human Sclera
18
neurotransmitters also implicated in refractive development (Stone et al., 2003). Refer to
Table 1.4 for general and specific locations of GABA receptors in the eye (both human and
animal due to somewhat limited human data).
A study was undertaken by Young in 2003 using human scleral tissue from nine donors with
non‐myopic refractive history (Young et al., 2003). A cDNA (complementary
deoxyribonucleic acid) library was constructed from the scleral ribonucleic acid (RNA) and a
total of 640 expressed sequence tags (ESTs) were produced. The only neuronal‐specific EST
yielded was for GABAA receptor‐associated protein (gene name: GABARAP). [It must be
noted that this study was by no means comprehensive. The authors acknowledged this
point based on the fact that genes such as collagen type 1 and elastin, known constituents of
the sclera, were not identified in their library screening procedure. The authors estimated
that the genes that were identified in the study represented only 1‐2% of the total number of
mRNA (messenger ribonucleic acid) species potentially expressed by scleral fibroblasts
(Young et al., 2003).]
It has been postulated that, in the normal eye, GABA may be involved in determining the
shape of the normal developing eye (Leung et al., 2005). One paper (Leung et al., 2005) has
suggested, based on animal studies undertaken in chicks, that GABA antagonists may have a
direct effect on ocular growth; accordingly, GABA antagonists have been recommended as
having “a promising clinical role in the regulation of ocular growth including the treatment
of myopia” (Leung et al., 2005). Leung et al. (2005) found that the GABA antagonists,
bicuculline and TPMPA, reduced form‐deprived ocular growth, as well as normal growth.
However, it must be noted that bicuculline alone, at a concentration of 10 mg / mL, caused
hypermetropia of the control eyes.
1.5.4 ‐Aminobutyric Acid in Animal Models
A recent study (Cheng et al., 2011) found the GABAC receptor subtype, rho1, present in chick
sclera (the presence or absence of the other two main receptor subtypes was not
investigated). Another recent study (Cheng et al., 2012) found the GABAA Alpha 1 and
GABAC Rho 1 receptor subtypes present in chick cornea; GABAB was not found to be
present. A study currently in press (Cheng et al., In Press) reported expression of GABAA
Alpha 1, GABAB R2, and GABAC Rho 1 receptor subtypes in chick RPE. Although GABA
Emily F. McDonald: GABA Receptors in Human Sclera
19
receptors have been found in chick sclera (and cornea and RPE), it is unknown whether
GABA receptors are present or absent in human sclera. For background information into
animal studies – species employed, techniques used, and rationale for different approaches,
refer to Appendix 1.
Emily F. McDonald: GABA Receptors in Human Sclera
20
Table 1.4: Ocular tissues – human and animal – found to have GABA receptors present.
GABA‐stained retinal cells include amacrine and ganglion cells.
Ocular Tissue GABA Present in: Finding Reference(s)
Human Retina The total number of GABA‐stained cells
(strongly or moderately stained) was
estimated to be between 26 and 40%. The
majority of cells that demonstrated GABA
immunoreactivity were interpreted as
amacrine cells, terminating in the inner
plexiform layer (as none of the stained cells
displayed extensions in an outward
direction). Furthermore, a subpopulation
was observed to be immunoreactive in the
ganglion cell layer (these cells were
assumed to be displaced amacrine cells).
Cells thought to represent sectioned
interplexiform cell fibres and terminals
present in the inner nuclear and outer
plexiform layers appeared to demonstrate
GABA immunoreactivity. There appeared
to be some GABA‐stained ganglion cells
but no horizontal, bipolar, or Müller cells
stained for GABA.
(Davanger et
al., 1991)
Human Retina The study focused on the central retina.
Approximately 40% of the amacrine cells
present in the inner nuclear layer were
found to be GABA immunoreactive.
Furthermore, a few amacrine cells in the
inner plexiform layer and ganglion cell
layer also demonstrated GABA
immunoreactivity. There appeared to be
faint staining of photoreceptors and cone
pedicles in the outer plexiform layer.
(Bipolar, horizontal, and most ganglion
cells did not demonstrate
immunoreactivity.)
(Crooks and
Kolb, 1992)
Human Retina Staining for GABAA Alpha 1 subunit was
found to be intense in both the inner and
outer plexiform layers. Immunoreactivity
for the above antibody was also present in
many amacrine and ganglion cell somas in
the inner nuclear layer and ganglion cell
layer. The same cells also stained for
GABAA Beta 2 & 3 but less intensely. The
presence of the GABAA receptors on the
bipolar dendritic tips may mean that the
role of the GABA receptors are to mediate
the receptive field surrounding both off and
on bipolar cells. The presence of the
GABAA receptors on the bipolar axon
terminals suggest that much of the
inhibition feeding back from GABAergic
amacrine to bipolar cells is GABAA‐
(Vardi and
Sterling, 1994)
Emily F. McDonald: GABA Receptors in Human Sclera
21
mediated.
Vertebrate Retina
Although all three GABA receptor subtypes
were found to be present in the vertebrate
retina, the retina was found to be
particularly enriched with GABAC. Of
note, it was mentioned that “GABA‐
mediated inhibition may play important
roles in modulating visual information as it
flows from photoreceptors to the brain”.
(Lukasiewicz
and Shields,
1998)
Human Retina GABAC Rho 1 immunoreactivity was primarily
observed in the inner plexiform layer.
(Gussin et al.,
2011)
Chick Sclera
The GABAC Rho 1 receptor subunit was found
to be present in fibroblasts and
chondrocytes of both the fibrous and
cartilaginous layers of chick sclera.
(Cheng et al.,
2011)
Chick Cornea
Chick corneal tissue was found to be positive
for both GABAA Alpha 1 and GABAC Rho 1
receptor subunits and was negative for
GABAB. GABA may play a role in corneal
transparency by way of fluid transportation
in the corneal epithelium. The GABA
receptors may be involved in regulating
corneal sensitivity or other neural functions
in the corneal epithelium.
(Cheng et al.,
2012)
1.5.5 ‐Aminobutyric Acid in Fibroblasts of other Tissues
The functional impact of GABA on fibroblast activity, in particular, has been documented in
a few relatively recent studies. For example, GABA stimulates the synthesis of hyaluronic
acid and enhances the survival rate of the dermal fibroblasts obtained from skin samples (Ito
et al., 2007). Less recently (Göhlich et al., 1984), it was demonstrated that the rate of GABA
synthesis in skin fibroblasts from Huntington’s disease patients can be around 3 times higher
than in healthy controls. A study on fibroblasts obtained from human buccal mucosa found
that GABA stimulated collagen synthesis and proliferation (Scutt et al., 1987). From a gene
expression perspective, several genes encoding cellular receptors, including GABAA, have
been noted in genes induced in skin and lung fibroblasts (Gu and Iyer, 2006). mRNA
expression for the GABAA receptor β3 subunit, GABRB3, has been found to be up‐regulated
in human cleft lip and/or palate fibroblasts (Baroni et al., 2006). The cell proliferation activity
of GABA was studied using the mouse fibroblast cell line, NIH3T3 (Han et al., 2007). It was
found that GABA treatment significantly promoted cell proliferation and significantly
suppressed the mRNA expression of inflammatory mediators, such as IL‐1β (interleukin‐1β)
and TNF‐α(tumour necrosis factor‐α) (Han et al., 2007). From the above studies, it is clear
that GABA can potentially play a functional role in fibroblast activity.
Emily F. McDonald: GABA Receptors in Human Sclera
22
1.5.6 Pharmacological Factors Affecting Eye Growth in Animal Models
A recent review into pharmaceutical interventions for myopia control (Ganesan and
Wildsoet, 2010) addressed the use of GABA and cited three studies; two studies involved
chicks and one involved monkeys. The chick studies – one utilising form‐deprivation
myopia and the original study of its kind (Stone et al., 2003) and the other one lens‐induced
myopia (Chebib et al., 2009a) – both reported the same outcome: anti‐myopia effects for a
range of GABA antagonists. More specifically, GABAC‐selective antagonists proved to be
more potent than either GABAA‐ or GABAB‐selective antagonists. Both of these studies are
in agreement with another recent study (Chebib et al., 2009b), which also found GABA
antagonists – cis‐ and trans‐3‐ACPBPA – had weak effects (presence of the antagonists
resulted in a reduced cellular GABA response) at GABAA and GABAB receptors but potent
antagonist effects at GABAC receptors. The study involving monkeys found retinal GABAC
receptors appeared to be involved in modulation by GABA of a retinoic acid pathway (Song
et al., 2005). The review concludes the section on GABA with this: “However, there has been
no follow‐up to this study [referring to: (Song et al., 2005)] and no relevant studies of other
mammalian models” (Ganesan and Wildsoet, 2010).
1.6 Human Sclera
The sclera, or ‘skeleton’ of the eye (Trier, 2005), is a dynamic tissue; it is capable of
responding to changes, modulated by visually guided signals originating from the retina, in
the visual environment by altering ocular size and refraction (Summers Rada et al., 2006).
The biochemical and biomechanical properties of the sclera determine, to a large degree, the
shape and size of the globe and thus the refractive state; scleral physiology must alter to
allow the eye to expand during refractive development (Summers Rada et al., 2006,
Benavente‐Perez, 2006, Jobling et al., 2009, Young et al., 2003, Yang et al., 2009). Accordingly,
myopia development presents, not only as a rapid increase in eye size, but is also associated
with a loss of scleral tissue weight (Yang et al., 2009) and scleral thinning (Morgan, 2003).
However, it has not been fully elucidated what initiates and regulates the scleral remodelling
that occurs during myopia onset and development (McBrien et al., 2006). For relevant
background information, the following sections outline the different constituents and
biochemical properties of the sclera.
Emily F. McDonald: GABA Receptors in Human Sclera
23
1.6.1 Gross Structure & Function of Sclera
The sclera (derived from the Greek word skleros, meaning ‘hard’), together with the cornea, is
derived from both the neural crest and mesoderm and forms the outermost covering of the
eye (Summers Rada et al., 2006, Kashiwagi et al., 2010, Young et al., 2003, Seko et al., 2008,
Fullwood et al., 2011). It is commonly known as the white of the eye and forms an almost
complete sphere between 22 mm (Tsai et al., 2010) and 24 mm diameter (Watson and Young,
2004). The sclera is a dense, fibrous, viscoelastic connective tissue (Summers Rada et al.,
2006, Rada et al., 1997, Yang et al., 2009), accounts for approximately 85% of the total ocular
surface (McBrien and Gentle, 2003, Watson and Young, 2004), and extends from the cornea
to the optic nerve (Elsheikh et al., 2010). The sclera is composed of three layers: (external
layer to inner aspect) the episclera, scleral stroma proper, and the lamina fusca (McCluskey,
2001, Watson and Young, 2004).
Scleral connective tissue contains matrix‐secreting fibroblasts embedded in a matrix of
irregular and interwoven collagen fibres in close association with various proteoglycans, or
PGs, and glycoproteins (Rada et al., 1997, Summers Rada et al., 2006, Young et al., 2003,
McCluskey, 2001, McBrien et al., 2006). The underlying structure, composition, and
arrangement of collagen fibres in the sclera presents very differently to collagen found in the
cornea; its presentation is more comparable to collagen found in the skin (Yang et al., 2009,
Summers Rada et al., 2006). Due to the irregularity of its collagen fibres and its relative
hydration, the sclera is characteristically opaque and yet brilliantly white (McBrien and
Gentle, 2003, Elsheikh et al., 2010, Meek and Fullwood, 2001, Kashiwagi et al., 2010, Tsai et
al., 2010, Fullwood et al., 2011). The opacity of the sclera ensures that internal light scattering
does not affect the retinal image (Watson and Young, 2004, Seko et al., 2008). The sclera is
avascular; it obtains its nutrients via the choroid and vascular plexi in Tenon’s capsule – a
hypocellular layer of radially‐arranged, compact collagen bundles running parallel to the
scleral surface – and episclera (Watson and Young, 2004).
The main functions of the sclera are essentially three‐fold: 1) the sclera is rigid, but not
inflexible, in order to offer resistance to the effects of intraocular pressure, or IOP, and
external trauma (Summers Rada et al., 2006, McBrien and Gentle, 2003, Elsheikh et al., 2010,
Rada et al., 1997, McCluskey, 2001, Tsai et al., 2010, Watson and Young, 2004); 2) the sclera is
tough and impenetrable – yet allowing vascular and neural access – in order to provide
Emily F. McDonald: GABA Receptors in Human Sclera
24
protection to ocular components (McBrien and Gentle, 2003, Summers Rada et al., 2006,
Elsheikh et al., 2010, McCluskey, 2001, Tsai et al., 2010, Trier, 2005, Watson and Young, 2004);
and 3) the sclera is capable of rapid remodelling whilst maintaining shape and dimensional
parameters by providing a stable base for contractions of the ciliary muscle (McBrien and
Gentle, 2003) and enabling attachment for other extraocular muscle insertions (Elsheikh et
al., 2010, McCluskey, 2001).
1.6.2 Composition of the Sclera
The major biochemical components of the sclera include collagen, elastin, glycoproteins, and
proteoglycans (refer to Table 1.5). This structure is responsible for maintaining the rigidity,
strength, and elasticity that is characteristic of the sclera (Summers Rada et al., 2006). The
sclera essentially consists of connective tissue comprised of the ECM and ECM‐secreting
fibroblasts (Summers Rada et al., 2006) in close association with PGs and glycoproteins
(Young et al., 2004); refer to Figure 1.9. Biochemical changes in the scleral framework and in
the molecules required for synthesis and degradation processes can lead to significant
changes in scleral biomechanical properties; accordingly, associated biochemical and
biomechanical changes have been observed in scleral shape, ocular size, and, eventually, the
refractive state of the eye (Young et al., 2004, McBrien et al., 2009). Current knowledge
addressing specific biochemical and biomechanical changes during myopia onset and
development are described at the end of each section below, if applicable.
Figure 1.9: Model illustrating the likely molecular structure – based on current knowledge –
of the ECM of the mammalian sclera (McBrien and Gentle, 2003). Major biochemical
components include collagen, elastin, glyproteins, and proteoglycans.
Emily F. McDonald: GABA Receptors in Human Sclera
25
Table 1.5: Main biochemical constituents present in human sclera.
Constituent Reference(s)
Fibrous Connective Tissue (Summers Rada et al., 2006, McBrien and Gentle, 2003, Elsheikh et al., 2010, Jobling et al., 2009, Kusakari et
al., 1997, Young et al., 2003, Yang et al., 2009)
Collagen
Types I, III, IV, V, VI, VIII, XII, & XIII (Jobling et al., 2009, Summers Rada et al., 2006, McBrien and Gentle, 2003, Kashiwagi et al., 2010, Wessel et
al., 1997, Yang et al., 2009, Kusakari et al., 1997, Trier, 2005)
Elastin (Moses et al., 1978, Maza et al., 2012)
Enzymes (McCluskey, 2001, McBrien and Gentle, 2003)
Fibroblasts & Myofibroblasts (Cui et al., 2008, McCluskey, 2001, Summers Rada et al., 2006, Young et al., 2003, McBrien and Gentle, 2003,
Cui et al., 2004)
Glycoproteins (McCluskey, 2001, Young et al., 2003, Tsai et al., 2010)
Growth Factors (Moring et al., 2007)
Proteoglycans (McCluskey, 2001, Tsai et al., 2010)
Aggrecan (McBrien and Gentle, 2003, Summers Rada et al., 2006, Rada et al., 1997)
Biglycan (McBrien and Gentle, 2003, Summers Rada et al., 2006, Rada et al., 1997)
Decorin (McBrien and Gentle, 2003, Summers Rada et al., 2006, Rada et al., 1997)
Glycosaminoglycans (Summers Rada et al., 2006)
Chondroitin sulfate (Summers Rada et al., 2006)
Dermatan sulfate (Summers Rada et al., 2006)
Heparan sulfate (Summers Rada et al., 2006)
Heparan (Summers Rada et al., 2006)
Hyaluronan (Kashiwagi et al., 2010, Summers Rada et al., 2006)
Keratan sulfate (Summers Rada et al., 2006)
Emily F. McDonald: GABA Receptors in Human Sclera
26
1.6.3 Collagen
Mammalian scleral tissue is composed of approximately 90% collagen by weight (Summers
Rada et al., 2006, McBrien and Gentle, 2003, Yang et al., 2009). There are 8 collagen subtypes
present in human sclera: Type I, III, IV, V, VI, VIII, XII and XIII (McBrien and Gentle, 2003,
Summers Rada et al., 2006, Yang et al., 2009, McCluskey, 2001, Kashiwagi et al., 2010, Trier,
2005, Jobling et al., 2009, Kusakari et al., 1997). The structure and function of each collagen
subtype varies considerably (Summers Rada et al., 2006). Type I collagen fibres are the most
abundant type and can be present in up to 50‐70% of the human sclera (Yang et al., 2009).
With respect to diameters, adult human scleral collagen fibres are highly variable: fibrils
have an average range of 94‐102 nm and an overall range between 25‐250 nm (Summers
Rada et al., 2006). More specifically, the outer scleral layer – the episclera – has been
reported to have an average of 100 nm (Yang et al., 2009). In terms of thickness, the average
fibre ranges between 10‐25 μm (Tsai et al., 2010). During myopia development, the diameter
of the scleral collagen fibrils is reduced, weakening the sclera (Choo, 2003, Gentle et al.,
2003).
1.6.4 Elastin
As is characteristic of tissues that are subjected to multidirectional stretching, the human
sclera is partly composed of elastic fibres (McCluskey, 2001, Moses et al., 1978). Elastic fibres
are partly abundant in the lamina fusca and trabecular meshwork (Watson and Young,
2004); however, overall, elastic tissue forms less than 2% of the sclera per se (Moses et al.,
1978). The elastin is composed of non‐polar hydrophobic amino acids, such as alanine,
valine, isoleucine, and leucine, and contains little hydroxyproline and no hydroxylysine
(Watson and Young, 2004).
1.6.5 Enzymes
Notable enzymes present in the sclera are matrix metalloproteinases (MMPs), elastases,
collagenases, and proteoglycanases (Maza et al., 2012). MMPs, matrix‐degrading, zinc‐
dependent endopeptidases (Benoit de Coignac et al., 2000), are produced by scleral
fibroblasts (McCluskey, 2001) as either secreted or membrane‐bound pro‐enzymes or
zymogens (Cauwe et al., 2007). Remodelling and breakdown of the ECM occurs, at least in
part, by MMPs (McBrien and Gentle, 2003, Kashiwagi et al., 2010) since they are responsible
for degrading collagens, PGs, and other matrix macromolecules (Tomita et al., 2002): MMPs
Emily F. McDonald: GABA Receptors in Human Sclera
27
cleave almost all ECM components (Pirilä et al., 2007). Other functions of MMPs are listed in
Table 1.6. The MMPs, of which there are 23 in humans (listed in Table 1.7), share a common
domain structure with a signal peptide for secretion, a propeptide, a catalytic domain, a
hinge region, and, in the majority of cases, a C‐terminal domain (Clark et al., 2008, Cauwe et
al., 2007). MMPs are activated by removal of the NH2‐terminal propeptide (Cauwe et al.,
2007). Altering the visual environment leads to changes in the concentration of MMPs
(Fredrick, 2002) and, accordingly, alterations have been observed in MMPs during myopia
development (McBrien et al., 2006). Specifically, levels of MMPs, and their tissue inhibitors,
increase during myopia development (Wride et al., 2006, Choo, 2003). MMP‐2 has been most
strongly implicated in the process of scleral remodelling (Jones et al., 1996).
Table 1.6: Known functions of MMPs. Some functions include regulation of cell growth,
regulation of apoptosis, and alteration of cell motility.
Functions of MMPs References
Opposing effects on angiogenesis via matrix degradation but
also release of angiogenesis inhibitors
(Clark et al., 2008, Cauwe et al.,
2007)
Regulation of cell growth via cleavage of cell surface‐bound
growth factors and receptors, release of growth factors
sequestered in the ECM or integrin signalling
Regulation of apoptosis via release of death or survival factors
Alteration of cell motility by revealing cryptic matrix signals,
or cleavage of adhesion molecules
Effects on the immune system and host defence
Modulation of the bioactivity of cytokines
Other proteases include elastases, collagenases, and proteoglycanases (McCluskey, 2001,
Maza et al., 2012). Elastase is regarded as a powerful proteinase that lacks specificity, unlike
some of the other proteinases, such as collagenase (Maza et al., 2012). Elastase, as its name
suggests, degrades elastin but, due to its lack of specificity, it is capable of degrading other
components of the ECM, such as collagen and PGs (Maza et al., 2012). Collagenase degrades
collagen fibrils; collagen degradation as a function in both normal and inflamed tissues
depends on the balance between collagenase and its inhibitors (Wooley, 1984).
Proteoglycanases degrade the core protein and link proteins of PGs (Maza et al., 2012).
Emily F. McDonald: GABA Receptors in Human Sclera
28
Table 1.7: Known MMPs and their associated substrate specificity. In the context of myopia, MMP‐2, or gelatinase‐A, has been most strongly
implicated in the process of scleral remodelling.
Gene Name(s) Reference(s)
MMP‐1 Interstitial collagenase or fibroblast collagenase or collagenase‐1 (Tomita et al., 2002)
MMP‐2 Gelatinase‐A or 72kDa type IV collagenase (Benoit de Coignac et al., 2000, Clark et al., 2008)
MMP‐3 Stromelysin‐1 (Cauwe et al., 2007)
MMP‐7 Matrilysin‐1 (Benoit de Coignac et al., 2000, Clark et al., 2008)
MMP‐8 Neutrophil collagenase or collagenase‐2 (Pirilä et al., 2007, Giambernardi et al., 2001)
MMP‐9 Gelatinase‐B (Benoit de Coignac et al., 2000, Clark et al., 2008)
MMP‐10 Stromelysin‐2 (Cauwe et al., 2007)
MMP‐11 Stromelysin‐3 (Cauwe et al., 2007)
MMP‐12 Macrophage metalloelastase (Benoit de Coignac et al., 2000, Clark et al., 2008)
MMP‐13 Collagenase‐3 (Cauwe et al., 2007)
MMP‐14 Membrane‐type 1‐MMP (Clark et al., 2008)
MMP‐15 Membrane‐type 2‐MMP (Clark et al., 2008)
MMP‐16 Membrane‐type 3‐MMP (Clark et al., 2008)
MMP‐17 Membrane‐type 4‐MMP (Clark et al., 2008)
MMP‐19 RASI‐1 (Cauwe et al., 2007)
MMP‐20 Enamalysin (Benoit de Coignac et al., 2000, Clark et al., 2008)
MMP‐21 Not classified (Cauwe et al., 2007)
MMP‐23 CA‐MMP (Cauwe et al., 2007)
MMP‐24 Membrane‐type 5‐MMP (Cauwe et al., 2007)
MMP‐25 Membrane‐type 6‐MMP (Cauwe et al., 2007)
MMP‐26 Matrilysin‐2 or endometase (Pirilä et al., 2007)
MMP‐27 ‐‐‐ (Clark et al., 2008)
MMP‐28 Epilysin (Cauwe et al., 2007)
Emily F. McDonald: GABA Receptors in Human Sclera
29
1.6.6 Scleral Fibroblasts
Scleral fibroblasts – or sclerocytes – are present in the ECM, although not in abundance
(McCluskey, 2001), and are arranged in lamellae, or layers (Summers Rada et al., 2006,
Young et al., 2003). It is thought the lamella arrangement of the fibroblasts may play an
important role in controlling the size of the eye (Summers Rada et al., 2006). Activated
fibroblasts have a spindle‐shaped morphology with stress fibre formation, fibronectin fibrils
and focal adhesion complexes (Tomasek et al., 2002, Jester and Ho‐Chang, 2003, Jester et al.,
2002). Fibroblasts, along with the corneal stroma, are responsible for the production of
proteins found in the ECM, such as collagen, PGs, and hyaluronan (Kashiwagi et al., 2010,
McCluskey, 2001). Accordingly, the structural organisation and integrity of the sclera is
largely dependent on the activity of the scleral fibroblasts (McBrien and Gentle, 2003, Baglole
et al., 2006); fibroblasts both synthesise and remodel the ECM (Young et al., 2003). Scleral
fibroblasts are involved in scleral remodelling during axial elongation in myopia (Cui et al.,
2004, Cui et al., 2008) and it has been recently suggested that cellular signals acting on the
scleral fibroblast may direct the growth process resulting in myopia (Barathi et al., 2009).
Interestingly, the proliferation of fibroblasts in the sclera decrease during myopia
development but, during recovery, increase (Choo, 2003). Fibroblasts are thought to play a
role(s) during myopic development (refer to Figure 1.10).
Figure 1.10: Proposed model of the role of scleral myofibroblast cells in the biochemical and
Emily F. McDonald: GABA Receptors in Human Sclera
30
biomechanical remodelling that facilitates myopia development (McBrien et al., 2009).
1.6.7 Glycoproteins
For the purposes of this document, the term ‘glycoprotein’ will be primarily used to describe
molecules consisting of an oligosaccharide with a mannose core N‐glycosidically linked to
asparagine; in the absence of the above clause, it could be argued that collagen, elastin, and
PGs are glycosylated proteins (Maza et al., 2012). Several non‐collagenous glycoproteins
have been characterised in the ground substance of the sclera during various embryological
developmental stages; they include fibronectin, vitronectin, and laminin (Summers Rada et
al., 2006). Fibronectin and laminin are also present in adult sclera (Chapman et al., 1998,
Fukuchi et al., 2001, Maza et al., 2012). It appears that fibronectin plays an important role in
the organisation of the pericellular and intercellular matrix due to its ability to bind to
collagen, fibroblasts, and glycosaminoglycans (GAGs) (Kleinman et al., 1981, Yamada et al.,
1980). Laminin, found in the basement membranes, participates in assembly of basement
membranes and promotion of cell adhesion, growth, migration, and differentiation
(Kleinman et al., 1985).
1.6.8 Growth Factors
It has been reported that many characteristics of scleral ECM remodelling are thought to be
under the control of specific growth factors (Summers Rada et al., 2006). During
embryological development, there are six known growth factors associated with scleral
growth: IGF‐I, IGF‐II, PDGF (platelet‐derived growth factor), TGF‐β (transforming growth
factor), NGF (nerve growth factor), and NE (norepinephrine) (Tripathi et al., 1991). It has
been observed in animal studies that, during myopia development, there is a decrease in the
levels of TGF‐β (Jobling et al., 2004). The levels of the growth factor, thrombospondin‐1
(Frost and Norton, 2007), have also been shown to reduce.
1.6.9 Proteoglycans
PGs comprise approximately 0.7‐0.9% of the total dry weight of the sclera (Summers Rada et
al., 2006). PGs, abundant ECM molecules, consist of a core protein with at least one attached
GAG side‐chain made up of repeating disaccharide units (Summers Rada et al., 2006,
McCluskey, 2001, Moreno et al., 2005, Ihanamäki et al., 2004). The GAG side‐chain attached
to the PG often carries a negative charge due to their high degree of sulfation (Summers
Emily F. McDonald: GABA Receptors in Human Sclera
31
Rada et al., 2006, McCluskey, 2001). Scleral PGs serve several biologic functions: regulation
of hydration in vivo, maintenance of structural integrity, growth regulation, matrix
organisation, collagen fibril assembly and arrangement, and cell adhesion (Rada et al., 1997,
Summers Rada et al., 2006, McCluskey, 2001, Majava et al., 2007, Watson and Young, 2004).
PGs are synthesised from proteins produced and secreted by fibroblasts, as mentioned
previously (McCluskey, 2001, Johnson et al., 2006).
Glycosaminoglycans
As mentioned above, PGs consist of a core protein with at least one attached GAG side‐chain
made up of repeating disaccharide units. GAGs are constructed from several types of sugar
residues, which include N‐acetylglucosamine, N‐acetylgalactosamine, glucuronic acid, and
iduronic acid (Summers Rada et al., 2006). GAGs are categorised into four main groups
based upon their disaccharide composition, the type of linkage between disaccharides, and
the number and location of sulfate residues: 1) hyaluronan, 2) chondroitin sulfate and
dermatan sulfate, 3) heparan sulfate and heparan, and 4) keratan sulfate (Summers Rada et
al., 2006, Ihanamäki et al., 2004). The most abundant GAGs appear to be dermatan sulphate
and chondroitin sulphate; hyaluronic acid and heparan are only present in small amounts
(Maza et al., 2012).
Hyaluronan, a unique, non‐sulphated GAG, is an important constituent of the ECM: it plays
a role in regulating cell migration, proliferation, adhesion, development, and differentiation
(Kashiwagi et al., 2010, Laurent and Fraser, 1992, Knudson and Knudson, 1993). Hyaluronan
occupies the limited space between the collagen fibrils (Trier, 2005). Chondroitin sulphate
(consisting of sulphated N‐acetylgalactosamine and glucuronic acid), dermatan sulphate
(consisting of sulphated N‐acetylgalactosamine and two different types of uronic acid,
glucuronic acid and iduronic acid), heparan sulphate (sulphated N‐acetylglucosamine and
two different types of uronic acid, glucuronic acid and iduronic acid), and hyaluronic acid
(N‐acetylglucosamine and glucuronic acid) form the greater composition of the amorphous
ground substance present in the intercellular and interfibrillar spaces of the sclera (Maza et
al., 2012). Among the biochemical changes observed in myopic patients, decreased
production of GAGs has also been reported (McBrien et al., 2000, Rada et al., 2000). It must
also be noted that, as part of the aging process, there is a significant loss of GAG composition
(particularly dermatan sulphate); as GAGs are highly hydrated, the decrease in age‐related
Emily F. McDonald: GABA Receptors in Human Sclera
32
tissue hydration can be attributed, at least in part, to this loss of GAG composition (Brown et
al., 1994).
Aggrecan, Biglycan, and Decorin
Three PG types have been identified in human sclera: aggrecan, biglycan, and decorin (Rada
et al., 1997, Johnson et al., 2006, Watson and Young, 2004, Boubriak et al., 2003). Of the PGs
synthesised from sclera organ culture, aggrecan, biglycan, and decorin represent 6%, 20%,
and 74% respectively (Trier, 2005, Rada et al., 1997). Compared to biglycan and decorin,
aggrecan is a comparatively large PG: it contains over 100 chondroitin sulfate chains, over 30
keratan sulfate chains (Rada et al., 1997), and more than 50 oligosaccharide chains (Vynios et
al., 2001). Aggrecan has a space filling role in both cartilage and the sclera (Fullwood et al.,
2011). Biglycan – also referred to as PG I – is a small PG (McBrien and Gentle, 2003); it has a
molecular mass of 200 kDa (Rada et al., 1997). Biglycan contains two chondroitin‐dermatan
sulfate chains (Rada et al., 1997, Vynios et al., 2001) and belongs to the Small Leucine‐Rich
Proteoglycans (SLRPs) family (Summers Rada et al., 2006, Zhang et al., 2009). SLRPs are
characterised by a central domain containing leucine‐rich repeats flanked on both N‐ and C‐
terminal sides by small cysteine clusters (Moreno et al., 2005, McEwan et al., 2006). Biglycan
plays an important role in regulating collagen fibril assembly and interaction (McBrien and
Gentle, 2003, Zhang et al., 2009). Decorin, the most abundant PG (Trier, 2005), is reasonably
small: it consists of a molecular mass of 120 kDa (Rada et al., 1997). Decorin contains one
chondroitin‐dermatan sulfate chain (Rada et al., 1997, Vynios et al., 2001). Biglycan and
decorin are closely related (Rada et al., 1997, McCluskey, 2001); decorin also belongs to the
SLRP family (Summers Rada et al., 2006, Zhang et al., 2009). [Both biglycan and decorin are
known as Class I SLRPs (Schaefer and Iozzo, 2008).] Decorin exhibits a unique organisation
of 10 tandem leucine‐rich repeats enabling the molecule to fold into an arch‐shape structure
suited to bind both globular and non‐globular proteins (Santra et al., 2002). Decorin – also
referred to as PG II – binds, in vitro, to collagens type I and II (Rada et al., 1997) and, along
with biglycan, plays an important role in collagen fibril assembly and interaction (McBrien
and Gentle, 2003, Zhang et al., 2009).
1.6.10 Other Receptor Types known to be Present in Human Sclera
Several receptor types have been found in human sclera; refer to Table 1.8. There has been
interest in muscarinic receptors as a potential target for pharmaceutical agents, in the context
Emily F. McDonald: GABA Receptors in Human Sclera
33
of myopia, but the studies have found variable effects (Luft et al., 2003, Diether et al., 2007).
Table 1.9 lists known locations of muscarinic receptors in both ocular and non‐ocular tissues
and Table 1.10 outlines key functions of receptors shown in Table 1.8.
Table 1.8: Receptor types observed in human sclera. Types include collagen, prostanoid,
and muscarinic receptors.
Receptor Type Present in Human Sclera References
α1(XIII) Collagen mRNA (Sandberg‐Lall et al., 2000)
ADORA1 (Cui et al., 2008)
ADORA2B (Cui et al., 2008)
CD14 (Chang et al., 2004)
E‐Prostanoid Receptors (Subtypes 1‐4) (Schlötzer‐Schrehardt et al., 2002)
FP (PGF2α Receptor) (Schlötzer‐Schrehardt et al., 2002)
MD‐2 (Chang et al., 2004)
Muscarinic Receptor Subtype 1 (M1) (Collison et al., 2000, Qu et al., 2006)
Muscarinic Receptor Subtype 2 (M2) (Qu et al., 2006)
Muscarinic Receptor Subtype 3 (M3) (Collison et al., 2000, Qu et al., 2006)
Muscarinic Receptor Subtype 4 (M4) (Qu et al., 2006)
Muscarinic Receptor Subtype 5 (M5) (Qu et al., 2006)
TLR4 (Chang et al., 2004)
Table 1.9: Location of muscarinic receptors in ocular and non‐ocular tissues.
Location Muscarinic Receptor/s Reference
Cornea and epithelium of
the crystalline lens
M3 (Collison et al., 2000)
Iris sphincter and ciliary
body
M1‐M5 (Gil et al., 1997, Gupta et al.,
1994, Zhang et al., 1995)
Retina M3 and M4 (Fischer et al., 1998)
Lung Fibroblasts M1‐M4 (Matthiesen et al., 2006)
Labial Salivary Glands M1, M3, M5 (Ryberg et al., 2008)
Sclera M1‐M5 (Qu et al., 2006)
Emily F. McDonald: GABA Receptors in Human Sclera
34
Table 1.10: Key functions of receptors present in human sclera.
Role or Possible Involvement Reference
ADORA1 and ADORA2B Receptors
Associated with the regulation of IOP in rabbits and monkeys (Crosson et al., 1994, Tian et al.,
1997)
ADORA1 inhibits adenylcyclase (Gi/o‐coupled) and therefore
decreases levels of cAMP (cyclic adenosine monophosphate)
(Burnstock, 2007)
ADORA2B activates adenylcyclase (Gs‐coupled) and increases
levels of cAMP
(Burnstock, 2007)
CD14 Receptors
Enhances activation of cells by lipopolysaccharide (Viriyakosol et al., 2000)
E‐Prostanoid Receptors
Exert a variety of actions in various tissues and cells; some of these
actions are described below:
relaxation and contraction of various types of smooth
muscles
modulate neuronal activity by either inhibiting or stimulating
neurotransmitter release, sensitizing sensory fibers to
noxious stimuli, or inducing central actions such as fever
generation and sleep induction
involved in apoptosis, cell differentiation, and oncogenesis
regulate the activity of blood platelets both positively and
negatively and are involved in vascular homeostasis and
haemostasis
(Narumiya et al., 1999)
FP (PGF2) Receptors
May play a role in regulating IOP (Schlötzer‐Schrehardt et al.,
2002)
MD‐2 Receptors
Accessory molecule that associates with the extracellular domain of
TLR4 (see below for more on TLR4) conferring on it
lipopolysaccharide responsiveness
(Nagai et al., 2002, Shimazu et
al., 1999)
Muscarinic Receptors
Transactivate growth factor receptors (Kanno et al., 2003)
Accommodation, altered aqueous outflow, and contraction of the
iris sphincter muscle
(Gabelt and Kaufman, 1992,
Kaufman, 1984)
Regulating growth of the corneal epithelium and control corneal
wound healing
(Lind and Cavanagh, 1995)
TLR4 Receptors
Recognition of the highly conserved pathogen‐associated
molecular patterns unique to microbes
(Chang et al., 2004)
Stimulation results in the activation of an immunostimulatory and
immunomodulatory cell‐signalling pathways essential for innate
immunity and activation of the adaptive arm of the immune
response
(Medzhitov et al., 1997, Schnare
et al., 2001)
1.6.11 Factors Affecting Human Scleral Structure & Function
During myopia development, fibril diameter and the processes involved in collagen
synthesis and degradation change (McBrien et al., 2006). In a human myopic eye, the sclera
thins and the diameter of collagen fibrils found in the posterior sclera becomes progressively,
Emily F. McDonald: GABA Receptors in Human Sclera
35
as compared to non‐myopic eyes, smaller (Jobling et al., 2009, Kusakari et al., 1997, Cui et al.,
2008, McBrien et al., 2001a, McBrien et al., 2000, Tseng et al., 2004, Yang et al., 2009, Gottlieb
et al., 1990). The thinning of the sclera and the narrowing of the fibrils is usually associated
with a disconnection of the collagen fibre bundles (Yang et al., 2009) and an abnormal
pattern of interlacing (Gottlieb et al., 1990). It has been hypothesised that the above‐
mentioned pathological features of the fibrils – narrowing and disconnection – results from
reduced collagen synthesis and/or increased collagen degradation (Yang et al., 2009).
Accordingly, elevated activity of collagen‐degrading enzymes has been implicated in early
stages of myopia onset (McBrien et al., 2001a). The process of scleral remodelling is depicted
in Figure 1.11.
Figure 1.11: Diagrammatic representation of the scleral remodelling that underpins myopia
development (McBrien et al., 2009). It is believed that the visually‐generated signal is
communicated from the retina and through the choroid to the sclera.
1.7 Summary
Based on the literature described here, it is clear that distribution and function of GABA in
scleral tissue is a relatively unexplored area. Previously, the human sclera has been thought
to be essentially inert (McBrien and Gentle, 2003) and, accordingly, there is a significant gap
in the literature addressing and exploring the potentially dynamic role(s) of the sclera –
including in the context of communication with neurotransmitters, such as GABA – in
refractive conditions (Watson and Young, 2004). GABA is an important inhibitory
Emily F. McDonald: GABA Receptors in Human Sclera
36
neurotransmitter present in the CNS and retina (Krogsgaard‐Larsen et al., 1997, Chebib et al.,
2009b, Enz and Cutting, 1999, Barnard et al., 1998). Specifically, GABA antagonists have
been found to influence ocular growth in chick models of myopia (Stone et al., 2003, Leung et
al., 2005) and, in association with inhibition of myopia development in chicks, facilitate
learning and memory in mice (Chebib et al., 2009b). One key animal study (Stone et al.,
2003) demonstrated that GABA plays a modulation role during eye growth and refractive
development. As stated in a recent paper (Cheng et al., 2011), due to the fact that there are
many examples of GABA receptors located in multiple ocular sites, the discovery of rho 1
GABAC receptors in non‐neuronal ocular tissues is not as unusual as it may first appear.
This study will provide important new information on GABA receptor localisation in human
scleral tissue at both a whole of tissue and cellular level.
We hypothesise, based on the limited chick data available, that GABA receptors will be
present in human non‐retinal tissues, including RPE and sclera.
Emily F. McDonald: GABA Receptors in Human Sclera
37
1.8 Research Aims
The aims of this research project were:
1) Investigate the expression of GABA receptors in human scleral tissue using both
immunohistochemistry (IHC) and gene expression studies
2) Investigate the expression of GABA receptors in cultured human scleral cells by
culturing scleral cells ex vivo and examining these for GABA receptor gene expression
3) Investigate the expression of GABA receptors in choroidal, RPE, and retinal tissue
using both IHC and gene expression studies
The overarching theme of this thesis was to investigate human sclera – cells and tissue – and
factors that may impact scleral cell growth with relevance to myopia. The first study to be
completed was to determine if GABA receptors are present in human scleral tissue. Based
on the fact that these receptors have been localised to the scleral tissue of other species
(Cheng et al., 2011), it was predicted that GABA receptors would also be present in human
scleral tissue. The second study sought to target mesenchymal stromal cell populations
obtained from human scleral cell cultures. Thirdly, we investigated the potential presence of
GABA receptors in choroidal, RPE, and retinal tissues obtained from the same donors as the
scleral tissue and stromal cells were sourced.
Emily F. McDonald: GABA Receptors in Human Sclera
38
2 Materials and methodology
This project utilised IHC – antibodies raised against four different GABA receptor subunits
previously found in human retina – and reverse‐transcriptase polymerase chain reaction
(RT‐PCR) – 21 different primers designed to amplify all known GABA receptor subunits.
IHC was only undertaken using human scleral tissue; RT‐PCR was undertaken using human
sclera, choroid/RPE, retina, and cultured human scleral cells. The following sections outline
all materials used and methodology implemented during this project and experiments are
listed in the following order: Experiment (i) – IHC; Experiment (ii) – Cell culturing and flow
cytometry (Dominici et al.) ; & Experiment (iii) – Analysis of GABA receptor gene expression
in ocular tissues and cells.
2.1 Human Research Ethics Issues
This project involves the use of human cadaveric tissue and, therefore, ethics approval was
required. For this project, the Queensland University of Technology (QUT) ethics committee
granted ethics approval for all experimental work. The QUT ethics approval number for this
project is 0800000807.
2.2 Eye Collection
Eye cups were collected from the Queensland Eye Bank (QEB), Princess Alexandra Hospital,
Brisbane, Queensland within 4‐5 days of death. Until collection, the tissue was stored at 4C
in tissue storage medium. Since eye cups were obtained in pairs, the right eye was fixed in
formalin for 2 days and then stored in 70% ethanol at 4°C; the right eye was used for IHC.
The left eye was stored at ‐80°C for subsequent gene expression studies. The age of the
donors varied from 61 to 86 years. The refractive history and ethnicity of the donors was not
known. However, the age and cause of death of all donors was known (Table 2.1).
Table 2.1: Donor characteristics; information supplied from the QEB.
Age Cause of Death IHC or RT‐PCR
71 Unknown IHC
86 Non‐Small Cell Lung Cancer IHC
79 Intracranial Haemorrhage IHC
65 Metastatic Lung Cancer RT‐PCR
61 Metastatic Pancreatic Cancer RT‐PCR
75 Lung Adenocarcinoma, COPD, Hypertension RT‐PCR
Emily F. McDonald: GABA Receptors in Human Sclera
39
2.3 Preparation for Microtomy
Whole eyes were sectioned into strips from the inferior, superior, medial, and lateral
quadrants ~15 mm x 5 mm from the anterior section to approximately 3 mm from the start of
the optic nerve (Figure 2.1 shows a photograph of a typical eye specimen). The rationale for
obtaining the four different regions was to allow for potential variability (at a cellular level)
from one region to another. Orientation (Figure 2.2 maps out directional orientation and
Figure 3 provides an illustration depicting how the eyes were dissected) was determined
using several parameters: as it was already known whether the eye was left or right
(supplied information from QEB) and the eyes each presented with a reasonable length of
optic nerve, it was relatively straightforward to determine the general orientation of the eye
based on the direction of the optic nerve. More specifically, the vortex veins were visible and
served as landmarks for determining the orientation. In some cases, the rectus and oblique
muscles were attached as well. For more information on the gross anatomy of human sclera
and associated landmarks, refer to Appendix 2.
Figure 2.1: Photograph (taken by EFM) of a typical eye specimen showing length of the optic
nerve and visible veins. In the top left region of the eye (as shown in the picture), some
remnants of muscle are evident.
Emily F. McDonald: GABA Receptors in Human Sclera
40
Figure 2.2: Scleral map highlighting superior, inferior, nasal, and temporal regions in
relation to the optic nerve (Elsheikh et al., 2010).
Figure 2.3: Illustration demonstrating how the eye cups were dissected. Each eye was cut
into four strips – superior, inferior, medial and lateral. Each strip was approximately 5 mm
wide and 15 mm in length.
2.4 Microtomy
The formalin‐fixed tissue sections mentioned above were processed by routine paraffin
embedding technique. The processing (dehydration with alcohols, clearing with xylene, and
infiltration with molten wax) was performed using a Tissue‐Tek VIP 1000 by Helen
OʹConnor at QUT, Gardens Point. Embedding was undertaken using a Tissue‐Tek Tissue
Embedding Console System 4593. Microtomy was performed using either a Reichert‐Jung
2030 (Queensland Eye Institute, or QEI) or a Microm HM 325 (QUT, Gardens Point) – both
are rotary microtomes with disposable blades. Serial sections were cut to 3 microns in width
and mounted on glass slides (Menzel HD Microscope Slides, Superfrost Plus Ground).
Tissue sections were dried at 60°C for several hours.
2.5 Preliminary Work: H&E and Bleaching Optimisation
The paraffin tissue sections were deparaffinised using xylene and rehydrated using
ascending grades of ethanol (70, 90, and 100%). Haematoxylin & eosin staining was
undertaken to examine the general morphology of the tissue (refer to Figure 2.4 for H&E
Emily F. McDonald: GABA Receptors in Human Sclera
41
images – donor 6397L – showing the landscape of the sclera). The tissue was stained with
Mayerʹs haematoxylin for 3 minutes, differentiated with two dips in acid alcohol, and treated
with Scottʹs reagent for 30 seconds. The images were taken using an Olympus BX41
microscope and a Nikon DXM 1200 camera.
Figure 2.4: Overview of scleral tissue structure, including demonstration of melanocytes in
Emily F. McDonald: GABA Receptors in Human Sclera
42
deeper sclera, from donor 6397L to determine integrity of tissue and basic structures using
H&E.
(A) A montage of three photographs (20x oil immersion lens) demonstrating nearly the full
thickness of the sclera and adjacent retinal tissue in a lateral section. Note the higher density
of stromal cell nuclei within the outer third of the sclera along with the presence of blood
vessels. (B) A corresponding image of the outer sclera within a section taken from the
medial aspect of the sclera. Note the thicker muscular wall of the arteriole surrounded by
unexpected melanocytes. (C) A higher power image (100x oil immersion lens) showing the
detailed morphology of the vessel wall (the arrow is highlighting the endothelium) and
adjacent melanocytes, which appear brown (medial section).
As can be seen in Figure 2.4 above, there are melanocytes present in the sclera. Due to the
possibility of melanocytes being mistaken for false‐positive antibody results (Orchard and
Calonje, 1998), bleaching – exposure to oxalic acid for one minute and to potassium
permanganate for 3‐5 minutes – was attempted prior to undertaking IHC. It was found that
3‐5 minutes of bleaching was an optimal timeframe to ensure the melanocytes appeared pale
instead of brown (refer to Figure 2.5). However, bleaching the tissue also increased the
basophilia of the tissue and resulted in a bluish appearance.
Figure 2.5: Bleaching optimisation results observed for donor 6397L (tissue taken from
lateral region).
(A) Mayer’s haematoxylin only as a control; the arrow is highlighting a melanocyte (B)
Appearance of tissue following one minute of oxalic acid and 30 seconds of potassium
permanganate. As shown, bleaching increased the basophilia of the tissue and resulted in
the tissue becoming negatively charged. The pigmentation has started to disappear but not
entirely; the arrow is highlighting the outer layer of sclera; (C) Appearance of tissue
following one minute of oxalic acid and 1 minute of potassium permanganate. Bruch’s
membrane has started to become visible and there is still pigmentation present; (D)
Appearance of tissue following one minute of oxalic acid and 2 minutes of potassium
permanganate. Still a small amount of pigmentation visible; (E) Appearance of tissue
following one minute of oxalic acid and 5 minutes of potassium permanganate. Bruch’s
membrane is now well‐defined as a thin blue line beneath the RPE.
Emily F. McDonald: GABA Receptors in Human Sclera
43
2.6 Immunohistochemistry: Experiment #1
IHC was performed using the Dako EnVision+ HRP (DAB) kit (DakoCytomation, Botany,
New South Wales, Australia). The following antibodies were used:
1) QED Biosciences Inc. Anti‐Alpha 1 GABA‐A Receptor Monoclonal (Lot # 032510)
2) Sigma Aldrich Prestige Antibodies Anti‐GABRR2 Rabbit (Lot # R06608)
3) Sapphire Biosciences Rb pAb to GABRR1 (Lot # GR25385‐2)
4) Epitomics GABA (B) R2 Rabbit mAb (Lot #YE102203)
The antibodies listed above – excluding the one for GABA B R2 – were selected based on
previous studies demonstrating presence in human retinal tissue: GABA A α‐1 (Vardi and
Sterling, 1994), GABA 1 (Gussin et al., 2011, Hackam et al., 1997), and GABA 2 (Wang et
al., 1994, Hackam et al., 1997). GABA B R2 was selected as representative for the GABA B
receptor type. Deparaffinised slides were blocked in 2% bovine serum albumin (BSA) in
phosphate buffered saline (PBS) for 30 minutes. The primary antibodies were diluted in 2%
BSA (1:100 and 1:200) and applied at room temperature for one hour. The peroxidise‐
labelled polymer was added for 20 minutes at room temperature after the slides were
washed three times in PBS to remove the primary antibody. DAB, or 3,3‐diaminobenzidine,
was added for 5 minutes and then the slides were counterstained with Mayer’s
haematoxylin. The sections were dehydrated using descending grades of ethanol (100, 90, &
70%), followed by xylene, and then mounted using Entellan New® (Pro Sci Tech,
Thuringowa, Queensland, Australia). Sections were viewed with an Olympus BX 41
microscope and images were taken using a NikonDXM 1200 camera. [All four quadrants
were exposed to all four antibodies using donor 6937L; the superior and medial sections
were exposed to the Anti‐Alpha 1 GABA‐A Receptor Monoclonal (QED Biosciences Inc) and
the Anti‐GABRR2 (Sigma Aldrich Prestige Antibodies) using donors 6806R and 6813R.]
2.7 Cell Culturing & Flow Cytometry: Experiment #2
Scleral stromal cells obtained from donors 6952 L and 6953L were kindly provided by Assoc
Prof Damien Harkin from QEI and characterised using FC by Dr Laura Bray (also from QEI).
An explant of scleral tissue – 1 cm2 – was washed twice in PBS, chopped finely into 1 mm2
pieces, resuspended in 2 ml fetal bovine serum (FBS), and seeded into a 25 cm2 flask and the
pieces were distributed. The flask was inverted and incubated for 5 hours at 37°C in a cell
culture incubator (5% CO2) to promote attachment of tissue pieces. The flask was then
reverted to normal orientation and 2 mL of culture medium (DMEM/F12 with 10% FBS and
Emily F. McDonald: GABA Receptors in Human Sclera
44
10 mM glutamine, supplemented with 50 U/ml penicillin/50 μg/ml streptomycin antibiotic
solution) was added. Out‐growth of stromal cells was clearly visible using a light
microscope after 1 week. The cultures were expanded to passage 3 (over a period of 5‐6
weeks) before storage in liquid nitrogen; 7.5 million cells per donor (stored in 90% FBS + 10%
DMSO).
Cellular phenotype analysis was performed using fluorescently labelled mouse anti‐human
antibodies (or rat anti‐human antibody in the case of CD44) as follows: IgG1 к isotype
control phycoerythrin (PE) (MOPC‐21), CD31 PE (WM‐59, IgG1 к), CD34 fluorescein
isothiocyanate (FITC) (581/CD34, IgG1 к), CD44 Pacific Blue (IM7, IgG2b, к), CD45 PE‐
cyanine dye (Cy7) (HI30, IgG1 к), CD73 allophycocyanin (APC) (AD2, IgG1 к), CD90 FITC
(5E10, IgG1 к), CD105 PE (SN6, IgG1 к), and CD141 PE (1A4, IgG1 к). The panel of markers
was a standard panel used to determine mesenchymal‐like characteristics. All antibodies
were purchased from Becton‐Dickinson (BD Pharmingen, CA, USA), eBioscience (in the case
of CD73 and CD105; Jomar Bioscience, SA, Australia), or Biolegend, Australian Biosearch,
WA, Australia (in the case of CD44). Viability was assessed by 7‐amino‐actinomycin D
incorporation (BD Viaprobe cell viability solution). Antibody concentrations were used
according to manufacturers’ instructions. Purified antibodies against GABAA‐α1, GABAAB‐
2, GABR‐R1, and GABR‐R2 (same as was used for IHC) were also utilised with either a
secondary Alexa Fluor 488 (for anti‐mouse) or 594 (for anti‐rabbit) antibody. Forty thousand
events were collected on a BD LSRII (BD Biosciences, CA, USA) where possible and analysed
using FlowJo software (Tree Star Inc., OR, USA).
2.8 Analysis of GABA Receptor Gene Expression in Ocular Tissues and Cells: Experiment #3
2.8.1 Primer Design
Primers were designed to amplify ~150‐200 base pair (bp) fragments of individual GABA
receptors sequences. Individual primers were 21 nucleotides in length and, of the total
number, 12‐13 nucleotides consisted of guanine or cytosine. Database searches using
determined sequences were performed using the BLAST program to confirm specificity of
the primers to their target GABA receptors. The sequences were aligned by using
ClustalW2. The following table (Table 2.2) lists the primers. Primers were obtained from
Sigma Aldrich. As the annealing temperature had to be deduced for each of the primers, the
Emily F. McDonald: GABA Receptors in Human Sclera
45
primers were exposed to three different temperatures: 63.0°C, 65.0°C, and 67.0°C. Analysis
for each primer was performed at the three temperatures mentioned and, if expression was
observed at a unique temperature, that temperature was determined to be the annealing
temperature. The results from the temperature‐range optimisation are shown in Table 2.3.
The remaining four primers not shown in the table – GABAA Alpha 2 v1 & 2, GABAA Alpha
3, GABAA Delta, and GABAC Rho 3 – did not demonstrate expression.
Emily F. McDonald: GABA Receptors in Human Sclera
46
Table 2.2: Individual primers (and expected product size) for each gene, including all known
transcript variants where applicable and represented by a ‘V’ in the gene name, representing
a GABA receptor subunit. The primer for GAPDH (housekeeping gene) is also shown below.
# GABA Gene Primer Product (bp)
1 GABAAΑ1V1,2,3,4,5,6,7
(GABA A ALPHA 1 V1‐V7)
F460 5ʹ AGCCCGCGATGAGGAAAAGTC – 3’
R653 5ʹ CCCAATCCTGGTCTCAGGCGA – 3’
193
2 GABAAΑ2V1 & 2
(GABA A ALPHA 2 V1 & V2)
F1340 5’ GGGCTTGGGATGGGAAGAGTG – 3’
R1504 5’ TGGGTTCTGGCGTGGTTGCAC – 3’
164
3 GABAAΑ3
(GABA A ALPHA 3)
F512 5’ TGGGCTTGGAGATGCAGTGAC – 3’
R703 5’ TGTGGAAGAAGGTGTCCGGTG – 3’
191
4 GABAAΑ4V1‐3
(GABA A ALPHA 4 V1‐V3)
F1867 5’ CTGTCCTCACCATGACCACAC – 3’
R2072 5’ CTCTCTCTGCACTGGAGCAGC – 3’
205
5 GABAAΑ5V1 & 2
(GABA A ALPHA 5 V1 & V2)
F746 5’ ATCACTCAGGTGAGGACCGAC – 3’
R929 5’ TGTCTGGGGTCCAGATCTTGC – 3’
183
6 GABAAΑ6
(GABA A ALPHA 6)
F609 5’ AGGTTGAAGTTTGGGGGGCCA – 3’
R801 5’ AACCAGCCTCATGGGACAGTC – 3’
192
7 GABRB1
(GABA A BETA 1)
F561 5’ GTTGGGATGCGGATCGATGTC – 3’
R731 5’ TGGTACCCAGAGTTGGTCAGC – 3’
170
8 GABRB2V1 & 2
(GABA A BETA 2 V1 & V2)
F1765 5’ CCTCCCACTGGAAGCAAGGAC – 3’
R1897 5’ TGGACCACAGGATAGGCCAGC – 3’
132
9 GABRB3V1‐4
(GABA A BETA 3 V1‐V4)
F2647 5’ GAGGCAAAGGAGGGCAACCTG – 3’
R2774 5’ GCGTCTATGAAACCGGTGCAC – 3’
127
10 GABRG1
(GABA A GAMMA 1)
F816 5’ AAGCCCTCCGTAGAAGTGGCT – 3’
R1064 5’ CGATGTTCTTGCAGGCACTGC – 3’
248
11 GABRG2V1,2,3
(GABA A GAMMA 2 V1‐V3)
F74 5’ TCTCCTTGTACCCTCCCCCTG – 3’
R257 5’ CCACCTGCCTCTAGTAGGTCC – 3’
183
12 GABRG3
(GABA A GAMMA 3)
F1094 5’ TGCTACGCCAGCAAGAACAGC – 3’
R1242 5’ CGGCGAAGACAAACAGGAAGC – 3’
148
13 GABRE
(GABA A EPSILON)
F361 5’ GTCAACAGCCTTGGTCCTCTC – 3’
R579 5’ GACCATCTGGTTGGGCATGGT – 3’
218
14 GABRD
(GABA A DELTA)
F385 5’ ACAGCAGGCTCTCCTACAACC – 3’
R577 5’ GTGGAGGTGATTCGGATGCTG – 3’
192
15 GABRQ
(GABA A THETA)
F404 5’ GACCCTGGACTATCGGATGCA – 3’
R559 5’ GATCCAGGGAACAAGCTGCTG – 3’
155
16 GABRP
(GABA A PI)
F452 5’ CCATATACCTCCGACAGCGCT – 3’
R657 5’ TCTGAGGGCATACAGGACCGT – 3’
205
17 GABBR1, 2, & 3
(GABA B R1)
F928 5’ GACGTGAATAGCCGCAGGGAC – 3’
R1122 5’ GAGGTTCCACATCCTAGCAGC – 3’
194
18 GABBR2
(GABA B R2)
F2900 5’ ATGCAGCTGCAGGACACACCA – 3’
R3081 5’ GTTCGAGAGGGCTCTGTTGTG – 3’
181
19 GABRR1
(GABA RHO 1)
F826 5’ TGAGGCACTACTGGAAGGACG – 3’
R981 5’ CGTTGTCTGTGGTGGTGTCGT – 3’
155
20 GABRR2
(GABA RHO 2)
F380 5’ TATGACCCTGTACCTGCGGCA – 3’
R581 5’ CACGTGTCCATCTGGGAACAC – 3’
201
21 GABRR3
(GABA RHO 3)
F339 5’ GAGACCTGGATTTGGAGGGTC – 3’
R491 5’ GCTGTGCTAGGAAAGGAGAGC – 3’
152
22 GAPDH F 5’ GCAAATTCCATGGCACCGT – 3’
R 5’ TCGCCCCACTTGATTTTGG – 3’
106
Emily F. McDonald: GABA Receptors in Human Sclera
47
Table 2.3: Annealing temperatures for primers following exposure of all cells and tissues to
three different temperature ranges: 63°C, 65°C & 67°C.
Annealing Temperature Primer Temperature/Primera
63°C GABA A Alpha 1 v1‐7 F: 70.5°C
R: 72.7°C
GABA A Alpha 5 v1 & 2 F: 65.5°C
R: 68.6°C
GABA A Beta 1 F: 70.8°C
R: 66.3°C
GABA A Beta 2 v1 & 2 F: 69.2°C
R: 70.5°C
GABA A Gamma 2 v1‐3 F: 68.4°C
R: 63.8°C
GABA A Gamma 3 F: 69.7°C
R: 70.0°C
GABA A Epsilon F: 65.1°C
R: 70.3°C
GABA A Theta F: 68.3°C
R: 68.1°C
GABA A Pi F: 67.1°C
R: 67.9°C
GABA B R2 F: 71.6°C
R: 66.1°C
GABA Rho 1 F: 66.5°C
R: 68.5°C
GABA Rho 2 F: 69.6°C
R: 67.8°C
65°C GABA A Alpha 4 v1‐3 F: 65.6°C
R: 66.9°C
GABA A Alpha 6 F: 72.4°C
R: 67.5°C
GABA A Beta 3 v1‐4 F: 71.0°C
R: 68.7°C
67°C GABA A Gamma 1 F: 67.1°C
R: 70.2°C
GABA B R1 F: 69.9°C
R: 64.9°C a Information supplied by the manufacturer.
2.8.2 RNA Isolation and Reverse‐Transcription
RNA was isolated from tissue samples and cultured scleral cells using TRIzol solution
(Invitrogen). In the case of the tissue samples, each layer was separated. Firstly, the retina
was carefully loosened from the choroid and RPE. Due to difficulty separating the choroid
from the RPE, both layers remained intact. Finally, the sclera was cleaned of any
contamination – easily observed with the eye due to the difference in colours of the layers.
Briefly, tissues were ground to a fine powder under liquid nitrogen using a mortar and
pestle and this was then transferred to a 2 ml Eppendorf tube containing 1 ml TRIzol. Total
Emily F. McDonald: GABA Receptors in Human Sclera
48
RNA was extracted from this following the manufacturer’s recommendations. The cells
were allowed to incubate at room temperature for five minutes. Cell homogenate was
transferred to 1.5 mL Eppendorf tubes. Two hundred L of chloroform was added to each 1
mL cell homogenate. Tubes were mixed vigorously for 15 seconds and then allowed to
stand for 2 minutes. Tubes were spun in the cold room (4C) for 15 minutes at 12,000 rpm.
The upper aqueous phase was carefully transferred to new Eppendorf tubes. RNA was
precipitated by adding 0.5 mL isopropyl alcohol per 1 mL of tissue homogenate. Tubes were
incubated for 10 minutes at room temperature. Tubes were spun at 12,000 rpm at 4C for 10
minutes. Supernatant was carefully discarded and the pellet was washed with 1 mL of 75%
ethanol per 1 mL of supernatant and mixed well. Tubes were spun at 7,500 rpm for 5
minutes. The supernatant was carefully removed and discarded. The pellet was
resuspended in 30 L of de‐ionised water and the pellet was mashed finely using the tip of a
sterile pipette. The RNA was quantitated using a NanoDrop Spectrophotometer (Thermo
Scientific, Wilmington, DE) and 2 g of total RNA was reverse‐transcribed for 10 minutes at
25°C, 60 minutes at 55°C, and 15 minutes at 70°C using 3 μl pD(N)6 primers (Invitrogen), 200
μM each deoxyribonucleotide triphosphate (dNTP) (Pharmacia, Uppsala, Sweden) and 200
U Superscript III reverse transcriptase (Invitrogen); the total reaction volume was 10 μL.
The concentration and purity of the RNA was determined by measurement of the optical
density at 260 nm and 280 nm and the results are shown in Table 2.4. The 260/280 nm ratios
ranged between 1.17 ‐ 1.99 but were on average 1.67. Lower ratios were seen in samples
from frozen tissues and, in particular, those extracted from the retina, which produces retinal
pigments, including melanin. Furthermore, it is important to note that the 260 nm/230 nm in
the retinal samples were influenced by the melanin found in these tissues but the RNA was
still suitable for expression analysis via RT‐PCR. The integrity of the cDNA made using the
RNA extracted from these samples was confirmed using primers to amplify the
housekeeping control gene, GAPDH. Attempts were made to extract RNA from donors
6806L, 6813L, and 6815L but the RNA yields were too small to complete the analysis of gene
expression for all of the GABA receptors in these samples – between 35.3 and 653.2 ng/μL –
so were excluded from the project.
Emily F. McDonald: GABA Receptors in Human Sclera
49
Table 2.4: Results from NanoDrop.
Sample Identification Concentration RNA ng/μl 260/280nm 260/230nm
6952L A Sclera 1862.8 1.46 0.77
6952L B Sclera 2902.3 1.8 1.16
6952L C Sclera 3311.7 1.67 1.31
6952L D Sclera 2502.0 1.55 1.02
6952L E Sclera 2295.2 1.56 0.92
6952L F Sclera 2763.5 1.70 1.10
6953L A Sclera 2201.8 1.64 0.89
6953L B Sclera 2677.8 1.37 1.08
6953L C Sclera 2467.0 1.66 0.99
6953L D Sclera 2551.4 1.65 1.02
6954L A Sclera 2455.5 1.77 0.99
6954L B Sclera 2981.6 1.60 1.19
6954L C Sclera 1346.3 1.25 0.57
6954L D Sclera 2303.9 1.69 0.92
6952L A Mesenchymal Stromal Cells 868.3 1.95 1.50
6952L B Mesenchymal Stromal Cells 911.8 1.98 1.88
6952L C Mesenchymal Stromal Cells 892.2 1.98 1.82
6952L D Mesenchymal Stromal Cells 1042.13 1.96 1.84
6953L A Mesenchymal Stromal Cells 1058.5 1.96 1.69
6953L B Mesenchymal Stromal Cells 1244.7 1.99 1.86
6953L C Mesenchymal Stromal Cells 952.6 1.95 1.63
6953L D Mesenchymal Stromal Cells 1087.6 1.97 1.95
6952L A Retina 3688.0 1.62 1.45
6952L B Retina (excluded) 281.2 1.43 0.72
6953L A Retina 3583.5 1.18 1.42
6952L A Choroid/RPE 2915.8 1.64 1.19
6953L A Choroid/RPE 3438.4 1.48 1.40
6953L B Choroid/RPE 3182.1 1.17 1.86
2.8.3 RT‐PCR Amplification of GABA Receptors
Primers specific to all 21 GABA receptor subunits (as shown previously in Table 2.2) and the
housekeeping gene GAPDH (glyceraldehyde‐3‐phosphate dehydrogenase) were used to
analyse gene expression. RT‐PCR reactions were performed in a PTC‐200 thermocycler
(Perkin Elmer, Waltham, MA) under the following conditions: Two μl cDNA template, 1.5
mM MgCl2, 200 μM each dNTP, 50 ng of each forward and reverse primer, and 0.5 units of
Platinum Taq polymerase in 1 x PCR buffer (Invitrogen); the total reaction volume was 50
μL. Cycling conditions included an initial denaturation at 94°C for 2 minutes, followed by
Emily F. McDonald: GABA Receptors in Human Sclera
50
40 cycles at 94°C for 30 seconds, 63‐67°C for 30 seconds and 72°C for 30 seconds, with a final
extension of 72°C for 7 minutes. Amplification products were visualised by ethidium
bromide staining following separation by electrophoresis through 2% agarose gels. The
housekeeping gene GAPDH was used to confirm the integrity of the cDNA. Controls used:
“PCR‐ve” – water was substituted for template; “housekeeping control” – primer used was
for housekeeping gene to confirm integrity of the cDNA sample; “RT‐ve” – Superscript III
was not added during reverse‐transcription. The number times a RT‐PCR reaction was
performed was once (following optimisation of the annealing temperatures). Purified RT‐
PCR product for each representative GABA gene was sent to the Australian Genome
Research Facility (AGRF) for sequencing. Two hundred L of Promega membrane binding
solution was added to each tube of product. The tubes were spun at 14,000 rpm for 1 minute
and the flow‐through was discarded. Five hundred L of membrane was solution (from the
same kit as the membrane binding solution) was added and the tubes were spun at 14,000
rpm for 1 minute and the flow‐through was discarded. The above steps were repeated (with
addition of 500 L of membrane wash solution). The tubes were spun at 14,000 rpm as
empty and then the basket was transferred with membrane to a tube (Eppendorf 1.5), 50 L
of nuclease‐free water was added (from Promega kit mentioned above), and the tubes were
spun at 14,000 rpm for 1 minute. Finally, 6 L of RT‐PCR product was transferred to a 1.5
Eppendorf tube and 1 L of forward primer and 5 L of ultra pure distilled water was
added. The samples were sequenced by the AGRF Sanger routine sequencing service using
capillary separation on an AB 3730xl Sequencer.
Emily F. McDonald: GABA Receptors in Human Sclera
51
3 results
The purpose of this project was to determine the presence/absence of GABA gene expression
in samples obtained from human sclera, choroid, RPE and retina. The results from the IHC
component of this project were inconclusive. The results from the RT‐PCR revealed the
presence of mRNA representing GABAA and GABAC receptor subunits throughout all ocular
layers tested, including the cells grown ex vivo. In addition, the cultured scleral cells and one
of the retinal donors yielded positive results for GABAC. Due to unresolvable issues with
contamination, we were not able to obtain consistent results for the housekeeping gene,
GAPDH, or any other housekeeping genes attempted. We observed positive results
representing the housekeeping control but also positive results in the case of the RT‐ve
control (refer to Table A8 in Appendix 3). We believe housekeeping gene contamination
may have been present in a communal reagent used during RNA extraction. Cleaned RT‐
PCR product representing each positive result was sent to the AGRF; our results were
verified. FC results revealed cell markers consistent with mesenchymal stromal cells.
3.1 Immunohistochemistry: Experiment #1
Shown in Figure 3.1 and Figure 3.2 is a representative example of the IHC (SMA – smooth
muscle actin – 1:100 and GABAA Alpha 1 1:100) undertaken during this project using donor
6397L (other donors used: 6806R & 6813R). IHC using all four antibodies was performed on
all four regions of the sclera using donor 6397L; no significant difference in staining for each
region was observed. Therefore, the data shown only concerns one region – the inferior
region – as a representative sample. A negative control was also performed by omission of
the primary antibody step. Due to concerns that bleaching may have reduced antigen‐
antibody interactions (Momose et al., 2011), the problem of an increased basophilic tissue,
and inconclusive results from the IHC staining, it was decided to employ molecular
techniques for future work.
Emily F. McDonald: GABA Receptors in Human Sclera
52
Figure 3.1: IHC – SMA – performed on donor 6397L (sections taken from inferior region).
(A) Non‐bleached control showing neural retina, RPE, choroid and some scleral tissue; (B)
Non‐bleached SMA (1:100); (C) deeper view of (B); (D) Bleached control showing full width
of sclera. Bleaching, in combination with a blocking step, has resulted in tissue oxidation.
The tissue now appears washed‐out and the nuclei are pale; (E) Deeper view of (D); (F)
Bleached SMA (1:100) showing the cross‐section of a blood vessel.
Emily F. McDonald: GABA Receptors in Human Sclera
53
Figure 3.2: IHC – GABAA Alpha 1 – performed on donor 6397L (sections taken from inferior
region).
(A) Non‐bleached control showing neural retina, RPE, choroid and some scleral tissue; (B)
Non‐bleached GABAA Alpha 1 (1:100); (C) Bleached GABAA Alpha 1 (1:100); (D) Non‐
bleached control showing deeper view of (A); (E) Non‐bleached GABAA Alpha 1 (1:100)
showing deeper view of (B); (F) Bleached GABAA Alpha 1 (1:100) showing deeper view of
(C); (G) Higher resolution of positive‐stained stromal cells; non‐bleached GABAA Alpha 1
(1:100); (H) Higher resolution of dendritic‐looking cells; non‐bleached GABAA Alpha 1
(1:100), (I) Some potential staining and some background staining; bleached GABAA Alpha 1
(1:100).
3.2 Flow Cytometry: Experiment #2
Crude cultures grown as fibroblast cells to passage 3 from the scleral explants – donors
6952L and 6953L – were characterised using FC and returned the following results for cell
surface markers: 99% positive for CD90, CD73, and CD105 and 15‐20% CD45 population.
From these results it could be deduced that the mesenchymal stromal cell population was at
Emily F. McDonald: GABA Receptors in Human Sclera
54
about 80‐85% (Bray et al., 2012, Dominici et al., 2006). The cells were also 98% positive for
CD44 and negative results were obtained for CD31 & CD34. Any results using GABA
antibodies were inconclusive. A graph depicting the FC data (Figure 3.3) and the raw data
(Table 3.1) are shown on the following page.
Emily F. McDonald: GABA Receptors in Human Sclera
55
Figure 3.3: Shown above is the percentage of live scleral‐derived stromal cells (passage 3). Ninety‐eight percent of the cells were positive for CD44
and 99% of the cells were positive for CD90, CD73, and CD105 and 15‐20% negative for CD45; based upon the expression of these cell surface
antigens, it was determined that the cell cultures were populated with 80‐85% mesenchymal stromal cells. Antibodies against GABAA‐α1, GABAAB‐
2, GABR‐R1, and GABR‐R2 were also utilised, as shown in the key for the table, but no positive results were obtained.
Table 3.1: Raw data analysis obtained from FC for human scleral stromal cells.
Antibody CD31 CD34 CD44 CD45 CD73 CD90 CD105 GABAA‐α1 GABAAB‐2 GABR‐R1 GABR‐R2
1.06 1.97 98.7 20.6 99.3 94.7 99.3 0.11 0 0.00346 0
0.84 2.33 98.9 19.4 99.5 93.9 99.4 0.055 0.00219 0 0.00354
0.14 1.61 99.8 17.4 99.6 94.8 99.1 0.093 0.00416 0.00349 0
19 98.8 97.9 98.3 0.014 0.02 0.00407
0.27 0.4 98.4 15.9 99.6 98.6 99 0.014 0.01 0
0.18 0.26 98.6 15.7 99.3 98.5 98.9 0.01 0.00512 0.015
Mean 0.498 1.314 98.88 18 99.35 96.4 99 0.086 0.007392 0.007012 0.003768
SD 0.37791 0.934949 0.544977 1.98897 0.275379 2.154066 0.389872 0.02816 0.006104 0.006524 0.005812
Emily F. McDonald: GABA Receptors in Human Sclera
56
3.3 Analysis of GABA Receptor Gene Expression in Ocular Tissues and Cells: Experiment #3
3.3.1 RT‐PCR Amplification of GABA Receptors
Expression of the genes for several GABA receptor subunits were found in all layers of the
eye – sclera, choroid/RPE, and retina – and the mesenchymal stromal cells. Refer to Table 3.2
for the results and levels of amplification and Appendix 3 for pictures of all gels. Donors
6952 and 6953 presented positive results for GABAA Alpha 4 v1‐3 in all layers of the eye and
the mesenchymal stromal cells. Other genes observed throughout various layers and cells
were GABAA Beta 2 v1 & 2, GABAA Gamma 1, GABAA Gamma 2 v1‐3, GABAC Rho 1, and
GABAC Rho 2.
The molecular results from the three scleral donors revealed the presence of multiple GABA
receptor subtypes. All three donors demonstrated positive results for GABAA Beta 2 v1 & 2,
GABAA Gamma 1, GABAA Gamma 2 v1‐3, GABAC Rho 1, and GABAC Rho 2. Donor 6952
also produced positive results for GABAA Alpha 4 v1‐3 and GABAA Beta 3 v1‐4. Donor 6953
yielded the same results as Donor 6952. Donor 6954 provided positive results for GABAA
Alpha 6 and GABAA Pi as well as the five subtypes mentioned above.
The most variety in the expression of GABA receptor subunits was observed for the scleral‐
derived mesenchymal stromal cells. Donor 6952 yielded positive results for 16 subunits out
of a possible 21 and donor 6953 produced positive results for 13. Both tested positive for
GABAA Alpha 1 v1‐7, GABAA Alpha 4 v1‐3, GABAA Beta 1, GABAA Beta 2 v1 & 2, GABAA
Beta 3 v1‐4, GABAA Gamma 1, GABAA Gamma 2 v1‐3, GABAA Epsilon, GABAA Theta,
GABAA Pi, GABAB R1, and GABAC Rho 2. Donor 6952 also tested positive for GABAA Alpha
5 v1 & 2, GABAA Gamma 3, GABAB R2, and GABAC Rho 1. In addition to the shared
subunits with donor 6952, donor 6953 tested positive for GABAA Alpha 6.
The only GABA receptor subunit present in choroid/RPE tissues taken from donor 6952
appeared to be GABAA Alpha 4 v1‐3. GABAA Alpha 4 v1‐3 was also present in 6953; other
subtypes expressed in this donor included GABAA Beta 2 v1 & 2, GABAA Gamma 1, GABAA
Pi, GABAC Rho 1, and GABAC Rho 2.
In terms of the retinal analysis, both donors yielded positive results for GABAA Alpha 4 v1‐3,
GABAA Beta 2 v1 & 2, GABAA Gamma 2 v1‐3, GABAA Pi, GABAC Rho 1, and GABAC Rho 2.
Emily F. McDonald: GABA Receptors in Human Sclera
57
In addition, donor 6953 tested positive for GABAA Gamma 1, GABAA Gamma 3, and GABAB
R2.
We experienced unresolvable issues with contamination of housekeeping genes despite
replacing all stock used during reverse‐transcription and RT‐PCR, trialling communal
housekeeping gene primer stock – such as beta‐2‐microglobulin, 18s rRNA, and PBGD, and
reordering another batch of GAPDH forward and reverse primers.
To confirm that the RT‐PCR products amplified using the specific primer pairs were in fact
the target gene, RT‐PCR products corresponding to each individual amplification reaction
were sequenced. This confirmed the specificity of the RT‐PCR products to their intended
gene target sequence and validates the results of the RT‐PCR GABA gene expression profiles
determined for each of the donor tissue and cell samples. The sequences, and their matched
sequence from the Genbank database, are shown in Appendix 4.
Emily F. McDonald: GABA Receptors in Human Sclera
58
Table 3.2: The results for each of the GABA receptor subunit genes as demonstrated by RT‐PCR. Refer below for a key showing the colour shades
representing the level of amplification of each gene.
Tissue/Cells: Donor GABA A
ALPHA 1 V1‐V7
GABA A
ALPHA 2 V1 & V2
GABA A
ALPHA 3
GABA A
ALPHA 4 V1‐V3
GABA A
ALPHA 5 V1 & V2
GABA A
ALPHA 6
GABA A
BETA 1
GABA A
BETA 2 V1 & V2
GABA A
BETA 3 V1‐V4
GABA A
GAMMA 1
Sclera: 6952
Sclera: 6953
Sclera: 6954
Mesenchymal Stromal Cells: 6952
Mesenchymal Stromal Cells: 6953
Choroid/RPE: 6952
Choroid/RPE: 6953
Retina: 6952
Retina: 6953
Weak Intermediate Strong
Emily F. McDonald: GABA Receptors in Human Sclera
59
Tissue/Cells: Donor GABA A
GAMMA 2 V1‐V3
GABA A
GAMMA 3
GABA A
EPSILON
GABA A
DELTA
GABA A
THETA
GABA A
PI
GABA B
R1
GABA B
R2
GABA
RHO 1
GABA
RHO 2
GABA
RHO 3
Sclera: 6952
Sclera: 6953
Sclera: 6954
Mesenchymal Stromal Cells: 6952
Mesenchymal Stromal Cells: 6953
Choroid/RPE: 6952
Choroid/RPE: 6953
Retina: 6952
Retina: 6953
Weak Intermediate Strong
Emily F. McDonald: GABA Receptors in Human Sclera
60
4 discussion
4.1 Summary of Findings
The major question to be answered by this research project was: “Are GABA receptors
present in human scleral tissue?” We predicted there would be GABA receptors present,
most likely GABAC Rho 1, based on a recent animal study which found GABAC Rho 1
present in chick sclera (Cheng et al., 2011); note: other receptor subtypes were not studied.
The three scleral donors yielded positive gene expression results for GABAA and GABAC
receptor subunits using RT‐PCR. Of interest to this project was the fact that GABA
receptors, including GABAA Alpha 1 and GABAC Rho 1, have been found to be present in the
human retina (Davanger et al., 1991, Crooks and Kolb, 1992, Vardi and Sterling, 1994, Gussin
et al., 2011). As we collected the scleral tissue in the form of eye cups and therefore had
access to the tissue, we also investigated the presence of GABA receptors in the choroid/RPE
and retina, as well. The choroid/RPE and retinal samples yielded positive results for GABAA
and GABAC and one of the retinal donors was positive for GABAB. In addition to the above,
human scleral cells were cultured and tested for the presence of GABA receptors. The scleral
cells were positive for GABAA, GABAB, and GABAC. Immunophenotyping of these cultures
indicated a cell surface expression profile similar to that displayed by mesenchymal stromal
cells grown from other human tissue, including the corneal limbus (Bray et al., 2012). It is
currently known (based on evidence from animal studies) that the inhibitory
neurotransmitter GABA influences eye growth and, accordingly, refractive development
(Stone et al., 2003, Leung et al., 2005, Chebib et al., 2009b). Therefore, the discovery of GABA
receptor mRNA, mainly GABAA and GABAC, in different layers of the human eye has
important implications for future research in the field of refractive errors.
4.2 Limitations of Immunohistochemistry
The IHC component of the project revealed good evidence of GABA receptor expression in
one donor; however, this could not be repeated in two other donors and the requirement for
melanin bleach further complicated the clarity of results. Although the results for IHC were
variable, it is important to note that the positive results for the SMA antibody might suggest
the lack of immunoreactivity is associated only with the GABA antibody‐antigen interactions
(in the case that there is expression and that the lack of immunoreactivity is not simply a lack
Emily F. McDonald: GABA Receptors in Human Sclera
61
of expression). A possible explanation for the variable GABA results could be related to
uncontrollable differences in the time between donor death and when the tissue was
retrieved and/or ultimately placed in fixative. Another variable is due to the time the tissue
spends in storage before being fixed and, in turn, the quality of the tissue. Furthermore,
better results may have been obtained if frozen eye sections were available – not just
formalin‐fixed – or if the IHC had been performed on cultured scleral cells. Formalin
fixation cross‐links proteins and can hinder the antibodies from gaining entry to binding
sites. However, despite the fact that frozen eye sections would circumvent this problem, the
morphology of the tissue is generally not as high quality. We would recommend future
studies utilise epitope, or antigen, retrieval techniques that would reduce cross‐linking and
improve binding of antibodies. Further studies utilising a larger number of tissue samples
and different staining techniques (e.g., use of different immunoperoxidase chromagen not
requiring melanin bleach, such as Fast Red) should hopefully resolve this issue. Given the
present time restrictions, however, it was deemed necessary to shift the focus of the project
from a histological approach to a gene expression approach.
4.3 Polymerase Chain Reaction Methodological Issues
Utilising RT‐PCR, all 21 genes for the GABA receptor subunits were tested in a minimum of
two donors (n=3 for scleral tissue). GABA gene expression was found to be present in all
layers of the eye – sclera, choroid/RPE, and retina – and was found to be present in cultured
scleral‐derived mesenchymal stromal cells, as well. Whilst the RT‐PCR component yielded
results and the IHC component proved variable, it is important to note that it is easier to
optimise an RT‐PCR method as the primers are designed to be very specific to the target.
IHC is reliant on interactions between proteins – the antibody, the target, and the
environment of the experiment; salt, pH, temperature, and other factors can affect the
affinity of the antibody for the GABA receptor protein in the tissue. In addition, the
processing of the tissue itself can sometimes mask, or hide, the epitopes that the antibody
recognises.
4.4 GABA Receptors in Sclera
GABAA (5/16 possible GABAA receptor subunits for all three donors) and GABAC (2/3
GABAC receptor subunits for all three donors) receptor subunits were found to be present in
the three scleral donors. Donors 6952, 6953, and 6954 returned positive results for GABAA
Emily F. McDonald: GABA Receptors in Human Sclera
62
and GABAC receptor subunits (no positive results were observed in any donor for GABAB
receptor subunits). To our knowledge, no one has demonstrated the presence of GABA
receptors in scleral tissue excepting one study demonstrating the presence of GABAC Rho 1
receptors in chick sclera (Cheng et al., 2011). As mentioned previously, another study found
expression of GABARAP, a gene associated with GABAA, in the human sclera (Young et al.,
2003). The majority of GABA receptor subunits were observed in the scleral‐derived
mesenchymal stromal cells. Between the two donors, only four out of the twenty‐one GABA
receptor subunits analysed were not expressed.
4.5 GABA Receptors in Retinal Pigment Epithelium & Choroid
Of particular note to this project, GABAA and GABAB receptor signalling pathways were
recently discovered in the RPE (Booij et al., 2010). The GABAA finding is consistent with our
results for the choroid/RPE samples obtained from both donors analysed as receptor
subunit(s) for GABAA were found to be present. It has been previously thought that the RPE
may have a role in clearing GABA from the subretinal space (species analysed: Rana
Catesbeiana) (Peterson and Miller, 1995). Similarly, Booij et al., 2010 have also suggested that
the GABA receptor signalling pathway in human RPE may function to uptake GABA from
the subretinal space (Booij et al., 2010). We did not find GABAB present in choroid/RPE from
either donor.
4.6 GABA Receptors in Retina
We noted the presence of several GABA receptor subunits in both donors. Some of our
results – GABAC Rho 1 and GABAC Rho 2 – from both retinal donors were consistent with
published literature (Gussin et al., 2011, Hackam et al., 1997, Wang et al., 1994) and one
previous finding (Vardi and Sterling, 1994) – GABAA Alpha 1 – was not observed in this
study. In addition, previously unpublished positive results – GABAA Alpha 4 v1‐3, GABAA
Beta 2 v1 & 2, GABAA Gamma 1, GABAA Gamma 2 v1‐3, GABAA Gamma 3, GABAA Pi, and
GABAB R2 – for both donors were also observed. Two studies (Gussin et al., 2011, Hackam
et al., 1997) have demonstrated positive findings for GABAC Rho 1 in human retinal tissue;
we also found this receptor subtype present in both of our donors. GABAC Rho 2 has been
shown previously to be present in human retinal tissue (Hackam et al., 1997, Wang et al.,
1994); we observed positive results for this receptor subtype in our donors. However, a
previous study (Vardi and Sterling, 1994) also reported a positive result for the GABAA
Emily F. McDonald: GABA Receptors in Human Sclera
63
Alpha 1 receptor subtype in the plexiform layers and many amacrine and ganglion cell
somas in the inner nuclear layer and ganglion cell layer using tissue obtained from human
retina. We did not observe positive results for this receptor subtype in either of our two
donors (as product for GABAA Alpha 1 was found to be expressed in the mesenchymal
stromal cells, it would be assumed that the primer worked and the gene was not expressed
in the retinal samples). As well as the positive results for the two receptor subtypes
mentioned above – GABAC Rho 1 and GABAC Rho 2 – we also observed positive findings for
GABAA Alpha 4 v1‐3, GABAA Beta 2 v1 & 2, GABAA Gamma 2 v1‐3, and GABAA Pi for both
donors. Donor 6953 also demonstrated positive results for GABAA Gamma 1, GABAA
Gamma 3, and GABAB R2.
4.7 Limitations of Flow Cytometry
The FC results using GABA antibodies were inconclusive. The antibodies used for FC
correlated with positive results from the RT‐PCR for both donors; the only exception was for
the receptor GABAB R2 in donor 6953. Inconclusive, perhaps negative, results may have
been due to the processes involved in FC; if the receptors are present on the surface of the
cell, the cell surface proteins may have been cleaved and, in the process, the GABA receptors
were lost. For example, as we used trypsin during the course of FC, we may have degraded
surface antigens (and possibly intracellular antigens). Another possibility is that the
receptors are present internally and FC is not the best method to characterise these receptors.
Furthermore, a lack of results for FC may be due to cell culturing conditions not being ideal
for preserving the GABA receptors.
4.8 Relevance to Myopia
As mentioned previously, GABAC‐selective antagonists have proven to be more potent than
either GABAA‐ or GABAB‐selective antagonists in inhibiting ocular growth (Stone et al., 2003,
Chebib et al., 2009a, Chebib et al., 2009b). Our finding is of significant interest to these
previous studies as we found GABAC to be present in each of the layers – sclera,
choroid/RPE, and retina (excluding only the choroid/RPE layer of donor 6952) – of both
donors’ eyes, as well as being present in the mesenchymal stromal cells. Also of
pharmacological interest is the fact that topirimate, an anticonvulsant and GABAA agonist,
has been associated with myopia as a notable side effect (Zilliox and Russell, 2011, Craig et
al., 2004, Verrotti et al., 2007, Bhattacharyya and Basu, 2005).
Emily F. McDonald: GABA Receptors in Human Sclera
64
4.9 Limitations
Perhaps the most obvious limitation of this study was the use of cadaveric tissue; the study
was limited to studying a post‐mortem endpoint rather than being able to examine the sclera
(and other tissues) during the course of onset and development of myopia – unlike animal
studies. It must be noted that one major limitation of animal studies are that form‐
deprivation myopia and lens‐induced myopia may involve different mechanisms to those
involved in the myopia onset and development observed in humans. However, animal
studies are very useful as they can inform and thus guide human‐based work. In many
instances, pathways are conserved across species. It is clear that there are pros and cons to
both approaches of research.
As part of the post‐mortem processes, the tissue must undergo serological testing before it
can be released. The delay for results can be as long as two to three days and, during this
period of time, tissue, and definitely the RNA within the tissue, can be subject to degrading
and different storage conditions. A housekeeping gene – GAPDH – was used to confirm the
integrity of the RNA extracted from the tissues that was then used to make the cDNA
template for the RT‐PCR amplification of the GABA receptor sequences. We observed
strong expression of the housekeeping gene and, therefore, in accordance with the high RNA
yields observed, are confident that the tissue used was of a suitable quality.
As the donors ranged in ages from 61‐86 years, it is possible that the age of the donors
impacted on the quality of the tissue. Therefore, it is possible that different results may be
obtained from younger eyes. We would only be able to address this potential confounding
variable through future research.
As mentioned previously, we were not provided information about the donors’ eyes in terms
of the presence of ocular pathologies or refractive error. We can only speculate that the
presence of either a diseased state or refractive error may potentially influence the results. It
would be interesting to compare results obtained from emmetropic and myopic individuals
in future studies, if possible.
It would be recommended that future studies use a larger sample size. For this project, we
used two donors for choroidal/RPE, retinal and stromal cell samples; this simply served as a
Emily F. McDonald: GABA Receptors in Human Sclera
65
snapshot and provides preliminary data for future avenues of research.
4.10 Real World Implications
At a practical level, the discovery of GABAC receptor mRNA throughout all layers of the eye,
including the scleral‐derived mesenchymal stromal cells, is of particular relevance to
pharmacological studies that have demonstrated that GABAC receptor antagonists can
inhibit ocular growth. With the knowledge that mRNA for these receptors is present, it
supports the hypothesis that GABAC receptors are pharmacological targets in human sclera
for agents that may potentially inhibit, or at least slow, the progression of myopia based on
results from animal studies.
4.11 Future Directions
There are several questions – both from histological and gene expression perspectives –
arising from the current project. Firstly, it would be important to follow‐up the current
project with a protein detection and quantification technique, such as Western blot and
quantitative RT‐PCR. As we have deduced the presence of mRNA for targeted GABA
receptor subtypes, Western blot would allow detection of GABA receptor protein, if present.
We did not undertake quantification studies for this project for a few reasons. This was
preliminary work and therefore we were most interested in presence/absence. The RNA was
not of the best quality and so there was no real justification for real‐time PCR. However, this
study does justify collection of eye tissue under more appropriate conditions for RNA
extraction and, under those circumstances, a qualitative study would be worthwhile. It may
even be as simple as placing the eye in RNA Later Solution or even more ideal, dissecting the
tissue on immediate removal from the patient and snap freezing in liquid nitrogen.
The next big overarching questions to address would be: If GABA protein is present, what
could the functional purpose(s) of these receptors be and what is their localisation? GABA
receptors are known to play a key inhibitory role in the CNS and may be pharmacologically
targeted for improved outcomes for individuals with myopia; specific, key role(s) in the eye
itself are yet to be deduced. Given a lack of data regarding the significance of the expression
of the different receptor subtypes, interpretation is currently difficult and this is something
that could be addressed in future research. If the protein for these GABA receptors is indeed
present, it would be interesting to localise where the receptors are within the individual
Emily F. McDonald: GABA Receptors in Human Sclera
66
layers of the eye. Follow‐up work would include IHC and immunocytochemistry using
relevant antibodies. As mentioned above, given the similar colour of melanin granules
compared with IHC staining using DAB and the complications of melanin bleach, I would,
in future, elect to use a different IHC system incorporating use of the chromagen Fast Red,
which can be distinguished from melanin.
Another possible avenue of future research would be to determine whether the receptors are
up‐regulated or down‐regulated in myopic eyes as compared with emmetropic eyes. mRNA
for the receptors is present but a next question to address would be whether they are
functional or not and, if so, what their biological contribution to myopia might be. One way
this could be undertaken would be through determining the influence of GABA drugs on the
different tissues and cells in terms of morphology, proliferation, expression of ECM‐
remodelling enzymes, and production of ECM components. Furthermore, it would be
interesting to look into possible growth factors that may be affected by or regulated in the
presence of GABAergic receptor modulators, as recommended previously (Leung et al.,
2005).
Furthermore, it would be useful to deduce where a supply of GABA active substance, or
GABA neurotransmitter, would come from. As the retina contains GABAergic neurons, we
hypothesise that active substance would most likely be supplied from the retina to the other
layers of the eye, including the sclera. It is also important to note, however, that GABA has
been shown to be present in cerebral blood vessels; both GAD, the enzyme for GABA
synthesis, and GABA‐T, the catabolic enzyme for GABA, occur in cerebral blood vessels
(Imai et al., 1991). More specifically, 25‐50% of the GABA present in whole blood is found
within the plasma fraction and the rest is localised in formed elements (Ferkany et al., 1979).
Therefore, an active supply may be present in the choroidal circulation. Finally, it would be
interesting to determine if these GABA receptors are involved in other ocular functions,
aside from potential involvement in eye growth regulation.
Finally, it would be necessary to consider what the implication(s) would be for a therapeutic
aimed at minimising proprioceptive control of scleral growth and the potential impact on
IOP. One rat study (Samuels et al., 2012) found that the use of GABAA receptor antagonist,
bicuculline, microinjected into the dorsomedial and perfornical hypothalamus evoked a
Emily F. McDonald: GABA Receptors in Human Sclera
67
substantial increase in IOP. It would be important to undertake further pharmacological
research in this area.
4.12 Conclusion
In summary, it appears that expression of GABA receptors – mainly GABAA and GABAC – is
present, based on positive mRNA findings, throughout the different layers of the eye,
including the scleral layer and scleral‐derived mesenchymal stromal cells. The finding of
GABAC receptor mRNA is of particular note based on previous pharmacological studies
using animals that found that GABAC antagonists are capable of inhibiting ocular growth.
This study has provided novel, preliminary gene expression data that may contribute to an
understanding of the myopia signalling cascade and further exploration of the contribution
of GABA receptors in these tissues will, in due course, hopefully lead to effective
preventative strategies for myopic onset or treatments aimed at slowing (or inhibiting)
progression.
Emily F. McDonald: GABA Receptors in Human Sclera
68
REFERENCES/BIBLIOGRAPHY
ABBOTT, C. J., GRÜNERT, U., PIANTA, M. J. & MCBRIEN, N. A. 2011. Retinal thinning in
tree shrews with induced high myopia: Optical coherence tomography and
histological assessment. Vision Research, 51, 376‐385.
AKK, G., COVEY, D. F., EVERS, A. S., STEINBACH, J. H., ZORUMSKI, C. F. &
MENNERICK, S. 2007. Mechanisms of neurosteroid interactions with GABAA
receptors. Pharmacology & Therapeutics, 116, 35‐57.
ALBRECHT, B. E. & DARLISON, M. G. 1995. Localization of the ρ1‐ and ρ2‐subunit
messenger RNAs in chick retina by in situ hybridization predicts the existence of γ‐
aminobutyric acid type C receptor subtypes. Neuroscience Letters, 189, 155‐158.
ALM, A. & BILL, A. 1973. Ocular and optic nerve blood flow at normal and increased
intraocular pressures in monkeys (Macaca irus): A study with radioactivity labelled
microspheres including flow determination in brain and some other tissues.
Experimental Eye Research, 15, 15‐29.
ALM, A. & BILL, A. 1987. Ocular circulation. In: MOSES, R. A. & HART, W. M. (eds.) Adlerʹs
Physiology of the Eye. St Louis, USA: Mosby Company.
ALM, A. & NILSSON, S. F. E. 2009. Uveoscleral outflow – A review. Experimental Eye
Research, 88, 760‐768.
ATCHISON, D. A., JONES, C. E., SCHMID, K. L., PRITCHARD, N., POPE, J. M.,
STRUGNELL, W. E. & RILEY, R. A. 2004. Eye shape in emmetropia and myopia.
Investigative Ophthalmology & Visual Science, 45, 3380‐3386.
ATCHISON, D. A. & SMITH, G. 2000. The human eye: An overview. Optics of the Human Eye.
Edinburgh: Butterworth‐Heinemann.
AYOUB, G. 2008. An organ of exquisite perfection. In: TOMBRAN‐TINK, J. &
BARNSTABLE, C. J. (eds.) Visual Transduction & Non‐Visual Light Perception. Totowa,
New Jersey: Humana Press.
BAEHR, W., WU, S. M., BIRD, A. C. & PALCZEWSKI, K. 2003. The retinoid cycle and retina
disease. Vision Research, 43, 2957‐2958.
BAGLOLE, C. J., RAY, D. M., BERNSTEIN, S. H., FELDON, S. E., SMITH, T. J., SIME, P. J. &
PHIPPS, R. P. 2006. More than structural cells, fibroblasts create and orchestrate the
tumor microenvironment. Immunological Investigations, 35, 297‐325.
BAIRD, P. N., SCHÄCHE, M. & DIRANI, M. 2010. The GEnes in Myopia (GEM) Study in
understanding the aetiology of refractive errors. Progress in Retinal and Eye Research,
29, 520‐542.
Emily F. McDonald: GABA Receptors in Human Sclera
69
BALTUSSEN, R., NAUS, J. & LIMBURG, H. 2009. Cost‐effectiveness of screening and
correcting refractive errors in school children in Africa, Asia, America and Europe.
Health Policy, 89, 201‐215.
BARATHI, V. & BEUERMAN, R. 2011. Molecular mechanisms of muscarinic receptors in
mouse scleral fibroblasts: Prior to and after induction of experimental myopia with
atropine treatment. Molecular Vision, 17, 680‐92.
BARATHI, V. A., BOOPATHI, V. G., YAP, E. P. H. & BEUERMAN, R. W. 2008. Two models
of experimental myopia in the mouse. Vision Research, 48, 904‐916.
BARATHI, V. A., WEON, S. R. & BEUERMAN, R. W. 2009. Expression of muscarinic
receptors in human and mouse sclera and their role in the regulation of scleral
fibroblasts proliferation. Molecular Vision, 15, 1277‐1293.
BARNARD, E. A., SKOLNICK, P., OLSEN, R. W., MOHLER, H., SIEGHART, W., BIGGIO,
G., BRAESTRUP, C., BATESON, A. N. & LANGER, S. Z. 1998. International Union of
Pharmacology. XV. Subtypes of γ‐aminobutyric acid A receptors: Classification on
the basis of subunit structure and receptor function. Pharmacological Reviews, 50, 291‐
314.
BARONI, T., BELLUCCI, C., LILLI, C., PEZZETTI, F., CARINCI, F., BECCHETTI, E.,
CARINCI, P., STABELLINI, G., CALVITTI, M., LUMARE, E. & BODO, M. 2006.
Retinoic acid, GABA‐ergic, and TGF‐β signaling systems are involved in human cleft
palate fibroblast phenotype. Molecular Medicine, 12, 237 ‐ 245.
BEN‐ARI, Y. 2002. Excitatory actions of GABA during development: The nature of the
nurture. Nature Reviews Neuroscience, 3, 728‐739.
BEN‐ARI, Y., GAIARSA, J.‐L., TYZIO, R. & KHAZIPOV, R. 2007. GABA: A pioneer
transmitter that excites immature neurons and generates primitive oscillations.
Physiological Reviews, 87, 1215‐1284.
BENAVENTE‐PEREZ, A. 2006. Understanding myopia. The Optician, 231, 16.
BENOIT DE COIGNAC, A., ELSON, G., DELNESTE, Y., MAGISTRELLI, G., JEANNIN, P.,
AUBRY, J.‐P., BERTHIER, O., SCHMITT, D., BONNEFOY, J.‐Y. & GAUCHAT, J.‐F.
2000. Cloning of MMP‐26. European Journal of Biochemistry, 267, 3323‐3329.
BESCH, D., JÄGLE, H., SCHOLL, H. P. N., SEELIGER, M. W. & ZRENNER, E. 2003.
Inherited multifocal RPE‐diseases: Mechanisms for local dysfunction in global
retinoid cycle gene defects. Vision Research, 43, 3095‐3108.
BETTLER, B. & TIAO, J. Y.‐H. 2006. Molecular diversity, trafficking and subcellular
localization of GABAB receptors. Pharmacology & Therapeutics, 110, 533‐543.
BHATTACHARYYA, K. & BASU, S. 2005. Acute myopia induced by Topiramate: Report of a
case and review of the literature.
BLOOM, R. I., FRIEDMAN, I. B. & CHUCK, R. S. 2010. Increasing rates of myopia: The long
view. Current Opinion in Ophthalmology, 21, 247‐248.
Emily F. McDonald: GABA Receptors in Human Sclera
70
BOGDANOV, K. 2000. Optics of the eye. Biology in Physics. San Diego: Academic Press.
BOK, D. 1993. The retinal pigment epithelium: A versatile partner in vision. Journal of Cell
Science; Supplement, 17, 189.
BOOIJ, J. C., TEN BRINK, J. B., SWAGEMAKERS, S. M. A., VERKERK, A. J. M. H., ESSING,
A. H. W., VAN DER SPEK, P. J. & BERGEN, A. A. B. 2010. A new strategy to identify
and annotate human RPE‐specific gene expression. PLoS ONE, 5, e9341.
BORMANN, J. 2000. The `ABCʹ of GABA receptors. Trends in Pharmacological Sciences, 21, 16‐
19.
BORMANN, J. & FEIGENSPAN, A. 1995. GABAc receptors. Trends in Neurosciences, 18, 515‐
519.
BOUBRIAK, O. A., URBAN, J. P. G. & BRON, A. J. 2003. Differential effects of aging on
transport properties of anterior and posterior human sclera. Experimental Eye
Research, 76, 701‐713.
BOULTON, M. & DAYHAW‐BARKER, P. 2001. The role of the retinal pigment epithelium:
Topographical variation and ageing changes. Eye, 15, 384‐389.
BOWERY, N. 1989. GABAB receptors and their significance in mammalian pharmacology.
Trends in Pharmacological Sciences, 10, 401‐407.
BRAND, C., SCHAEFFEL, F. & FELDKAEMPER, M. P. 2007. A microarray analysis of retinal
transcripts that are controlled by image contrast in mice. Molecular Vision, 13, 920‐32.
BRAY, L. J., HEAZLEWOOD, C., ATKINSON, K., HUTMACHER, D. W. & HARKIN, D. G.
2012. Evaluation of methods for cultivating limbal mesenchymal stromal cells.
Cytotherapy, 14, 936‐47.
BROWN, C. T., VURAL, M., JOHNSON, M. & TRINKAUS‐RANDALL, V. 1994. Age‐related
changes of scleral hydration and sulfated glycosaminoglycans. Mechanisms of Ageing
and Development, 77, 97‐107.
BURNSTOCK, G. 2007. Purine and pyrimidine receptors. Cellular and Molecular Life Sciences,
64, 1471‐1483.
CANDY, T. R., WANG, J. & RAVIKUMAR, S. 2009. Retinal image quality and postnatal
visual experience during infancy. Optometry and vision science : official publication of the
American Academy of Optometry, 86, E556‐71.
CAUWE, B., VAN DEN STEEN, P. E. & OPDENAKKER, G. 2007. The biochemical,
biological, and pathological kaleidoscope of cell surface substrates processed by
matrix metalloproteinases. Critical Reviews in Biochemistry and Molecular Biology, 42,
113‐185.
CHANG, J. H., MCCLUSKEY, P. & WAKEFIELD, D. 2004. Expression of toll‐like receptor 4
and its associated lipopolysaccharide receptor complex by resident antigen‐
Emily F. McDonald: GABA Receptors in Human Sclera
71
presenting cells in the human uvea. Investigative Ophthalmology & Visual Science, 45,
1871‐1878.
CHAPMAN, S. A., AYAD, S., OʹDONOGHUE, E. & BONSHEK, R. E. 1998. Glycoproteins of
trabecular meshwork, cornea and sclera. Eye, 12, 440‐448.
CHARMAN, W. N. 2011. Keeping the world in focus: How might this be achieved?
Optometry & Vision Science, 88, 373‐376.
CHEBIB, M., GAVANDE, N., WONG, K., PARK, A., PREMOLI, I., MEWETT, K., ALLAN,
R., DUKE, R., JOHNSTON, G. R. & HANRAHAN, J. 2009a. Guanidino acids act as ρ1
GABAC receptor antagonists. Neurochemical Research, 34, 1704‐1711.
CHEBIB, M., HINTON, T., SCHMID, K. L., BRINKWORTH, D., QIAN, H., MATOS, S., KIM,
H.‐L., ABDEL‐HALIM, H., KUMAR, R. J., JOHNSTON, G. A. R. & HANRAHAN, J.
R. 2009b. Novel, potent, and selective GABAC antagonists inhibit myopia
development and facilitate learning and memory. Journal of Pharmacology and
Experimental Therapeutics, 328, 448‐457.
CHEN, J. C., SCHMID, K. L. & BROWN, B. 2003. The autonomic control of accommodation
and implications for human myopia development: A review. Ophthalmic and
Physiological Optics, 23, 401‐422.
CHEN, Y.‐P., HOCKING, P. M., WANG, L., POVAŽAY, B., PRASHAR, A., TO, C.‐H.,
ERICHSEN, J. T., FELDKAEMPER, M., HOFER, B., DREXLER, W., SCHAEFFEL, F. &
GUGGENHEIM, J. A. 2011. Selective breeding for susceptibility to myopia reveals a
gene–environment interaction. Investigative Ophthalmology & Visual Science, 52, 4003‐
4011.
CHEN, Y.‐P., PRASHAR, A., HOCKING, P. M., ERICHSEN, J. T., TO, C. H., SCHAEFFEL, F.
& GUGGENHEIM, J. A. 2010. Sex, eye size, and the rate of myopic eye growth due to
form deprivation in outbred white leghorn chickens. Investigative Ophthalmology &
Visual Science, 51, 651‐657.
CHENG, Z.‐Y., CHEBIB, M. & SCHMID, K. L. 2011. rho1 GABAc receptors are expressed in
fibrous and cartilaginous layers of chick sclera and located on sclera fibroblasts and
chondrocytes. Journal of Neurochemistry, 118, 281‐287.
CHENG, Z.‐Y., CHEBIB, M. & SCHMID, K. L. 2012. Identification of GABA receptors in
chick cornea. Molecular Vision, 18, 1107‐1114.
CHENG, Z.‐Y., WANG, X.‐P., SCHMID, K. L. & LIU, L. In Press. Identification of GABA
receptors in chick retinal pigment epithelium. Neuroscience Letters.
CHERUBINI, E. & STRATA, F. 1997. GABAC receptors: A novel receptor family with
unusual pharmacology. Physiology, 12, 136‐141.
CHOO, V. 2003. A look at slowing progression of myopia. The Lancet, 361, 1622‐1623.
Emily F. McDonald: GABA Receptors in Human Sclera
72
CLARK, I. M., SWINGLER, T. E., SAMPIERI, C. L. & EDWARDS, D. R. 2008. The regulation
of matrix metalloproteinases and their inhibitors. The International Journal of
Biochemistry & Cell Biology, 40, 1362‐1378.
COLLINS, M. J., BUEHREN, T. & ISKANDER, D. R. 2006. Retinal image quality, reading and
myopia. Vision Research, 46, 196‐215.
COLLISON, D. J., COLEMAN, R. A., JAMES, R. S., CAREY, J. & DUNCAN, G. 2000.
Characterization of muscarinic receptors in human lens cells by pharmacologic and
molecular techniques. Investigative Ophthalmology & Visual Science, 41, 2633‐2641.
CORDAIN, L., EATON, S. B., BRAND MILLER, J., LINDEBERG, S. & JENSEN, C. 2002. An
evolutionary analysis of the aetiology and pathogenesis of juvenile‐onset myopia.
Acta Ophthalmologica Scandinavica, 80, 125‐135.
CRAIG, J. E., ONG, T. J., LOUIS, D. L. & WELLS, J. M. 2004. Mechanism of Topiramate‐
induced acute‐onset myopia and angle closure glaucoma. American Journal of
Ophthalmology, 137, 193‐195.
CREWTHER, D. P. 2000. The role of photoreceptors in the control of refractive state. Progress
in Retinal and Eye Research, 19, 421‐457.
CROOKS, J. & KOLB, H. 1992. Localization of GABA, glycine, glutamate and tyrosine
hydroxylase in the human retina. The Journal of Comparative Neurology, 315, 287‐302.
CROSSON, C., DEBENEDETTO, R. & GIDDAY, J. 1994. Functional evidence for retinal
adenosine receptors, New York, NY, ETATS‐UNIS, Liebert.
CUI, D., TRIER, K., CHEN, X., ZENG, J., YANG, X., HU, J. & GE, J. 2008. Distribution of
adenosine receptors in human sclera fibroblasts. Molecular Vision, 14, 523‐529.
CUI, W., BRYANT, M. R., SWEET, P. M. & MCDONNELL, P. J. 2004. Changes in gene
expression in response to mechanical strain in human scleral fibroblasts. Experimental
Eye Research, 78, 275‐284.
DAVANGER, S., OTTERSEN, O. P. & STORM‐MATHISEN, J. 1991. Glutamate, GABA, and
glycine in the human retina: An immunocytochemical investigation. The Journal of
Comparative Neurology, 311, 483‐494.
DIETHER, S. & SCHAEFFEL, F. 1997. Local changes in eye growth induced by imposed local
refractive error despite active accommodation. Vision Research, 37, 659‐668.
DIETHER, S., SCHAEFFEL, F., LAMBROU, G. N., FRITSCH, C. & TRENDELENBURG, A.‐U.
2007. Effects of intravitreally and intraperitonally injected atropine on two types of
experimental myopia in chicken. Experimental Eye Research, 84, 266‐274.
DIRANI, M., SHEKAR, S. N. & BAIRD, P. N. 2008. Evidence of shared genes in refraction
and axial length: The Genes in Myopia (GEM) Twin Study. Investigative
Ophthalmology & Visual Science, 49, 4336‐4339.
Emily F. McDonald: GABA Receptors in Human Sclera
73
DOMINICI, M., LE, MUELLER, I., SLAPER‐CORTENBACH, I., MARINI, F., KRAUSE, D.,
DEANS, R., KEATING, A., PROCKOP, D. & HORWITZ, E. 2006. Minimal criteria for
defining multipotent mesenchymal stromal cells. The International Society for
Cellular Therapy position statement. Cytotherapy, 8, 315‐317.
DORNONVILLE DE LA COUR, M. 1993. Ion transport in the retinal pigment epithelium. A
study with double‐barrelled ion‐selective microelectrodes. Acta Ophthalmol Suppl, 1‐
32.
ELSHEIKH, A., GERAGHTY, B., ALHASSO, D., KNAPPETT, J., CAMPANELLI, M. &
RAMA, P. 2010. Regional variation in the biomechanical properties of the human
sclera. Experimental Eye Research, 90, 624‐633.
EMBERGER, W., WINDPASSINGER, C., PETEK, E., KROISEL, P. M. & WAGNER, K. 2000.
Assignment of the human GABAA receptor delta‐subunit gene (GABRD) to
chromosome band 1p36.3 distal to marker NIB1364 by radiation hybrid mapping.
Cytogenetic and Genome Research, 89, 281‐282.
ENNA, S. J. 2007. The GABA receptors. In: ENNA, S. J. & MÖHLER, H. (eds.) The GABA
Receptors. Humana Press.
ENZ, R. & CUTTING, G. R. 1999. GABAC receptor ρ subunits are heterogeneously expressed
in the human CNS and form homo‐ and heterooligomers with distinct physical
properties. European Journal of Neuroscience, 11, 41‐50.
FERKANY, J. W., BUTLER, I. J. & ENNA, S. J. 1979. Effect of drugs on rat brain,
cerebrospinal fluid and blood GABA content. Journal of Neurochemistry, 33, 29‐33.
FINNEMANN, S. C. 2003. Focal adhesion kinase signaling promotes phagocytosis of integrin‐bound
photoreceptors, London, Nature Publishing Group.
FISCHER, A. J., MCGUIRE, J. J., SCHAEFFEL, F. & STELL, W. K. 1999. Light‐ and focus‐
dependent expression of the transcription factor ZENK in the chick retina. Nature
Neuroscience, 2, 706‐712.
FISCHER, A. J., MCKINNON, L. A., NATHANSON, N. M. & STELL, W. K. 1998.
Identification and localization of muscarinic acetylcholine receptors in the ocular
tissues of the chick. The Journal of Comparative Neurology, 392, 273‐284.
FISCHER, A. J. & REH, T. A. 2003. Growth factors induce neurogenesis in the ciliary body.
Developmental Biology, 259, 225‐240.
FLITCROFT, D. I. 2012. The complex interactions of retinal, optical and environmental
factors in myopia aetiology. Progress in Retinal and Eye Research, 31, 622‐660.
FREDRICK, D. R. 2002. Myopia. British Medical Journal, 324, 1195‐1199.
FRITSCHY, J.‐M., SIDLER, C., PARPAN, F., GASSMANN, M., KAUPMANN, K., BETTLER,
B. & BENKE, D. 2004. Independent maturation of the GABAB receptor subunits
GABAB1 and GABAB2 during postnatal development in rodent brain. The Journal of
Comparative Neurology, 477, 235‐252.
Emily F. McDonald: GABA Receptors in Human Sclera
74
FROST, M. & NORTON, T. T. 2007. Differential protein expression in tree shrew sclera
during development of lens‐induced myopia and recovery. Molecular Vision, 13, 1580‐
1588.
FUKUCHI, T., UEDA, J., ABE, H. & SAWAGUCHI, S. 2001. Cell adhesion glycoproteins in
the human lamina cribrosa. Japanese Journal of Ophthalmology, 45, 363‐367.
FULLWOOD, N. J., MARTIN, F. L., BENTLEY, A. J., LEE, J. P. & LEE, S. J. 2011. Imaging
sclera with hard x‐ray microscopy. Micron, 42, 506‐511.
GABELT, B. T. & KAUFMAN, P. L. 1992. Inhibition of outflow facility and accommodative
and miotic responses to pilocarpine in rhesus monkeys by muscarinic receptor
subtype antagonists. Journal of Pharmacology and Experimental Therapeutics, 263, 1133‐
1139.
GAL, A., LI, Y.‐J., THOMPSON, D. A., WEIR, J., ORTH, U., JACOBSON, S., APFELSTEDT‐
SYLLA, E. & VOLLRATH, D. 2000. Mutations in MERTK, the human orthologue of
the RCS rat retinal dystrophy gene, causes retinitis pigmentosa. Nature Genetics, 26,
270‐271.
GANESAN, P. & WILDSOET, C. F. 2010. Pharmaceutical intervention for myopia control.
Expert Review of Ophthalmology, 5, 759‐787.
GENTLE, A., LIU, Y., MARTIN, J. E., CONTI, G. L. & MCBRIEN, N. A. 2003. Collagen gene
expression and the altered accumulation of scleral collagen during the development
of high myopia. Journal of Biological Chemistry, 278, 16587‐16594.
GIAMBERNARDI, T. A., SAKAGUCHI, A. Y., GLUHAK, J., PAVLIN, D., TROYER, D. A.,
DAS, G., RODECK, U. & KLEBE, R. J. 2001. Neutrophil collagenase (MMP‐8) is
expressed during early development in neural crest cells as well as in adult
melanoma cells. Matrix Biology, 20, 577‐587.
GIL, D. W., KRAUSS, H. A., BOGARDUS, A. M. & WOLDEMUSSIE, E. 1997. Muscarinic
receptor subtypes in human iris‐ciliary body measured by immunoprecipitation.
Investigative Ophthalmology & Visual Science, 38, 1434‐42.
GILMARTIN, B. 2004. Myopia: Precedents for research in the Twenty‐First Century. Clinical
& Experimental Ophthalmology, 32, 305‐324.
GÖHLICH, G., KUHN, W., HÖHN, H. & PRZUNTEK, H. 1984. Huntingtonʹs disease:
Biochemical prediction by determination of GABA synthesis of cultured fibroblasts.
Journal of Neurology, 231, 50‐51.
GOLDSCHMIDT, E. & JACOBSEN, N. 2014. Genetic and environmental effects on myopia
development and progression. Eye, 28, 126‐133.
GOLLENDER, M., THORN, F. & ERICKSON, P. 1979. Development of axial ocular
dimensions following eyelid suture in the cat. Vision Research, 19, 221‐223.
GOTTESMANN, C. 2002. GABA mechanisms and sleep. Neuroscience, 111, 231‐239.
Emily F. McDonald: GABA Receptors in Human Sclera
75
GOTTLIEB, M. D., JOSHI, H. B. & NICKLA, D. L. 1990. Scleral changes in chicks with form‐
deprivation myopia. Current Eye Research, 9, 1157‐1165.
GU, J. & IYER, V. R. 2006. PI3K signaling and miRNA expression during the response of
quiescent human fibroblasts to distinct proliferative stimuli. Genome Biology, 7, 1‐15.
GUPTA, N., DRANCE, S., MCALLISTER, R., PRASAD, S., ROOTMAN, J. & CYNADER, M.
1994. Localization of M3 muscarinic receptor subtype and mRNA in the human eye.
Ophthalmic Research, 26, 207‐13.
GUSSIN, H. A., KHASAWNEH, F. T., XIE, A., FENG, F., MEMIC, A., QIAN, H., LE
BRETON, G. C. & PEPPERBERG, D. R. 2011. Subunit‐specific polyclonal antibody
targeting human ρ1 GABAC receptor. Experimental Eye Research, 93, 59‐64.
GUYER, D. R., SCHACHAT, A. P. & GREEN, W. R. 2005. The choroid: Structural
considerations. In: RYAN, S. J., HINTON, D. R., SCHACHAT, A. P. & WILKINSON,
C. P. (eds.) Retina, 4th ed.
HACKAM, A. S., WANG, T.‐L., GUGGINO, W. B. & CUTTING, G. R. 1997. The N‐terminal
domain of human GABA receptor ρ1 subunits contains signals for homooligomeric
and heterooligomeric interaction. Journal of Biological Chemistry, 272, 13750‐13757.
HAMANN, S. 2002. Molecular mechanisms of water transport in the eye. International Review
of Cytology, 215, 395.
HAMMOND, C. J., ANDREW, T., TAT MAK, Y. & SPECTOR, T. D. 2004. A susceptibility
locus for myopia in the normal population is linked to the PAX6 gene region on
chromosome 11: A genomewide scan of dizygotic twins. The American Journal of
Human Genetics, 75, 294‐304.
HAN, D., KIM, H.‐Y., LEE, H.‐J., SHIM, I. & HAHM, D.‐H. 2007. Wound healing activity of
gamma‐aminobutyric acid (GABA) in rats. Journal of Microbiology and Biotechnology,
17, 1661‐1669.
HERING, H. & KRÖGER, S. 1996. Formation of synaptic specializations in the inner
plexiform layer of the developing chick retina. The Journal of Comparative Neurology,
375, 393‐405.
HODOS, W. & KUENZEL, W. J. 1984. Retinal‐image degradation produces ocular
enlargement in chicks. Investigative Ophthalmology and Visual Science, 25, 652‐659.
HORNBEAK, D. M. & YOUNG, T. L. 2009. Myopia genetics: A review of current research
and emerging trends. Current Opinion in Ophthalmology, 20, 356‐362
10.1097/ICU.0b013e32832f8040.
HOWLETT, M. & MCFADDEN, S. 2002. A fast and effective mammalian model to study the
visual regulation of eye growth. Investigative Ophthalmology & Visual Science, 43, 2928‐.
IHANAMÄKI, T., PELLINIEMI, L. J. & VUORIO, E. 2004. Collagens and collagen‐related
matrix components in the human and mouse eye. Progress in Retinal and Eye Research,
23, 403‐434.
Emily F. McDonald: GABA Receptors in Human Sclera
76
IMAI, H., OKUNO, T., WU, J. Y. & LEE, T. J. F. 1991. GABAergic innervation in cerebral
blood vessels: An immunohistochemical demonstration of l‐glutamic acid
decarboxylase and GABA transaminase. Journal of Cerebral Blood Flow & Metabolism,
11, 129‐134.
ISHIDA, K., PANJWANI, N., CAO, Z. & STREILEIN, J. W. 2003. Participation of pigment
epithelium in ocular immune privilege. 3. Epithelia cultured from iris, ciliary body,
and retina suppress T‐Cell activation by partially non‐overlapping mechanisms.
Pathology International, 11, 91‐105.
ITO, K., TANAKA, K., NISHIBE, Y., HASEGAWA, J. & UENO, H. 2007. GABA‐synthesizing
enzyme, GAD67, from dermal fibroblasts: Evidence for a new skin function.
Biochimica et Biophysica Acta (BBA) ‐ General Subjects, 1770, 291‐296.
JACOBI, F. K. & PUSCH, C. M. 2010. A decade in search of myopia genes. Frontiers in
Bioscience, 15, 359.
JESTER, J. V. & HO‐CHANG, J. 2003. Modulation of cultured corneal keratocyte phenotype
by growth factors/cytokines control in vitro contractility and extracellular matrix
contraction. Experimental Eye Research, 77, 581‐592.
JESTER, J. V., HUANG, J., MATTHEW PETROLL, W. & DWIGHT CAVANAGH, H. 2002.
TGFβ induced myofibroblast differentiation of rabbit keratocytes requires synergistic
TGFβ, PDGF and integrin signaling. Experimental Eye Research, 75, 645‐657.
JINREN, N. & SMITH III, E. L. 1989. Effects of chronic optical defocus on the kittenʹs
refractive status. Vision Research, 29, 929‐938.
JOBLING, A. I., GENTLE, A., METLAPALLY, R., MCGOWAN, B. J. & MCBRIEN, N. A.
2009. Regulation of scleral cell contraction by transforming growth factor‐β and
stress. Journal of Biological Chemistry, 284, 2072‐2079.
JOBLING, A. I., NGUYEN, M., GENTLE, A. & MCBRIEN, N. A. 2004. Isoform‐specific
changes in scleral transforming growth factor‐β expression and the regulation of
collagen synthesis during myopia progression. Journal of Biological Chemistry, 279,
18121‐18126.
JOHNSON, J. M., YOUNG, T. L. & SUMMERS RADA, J. A. 2006. Small leucine rich repeat
proteoglycans (SLRPs) in the human sclera: Identification of abundant levels of
PRELP. Molecular Vision, 12, 1057‐1066.
JOHNSTON, G. A. R. 1996. GABAC receptors: Relatively simple transmitter‐gated ion
channels? Trends in Pharmacological Sciences, 17, 319‐323.
JONES‐JORDAN, L. A., SINNOTT, L. T., MANNY, R. E., COTTER, S. A., KLEINSTEIN, R.
N., MUTTI, D. O., TWELKER, J. D., ZADNIK, K., ETHNICITY, T. C. L. E. O. &
GROUP, R. E. S. 2010. Early childhood refractive error and parental history of myopia
as predictors of myopia. Investigative Ophthalmology & Visual Science, 51, 115‐121.
JONES, B. E., THOMPSON, E. W., HODOS, W., WALDBILLIG, R. & CHADER, G. J. 1996.
Scleral matrix metalloproteinases, serine proteinase activity and hydrational capacity
Emily F. McDonald: GABA Receptors in Human Sclera
77
are increased in myopia induced by retinal image degradation. Experimental Eye
Research, 63, 369‐381.
JONES, L. A., SINNOTT, L. T., MUTTI, D. O., MITCHELL, G. L., MOESCHBERGER, M. L. &
ZADNIK, K. 2007. Parental history of myopia, sports and outdoor activities, and
future myopia. Investigative Ophthalmology & Visual Science, 48, 3524‐3532.
KANEDA, M., ANDRASFALVY, B. & KANEKO, A. 2000. Modulation by Zn2+ of GABA
responses in bipolar cells of the mouse retina. Visual Neuroscience, 17, 273‐281.
KANNO, H., HORIKAWA, Y., HODGES, R. R., ZOUKHRI, D., SHATOS, M. A., RIOS, J. D.
& DARTT, D. A. 2003. Cholinergic agonists transactivate EGFR and stimulate MAPK
to induce goblet cell secretion. American Journal of Physiology ‐ Cell Physiology, 284,
C988‐C998.
KASHIWAGI, Y., NISHITSUKA, K., NAMBA, H., KAMIRYO, M., TAKAMURA, H. &
YAMASHITA, H. 2010. Cloning and characterization of cell strains derived from
human corneal stroma and sclera. Japanese Journal of Ophthalmology, 54, 74‐80.
KAUFMAN, P. L. 1984. Mechanisms of action of cholinergic drugs in the eye. In: DRANCE,
S. & NEUFELD, A. H. (eds.) Glaucoma. Orlando: Grune and Stratton.
KHADER, Y., BATAYHA, W., ABDUL‐AZIZ, S. & AL‐SHIEKH‐KHALIL, M. 2006.
Prevalence and risk indicators of myopia among schoolchildren in Amman, Jordan.
Eastern Mediterranean Health Journal, 12, 434‐439.
KIEFER, A. K., TUNG, J. Y., DO, C. B., HINDS, D. A., MOUNTAIN, J. L., FRANCKE, U. &
ERIKSSON, N. 2013. Genome‐wide analysis points to roles for extracellular matrix
remodeling, the visual cycle, and neuronal development in myopia. PLoS Genet, 9,
e1003299.
KIILGAARD, J. F. & JENSEN, P. K. 2005. The choroid and optic nerve head. In: FISCHBARG,
J. (ed.) Advances in Organ Biology. Elsevier.
KLEINMAN, H. K., CANNON, F. B., LAURIE, G. W., HASSELL, J. R., AUMAILLEY, M.,
TERRANOVA, V. P., MARTIN, G. R. & DUBOIS‐DALCQ, M. 1985. Biological
activities of laminin. Journal of Cellular Biochemistry, 27, 317‐325.
KLEINMAN, H. K., KLEBE, R. J. & MARTIN, G. R. 1981. Role of collagenous matrices in the
adhesion and growth of cells. The Journal of Cell Biology, 88, 473‐485.
KLEINSTEIN, R. N., JONES, L. A., HULLETT, S., KWON, S., LEE, R. J., FRIEDMAN, N. E.,
MANNY, R. E., MUTTI, D. O., YU, J. A. & ZADNIK, K. 2003. Refractive error and
ethnicity in children. Archives of Ophthalmology, 121, 1141‐1147.
KNUDSON, C. B. & KNUDSON, W. 1993. Hyaluronan‐binding proteins in development,
tissue homeostasis, and disease. The FASEB Journal, 7, 1233‐41.
KROGSGAARD‐LARSEN, P., FRLUND, B., KRISTIANSEN, U., FRYDENVANG, K. &
EBERT, B. 1997. GABAA and GABAB receptor agonists, partial agonists, antagonists
Emily F. McDonald: GABA Receptors in Human Sclera
78
and modulators: design and therapeutic prospects. European Journal of Pharmaceutical
Sciences, 5, 355‐384.
KUMAR, R. J., CHEBIB, M., HIBBS, D. E., KIM, H.‐L., JOHNSTON, G. A. R., SALAM, N. K.
& HANRAHAN, J. R. 2008. Novel γ‐aminobutyric acid p[1] receptor antagonists;
Synthesis, pharmacological activity and structure‐activity relationships, Columbus, OH,
ETATS‐UNIS, American Chemical Society.
KUSAKARI, T., SATO, T. & TOKORO, T. 1997. Regional scleral changes in form‐deprivation
myopia in chicks. Experimental Eye Research, 64, 465‐476.
LAURENT, T. C. & FRASER, J. R. 1992. Hyaluronan. The FASEB Journal, 6, 2397‐404.
LEO, S.‐W. & YOUNG, T. L. 2011. An evidence‐based update on myopia and interventions to
retard its progression. Journal of American Association for Pediatric Ophthalmology and
Strabismus, 15, 181‐189.
LEUNG, C. K. S., YEUNG, C. K., CHIANG, S. W. Y., CHAN, K. P., PANG, C. P. & LAM, D.
S. C. 2005. GABAA and GABAC (GABAA0r) receptors affect ocular growth and form‐
deprivation myopia. Cutaneous and Ocular Toxicology, 24, 187‐196.
LIANG, C.‐L., YEN, E., SU, J.‐Y., LIU, C., CHANG, T.‐Y., PARK, N., WU, M.‐J., LEE, S.,
FLYNN, J. T. & JUO, S.‐H. H. 2004. Impact of family history of high myopia on level
and onset of myopia. Investigative Ophthalmology & Visual Science, 45, 3446‐3452.
LIN, H.‐J., WAN, L., TSAI, Y., CHEN, W.‐C., TSAI, S.‐W. & TSAI, F.‐J. 2009. Muscarinic
acetylcholine receptor 1 gene polymorphisms associated with high myopia. Molecular
Vision, 15, 1774‐1780.
LIND, G. J. & CAVANAGH, H. D. 1995. Identification and subcellular distribution of
muscarinic acetylcholine receptor‐related proteins in rabbit corneal and chinese
hamster ovary cells. Investigative Ophthalmology & Visual Science, 36, 1492‐507.
LOUGHEED, T. 2014. Myopia. Environmental Health Perspectives, 122, A12‐9.
LUFT, W. A., MING, Y. & STELL, W. K. 2003. Variable effects of previously untested
muscarinic receptor antagonists on experimental myopia. Investigative Ophthalmology
& Visual Science, 44, 1330‐1338.
LUKASIEWICZ, P. D. & SHIELDS, C. R. 1998. A diversity of GABA receptors in the retina.
Seminars in Cell & Developmental Biology, 9, 293‐299.
LUNDSTRÖM, L., MIRA‐AGUDELO, A. & ARTAL, P. 2009. Peripheral optical errors and
their change with accommodation differ between emmetropic and myopic eyes.
Journal of Vision, 9.
LYHNE, N., SJØLIE, A. K., KYVIK, K. O. & GREEN, A. 2001. The importance of genes and
environment for ocular refraction and its determiners: A population‐based study
among 20–45 year‐old twins. British Journal of Ophthalmology, 85, 1470‐1476.
Emily F. McDonald: GABA Receptors in Human Sclera
79
MACDONALD, R. L., KANG, J.‐Q., GALLAGHER, M. J. & FENG, H.‐J. 2007. GABAA‐
receptor mutations associated with idiopathic generalized epilepsies and febrile
seizures. In: ENNA, S. J. & MÖHLER, H. (eds.) The GABA Receptors. Humana Press.
MAJAVA, M., BISHOP, P. N., HÄGG, P., SCOTT, P. G., RICE, A., INGLEHEARN, C.,
HAMMOND, C. J., SPECTOR, T. D., ALA‐KOKKO, L. & MÄNNIKKÖ, M. 2007.
Novel mutations in the small leucine‐rich repeat protein/proteoglycan (SLRP) genes
in high myopia. Human Mutation, 28, 336‐344.
MARMOR, M. 1999. Mechanisms of fluid accumulation in retinal edema. Documenta
Ophthalmologica, 97, 239.
MASSEY, S. C. 2005. Functional anatomy of the mammalian retina. In: RYAN, S. J.,
HINTON, D. R., SCHACHAT, A. P. & WILKINSON, C. P. (eds.) Retina, 4th ed.
MATHUR, A., ATCHISON, D. A. & CHARMAN, W. N. 2009. Myopia and peripheral ocular
aberrations. Journal of Vision, 9.
MATTHIESEN, S., BAHULAYAN, A., KEMPKENS, S., HAAG, S., FUHRMANN, M.,
STICHNOTE, C., JUERGENS, U. R. & RACKÉ, K. 2006. Muscarinic receptors mediate
stimulation of human lung fibroblast proliferation. American Journal of Respiratory Cell
and Molecular Biology, 35, 621‐627.
MAZA, M. S. D. L., TAUBER, J. & FOSTER, C. S. 2012. Structural considerations of the sclera.
The Sclera. Springer Science + Business Media, LLC.
MCBRIEN, N. A., CORNELL, L. M. & GENTLE, A. 2001a. Structural and ultrastructural
changes to the sclera in a mammalian model of high myopia. Investigative
Ophthalmology & Visual Science, 42, 2179‐2187.
MCBRIEN, N. A., COTTRIAL, C. L. & ANNIES, R. 2001b. Retinal acetylcholine content in
normal and myopic eyes: A role in ocular growth control? Visual Neuroscience, 18, 571‐
580.
MCBRIEN, N. A. & GENTLE, A. 2003. Role of the sclera in the development and
pathological complications of myopia. Progress in Retinal and Eye Research, 22, 307‐338.
MCBRIEN, N. A., JOBLING, A. I. & GENTLE, A. 2009. Biomechanics of the sclera in myopia:
Extracellular and cellular factors. Optometry & Vision Science, 86, E23‐E30
10.1097/OPX.0b013e3181940669.
MCBRIEN, N. A., LAWLOR, P. & GENTLE, A. 2000. Scleral remodeling during the
development of and recovery from axial myopia in the tree shrew. Investigative
Ophthalmology & Visual Science, 41, 3713‐3719.
MCBRIEN, N. A., METLAPALLY, R., JOBLING, A. I. & GENTLE, A. 2006. Expression of
collagen‐binding integrin receptors in the mammalian sclera and their regulation
during the development of myopia. Investigative Ophthalmology & Visual Science, 47,
4674‐4682.
Emily F. McDonald: GABA Receptors in Human Sclera
80
MCBRIEN, N. A., MOGHADDAM, H. O., NEW, R. & WILLIAMS, L. R. 1993. Experimental
myopia in a diurnal mammal (Sciurus carolinensis) with no accommodative ability.
The Journal of Physiology, 469, 427‐441.
MCCLUSKEY, P. (ed.) 2001. Scleritis, London: BMJ Books.
MCEWAN, P. A., SCOTT, P. G., BISHOP, P. N. & BELLA, J. 2006. Structural correlations in
the family of small leucine‐rich repeat proteins and proteoglycans. Journal of
Structural Biology, 155, 294‐305.
MEDZHITOV, R., PRESTON‐HURLBURT, P. & JANEWAY, C. A. 1997. A human
homologue of the drosophila toll protein signals activation of adaptive immunity.
Nature, 388, 394‐397.
MEEK, K. M. & FULLWOOD, N. J. 2001. Corneal and scleral collagens‐‐A microscopistʹs
perspective. Micron, 32, 261‐272.
MENG, W., BUTTERWORTH, J., MALECAZE, F. & CALVAS, P. 2011. Axial length of
myopia: A review of current research. Ophthalmologica, 225, 127‐134.
METLAPALLY, S. & MCBRIEN, N. A. 2008. The effect of positive lens defocus on ocular
growth and emmetropization in the tree shrew. Journal of Vision, 8.
MILLER, S. S. & EDELMAN, J. L. 1990. Active ion transport pathways in the bovine retinal
pigment epithelium. The Journal of Physiology, 424, 283‐300.
MITRA, A. K., ANAND, B. S. & DUVVURI, S. 2005. Drug delivery to the eye. In:
FISCHBARG, J. (ed.) Advances in Organ Biology. Elsevier.
MOMOSE, M., OTA, H. & HAYAMA, M. 2011. Re‐evaluation of melanin bleaching using
warm diluted hydrogen peroxide for histopathological analysis. Pathology
International, 61, 345‐350.
MORENO, M., MUNOZ, R., AROCA, F., LABARACA, M., BRANDAN, E. & LARRAIN, J.
2005. Biglycan is a new extracellular component of the chordin‐BMP4 signaling
pathway. The EMBO Journal, 24, 1397‐1405.
MORGAN, I. G. 2003. The biological basis of myopic refractive error. Clinical and
Experimental Optometry, 86, 276‐288.
MORING, A. G., BAKER, J. R. & NORTON, T. T. 2007. Modulation of glycosaminoglycan
levels in tree shrew sclera during lens‐induced myopia development and recovery.
Investigative Ophthalmology & Visual Science, 48, 2947‐2956.
MOSES, R. A., GRODZKI, W. J., STARCHER, B. C. & GALIONE, M. J. 1978. Elastin content
of the scleral spur, trabecular mesh, and sclera. Investigative Ophthalmology & Visual
Science, 17, 817‐8.
MUTNEJA, M., BERTON, F., SUEN, K.‐F., LÜSCHER, C. & SLESINGER, P. A. 2005.
Endogenous RGS proteins enhance acute desensitization of GABAB receptor‐
Emily F. McDonald: GABA Receptors in Human Sclera
81
activated GIRK currents in HEK‐293T cells. Pflügers Archiv European Journal of
Physiology, 450, 61‐73.
MUTTI, D. O., HAYES, J. R., MITCHELL, G. L., JONES, L. A., MOESCHBERGER, M. L.,
COTTER, S. A., KLEINSTEIN, R. N., MANNY, R. E., TWELKER, J. D. & ZADNIK, K.
2007. Refractive error, axial length, and relative peripheral refractive error before and
after the onset of myopia. Investigative Ophthalmology & Visual Science, 48, 2510‐2519.
MUTTI, D. O. & MARKS, A. R. 2011. Blood levels of vitamin D in teens and young adults
with myopia. Optometry & Vision Science, 88, 377‐382.
NAGAI, Y., AKASHI, S., NAGAFUKU, M., OGATA, M., IWAKURA, Y., AKIRA, S.,
KITAMURA, T., KOSUGI, A., KIMOTO, M. & MIYAKE, K. 2002. Essential role of
MD‐2 in LPS responsiveness and TLR4 distribution. Nat Immunol, 3, 667‐672.
NARUMIYA, S., SUGIMOTO, Y. & USHIKUBI, F. 1999. Prostanoid receptors: Structures,
properties, and functions. Physiological Reviews, 79, 1193‐1226.
NG, C., KIM, H., GAVANDE, N., YAMAMOTO, I., KUMAR, R., MEWETT, K., JOHNSTON,
G., HANRAHAN, J. & CHEBIB, M. 2011. Medicinal chemistry of ρ GABAC receptors.
Future Medicinal Chemistry, 3, 197‐209.
NGUYEN‐LEGROS, J., VERSAUX‐BOTTERI, C. & SAVY, C. 1997. Dopaminergic and
GABAergic retinal cell populations in mammals. Microscopy Research and Technique,
36, 26‐42.
NICKLA, D. 2006. The phase relationships between the diurnal rhythms in axial length and
choroidal thickness and the association with ocular growth rate in chicks. Journal of
Comparative Physiology A, 192, 399‐407.
NICKLA, D. L. & WALLMAN, J. 2010. The multifunctional choroid. Progress in Retinal and
Eye Research, 29, 144‐168.
NICKLA, D. L., WILDSOET, C. & WALLMAN, J. 1998. Visual influences on diurnal rhythms
in ocular length and choroidal thickness in chick eyes. Experimental Eye Research, 66,
163‐181.
NORTON, T. T., ESSINGER, J. A. & MCBRIEN, N. A. 1994. Lid‐suture myopia in tree shrews
with retinal ganglion cell blockade. Visual Neuroscience, 11, 143‐153.
OLSEN, R. W. & BETZ, H. 2006. Energy metabolism of the brain. In: SIEGEL, G.,
AGRANOFF, B., ALBERS, R. & FISHER, S. (eds.) Basic Neurochemistry: Molecular,
Cellular, and Medical Aspects. 7th Edition ed. Philadelphia: Lippincott‐Raven.
ORCHARD, G. E. & CALONJE, E. 1998. The effect of melanin bleaching on
immunohistochemical staining in heavily pigmented melanocytic neoplasms. The
American Journal of Dermatopathology, 20, 357‐361.
PAGET, S., JULIA, S., VITEZICA, Z., SOLER, V., MALECAZE, F. & CALVAS, P. 2008.
Linkage analysis of high myopia susceptibility locus in 26 families. Molecular Vision,
14, 2566‐2574.
Emily F. McDonald: GABA Receptors in Human Sclera
82
PALURU, P. C., SCAVELLO, G. S., GANTER, W. R. & YOUNG, T. L. 2004. Exclusion of
lumican and fibromodulin as candidate genes in MYP3 linked high grade myopia.
Molecular Vision, 10, 917‐922.
PAN, C.‐W., RAMAMURTHY, D. & SAW, S.‐M. 2012. Worldwide prevalence and risk
factors for myopia. Ophthalmic and Physiological Optics, 32, 3‐16.
PAPASTERGIOU, G. I., SCHMID, G. F., RIVA, C. E., MENDEL, M. J., STONE, R. A. &
LATIES, A. M. 1998. Ocular Axial Length and Choroidal Thickness in Newly
Hatched Chicks and One‐year‐old Chickens Fluctuate in a Diurnal Pattern that is
Influenced by Visual Experience and Intraocular Pressure Changes. Experimental Eye
Research, 66, 195‐205.
PARVER, L., AUKER, C. & CARPENTER, D. 1980. Choroidal blood flow as a heat
dissipating mechanism in the macula. American Journal of Ophthalmology, 89, 641‐6.
PENHA, A. M., SCHAEFFEL, F. & FELDKAEMPER, M. 2011. Insulin, insulin‐like growth
factor‐1, insulin receptor, and insulin like growth factor‐1 receptor expression in the
chick eye and their regulation with imposed myopic or hyperopic defocus. Mol Vis,
17, 1436‐1448.
PETERSON, W. M. & MILLER, S. S. 1995. Identification and functional characterization of a
dual GABA/taurine transporter in the bullfrog retinal pigment epithelium. The Journal
of General Physiology, 106, 1089‐1122.
PIERCE, K. L., PREMONT, R. T. & LEFKOWITZ, R. J. 2002. Seven‐transmembrane receptors.
Nature Reviews Molecular Cell Biology, 3, 639‐650.
PIRILÄ, E., KORPI, J. T., KORKIAMÄKI, T., JAHKOLA, T., GUTIERREZ‐FERNANDEZ, A.,
LOPEZ‐OTIN, C., SAARIALHO‐KERE, U., SALO, T. & SORSA, T. 2007. Collagenase‐
2 (MMP‐8) and matrilysin‐2 (MMP‐26) expression in human wounds of different
etiologies. Wound Repair and Regeneration, 15, 47‐57.
QIAN, H. & RIPPS, H. 2009. Focus on molecules: The GABAC receptor. Experimental Eye
Research, 88, 1002‐1003.
QU, J., ZHOU, X., XIE, R., ZHANG, L., HU, D., LI, H. & LU, F. 2006. The presence of M1 to
M5 receptors in human sclera: Evidence of the sclera as a potential site of action for
muscarinic receptor antagonists. Current Eye Research, 31, 587‐597.
RADA, J. A., ACHEN, V. R., PERRY, C. A. & FOX, P. W. 1997. Proteoglycans in the human
sclera. Evidence for the presence of aggrecan. Investigative Ophthalmology & Visual
Science, 38, 1740‐51.
RADA, J. A., NICKLA, D. L. & TROILO, D. 2000. Decreased proteoglycan synthesis
associated with form deprivation myopia in mature primate eyes. Investigative
Ophthalmology & Visual Science, 41, 2050‐2058.
RAMRATTAN, R. S., VAN DER SCHAFT, T. L., MOOY, C. M., DE BRUIJN, W. C.,
MULDER, P. G. & DE JONG, P. T. 1994. Morphometric analysis of Bruchʹs
Emily F. McDonald: GABA Receptors in Human Sclera
83
membrane, the choriocapillaris, and the choroid in aging. Investigative Ophthalmology
& Visual Science, 35, 2857‐64.
RAVIOLA, E. & WIESEL, T. N. 2007. Neural control of eye growth and experimental myopia
in primates. Ciba Foundation Symposium 155 ‐ Myopia and the Control of Eye Growth.
John Wiley & Sons, Ltd.
ROBERTS, E. & FRANKEL, S. 1950. γ‐Aminobutyric acid in brain: Its formation from
glutamic acid. Journal of Biological Chemistry, 187, 55‐63.
ROHEN, J. 1964. Handbuch der mikroskoplschen anatomie des menschen. Haut and sinnesorgane.
IV. Das auge und seine hilfsogane, Berlin, Springer‐Verlag.
ROSE, K. A., MORGAN, I. G., IP, J., KIFLEY, A., HUYNH, S., SMITH, W. & MITCHELL, P.
2008a. Outdoor activity reduces the prevalence of myopia in children. Ophthalmology,
115, 1279‐1285.
ROSE, K. A., MORGAN, I. G., SMITH, W., BURLUTSKY, G., MITCHELL, P. & SAW, S.‐M.
2008b. Myopia, lifestyle, and schooling in students of Chinese ethnicity in Singapore
and Sydney. Archives of Ophthalmology, 126, 527‐530.
RYBERG, A. T., WARFVINGE, G., AXELSSON, L., SOUKUP, O., GÖTRICK, B. & TOBIN, G.
2008. Expression of muscarinic receptor subtypes in salivary glands of rats, sheep and
man. Archives of Oral Biology, 53, 66‐74.
RYMER, J. & WILDSOET, C. 2005. The role of the retinal pigment epithelium in eye growth
regulation and myopia: A review. Visual Neuroscience, 22, 251‐261.
SAMUELS, B. C., HAMMES, N. M., JOHNSON, P. L., SHEKHAR, A., MCKINNON, S. J. &
ALLINGHAM, R. R. 2012. Dorsomedial/perifornical hypothalamic stimulation
increases intraocular pressure, intracranial pressure, and the translaminar pressure
gradient. Investigative Ophthalmology & Visual Science, 53, 7328‐7335.
SANDBERG‐LALL, M., HÄGG, P. O., WAHLSTRÖM, I. & PIHLAJANIEMI, T. 2000. Type
XIII collagen is widely expressed in the adult and developing human eye and
accentuated in the ciliary muscle, the optic nerve and the neural retina. Experimental
Eye Research, 70, 401‐410.
SANTRA, M., REED, C. C. & IOZZO, R. V. 2002. Decorin binds to a narrow region of the
epidermal growth factor (EGF) receptor, partially overlapping but distinct from the
EGF‐binding epitope. Journal of Biological Chemistry, 277, 35671‐35681.
SARANG, S. S., PLOTKIN, M. D., GULLANS, S. R., CUMMINGS, B. S., GRANT, D. F. &
SCHNELLMANN, R. G. 2001. Identification of the γ‐aminobutyric acid receptor β2
and β3 subunits in rat, rabbit, and human kidneys. Journal of the American Society of
Nephrology, 12, 1107‐1113.
SAW, S.‐M., GAZZARD, G., SHIH‐YEN, E. C. & CHUA, W.‐H. 2005. Myopia and associated
pathological complications. Ophthalmic and Physiological Optics, 25, 381‐391.
Emily F. McDonald: GABA Receptors in Human Sclera
84
SCHAEFER, L. & IOZZO, R. V. 2008. Biological functions of the small leucine‐rich
proteoglycans: From genetics to signal transduction. Journal of Biological Chemistry,
283, 21305‐21309.
SCHAEFFEL, F., BARTMANN, M., HAGEL, G. & ZRENNER, E. 1995. Studies on the role of
the retinal dopamine/melatonin system in experimental refractive errors in chickens.
Vision Research, 35, 1247‐1264.
SCHAEFFEL, F., GLASSER, A. & HOWLAND, H. C. 1988. Accommodation, refractive error
and eye growth in chickens. Vision Research, 28, 639‐657.
SCHLÖTZER‐SCHREHARDT, U., ZENKEL, M. & NÜSING, R. M. 2002. Expression and
localization of FP and EP prostanoid receptor subtypes in human ocular tissues.
Investigative Ophthalmology & Visual Science, 43, 1475‐1487.
SCHNARE, M., BARTON, G. M., HOLT, A. C., TAKEDA, K., AKIRA, S. & MEDZHITOV, R.
2001. Toll‐like receptors control activation of adaptive immune responses. Nat
Immunol, 2, 947‐950.
SCHOUSBOE, A. & WAAGEPETERSEN, H. S. 2003. Role of astrocytes in homeostasis of
glutamate and GABA during physiological and pathophysiological conditions. In:
LEIF, H. (ed.) Advances in Molecular and Cell Biology. Elsevier.
SCHOUSBOE, A. & WAAGEPETERSEN, H. S. 2008. GABA neurotransmission: An
overview. In: LAJTHA, A. & VIZI, E. S. (eds.) Handbook of Neurochemistry and
Molecular Neurobiology. Springer US.
SCUTT, A., MEGHJI, S. & HARVEY, W. 1987. Stimulation of human fibroblast collagen
synthesis in vitro by γ‐aminobutyric acid. Biochemical Pharmacology, 36, 1333‐1335.
SEKO, Y., AZUMA, N., TAKAHASHI, Y., MAKINO, H., MORITO, T., MUNETA, T.,
MATSUMOTO, K., SAITO, H., SEKIYA, I. & UMEZAWA, A. 2008. Human sclera
maintains common characteristics with cartilage throughout evolution. PLoS ONE, 3,
e3709.
SHELTON, L. & SUMMERS RADA, J. A. 2009. TGFBIp inhibits the attachment of human
scleral fibroblasts to collagen type I. Investigative Ophthalmology & Visual Science, 50,
3542‐3552.
SHEN, W., VIJAYAN, M. & SIVAK, J. G. 2005. Inducing form‐deprivation myopia in fish.
Investigative Ophthalmology & Visual Science, 46, 1797‐1803.
SHERMAN, S. M., NORTON, T. T. & CASAGRANDE, V. A. 1977. Myopia in the lid‐sutured
tree shrew (Tupaia glis). Brain Research, 124, 154‐157.
SHIMAZU, R., AKASHI, S., OGATA, H., NAGAI, Y., FUKUDOME, K., MIYAKE, K. &
KIMOTO, M. 1999. MD‐2, a molecule that confers lipopolysaccharide responsiveness
on toll‐like receptor 4. The Journal of Experimental Medicine, 189, 1777‐1782.
SIEGHART, W. 2006. Structure, pharmacology, and function of GABAA receptor subtypes.
In: ENNA, S. J. (ed.) Advances in Pharmacology. Academic Press.
Emily F. McDonald: GABA Receptors in Human Sclera
85
SONG, X. Q., MENG, F., RAMSEY, D. J., RIPPS, H. & QIAN, H. 2005. The GABA ρ1 subunit
interacts with a cellular retinoic acid binding protein in mammalian retina.
Neuroscience, 136, 467‐475.
STEINBERG, R. H. 1985. Interactions between the retinal pigment epithelium and the neural
retina. Documenta Ophthalmologica, 60, 327‐346.
STEINBERG, R. H., LINSENMEIER, R. A. & GRIFF, E. R. 1983. Three light‐evoked responses
of the retinal pigment epithelium. Vision Research, 23, 1315‐1323.
STONE, R. A., LIU, J., SUGIMOTO, R., CAPEHART, C., ZHU, X. & PENDRAK, K. 2003.
GABA, experimental myopia, and ocular growth in chick. Investigative Ophthalmology
& Visual Science, 44, 3933‐3946.
STRAUSS, O. 2005. The retinal pigment epithelium in visual function. Physiological Reviews,
85, 845‐881.
STRAUSS, O., STUMPFF, F., MERGLER, S., WIENRICH, M. & WIEDERHOLT, M. 1998. The
Royal College of Surgeons Rat: An animal model for inherited retinal degeneration
with a still unknown genetic defect. Cells Tissues Organs, 162, 101‐111.
STREILEIN, J. W., MA, N., WENKEL, H., FONG NG, T. & ZAMIRI, P. 2002. Immunobiology
and privilege of neuronal retina and pigment epithelium transplants. Vision Research,
42, 487‐495.
SUMMERS, J. A. 2013. The choroid as a sclera growth regulator. Experimental Eye Research,
114, 120‐127.
SUMMERS RADA, J. A. & HOLLAWAY, L. R. 2011. Regulation of the biphasic decline in
scleral proteoglycan synthesis during the recovery from induced myopia.
Experimental Eye Research, 92, 394‐400.
SUMMERS RADA, J. A., SHELTON, S. & NORTON, T. T. 2006. The sclera and myopia.
Experimental Eye Research, 82, 185‐200.
TAN, J., DENG, Z.‐H., LIU, S.‐Z., WANG, J.‐T. & HUANG, C. 2010. TGF‐β2 in human retinal
pigment epithelial cells: Expression and secretion regulated by cholinergic signals in
vitro. Current Eye Research, 35, 37‐44.
TANIHARA, H., INATANI, M. & HONDA, Y. 1997. Growth factors and their receptors in
the retina and pigment epithelium. Progress in Retinal and Eye Research, 16, 271‐301.
THOMPSON, D. A. & GAL, A. 2003. Genetic defects in vitamin A metabolism of the retinal
pigment epithelium. Genetics in Ophthalmology, 37, 141‐154.
TIAN, B., GABELT, B. A. T., CROSSON, C. E. & KAUFMAN, P. L. 1997. Effects of adenosine
agonists on intraocular pressure and aqueous humor dynamics in cynomolgus
monkeys. Experimental Eye Research, 64, 979‐989.
Emily F. McDonald: GABA Receptors in Human Sclera
86
TOMASEK, J. J., GABBIANI, G., HINZ, B., CHAPONNIER, C. & BROWN, R. A. 2002.
Myofibroblasts and mechano‐regulation of connective tissue remodelling. Nature
Reviews Molecular Cell Biology, 3, 349‐363.
TOMITA, T., NAKASE, T., KANEKO, M., SHI, K., TAKAHI, K., OCHI, T. & YOSHIKAWA,
H. 2002. Expression of extracellular matrix metalloproteinase inducer and
enhancement of the production of matrix metalloproteinases in rheumatoid arthritis.
Arthritis & Rheumatism, 46, 373‐378.
TORCZYNSKI, E. 1987. Choroid and suprachoroid. In: DUANE, T. & JAEGER, E. (eds.)
Biomedical Foundations of Ophthalmology. Philadelphia: Harper and Row.
TORNQVIST, K. & EHINGER, B. 1988. Peptide immunoreactive neurons in the human
retina. Investigative Ophthalmology & Visual Science, 29, 680‐6.
TRIER, K. 2005. The sclera. In: FISCHBARG, J. (ed.) Advances in Organ Biology. Elsevier.
TRIPATHI, B. J., TRIPATHI, R. C., LIVINGSTON, A. M. & BORISUTH, N. C. 1991. The role
of growth factors in the embryogenesis and differentiation of the eye. American
Journal of Anatomy, 192, 442‐471.
TROILO, D., GOTTLIEB, M. D. & WALLMAN, J. 1987. Visual deprivation causes myopia in
chicks with optic nerve section. Current Eye Research, 6, 993‐999.
TROILO, D. & JUDGE, S. J. 1993. Ocular development and visual deprivation myopia in the
common marmoset (Callithrix jacchus). Vision Research, 33, 1311‐1324.
TROILO, D., NICKLA, D. L., MERTZ, J. R. & RADA, J. A. S. 2006. Change in the synthesis
rates of ocular retinoic acid and scleral glycosaminoglycan during experimentally
altered eye growth in marmosets. Investigative Ophthalmology & Visual Science, 47,
1768‐1777.
TROILO, D., QUINN, N. & BAKER, K. 2007. Accommodation and induced myopia in
marmosets. Vision Research, 47, 1228‐1244.
TSAI, J., DENNISTON, A. & MURRAY, P. 2010. Sclera. Oxford American Handbook of
Ophthalmology. USA: Oxford University Press.
TSENG, J. J., TURANO JR, M. R., LANGTON, K. & CHANG, S. 2004. Measurement of retinal
thickness by ocular coherence tomography in a case of scleral transparency in high
myopia. American Journal of Ophthalmology, 138, 169‐170.
TYAGI, N., LOMINADZE, D., GILLESPIE, W., MOSHAL KARNI, S., SEN, U.,
ROSENBERGER DOROTHEA, S., STEED, M. & TYAGI SURESH, C. 2007.
Differential expression of γ‐aminobutyric acid receptor A (GABAA) and effects of
homocysteine. Clinical Chemical Laboratory Medicine.
VAN DER ZEYDEN, M., OLDENZIEL, W. H., REA, K., CREMERS, T. I. & WESTERINK, B.
H. 2008. Microdialysis of GABA and glutamate: Analysis, interpretation and
comparison with microsensors. Pharmacology Biochemistry and Behavior, 90, 135‐147.
Emily F. McDonald: GABA Receptors in Human Sclera
87
VARDI, N. & STERLING, P. 1994. Subcellular localization of GABAA receptor on bipolar
cells in macaque and human retina. Vision Research, 34, 1235‐1246.
VERROTTI, A., MANCO, R., MATRICARDI, S., FRANZONI, E. & CHIARELLI, F. 2007.
Antiepileptic drugs and visual function. Pediatric Neurology, 36, 353‐360.
VIRIYAKOSOL, S., MATHISON, J. C., TOBIAS, P. S. & KIRKLAND, T. N. 2000. Structure‐
function analysis of CD14 as a soluble receptor for lipopolysaccharide. Journal of
Biological Chemistry, 275, 3144‐3149.
VITHLANI, M., TERUNUMA, M. & MOSS, S. J. 2011. The dynamic modulation of GABAA
receptor trafficking and its role in regulating the plasticity of inhibitory synapses.
Physiological Reviews, 91, 1009‐1022.
VYNIOS, D. H., PAPAGEORGAKOPOULOU, N., SAZAKLI, H. & TSIGANOS, C. P. 2001.
The interactions of cartilage proteoglycans with collagens are determined by their
structures. Biochimie, 83, 899‐906.
WAAGEPETERSEN, H. S. & SCHOUSBOE, A. 2009. Glial glutamate and GABA metabolism.
In: LARRY, R. S. (ed.) Encyclopedia of Neuroscience. Oxford: Academic Press.
WAAGEPETERSEN, H. S., SONNEWALD, U. & SCHOUSBOE, A. 2007. Glutamine,
glutamate, and GABA: Metabolic aspects. In: LAJTHA, A., OJA, S. S., SCHOUSBOE,
A. & SARANSAARI, P. (eds.) Handbook of Neurochemistry and Molecular Neurobiology.
Springer US.
WALLMAN, J. 1993. Retinal control of eye growth and refraction. Progress in Retinal Research,
12, 133‐153.
WALLMAN, J., GOTTLIEB, M., RAJARAM, V. & FUGATE‐WENTZEK, L. 1987. Local retinal
regions control local eye growth and myopia. Science, 237, 73‐77.
WALLMAN, J., TURKEL, J. & TRACHTMAN, J. 1978. Extreme myopia produced by modest
change in early visual experience. Science, 201, 1249‐1251.
WALLMAN, J., WILDSOET, C., XU, A., GOTTLIEB, M. D., NICKLA, D. L., MARRAN, L.,
KREBS, W. & CHRISTENSEN, A. M. 1995. Moving the retina: Choroidal modulation
of refractive state. Vision Research, 35, 37‐50.
WALLMAN, J. & WINAWER, J. 2004. Homeostasis of eye growth and the question of
myopia. Neuron, 43, 447‐468.
WANG, Q., ZHAO, G., XING, S., ZHANG, L. & YANG, X. 2011. Role of bone morphogenetic
proteins in form‐deprivation myopia sclera. Molecular Vision, 17, 647‐657.
WANG, T., GUGGINO, W. & CUTTING, G. 1994. A novel gamma‐aminobutyric acid
receptor subunit (rho 2) cloned from human retina forms bicuculline‐insensitive
homooligomeric receptors in Xenopus oocytes. The Journal of Neuroscience, 14, 6524‐
6531.
Emily F. McDonald: GABA Receptors in Human Sclera
88
WATSON, P. G. & YOUNG, R. D. 2004. Scleral structure, organisation and disease. A review.
Experimental Eye Research, 78, 609‐623.
WESSEL, H., ANDERSON, S., FITE, D., HALVAS, E., HEMPEL, J. & SUNDARRAJ, N. 1997.
Type XII collagen contributes to diversities in human corneal and limbal extracellular
matrices. Investigative Ophthalmology & Visual Science, 38, 2408‐22.
WIESEL, T. N. & RAVIOLA, E. 1977. Myopia and eye enlargement after neonatal lid fusion
in monkeys. Nature, 266, 66‐68.
WILDSOET, C. & WALLMAN, J. 1995. Choroidal and scleral mechanisms of compensation
for spectacle lenses in chicks. Vision Research, 35, 1175‐1194.
WILDSOET, C. F. 2003. Neural pathways subserving negative lens‐induced
emmetropization in chicks – Insights from selective lesions of the optic nerve and
ciliary nerve. Current Eye Research, 27, 371‐385.
WILDSOET, C. F. & PETTIGREW, J. D. 1988. Experimental myopia and anamalous eye
growth patterns unaffected by optic nerve section in chickens: Evidence for local
control of eye growth. Clinical Vision Sciences, 3, 99‐107.
WILSON, H. R. & COWAN, J. D. 1972. Excitatory and inhibitory interactions in localized
populations of model neurons. Biophysical Journal, 12, 1‐24.
WISTOW, G., BERNSTEIN, S. L., WYATT, K. M., FARISS, R. N., BEHAL, A., TOUCHMAN,
J. W., BOUFFARD, G., SMITH, D. & PETERSEN, K. 2002. Expressed sequence tag
analysis of human RPE/choroid for the NEIBank Project: Over 6000 non‐redundant
transcripts, novel genes and splice variants. Molecular Vision, 8, 205‐220.
WOOLEY, D. 1984. Mammalian collagenases. In: PIEZ, K. & REDDI, A. (eds.) Extracellular
Matrix Biochemistry. New York: Elsevier.
WRIDE, M. A., GEATRELL, J. & GUGGENHEIM, J. A. 2006. Proteases in eye development
and disease. Birth Defects Research Part C: Embryo Today: Reviews, 78, 90‐105.
YAMADA, K. M., KENNEDY, D. W., KIMATA, K. & PRATT, R. M. 1980. Characterization of
fibronectin interactions with glycosaminoglycans and identification of active
proteolytic fragments. Journal of Biological Chemistry, 255, 6055‐63.
YANG, X.‐L. 2004. Characterization of receptors for glutamate and GABA in retinal neurons.
Progress in Neurobiology, 73, 127‐150.
YANG, Y., LI, X., YAN, N., CAI, S. & LIU, X. 2009. Myopia: A collagen disease? Medical
Hypotheses, 73, 485‐487.
YAZULLA, S. 2010. GABA receptors in the retina. In: EDITOR‐IN‐CHIEF: DARLENE, A. D.
(ed.) Encyclopedia of the Eye. Oxford: Academic Press.
YOUNG, T. 2004. Dissecting the genetics of human high myopia: A molecular biologic
approach. Transactions of the American Ophthalmological Society, 102, 423‐446.
Emily F. McDonald: GABA Receptors in Human Sclera
89
YOUNG, T., GUO, X., KING, R. & RADA, J. 2003. Identification of genes expressed in a
human scleral cDNA library. Investigative Ophthalmology & Visual Science, 43, 2466‐.
YOUNG, T. L. 2010. Chapter 55 ‐ Myopia. In: LEONARD, A. L., MD, PHD & DANIEL M.
ALBERT, M. M. (eds.) Ocular Disease. Edinburgh: W.B. Saunders.
YOUNG, T. L., METLAPALLY, R. & SHAY, A. E. 2007. Complex trait genetics of refractive
error. Archives of Ophthalmology, 125, 38‐48.
YOUNG, T. L., SCAVELLO, G. S., PALURU, P. C., CHOI, J. D., RAPPAPORT, E. F. & RADA,
J. A. 2004. Microarray analysis of gene expression in human donor sclera. Molecular
Vision, 10, 163‐76.
ZHANG, G., CHEN, S., GOLDONI, S., CALDER, B. W., SIMPSON, H. C., OWENS, R. T.,
MCQUILLAN, D. J., YOUNG, M. F., IOZZO, R. V. & BIRK, D. E. 2009. Genetic
evidence for the coordinated regulation of collagen fibrillogenesis in the cornea by
decorin and biglycan. Journal of Biological Chemistry, 284, 8888‐8897.
ZHANG, X., HERNANDEZ, M. R., YANG, H. & ERICKSON, K. 1995. Expression of
muscarinic receptor subtype mRNA in the human ciliary muscle. Investigative
Ophthalmology & Visual Science, 36, 1645‐57.
ZILLIOX, L. & RUSSELL, J. 2011. Treatment of diabetic sensory polyneuropathy. Current
Treatment Options in Neurology, 13, 143‐159.
Emily F. McDonald: GABA Receptors in Human Sclera
90
Appendix one: ANIMAL STUDIES – background
Animal models have provided invaluable insights into some of the processes occurring
during the onset and progression of myopia. The development of animal models of myopia
occurred when Wiesel and Raviola discovered that suturing the eyes of monkeys induced
myopia (Wiesel and Raviola, 1977). In the intervening years, experiments using techniques,
such as form‐deprivation (Wiesel and Raviola, 1977) and optical defocus (Schaeffel et al.,
1988), have demonstrated the role of vision in the regulation (and alteration) of eye growth
(Collins et al., 2006). [However, it must be noted that it is still unclear how correlative
induced myopia in animals may be to physiologic myopia in humans (Leo and Young,
2011).] Refer to Figure A1 for a diagrammatic representation of the processes occurring
during form‐deprivation and myopic defocus in animal studies.
Figure A1: Animal models depicting the processes involved during induced‐hyperopia
myopic defocus (portrayed on the left) and induced‐myopia hyperopic defocus (portrayed
on the right) (Rymer and Wildsoet, 2005).
Several animal models have been used to date (refer to Table A1); the most common model is
the chick model (Metlapally and McBrien, 2008). While chick models, in particular, have
allowed greater understanding of myopia, there are some fundamental and important
differences – in comparison to mammalian eyes – in both the structure of the eye and in the
way the eye changes in the context of myopia (Morgan, 2003). For example, chick sclera is
bi‐layered: it consists largely of cartilaginous tissue but contains a small layer of fibrous
Emily F. McDonald: GABA Receptors in Human Sclera
91
tissue (Morgan, 2003). The human eye consists of a single fibrous layer only (Summers Rada
et al., 2006). In most animals, the sclera is supported with cartilage and even bone; is
thought that the less rigid fibrous structure of the human sclera allows a more even
distribution of the blood supply to the choroid, and hence the retina, during large rotations
of the eyeball (Watson and Young, 2004). Another notable feature of the chick eye ‐ absent in
the human eye – is the presence of ossicles, or rings of bony structures, located near the
corneal limbus (Wallman and Winawer, 2004).
Table A1: Recent examples of animal models used for myopia research [for an extensive list
of original papers representing studies for each of these species, refer to (Barathi et al., 2008)].
Species References
Avian: Gallus gallus domesticus (Chen et al., 2010, Summers Rada et al., 2006, Wallman et al., 1978)
Cat (Jinren and Smith III, 1989, Gollender et al., 1979)
Fish: Oreochromis niloticus (Shen et al., 2005)
Guinea Pig: Cavia porcellus (Howlett and McFadden, 2002)
Marmoset: Callithrix jacchus (Troilo and Judge, 1993, Troilo et al., 2006, Troilo et al., 2007)
Monkey: Macaca mulatta (Wiesel and Raviola, 1977, Summers Rada et al., 2006)
Mouse: Mus musculus (Barathi and Beuerman, 2011, Barathi et al., 2008)
Squirrel: Sciurus carolinensis (McBrien et al., 1993)
Tree Shrew: Tupaia glis belangeri (Abbott et al., 2011, Sherman et al., 1977, Summers Rada et al., 2006)
Emily F. McDonald: GABA Receptors in Human Sclera
92
Appendix Two: Gross Anatomy of Human Sclera
Following are a series of figures (Figures A2 – A7) outlining the relative positions of the
major muscles and blood vessels surrounding the human eye. These landmarks were used
to orient the regions of interest – superior, inferior, medial, and lateral – of the eyes used for
the immunohistochemical component of this project.
Figure A2: Some of the major muscles surrounding the eyeball; shown are the relative
positions of the insertions of the horizontal and vertical rectus muscles (Maza et al., 2012).
Figure A3: The insertions of the superior oblique and inferior oblique muscles (Maza et al.,
2012).
Emily F. McDonald: GABA Receptors in Human Sclera
93
Figure A4: Vascular supply to the globe, highlighting the relationships between the internal
carotid, ophthalmic, central retina, long posterior ciliary, short posterior ciliary, anterior
ciliary, and lacrimal arteries (Maza et al., 2012).
Figure A5: Sites of perforation of the sclera by the long and short posterior ciliary arteries,
the short posterior ciliary veins, and the inferior and superior vortex veins (Maza et al.,
2012).
Emily F. McDonald: GABA Receptors in Human Sclera
94
Figure A6: The relationships between the lacrimal, vortex, short posterior ciliary, inferior
ophthalmic, retinal, supraorbital, and superior ophthalmic veins (Maza et al., 2012).
Figure A7: The relationships, shown as a transverse section of the globe, between the short
posterior ciliary, long posterior ciliary, and anterior ciliary arteries and short posterior
ciliary, anterior ciliary, and vortex veins (Maza et al., 2012).
Emily F. McDonald: GABA Receptors in Human Sclera
95
Appendix Three: Gel results
The following tables provide all results for polymerase chain reaction undertaken during this
project. We observed results consistent with intron genomic DNA and splice variants, for
example. We have included maps in Appendix 5 that outlines the positions of the primers
with respect to introns and exons.
Table A2: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952. The aim
of this study was to determine the presence or absence of GABA receptors in human scleral
tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Scleral Stromal Cells – 6952 – 65°C (Pages 87‐88 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7
3 Primer #2: GABA A Alpha 2v1&2
4 Primer #3: GABA A Alpha 3
5 Primer #4: GABA A Alpha 4v1‐3 Intermediate expression
6 Primer #5: GABA A Alpha 5v1&2
7 Primer #6: GABA A Alpha 6 Intermediate expressiona
8 Primer #7: GABA A Beta 1
9 Primer #8: GABA A Beta 2v1&2 Weak expression
10 Primer #9: GABA A Beta 3v1‐4 Strong expression
11 Primer #10: GABA A Gamma 1
12 Primer #11: GABA A Gamma 2v1‐3
13 Primer #12: GABA A Gamma 3
Emily F. McDonald: GABA Receptors in Human Sclera
96
14 Primer #13: GABA A Epsilon Presence of faint band
15 Primer #14: GABA A Delta
16 Primer #15: GABA A Theta
17 Primer #16: GABA A Pi
18 Primer #17: GABA B R1 Weak expression
19 Primer #18: GABA B R2 Weak expression
20 Primer #19: GABA C Rho 1 Weak expression
21 Primer # 20: GABA C Rho 2
22 Primer #21: GABA C Rho 3
Lane: Bottom Row Primer Notes
1 Marker VIII
2 Housekeeping control Housekeeping gene: GAPDH – No expression
3 RT‐ve control Housekeeping gene: GAPDH
4 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
5 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
6 Primer #3: GABA A Alpha 3 PCR‐ve control
7 Primer #4: GABA A Alpha 4v1‐3 PCR‐ve control
8 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control
9 Primer #6: GABA A Alpha 6 PCR‐ve control
10 Primer #7: GABA A Beta 1 PCR‐ve control
11 Primer #8: GABA A Beta 2v1&2 PCR‐ve control a As the band appears too high based on the predicted base pair, we suspect that this is caused by intron genomic
DNA. The primer worked but the gene was not present and, therefore, the primer serves as an internal control.
Emily F. McDonald: GABA Receptors in Human Sclera
97
Table A3: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953. The aim
of this study was to determine the presence or absence of GABA receptors in human scleral
tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Scleral Stromal Cells – 6953 – 65°C (Pages 89‐90 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7
3 Primer #2: GABA A Alpha 2v1&2
4 Primer #3: GABA A Alpha 3
5 Primer #4: GABA A Alpha 4v1‐3
6 Primer #5: GABA A Alpha 5v1&2
7 Primer #6: GABA A Alpha 6 Strong expression
8 No load
9 Primer #7: GABA A Beta 1
10 Primer #8: GABA A Beta 2v1&2 Weak expression
11 Primer #9: GABA A Beta 3v1‐4 Strong expression
12 Primer #10: GABA A Gamma 1 Presence of faint band
13 Primer #11: GABA A Gamma 2v1‐3
14 Primer #12: GABA A Gamma 3
15 Primer #13: GABA A Epsilon
16 Primer #14: GABA A Delta
17 Primer #15: GABA A Theta
18 Primer #16: GABA A Pi Weak expressiona
19 Primer #17: GABA B R1
20 Primer #18: GABA B R2
21 Primer #19: GABA C Rho 1
22 Primer # 20: GABA C Rho 2 Weak expressiona
23 Primer #21: GABA C Rho 3
Lane: Bottom Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
3 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
4 Primer #3: GABA A Alpha 3 PCR‐ve control
Emily F. McDonald: GABA Receptors in Human Sclera
98
5 Primer #4: GABA A Alpha 4v1‐3 PCR‐ve control
6 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control
7 Primer #6: GABA A Alpha 6 PCR‐ve control
8 Primer #7: GABA A Beta 1 PCR‐ve control
9 Primer #8: GABA A Beta 2v1&2 PCR‐ve control
10 RT‐ve control Housekeeping gene: GAPDH
11 Housekeeping control GAPDH – Strong expression a As the bands appear too low for the predicted base pair, it is possible that this is caused by a splice variant.
Emily F. McDonald: GABA Receptors in Human Sclera
99
Table A4: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952. The aim
of this study was to determine the presence or absence of GABA receptors in human scleral
tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Scleral Stromal Cells – 6952 & 6953 – 63°C (Pages 91‐92 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 6952
3 Primer #2: GABA A Alpha 2v1&2 6952
4 Primer #3: GABA A Alpha 3 6952
5 Primer #5: GABA A Alpha 5v1&2 6952 – Weak expression
6 Primer #7: GABA A Beta 1 6952
7 Primer #8: GABA A Beta 2v1&2 6952 – Strong expression
8 Primer #10: GABA A Gamma 1 6952 – Weak expression
9 Primer #11: GABA A Gamma 2v1‐3 6952 – Strong expression
10 Primer #12: GABA A Gamma 3 6952
11 Primer #13: GABA A Epsilon 6952 – Intermediate expression
12 Primer #14: GABA A Delta 6952
13 Primer #15: GABA A Theta 6952
14 Primer #16: GABA A Pi 6953 – Strong expression
15 Primer #17: GABA B R1 6952 – Weak expression
16 Primer #18: GABA B R2 6952 – Intermediate expression
17 Primer #19: GABA C Rho 1 6952 – Intermediate expression
18 Primer # 20: GABA C Rho 2 6953 – Strong expression
19 Primer #21: GABA C Rho 3 6952
Lane: Bottom Row Primer Notes
1 Marker VIII All of the following: 6952
2 Housekeeping control GAPDH – Strong expression
3 RT‐ve control Housekeeping gene: GAPDH
4 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
Emily F. McDonald: GABA Receptors in Human Sclera
100
5 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
6 Primer #3: GABA A Alpha 3 PCR‐ve control
7 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control
8 Primer #7: GABA A Beta 1 PCR‐ve control
9 Primer #11: GABA A Gamma 2v1‐3 PCR‐ve control
10 Primer #12: GABA A Gamma 3 PCR‐ve control
11 Primer #14: GABA A Delta PCR‐ve control
Emily F. McDonald: GABA Receptors in Human Sclera
101
Table A5: RT‐PCR results for mesenchymal stromal cells obtained from donors 6952 & 6953.
The aim of this study was to determine the presence or absence of GABA receptors in human
scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Scleral Stromal Cells – 6952 & 6953 – 67°C (Pages 94‐97 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 6952
3 Primer #2: GABA A Alpha 2v1&2 6952
4 Primer #3: GABA A Alpha 3 6952
5 Primer #5: GABA A Alpha 5v1&2 6952
6 Primer #7: GABA A Beta 1 6952
7 Primer #10: GABA A Gamma 1 6952 – Strong expression
8 Primer #12: GABA A Gamma 3 6952
9 Primer #14: GABA A Delta 6952
10 Primer #15: GABA A Theta 6952
11 Primer #17: GABA B R1 6952 – Strong expression
12 Primer #21: GABA C Rho 3 6952
13 Primer #1: GABA A Alpha 1v1‐7 6953
14 Primer #2: GABA A Alpha 2v1&2 6953
15 Primer #3: GABA A Alpha 3 6953
16 Primer #5: GABA A Alpha 5v1&2 6953
17 Primer #7: GABA A Beta 1 6953
18 Primer #10: GABA A Gamma 1 6953 – Strong expression
19 Primer #12: GABA A Gamma 3 6953
20 Primer #14: GABA A Delta 6953
21 Primer #15: GABA A Theta 6953
22 Primer #17: GABA B R1 6953
23 Primer #21: GABA C Rho 3 6953
Lane: Bottom Row Primer Notes
1 Marker VIII
2 Housekeeping control (6952) GAPDH – Strong expression
3 RT‐ve control (6952) Housekeeping gene: GAPDH
4 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control (6952)
Emily F. McDonald: GABA Receptors in Human Sclera
102
5 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control (6952)
6 Primer #3: GABA A Alpha 3 PCR‐ve control (6952)
7 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control (6953)
8 Primer #7: GABA A Beta 1 PCR‐ve control (6953)
9 Primer #10: GABA A Gamma 1 PCR‐ve control (6953)
Emily F. McDonald: GABA Receptors in Human Sclera
103
Table A6: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953. The aim
of this study was to determine the presence or absence of GABA receptors in human scleral
tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Scleral Stromal Cells – 6953 – 63°C (Pages 98‐100 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Weak expression
3 Primer #2: GABA A Alpha 2v1&2
4 Primer #3: GABA A Alpha 3
5 Primer #5: GABA A Alpha 5v1&2
6 Primer #7: GABA A Beta 1 Weak expression
8 Primer #12: GABA A Gamma 3
9 Primer #14: GABA A Delta
10 Primer #15: GABA A Theta Weak expression
12 Primer #21: GABA C Rho 3
Lane: Bottom Row Primer Notes
1 Marker VIII
2 Housekeeping control Housekeeping gene: GAPDH – Strong expression
3 RT‐ve control Housekeeping gene: GAPDH
4 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
5 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
6 Primer #3: GABA A Alpha 3 PCR‐ve control
7 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control
8 Primer #7: GABA A Beta 1 PCR‐ve control
9 Primer #10: GABA A Gamma 1 PCR‐ve control
Emily F. McDonald: GABA Receptors in Human Sclera
104
Table A7: RT‐PCR results for choroid/RPE, retina, and mesenchymal stromal cells obtained
from donors 6952 & 6953. The aim of this study was to determine the presence or absence of
GABA receptors in human scleral tissue and cultured human scleral cells, as well as
choroidal/RPE and retinal tissue.
Choroid/RPE, Retina, Scleral Stromal Cells – 6952 & 6953 – 67°C (Pages 104‐105 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6952
3 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6952
4 Primer #10: GABA A Gamma 1 Choroid/RPE – 6952
5 Primer #12: GABA A Gamma 3 Choroid/RPE – 6952
6 Primer #14: GABA A Delta Choroid/RPE – 6952
7 Primer #17: GABA B R1 Choroid/RPE – 6952
8 Primer #21: GABA C Rho 3 Choroid/RPE – 6952
9 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control (Choroid/RPE – 6952)
10 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control (Choroid/RPE – 6952)
11 Primer #10: GABA A Gamma 1 PCR‐ve control (Choroid/RPE – 6952)
12 Primer #1: GABA A Alpha 1v1‐7 RT‐ve control (Choroid/RPE – 6952)
13 Housekeeping control GAPDH – Strong expression
14 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6953
15 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6953
16 Primer #10: GABA A Gamma 1 Choroid/RPE – 6953 – Strong expression
17 Primer #12: GABA A Gamma 3 Choroid/RPE – 6953
18 Primer #14: GABA A Delta Choroid/RPE – 6953
19 Primer #17: GABA B R1 Choroid/RPE – 6953
20 Primer #21: GABA C Rho 3 Choroid/RPE – 6953
21 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control (Choroid/RPE – 6953)
22 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control (Choroid/RPE – 6953)
23 Primer #10: GABA A Gamma 1 PCR‐ve control (Choroid/RPE – 6953)
24 Primer #1: GABA A Alpha 1v1‐7 RT‐ve control (Choroid/RPE – 6953)
25 Housekeeping control GAPDH – Strong expression
26 Primer #10: GABA A Gamma 1 Scleral Stromal Cells– 6952 – Strong expression
27 Primer #17: GABA B R1 Scleral Stromal Cells – 6952
28 Primer #10: GABA A Gamma 1 PCR‐ve control (Scleral Stromal Cells – 6953)
29 Primer #17: GABA B R1 PCR‐ve control (Scleral Stromal Cells – 6953)
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
105
Lane: Bottom Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Retina – 6952
3 Primer #2: GABA A Alpha 2v1&2 Retina – 6952
4 Primer #10: GABA A Gamma 1 Retina – 6952
5 Primer #12: GABA A Gamma 3 Retina – 6952
6 Primer #14: GABA A Delta Retina – 6952
7 Primer #17: GABA B R1 Retina – 6952
8 Primer #21: GABA C Rho 3 Retina – 6952
9 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control (Retina – 6952)
10 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control (Retina – 6952)
11 Primer #10: GABA A Gamma 1 PCR‐ve control (Retina – 6952)
12 Primer #1: GABA A Alpha 1v1‐7 RT‐ve control (Retina – 6952)
13 Housekeeping control GAPDH – Strong expression
14 Primer #1: GABA A Alpha 1v1‐7 Retina – 6953
15 Primer #2: GABA A Alpha 2v1&2 Retina – 6953
16 Primer #10: GABA A Gamma 1 Retina – 6953 – Strong expression
17 Primer #12: GABA A Gamma 3 Retina – 6953
18 Primer #14: GABA A Delta Retina – 6953
19 Primer #17: GABA B R1 Retina – 6953
20 Primer #21: GABA C Rho 3 Retina – 6953
21 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control (Retina – 6953)
22 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control (Retina – 6953)
23 Primer #10: GABA A Gamma 1 PCR‐ve control (Retina – 6953)
24 Primer #1: GABA A Alpha 1v1‐7 RT‐ve control (Retina – 6953)
25 Housekeeping control GAPDH – Strong expression
26 Primer #1: GABA A Alpha 1v1‐7 RT‐ve control (Stromal Cells – 6952)
27 Housekeeping control Housekeeping gene: GAPDH – No expression
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
106
Table A8: RT‐PCR results for choroid/RPE, retina, sclera, and mesenchymal stromal cells
obtained from donors 6952 & 6953. The aim of this study was to determine the presence or
absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well
as choroidal/RPE and retinal tissue.
Choroid/RPE, Retina, Sclera, Scleral Stromal Cells – 6952 & 6953 – 60/67°C (Pages 106‐107 of Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 GAPDH – Sclera – 6952 Housekeeping control – Expression
3 GAPDH – Sclera – 6953 Housekeeping control – Expression
4 GAPDH – Sclera – 6954 Housekeeping control – Expression
5 GAPDH – Choroid/RPE – 6952 Housekeeping control – Expression
6 GAPDH – Choroid/RPE – 6953 Housekeeping control – Expression
7 GAPDH – Retina – 6952 Housekeeping control – Expression
8 GAPDH – Retina – 6953 Housekeeping control – Expression
9 GAPDH – Scleral Stromal Cells – 6952 Housekeeping control – Expression
10 GAPDH – Scleral Stromal Cells – 6953 Housekeeping control – Expression
11 Marker VIII
13 Primer #10: GABA A Gamma 1 Cells – 6952 – Strong expression
14 Primer #17: GABA B R1 Cells – 6953 – Intermediate expression
Lane: Bottom Row Primer Notes
1 Marker VIII
2 GAPDH – Sclera – 6952 PCR‐ve control
3 GAPDH – Sclera – 6953 PCR‐ve control
4 GAPDH – Sclera – 6954 PCR‐ve control
5 GAPDH – Choroid/RPE – 6952 PCR‐ve control – Expression
6 GAPDH – Choroid/RPE – 6953 PCR‐ve control
7 GAPDH – Retina – 6952 PCR‐ve control
8 GAPDH – Retina – 6953 PCR‐ve control
9 GAPDH – Scleral Stromal Cells – 6952 PCR‐ve control
10 GAPDH – Scleral Stromal Cells – 6953 PCR‐ve control
Emily F. McDonald: GABA Receptors in Human Sclera
107
13 GAPDH – Sclera – 6952 RT‐ve control – Expression
14 GAPDH – Sclera – 6953 RT‐ve control – Expression
15 GAPDH – Sclera – 6954 RT‐ve control – Expression
16 GAPDH – Choroid/RPE – 6952 RT‐ve control – Expression
17 GAPDH – Choroid/RPE – 6953 RT‐ve control – Expression
18 GAPDH – Retina – 6952 RT‐ve control – Expression
19 GAPDH – Retina – 6953 RT‐ve control – Expression
20 GAPDH – Scleral Stromal Cells – 6952 RT‐ve control – Expression
21 GAPDH – Scleral Stromal Cells – 6953 RT‐ve control – Expression
22 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
108
Table A9: RT‐PCR results for sclera obtained from donor 6952. The aim of this study was to
determine the presence or absence of GABA receptors in human scleral tissue and cultured
human scleral cells, as well as choroidal/RPE and retinal tissue.
Sclera – 6952 – 60/63°C (Pages 112‐113 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6952
3 Primer #3: GABA A Alpha 3 Sclera – 6952
4 Primer #5: GABA A Alpha 5v1&2 Sclera – 6952
5 Primer #7: GABA A Beta 1 Sclera – 6952
6 Primer #8: GABA A Beta 2v1&2 Sclera – 6952 – Strong expression
7 Primer #11: GABA A Gamma 2v1‐3 Sclera – 6952 – Intermediate expression
8 Primer #12: GABA A Gamma 3 Sclera – 6952
9 Primer #13: GABA A Epsilon Sclera – 6952
10 Primer #14: GABA A Delta Sclera – 6952
11 Primer #15: GABA A Theta Sclera – 6952
12 Primer #16: GABA A Pi Sclera – 6952
13 Primer #18: GABA B R2 Sclera – 6952
14 Primer #19: GABA C Rho 1 Sclera – 6952 – Weak expression
15 Primer # 20: GABA C Rho 2 Sclera – 6952 – Intermediate expression
16 Primer #21: GABA C Rho 3 Sclera – 6952
17 GAPDH – Sclera – 6952 Housekeeping control – Expression
18 GAPDH – Sclera – 6952 RT‐ve control – Expression
19 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
20 Primer #3: GABA A Alpha 3 PCR‐ve control
21 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control
22 Primer #7: GABA A Beta 1 PCR‐ve control
23 Primer #8: GABA A Beta 2v1&2 PCR‐ve control
24 Primer #11: GABA A Gamma 2v1‐3 PCR‐ve control
25 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
109
Table A10: RT‐PCR results for sclera obtained from donor 6953. The aim of this study was
to determine the presence or absence of GABA receptors in human scleral tissue and
cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Sclera – 6953 – 60/63°C (Pages 114‐115 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6953
3 Primer #3: GABA A Alpha 3 Sclera – 6953
4 Primer #5: GABA A Alpha 5v1&2 Sclera – 6953
5 Primer #7: GABA A Beta 1 Sclera – 6953
6 Primer #8: GABA A Beta 2v1&2 Sclera – 6953 – Strong expression
7 Primer #11: GABA A Gamma 2v1‐3 Sclera – 6953 – Intermediate expression
8 Primer #12: GABA A Gamma 3 Sclera – 6953
9 Primer #13: GABA A Epsilon Sclera – 6953
10 Primer #14: GABA A Delta Sclera – 6953
11 Primer #15: GABA A Theta Sclera – 6953
12 Primer #16: GABA A Pi Sclera – 6953
13 Primer #18: GABA B R2 Sclera – 6953
14 Primer #19: GABA C Rho 1 Sclera – 6953 – Intermediate expression
15 Primer # 20: GABA C Rho 2 Sclera – 6953 – Strong expression
16 Primer #21: GABA C Rho 3 Sclera – 6953
17 GAPDH – Sclera – 6953 Housekeeping control – Expression
18 GAPDH – Sclera – 6953 RT‐ve control – Expression
19 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
20 Primer #3: GABA A Alpha 3 PCR‐ve control
21 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control
22 Primer #7: GABA A Beta 1 PCR‐ve control
23 Primer #8: GABA A Beta 2v1&2 PCR‐ve control
24 Primer #11: GABA A Gamma 2v1‐3 PCR‐ve control
25 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
110
Table A11: RT‐PCR results for sclera obtained from donor 6954. The aim of this study was
to determine the presence or absence of GABA receptors in human scleral tissue and
cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Sclera – 6954 – 60/63°C (Pages 116‐117 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6954
3 Primer #2: GABA A Alpha 2v1&2 Sclera – 6952
4 Primer #2: GABA A Alpha 2v1&2 Sclera – 6953
5 Primer #2: GABA A Alpha 2v1&2 Sclera – 6954
6 Primer #3: GABA A Alpha 3 Sclera – 6954
7 Primer #5: GABA A Alpha 5v1&2 Sclera – 6954
8 Primer #7: GABA A Beta 1 Sclera – 6954
9 Primer #8: GABA A Beta 2v1&2 Sclera – 6954 – Strong expression
10 Primer #11: GABA A Gamma 2v1‐3 Sclera – 6954 – Strong expression
11 Primer #12: GABA A Gamma 3 Sclera – 6954
12 Primer #13: GABA A Epsilon Sclera – 6954
13 Primer #14: GABA A Delta Sclera – 6954
14 Primer #15: GABA A Theta Sclera – 6954
15 Primer #16: GABA A Pi Sclera – 6954 – Intermediate expression
16 Primer #18: GABA B R2 Sclera – 6954
17 Primer #19: GABA C Rho 1 Sclera – 6954 – Intermediate expression
18 Primer # 20: GABA C Rho 2 Sclera – 6954 – Strong expression
19 Primer #21: GABA C Rho 3 Sclera – 6954
30 Marker VIII
Lane: Bottom Row Primer Notes
1 Marker VIII
2 GAPDH – Sclera – 6954 Housekeeping control
3 GAPDH – Sclera – 6952 RT‐ve control
4 GAPDH – Sclera – 6953 RT‐ve control
5 GAPDH – Sclera – 6954 RT‐ve control
6 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
7 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
8 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
9 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
10 Primer #3: GABA A Alpha 3 PCR‐ve control
11 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control
12 Primer #7: GABA A Beta 1 PCR‐ve control
13 Primer #8: GABA A Beta 2v1&2 PCR‐ve control
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
111
Table A12: RT‐PCR results for sclera obtained from donors 6952, 6953, & 6954. The aim of
this study was to determine the presence or absence of GABA receptors in human scleral
tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Sclera – 6952, 6953, & 6954 – 65°C (Pages 118‐119 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6952
3 Primer #2: GABA A Alpha 2v1&2 Sclera – 6952
4 Primer #3: GABA A Alpha 3 Sclera – 6952
5 Primer #4: GABA A Alpha 4v1‐3 Sclera – 6952 – Strong expression
6 Primer #5: GABA A Alpha 5v1&2 Sclera – 6952
7 Primer #6: GABA A Alpha 6 Sclera – 6952
8 Primer #9: GABA A Beta 3v1‐4 Sclera – 6952 – Strong expression
9 Primer #12: GABA A Gamma 3 Sclera – 6952
10 Primer #14: GABA A Delta Sclera – 6952
11 Primer #21: GABA C Rho 3 Sclera – 6952
12 GAPDH – Sclera – 6952 Housekeeping control
13 GAPDH – Sclera – 6952 RT‐ve control
14 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
15 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
16 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6953
17 Primer #2: GABA A Alpha 2v1&2 Sclera – 6953
18 Primer #3: GABA A Alpha 3 Sclera – 6953
19 Primer #4: GABA A Alpha 4v1‐3 Sclera – 6953 – Weak expression
20 Primer #5: GABA A Alpha 5v1&2 Sclera – 6953
21 Primer #6: GABA A Alpha 6 Sclera – 6953
22 Primer #9: GABA A Beta 3v1‐4 Sclera – 6953 – Strong expression
23 Primer #12: GABA A Gamma 3 Sclera – 6953
24 Primer #14: GABA A Delta Sclera – 6953
25 Primer #21: GABA C Rho 3 Sclera – 6953
26 GAPDH – Sclera – 6953 Housekeeping control
27 GAPDH – Sclera – 6953 RT‐ve control
28 Primer #3: GABA A Alpha 3 PCR‐ve control
29 Primer #4: GABA A Alpha 4v1‐3 PCR‐ve control
30 Marker VIII
Lane: Bottom Row Primer Notes
1 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
112
2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6954
3 Primer #2: GABA A Alpha 2v1&2 Sclera – 6954
4 Primer #3: GABA A Alpha 3 Sclera – 6954
5 Primer #4: GABA A Alpha 4v1‐3 Sclera – 6954
6 Primer #5: GABA A Alpha 5v1&2 Sclera – 6954
7 Primer #6: GABA A Alpha 6 Sclera – 6954 – Strong expression
8 Primer #9: GABA A Beta 3v1‐4 Sclera – 6954
9 Primer #12: GABA A Gamma 3 Sclera – 6954
10 Primer #14: GABA A Delta Sclera – 6954
11 Primer #21: GABA C Rho 3 Sclera – 6954
12 GAPDH – Sclera – 6954 Housekeeping control
13 GAPDH – Sclera – 6954 RT‐ve control
14 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control
15 Primer #6: GABA A Alpha 6 PCR‐ve control
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
113
Table A13: RT‐PCR results for sclera obtained from donors 6952, 6953, & 6954. The aim of
this study was to determine the presence or absence of GABA receptors in human scleral
tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Sclera – 6952, 6953, & 6954 – 60/67°C (Pages 120‐121 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6952
3 Primer #2: GABA A Alpha 2v1&2 Sclera – 6952
4 Primer #10: GABA A Gamma 1 Sclera – 6952 – Strong expression
5 Primer #12: GABA A Gamma 3 Sclera – 6952
6 Primer #14: GABA A Delta Sclera – 6952
7 Primer #17: GABA B R1 Sclera – 6952
8 Primer #21: GABA C Rho 3 Sclera – 6952
9 GAPDH – Sclera – 6952 Housekeeping control
10 GAPDH – Sclera – 6952 RT‐ve control – Contamination?
11 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
12 Primer #10: GABA A Gamma 1 PCR‐ve control
13 Primer #17: GABA B R1 PCR‐ve control
14 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6953
15 Primer #2: GABA A Alpha 2v1&2 Sclera – 6953
16 Primer #10: GABA A Gamma 1 Sclera – 6953 – Strong expression
17 Primer #12: GABA A Gamma 3 Sclera – 6953
18 Primer #14: GABA A Delta Sclera – 6953
19 Primer #17: GABA B R1 Sclera – 6953
20 Primer #21: GABA C Rho 3 Sclera – 6953
21 GAPDH – Sclera – 6953 Housekeeping control
22 GAPDH – Sclera – 6953 RT‐ve control
23 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
24 Primer #10: GABA A Gamma 1 PCR‐ve control
25 Primer #17: GABA B R1 PCR‐ve control
26 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6954
27 Primer #2: GABA A Alpha 2v1&2 Sclera – 6954
28 Primer #10: GABA A Gamma 1 Sclera – 6954 – Intermediate expression
29 Primer #12: GABA A Gamma 3 Sclera – 6954
30 Marker VIII
Lane: Bottom Row Primer Notes
1 Primer #14: GABA A Delta Sclera – 6954
2 Primer #17: GABA B R1 Sclera – 6954
Emily F. McDonald: GABA Receptors in Human Sclera
114
3 Primer #21: GABA C Rho 3 Sclera – 6954
4 GAPDH – Sclera – 6954 Housekeeping control
5 GAPDH – Sclera – 6954 RT‐ve control – Contamination?
6 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
7 Primer #10: GABA A Gamma 1 PCR‐ve control
8 Primer #17: GABA B R1 PCR‐ve control
29 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
115
Table A14: RT‐PCR results for choroid/RPE obtained from donor 6952. The aim of this study
was to determine the presence or absence of GABA receptors in human scleral tissue and
cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Choroid/RPE – 6952 – 60/63°C (Pages 122‐123 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6952
3 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6952
4 Primer #3: GABA A Alpha 3 Choroid/RPE – 6952
5 Primer #5: GABA A Alpha 5v1&2 Choroid/RPE – 6952
6 Primer #7: GABA A Beta 1 Choroid/RPE – 6952
7 Primer #8: GABA A Beta 2v1&2 Choroid/RPE – 6952
8 Primer #11: GABA A Gamma 2v1‐3 Choroid/RPE – 6952
9 Primer #12: GABA A Gamma 3 Choroid/RPE – 6952
10 Primer #13: GABA A Epsilon Choroid/RPE – 6952
11 Primer #14: GABA A Delta Choroid/RPE – 6952
12 Primer #15: GABA A Theta Choroid/RPE – 6952
13 Primer #16: GABA A Pi Choroid/RPE – 6952
14 Primer #18: GABA B R2 Choroid/RPE – 6952
15 Primer #19: GABA C Rho 1 Choroid/RPE – 6952
16 Primer # 20: GABA C Rho 2 Choroid/RPE – 6952
17 Primer #21: GABA C Rho 3 Choroid/RPE – 6952
18 18s rRNA – Choroid/RPE – 6952 Housekeeping control – Expression
19 18s rRNA – Choroid/RPE – 6952 RT‐ve control
20 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
21 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
22 Primer #3: GABA A Alpha 3 PCR‐ve control
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
116
Table A15: RT‐PCR results for choroid/RPE & retina obtained from donors 6952 & 6953. The
aim of this study was to determine the presence or absence of GABA receptors in human
scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Choroid/RPE & Retina – 6952 & 6953 – 65/67°C (Pages 124‐125 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6952
3 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6952
4 Primer #10: GABA A Gamma 1 Choroid/RPE – 6952
5 Primer #12: GABA A Gamma 3 Choroid/RPE – 6952
6 Primer #14: GABA A Delta Choroid/RPE – 6952
7 Primer #17: GABA B R1 Choroid/RPE – 6952
8 Primer #21: GABA C Rho 3 Choroid/RPE – 6952
9 B2M – Choroid/RPE – 6952 Housekeeping control – Expression
10 B2M – Choroid/RPE – 6952 RT‐ve control
11 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
12 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
13 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6953
14 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6953
15 Primer #10: GABA A Gamma 1 Choroid/RPE – 6953 – Intermediate expression
16 Primer #12: GABA A Gamma 3 Choroid/RPE – 6953
17 Primer #14: GABA A Delta Choroid/RPE – 6953
18 Primer #17: GABA B R1 Choroid/RPE – 6953
19 Primer #21: GABA C Rho 3 Choroid/RPE – 6953
20 B2M – Choroid/RPE – 6953 Housekeeping control – Expression
21 B2M – Choroid/RPE – 6953 RT‐ve control
22 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
23 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
24 Primer #1: GABA A Alpha 1v1‐7 Retina – 6952
25 Primer #2: GABA A Alpha 2v1&2 Retina – 6952
26 Primer #10: GABA A Gamma 1 Retina – 6952
27 Primer #12: GABA A Gamma 3 Retina – 6952
28 Primer #14: GABA A Delta Retina – 6952
29 Primer #17: GABA B R1 Retina – 6952
Emily F. McDonald: GABA Receptors in Human Sclera
117
30 Marker VIII
Lane: Bottom Row Primer Notes
1 Marker VIII
2 Primer #21: GABA C Rho 3 Retina – 6952
3 B2M – Retina – 6952 Housekeeping control – Expression
4 B2M – Retina – 6952 RT‐ve control
5 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
6 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
7 Primer #1: GABA A Alpha 1v1‐7 Retina – 6953
8 Primer #2: GABA A Alpha 2v1&2 Retina – 6953
9 Primer #10: GABA A Gamma 1 Retina – 6953 – Strong expression
10 Primer #12: GABA A Gamma 3 Retina – 6953
11 Primer #14: GABA A Delta Retina – 6953
12 Primer #17: GABA B R1 Retina – 6953
13 Primer #21: GABA C Rho 3 Retina – 6953
14 B2M – Retina – 6953 Housekeeping control – Expression
15 B2M – Retina – 6953 RT‐ve control
16 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
17 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
118
Table A16: RT‐PCR results for retina obtained from donor 6953. The aim of this study was
to determine the presence or absence of GABA receptors in human scleral tissue and
cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Retina – 6953 – 63/65°C (Pages 126‐127 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Retina – 6953
3 Primer #2: GABA A Alpha 2v1&2 Retina – 6953
4 Primer #3: GABA A Alpha 3 Retina – 6953
5 Primer #5: GABA A Alpha 5v1&2 Retina – 6953
6 Primer #7: GABA A Beta 1 Retina – 6953
7 Primer #8: GABA A Beta 2v1&2 Retina – 6953 – Strong expression
8 Primer #11: GABA A Gamma 2v1‐3 Retina – 6953 – Strong expression
9 Primer #12: GABA A Gamma 3 Retina – 6953 – Intermediate expression
10 Primer #13: GABA A Epsilon Retina – 6953
11 Primer #14: GABA A Delta Retina – 6953
12 Primer #15: GABA A Theta Retina – 6953
13 Primer #16: GABA A Pi Retina – 6953 – Strong expression
14 Primer #18: GABA B R2 Retina – 6953 – Intermediate expression
15 Primer #19: GABA C Rho 1 Retina – 6953 – Strong expression
16 Primer # 20: GABA C Rho 2 Retina – 6953 – Strong expression
17 Primer #21: GABA C Rho 3 Retina – 6953
18 B2M – Retina – 6953 Housekeeping control – Expression
19 B2M – Retina – 6953 RT‐ve control
20 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
21 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
22 Primer #3: GABA A Alpha 3 PCR‐ve control
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
119
Table A17: RT‐PCR results for retina, choroid/RPE, sclera, and mesenchymal stromal cells
obtained from donor 6952. The aim of this study was to determine the presence or absence
of GABA receptors in human scleral tissue and cultured human scleral cells, as well as
choroidal/RPE and retinal tissue.
Retina, Choroid/RPE, Sclera, & Scleral Stromal Cells – 6952, 3 & 4 – 63/65°C (Pages 130‐131 of Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 GAPDH – Choroid/RPE – 6952 Housekeeping control
3 GAPDH – Choroid/RPE – 6953 Housekeeping control
4 GAPDH – Retina – 6952 Housekeeping control
5 GAPDH – Retina – 6953 Housekeeping control
6 GAPDH – Sclera – 6952 Housekeeping control
7 GAPDH – Sclera – 6953 Housekeeping control
8 GAPDH – Sclera – 6954 Housekeeping control
9 GAPDH – Scleral Stromal Cells – 6952 Housekeeping control
10 GAPDH – Scleral Stromal Cells – 6953 Housekeeping control
21 B2M – Choroid/RPE – 6952 Housekeeping control
22 B2M – Choroid/RPE – 6953 Housekeeping control
23 B2M – Retina – 6952 Housekeeping control
24 B2M – Retina – 6953 Housekeeping control
25 B2M – Sclera – 6952 Housekeeping control
26 B2M – Sclera – 6953 Housekeeping control
27 B2M – Sclera – 6954 Housekeeping control
28 B2M – Scleral Stromal Cells – 6952 Housekeeping control
29 B2M – Scleral Stromal Cells – 6953 Housekeeping control – Faint expression
30 Marker VIII
Lane: Bottom Row Primer Notes
1 Marker VIII
2 GAPDH – Choroid/RPE – 6952 RT‐ve control
3 GAPDH – Choroid/RPE – 6953 RT‐ve control
4 GAPDH – Retina – 6952 RT‐ve control
5 GAPDH – Retina – 6953 RT‐ve control
6 GAPDH – Sclera – 6952 RT‐ve control
Emily F. McDonald: GABA Receptors in Human Sclera
120
7 GAPDH – Sclera – 6953 RT‐ve control
8 GAPDH – Sclera – 6954 RT‐ve control
9 GAPDH – Scleral Stromal Cells – 6952 RT‐ve control
10 GAPDH – Scleral Stromal Cells – 6953 RT‐ve control
21 B2M – Choroid/RPE – 6952 RT‐ve control
22 B2M – Choroid/RPE – 6953 RT‐ve control
23 B2M – Retina – 6952 RT‐ve control
24 B2M – Retina – 6953 RT‐ve control
25 B2M – Sclera – 6952 RT‐ve control
26 B2M – Sclera – 6953 RT‐ve control
27 B2M – Sclera – 6954 RT‐ve control – Faint expression
28 B2M – Scleral Stromal Cells – 6952 RT‐ve control
29 B2M – Scleral Stromal Cells – 6953 RT‐ve control
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
121
Table A18: RT‐PCR results for choroid/RPE – donor 6953 – & retina – donor 6952. The aim
of this study was to determine the presence or absence of GABA receptors in human scleral
tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Choroid/RPE (6953) & Retina (6952) – 63°C (Pages 132‐133 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6953
3 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6953
4 Primer #3: GABA A Alpha 3 Choroid/RPE – 6953
5 Primer #5: GABA A Alpha 5v1&2 Choroid/RPE – 6953
6 Primer #7: GABA A Beta 1 Choroid/RPE – 6953
7 Primer #8: GABA A Beta 2v1&2 Choroid/RPE – 6953 – Weak expression
8 Primer #11: GABA A Gamma 2v1‐3 Choroid/RPE – 6953
9 Primer #12: GABA A Gamma 3 Choroid/RPE – 6953
10 Primer #13: GABA A Epsilon Choroid/RPE – 6953
11 Primer #14: GABA A Delta Choroid/RPE – 6953
12 Primer #15: GABA A Theta Choroid/RPE – 6953
13 Primer #16: GABA A Pi Choroid/RPE – 6953 – Strong expression
14 Primer #18: GABA B R2 Choroid/RPE – 6953
15 Primer #19: GABA C Rho 1 Choroid/RPE – 6953‐ Strong expression
16 Primer # 20: GABA C Rho 2 Choroid/RPE – 6953 – Strong expression
17 Primer #21: GABA C Rho 3 Choroid/RPE – 6953
18 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
19 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
20 Primer #3: GABA A Alpha 3 PCR‐ve control
21 Primer #1: GABA A Alpha 1v1‐7 Retina – 6952
22 Primer #2: GABA A Alpha 2v1&2 Retina – 6952
23 Primer #3: GABA A Alpha 3 Retina – 6952
24 Primer #5: GABA A Alpha 5v1&2 Retina – 6952
25 Primer #7: GABA A Beta 1 Retina – 6952
26 Primer #8: GABA A Beta 2v1&2 Retina – 6952 – Intermediate expression
27 Primer #11: GABA A Gamma 2v1‐3 Retina – 6952 – Strong expression
28 Primer #12: GABA A Gamma 3 Retina – 6952
Emily F. McDonald: GABA Receptors in Human Sclera
122
29 Primer #13: GABA A Epsilon Retina – 6952
30 Marker VIII
Lane: Bottom Row Primer Notes
1 Marker VIII
2 Primer #14: GABA A Delta Retina – 6952
3 Primer #15: GABA A Theta Retina – 6952
4 Primer #16: GABA A Pi Retina – 6952 – Weak expression
5 Primer #18: GABA B R2 Retina – 6952
6 Primer #19: GABA C Rho 1 Retina – 6952 – Weak expression
7 Primer # 20: GABA C Rho 2 Retina – 6952 – Weak expression
8 Primer #21: GABA C Rho 3 Retina – 6952
9 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
10 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
11 Primer #3: GABA A Alpha 3 PCR‐ve control
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
123
Table A19: RT‐PCR results for choroid/RPE & retina obtained from donors 6952 & 6953. The
aim of this study was to determine the presence or absence of GABA receptors in human
scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Choroid/RPE & Retina – 6952 & 6953 – 65°C (Pages 134‐135 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6952
3 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6952
4 Primer #3: GABA A Alpha 3 Choroid/RPE – 6952
5 Primer #4: GABA A Alpha 4v1‐3 Choroid/RPE – 6952 – Strong expression
6 Primer #5: GABA A Alpha 5v1&2 Choroid/RPE – 6952
7 Primer #6: GABA A Alpha 6 Choroid/RPE – 6952
8 Primer #9: GABA A Beta 3v1‐4 Choroid/RPE – 6952
9 Primer #12: GABA A Gamma 3 Choroid/RPE – 6952
10 Primer #14: GABA A Delta Choroid/RPE – 6952
11 Primer #21: GABA C Rho 3 Choroid/RPE – 6952
12 B2M – Choroid/RPE – 6952 Housekeeping control
13 B2M – Choroid/RPE – 6952 RT‐ve control
14 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
15 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
16 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6953
17 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6953
18 Primer #3: GABA A Alpha 3 Choroid/RPE – 6953
19 Primer #4: GABA A Alpha 4v1‐3 Choroid/RPE – 6953 – Strong expression
20 Primer #5: GABA A Alpha 5v1&2 Choroid/RPE – 6953
21 Primer #6: GABA A Alpha 6 Choroid/RPE – 6953
22 Primer #9: GABA A Beta 3v1‐4 Choroid/RPE – 6953
23 Primer #12: GABA A Gamma 3 Choroid/RPE – 6953
24 Primer #14: GABA A Delta Choroid/RPE – 6953
25 Primer #21: GABA C Rho 3 Choroid/RPE – 6953
26 B2M – Choroid/RPE – 6953 Housekeeping control
27 B2M – Choroid/RPE – 6953 RT‐ve control
28 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
29 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
Emily F. McDonald: GABA Receptors in Human Sclera
124
30 Marker VIII
Lane: Bottom Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Retina – 6952
3 Primer #2: GABA A Alpha 2v1&2 Retina – 6952
4 Primer #3: GABA A Alpha 3 Retina – 6952
5 Primer #4: GABA A Alpha 4v1‐3 Retina – 6952 – Strong expression
6 Primer #5: GABA A Alpha 5v1&2 Retina – 6952
7 Primer #6: GABA A Alpha 6 Retina – 6952
8 Primer #9: GABA A Beta 3v1‐4 Retina – 6952
9 Primer #12: GABA A Gamma 3 Retina – 6952
10 Primer #14: GABA A Delta Retina – 6952
11 Primer #21: GABA C Rho 3 Retina – 6952
12 B2M – Retina – 6952 Housekeeping control – Expression
13 B2M – Retina – 6952 RT‐ve control
14 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
15 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
16 Primer #1: GABA A Alpha 1v1‐7 Retina – 6953
17 Primer #2: GABA A Alpha 2v1&2 Retina – 6953
18 Primer #3: GABA A Alpha 3 Retina – 6953
19 Primer #4: GABA A Alpha 4v1‐3 Retina – 6953 – Strong expression
20 Primer #5: GABA A Alpha 5v1&2 Retina – 6953
21 Primer #6: GABA A Alpha 6 Retina – 6953
22 Primer #9: GABA A Beta 3v1‐4 Retina – 6953
23 Primer #12: GABA A Gamma 3 Retina – 6953
24 Primer #14: GABA A Delta Retina – 6953
25 Primer #21: GABA C Rho 3 Retina – 6953
26 B2M – Retina – 6953 Housekeeping control
27 B2M – Retina – 6953 RT‐ve control
28 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control
29 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
125
Table A20: RT‐PCR results for retina, choroid/RPE, sclera, and mesenchymal stromal cells
obtained from donor 6952. The aim of this study was to determine the presence or absence
of GABA receptors in human scleral tissue and cultured human scleral cells, as well as
choroidal/RPE and retinal tissue.
Retina, Choroid/RPE, Sclera, & Scleral Stromal Cells – 6952, 3 & 4 – 63/65°C (Pages 130‐131 of Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 PBGD – Choroid/RPE – 6952 Housekeeping control
3 PBGD – Choroid/RPE – 6953 Housekeeping control
4 PBGD – Retina – 6952 Housekeeping control
5 PBGD – Retina – 6953 Housekeeping control
6 PBGD – Sclera – 6952 Housekeeping control – Faint expression
7 PBGD – Sclera – 6953 Housekeeping control
8 PBGD – Sclera – 6954 Housekeeping control
9 PBGD – Scleral Stromal Cells – 6952 Housekeeping control
10 PBGD – Scleral Stromal Cells – 6953 Housekeeping control
21 B2M – Choroid/RPE – 6952 Housekeeping control
22 B2M – Choroid/RPE – 6953 Housekeeping control
23 B2M – Retina – 6952 Housekeeping control
24 B2M – Retina – 6953 Housekeeping control
25 B2M – Sclera – 6952 Housekeeping control
26 B2M – Sclera – 6953 Housekeeping control
27 B2M – Sclera – 6954 Housekeeping control
28 B2M – Scleral Stromal Cells – 6952 Housekeeping control
29 B2M – Scleral Stromal Cells – 6953 Housekeeping control
30 Marker VIII
Lane: Bottom Row Primer Notes
1 Marker VIII
2 PBGD – Choroid/RPE – 6952 RT‐ve control
3 PBGD – Choroid/RPE – 6953 RT‐ve control
4 PBGD – Retina – 6952 RT‐ve control
5 PBGD – Retina – 6953 RT‐ve control
6 PBGD – Sclera – 6952 RT‐ve control
Emily F. McDonald: GABA Receptors in Human Sclera
126
7 PBGD – Sclera – 6953 RT‐ve control
8 PBGD – Sclera – 6954 RT‐ve control
9 PBGD – Scleral Stromal Cells – 6952 RT‐ve control
10 PBGD – Scleral Stromal Cells – 6953 RT‐ve control
21 B2M – Choroid/RPE – 6952 RT‐ve control
22 B2M – Choroid/RPE – 6953 RT‐ve control
23 B2M – Retina – 6952 RT‐ve control
24 B2M – Retina – 6953 RT‐ve control
25 B2M – Sclera – 6952 RT‐ve control
26 B2M – Sclera – 6953 RT‐ve control
27 B2M – Sclera – 6954 RT‐ve control
28 B2M – Scleral Stromal Cells – 6952 RT‐ve control
29 B2M – Scleral Stromal Cells – 6953 RT‐ve control
30 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
127
Table A21: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953. The
aim of this study was to determine the presence or absence of GABA receptors in human
scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Scleral Stromal Cells – 6953 – Varied°C (Pages 143‐144 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7
3 Primer #2: GABA A Alpha 2v1&2
4 Primer #3: GABA A Alpha 3
5 Primer #4: GABA A Alpha 4v1‐3 Weak expression
6 Primer #5: GABA A Alpha 5v1&2
7 Primer #6: GABA A Alpha 6
8 Primer #7: GABA A Beta 1 Intermediate expression
9 Primer #8: GABA A Beta 2v1&2 Intermediate expression
10 Primer #9: GABA A Beta 3v1‐4 Strong expression
11 Primer #10: GABA A Gamma 1
12 Primer #11: GABA A Gamma 2v1‐3 Strong expression
13 Primer #12: GABA A Gamma 3
14 Primer #13: GABA A Epsilon Intermediate expression
15 Primer #14: GABA A Delta
16 Primer #15: GABA A Theta
17 Primer #16: GABA A Pi Weak expression
18 Primer #17: GABA B R1
19 Primer #18: GABA B R2
20 Primer #19: GABA C Rho 1
21 Primer # 20: GABA C Rho 2 Weak expression
22 Primer #21: GABA C Rho 3
23 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
128
Table A22: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952. The
aim of this study was to determine the presence or absence of GABA receptors in human
scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue.
Scleral Stromal Cells – 6952 – Varied°C (Page 149 of Laboratory Notebook)
Lane: Top Row Primer Notes
1 Marker VIII
2 Primer #1: GABA A Alpha 1v1‐7 Intermediate expression
3 Primer #2: GABA A Alpha 2v1&2
4 Primer #3: GABA A Alpha 3
5 Primer #4: GABA A Alpha 4v1‐3 Strong expression
6 Primer #5: GABA A Alpha 5v1&2 Strong expression
7 Primer #6: GABA A Alpha 6
8 Primer #7: GABA A Beta 1 Strong expression
9 Primer #8: GABA A Beta 2v1&2 Strong expression
10 Primer #9: GABA A Beta 3v1‐4 Strong expression
11 Primer #10: GABA A Gamma 1 Strong expression
12 Primer #11: GABA A Gamma 2v1‐3 Strong expression
13 Primer #12: GABA A Gamma 3 Weak expression
14 Primer #13: GABA A Epsilon Strong expression
15 Primer #14: GABA A Delta
16 Primer #15: GABA A Theta Strong expression
17 Primer #16: GABA A Pi Strong expression
18 Primer #17: GABA B R1 Strong expression
19 Primer #18: GABA B R2 Strong expression
20 Primer #19: GABA C Rho 1 Strong expression
21 Primer # 20: GABA C Rho 2 Strong expression
22 Primer #21: GABA C Rho 3
23 Marker VIII
Emily F. McDonald: GABA Receptors in Human Sclera
129
Appendix Four: GABA RECEPTOR GENE SEQUENCING
Representative RT‐PCR product for each GABA receptor for which a positive result was
obtained was sent to the Australian Genome Research Facility (AGRF) for independent
sequencing. Firstly, the product was cleaned and each product was assigned an identifying
label solely (USS1‐17; no further information was supplied to the AGRF). Each label
corresponded to the different GABA receptor genes as shown below. Refer to Table A2 for
Blast results.
USS1: GABA A Alpha 1
USS2: GABA A Alpha 4
USS3: GABA A Alpha 5
USS4: GABA A Alpha 6
USS5: GABA A Beta 1
USS6: GABA A Beta 2
USS7: GABA A Beta 3
USS8: GABA A Gamma 1
USS9: GABA A Gamma 2
USS10: GABA A Gamma 3
USS11: GABA A Epsilon
USS12: GABA A Theta
USS13: GABA A Pi
USS14: GABA B R1
USS15: GABA B R2
USS16: GABA A Rho 1
USS17: GABA A Rho 2
Emily F. McDonald: GABA Receptors in Human Sclera
130
Table A23: Relevant Blast results obtained from the AGRF for each product representative of
potential positive results for GABA receptor genes.
Code USS1
Gene >gi|21265167|gb|BC030696.1| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 1, mRNA (cDNA clone MGC:26564 IMAGE:4820972), complete cds
Length 3440
Score 291 bits (147)
Expect 5e‐76
Identities 147/147 (100%)
Strand Plus/Plus
Blast Result ctggatcctccttctgagcacactgactggaagaagctatggacagccgtcattacaaga ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||ctggatcctccttctgagcacactgactggaagaagctatggacagccgtcattacaaga tgaacttaaagacaataccactgtcttcaccaggattttggacagactcctagatggtta ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||tgaacttaaagacaataccactgtcttcaccaggattttggacagactcctagatggtta tgacaatcgcctgagaccaggattggg 147 ||||||||||||||||||||||||||| tgacaatcgcctgagaccaggattggg 254
Code USS2
Gene >gi|34452722|ref|NM_000809.2| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 4 (GABRA4), mRNA
Length 11143
Score 333 bits (168)
Expect 2e‐88
Identities 174/176 (98%)
Strand Plus/Plus
Blast Result aagtgtcctatgctaccgccatggactggttcatagctgtctgctttgcttttgtatttt ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||aagtgtcctatgctaccgccatggactggttcatagctgtctgctttgcttttgtatttt cggcccttatcgagtttgctgctgtcaactatttcaccaatattcaaatggaaaaagcca ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||cggcccttatcgagtttgctgctgtcaactatttcaccaatattcaaatggaaaaagcca aaaggaagacatcaaagccccctcaggaagttcccgctgctccatggcagagagag 184|||||||||||||||||||||||||||||||||||||||||||| |||||||||| Aaaggaagacatcaaagccccctcaggaagttcccgctgctccagtgcagagagag 1249
Code USS3
Gene >gi|182915|gb|L08485.1|HUMGABRA5Y Human GABA-benzodiazepine receptor alpha-5-subunit (GABRA5) mRNA, complete cds
Length 2318
Score 248 bits (125)
Expect 6e‐63
Identities 125/125 (100%)
Strand Plus/Plus
Sequence aatggagtacaccatagacgtgtttttccgacaaagctggaaagatgaaaggcttcggtt ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||aatggagtacaccatagacgtgtttttccgacaaagctggaaagatgaaaggcttcggtt taaggggcccatgcagcgcctccctctcaacaacctccttgccagcaagatctggacccc ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||taaggggcccatgcagcgcctccctctcaacaacctccttgccagcaagatctggacccc agaca 128 |||||
Emily F. McDonald: GABA Receptors in Human Sclera
131
agaca 702
Code USS4
Gene >gi|109731537|gb|BC099641.3| Homo sapiens gamma-aminobutyric acid(GABA) A receptor, alpha 6, mRNA (cDNA clone MGC:116904 IMAGE:40005679), complete cds
Length 1539 Score 250 bits (126) Expect 3e-63 Identities 133/134 (99%) Strand Plus/Plus Sequence atttgatggtcagtaaa-tctggacgcctgacacctttttcagaaatggtaaaaagtcca
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||atttgatggtcagtaaaatctggacgcctgacacctttttcagaaatggtaaaaagtcca ttgctcacaacatgacaactcctaataaactcttcagaataatgcagaatggaaccattt ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||ttgctcacaacatgacaactcctaataaactcttcagaataatgcagaatggaaccattt tatacaccatgagg 135 |||||||||||||| tatacaccatgagg 473
Code USS5
Gene >gi|182918|gb|M59213.1|HUMGABRB12 Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exon 4
Length 2165 Score 218 bits (110) Expect 4e-54 Identities 110/110 (100%) Strand Plus/Plus Sequence atacactcaccatgtatttccagcagtcttggaaagacaaaaggctttcttattctggaa
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||atacactcaccatgtatttccagcagtcttggaaagacaaaaggctttcttattctggaa tcccactgaacctcaccctagacaatagggtagctgaccaactctgggta 110 |||||||||||||||||||||||||||||||||||||||||||||||||| tcccactgaacctcaccctagacaatagggtagctgaccaactctgggta 889
Code USS6
Gene >gi|71043451|gb|BC099719.1| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 2, mRNA (cDNA clone MGC:119389 IMAGE:40006779), complete cds
Length 1977 Score 127 (64) Expect 6e-27 Identities 64/64 (100%) Strand Plus/Plus Sequence acacatcaatccaggacaaaagtgacgctaaaataccttagttgctggcctatcctgtgg
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||acacatcaatccaggacaaaagtgacgctaaaataccttagttgctggcctatcctgtgg tcca 64 |||| tcca 1948
Code USS7
Gene >gi|14714964|gb|BC010641.1| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 3, mRNA (cDNA clone MGC:9051 IMAGE:3871111), complete cds
Emily F. McDonald: GABA Receptors in Human Sclera
132
Length 2994 Score 129 bits (65) Expect 1e-27 Identities 65/65 (100%) Strand Plus/Plus Sequence gcctcatcagtatttggactttttaaagctcgtagaaacaagacaaggtgcaccggtttc
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||gcctcatcagtatttggactttttaaagctcgtagaaacaagacaaggtgcaccggtttc ataga 65 ||||| ataga 2939
Code USS8
Gene >gi|21411385|gb|BC031087.1| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 1, mRNA (cDNA clone MGC:33838 IMAGE:5289008), complete cds
Length 2264 Score 216 bits (109) Expect 5e-53 Identities 125/133 (93%) Strand Plus/Plus Sequence ggggattatgttatcatgacaannnnnnnngacctgagcagaagaatgggatatttcact
|||||||||||||||||||||| ||||||||||||||||||||||||||||||ggggattatgttatcatgacaattttttttgacctgagcagaagaatgggatatttcact attcagacctacattccatgcattctgacagttgttctttcttgggtgtctttttggatc ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||attcagacctacattccatgcattctgacagttgttctttcttgggtgtctttttggatc aataaagatgcag 293 ||||||||||||| aataaagatgcag 983
Code USS9
Gene >gi|189083761|ref|NM_198903.2| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 2 (GABRG2), transcript variant 3, mRNA
Length 4077 Score 260 bits (131) Expect 2e-66 Identities 131/131 (100%) Strand Plus/Plus Sequence ccgctgccagagtgacgctttgatggtatctgcaagcgtttttgctgatcttatctctgc
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||ccgctgccagagtgacgctttgatggtatctgcaagcgtttttgctgatcttatctctgc cccctgaatattaattccctaatctggtagcaatccatctccccagtgaaggacctacta ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||cccctgaatattaattccctaatctggtagcaatccatctccccagtgaaggacctacta gaggcaggtgg 131 ||||||||||| gaggcaggtgg 257
Code USS10
Gene >gi|110556626|ref|NM_033223.3| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 3 (GABRG3), mRNA
Length 1677 Score 190 bits (96) Expect 8e-46
Emily F. McDonald: GABA Receptors in Human Sclera
133
Identities 96/96 (100%) Strand Plus/Plus Sequence ccctgagcaccatcgccaggaagtccttgccacgcgtgtcctacgtgaccgccatggacc
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||ccctgagcaccatcgccaggaagtccttgccacgcgtgtcctacgtgaccgccatggacc tttttgtgaccgtgtgcttcctgtttgtcttcgccg 96 |||||||||||||||||||||||||||||||||||| tttttgtgaccgtgtgcttcctgtttgtcttcgccg 1154
Code USS11
Gene >gi|1857125|gb|U66661.1|HSU66661 Human GABA-A receptor epsilon subunit mRNA, complete cds
Length 3154 Score 274 bits (138) Expect 1e-70 Identities 144/146 (98%) Strand Plus/Plus Sequence ggtacgacgaacgcctctgttacaacgacacctttgagtctcttgttctgaatggcaatg
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||ggtacgacgaacgcctctgttacaacgacacctttgagtctcttgttctgaatggcaatg tggtgagccagctatggatcccggacaccttttttaggaattctaagaggacccacgagc ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||tggtgagccagctatggatcccggacaccttttttaggaattctaagaggacccacgagc atgagatcaccatgccaacccagatg 158 |||||||||||||||| | ||||||| atgagatcaccatgcccaaccagatg 562
Code USS12
Gene >gi|5764186|gb|AF144648.1|AF144648 Homo sapiens GABA-A receptor theta (theta) mRNA, complete cds
Length 1884 Score 232 bits (117) Expect 3e-58 Identities 117/117 (100%) Strand Plus/Plus Sequence acagcaaggatgctttcgtgcatgatgtgactgtggagaatcgcgtgtttcagcttcacc
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||acagcaaggatgctttcgtgcatgatgtgactgtggagaatcgcgtgtttcagcttcacc cagatggaacggtgcggtacggcatccgactcaccactacagcagcttgttccctgg485||||||||||||||||||||||||||||||||||||||||||||||||||||||||| cagatggaacggtgcggtacggcatccgactcaccactacagcagcttgttccctgg541
Code USS13
Gene >gi|2197000|gb|U95367.1|HSU95367 Human GABA-A receptor pi subunit mRNA, complete cds
Length 3282 Score 307 bits (155) Expect 9e-81 Identities 155/155 (100%) Strand Plus/Plus Sequence acaagagcttcactctggatgcccgcctcgtggagttcctctgggtgccagatacttaca
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||acaagagcttcactctggatgcccgcctcgtggagttcctctgggtgccagatacttaca ttgtggagtccaagaagtccttcctccatgaagtcactgtgggaaacaggctcatccgcc ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||ttgtggagtccaagaagtccttcctccatgaagtcactgtgggaaacaggctcatccgcc
Emily F. McDonald: GABA Receptors in Human Sclera
134
tcttctccaatggcacggtcctgtatgccctcaga 159 ||||||||||||||||||||||||||||||||||| tcttctccaatggcacggtcctgtatgccctcaga 615
Code USS14
Gene >gi|4063891|gb|AF099148.1|AF099148 Homo sapiens GABA-B1a receptor mRNA, complete cds
Length 3192 Score 293 bits (148) Expect 1e-76 Identities 148/148 (100%) Strand Plus/Plus Sequence gctcatccaccacgacagcaagtgtgatccaggccaagccaccaagtacctatatgagct
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||gctcatccaccacgacagcaagtgtgatccaggccaagccaccaagtacctatatgagct gctctacaacgaccctatcaagatcatccttatgcctggctgcagctctgtctccacgct ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||gctctacaacgaccctatcaagatcatccttatgcctggctgcagctctgtctccacgct ggtggctgaggctgctaggatgtggaac 148 |||||||||||||||||||||||||||| ggtggctgaggctgctaggatgtggaac 891
Code USS15
Gene >gi|4836217|gb|AF095784.1|AF095784 Homo sapiens GABA-B receptor R2 (GABBR2) mRNA, complete cds
Length 3240 Score 256 bits (129) Expect 2e-65 Identities 129/129 (100%) Strand Plus/Plus Sequence ctaccaagagctcaatgacatcctcaacctgggaaacttcactgagagcacagatggagg
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||ctaccaagagctcaatgacatcctcaacctgggaaacttcactgagagcacagatggagg aaaggccattttaaaaaatcacctcgatcaaaatccccagctacagtggaacacaacaga ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||aaaggccattttaaaaaatcacctcgatcaaaatccccagctacagtggaacacaacaga gccctctcg 129 ||||||||| gccctctcg 2749
Code USS16
Gene >gi|120659825|gb|BC130344.1| Homo sapiens gamma-aminobutyric acid (GABA) receptor, rho 1, mRNA (cDNA clone MGC:163216 IMAGE:40146375), complete cds
Length 1862 Score 194 bits (98) Expect 5e-47 Identities 101/102 (99%) Strand Plus/Plus Sequence gcatgacgtttgacggccggctggtcaagaagatctgggtccctgacatgtttttcgtgc
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||gcatgacgtttgatggccggctggtcaagaagatctgggtccctgacatgtttttcgtgc actccaaacgctccttcatccacgacaccaccacagacaacg 102 |||||||||||||||||||||||||||||||||||||||||| actccaaacgctccttcatccacgacaccaccacagacaacg 535
Emily F. McDonald: GABA Receptors in Human Sclera
135
Code USS17
Gene >gi|182912|gb|M86868.1|HUMGABARHO Human gamma amino butyric acid (GABA rho2) gene mRNA, complete cds
Length 1628 Score 283 bits (143) Expect 1e-73 Identities 150/151 (99%) Gaps 1/151 (0%) Strand Plus/Plus Sequence cagcgccagca-caagagcatgaccttcgatggccggctggtgaagaagatctgggtccc
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||cagcgccagcaacaagagcatgaccttcgatggccggctggtgaagaagatctgggtccc tgatgtcttctttgttcactccaaaagatcgttcactcatgacaccaccactgacaacat ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||tgatgtcttctttgttcactccaaaagatcgttcactcatgacaccaccactgacaacat catgctgagggtgttcccagatggacacgtg 157 ||||||||||||||||||||||||||||||| catgctgagggtgttcccagatggacacgtg 578
Emily F. McDonald: GABA Receptors in Human Sclera
136
Appendix Five: Genome mAPS
Shown below are representative genome maps for thirteen of the primers used for the RT‐
PCR component of this project.
Emily F. McDonald: GABA Receptors in Human Sclera
137