eukaryotic of microbiology al._jeumic_2014_s...species diversity and, therefore, are not equivalent...

MicrobiologyEukaryoticthe

journal

of

Published by the International Society of Protistologists

Volume 61 | Issue 1 | January/February 2014

Published by the International Society of Protistologists

THE JOURNAL OF EUKARYOTIC MICROBIOLOGY

Editor-in-ChiefRoberto DocampoCenter for Tropical and Emerging Global Diseases and Department of Cellular BiologyUniversity of Georgia500 DW Brooks Drive Athens, GA 30602

Editorial AssistantTammy AndrosCenter for Tropical and Emerging Global DiseasesUniversity of Georgia334 Coverdell CenterAthens, GA 30602 USA

Email: [email protected]

Douglas ChalkerDepartment of BiologyWashington UniversityOne Brookings DriveSt. Louis, MO 63130USA

John R. DolanMarine Microbial EcologyLaboratoire d’Océanographie de VillefrancheStation ZoologiqueBP 28, 06230, Villefranche-sur-MerFrance

Edna S. KaneshiroDepartment of Biological SciencesUniversity of CincinnatiCincinnati, OH 45221-0006USA

Paul MichelsInstitute of Structural and Molecular Biology University of Edinburgh King’s Buildings, Offi ce D301 Mayfi eld RoadEdinburgh EH9 3JU, Scotland and Laboratorio de Enzimología de ParásitosDepartamento de BiologíaUniversidad de Los Andes Mérida, Venezuela

Tomoko NozakiGraduate School of Life and Environmental SciencesUniversity of TsukubaTsukuba, Ibaraki Japan

Helmut PlattnerDepartment of BiologyUniversity of KonstanzPO BOX 5560, Konstanz 78457Germany

Alastair G. B. SimpsonDepartment of BiologyDalhousie UniversityLife Sciences CentreHalifax, NS B3H 4J1Canada

Michaela Strueder-KypkeDepartment of Molecular and Cellular BiologyUniversity of GuelphGuelph, ON N1G 2W1Canada

Associate Editors

Sabine AgathaHelmut BergerGaylen BradleyDavid CaronKwang-Poo ChangJohn ClampTheodore G. ClarkEric ColeJohan De JonckheereWanderley de SouzaJohn DolanJean-Francois Dubremetz

Avelina EspinosaJames ForneyRebecca GastRay GavinFrances GillinAdrian HehlMona HoppenrathMatthias HornPatrick KeelingScott KeelyNaveed KhanConrad KingBrian Leander

Michael LinkeGeorge McManusJan MeadDavid J. MontagnesSilva N. J. MorenoCharles O’KellyTimothy PagetFranz PetryTerry PrestonRenate RadekAndrew RogerPhillip RyalsJeff Silberman

Alexey SmirnovRichard SnyderThorsten StoeckBoris StriepenJames StringerJan TachezyLesly TemesvariTom TempletonAndrea Valigurova Mark van der GiezenRoss F. WallerJulia WalochnikGuan Zhu

Board of Reviewers

Cover Photo: Dinoflagellates in the Genus Symbiodinium are more than just endosymbionts. The newly described S. voratum n. sp., featured on the cover, appears to be free-living and can supplement its nutritional needs by phagotro-phic feeding on bacteria and by consuming other microalgae. It may also exhibit periodic “blooming” characteristics of planktonic microalgae in temperate coastal areas of the Pacific Ocean and Mediterranean Sea (image by Sung Yeon Lee, Seoul National University).

The International Society of ProtistologistsExecutive Committee 2013–2014

PRESIDENTC. Graham Clark (2013–2014)Department of Pathogen MolecularBiology, London School of Hygiene & Tropical Medicine London WC1E 7HT, United Kingdom

PRESIDENT-ELECTFrederick W. Spiegel (2013–2014)Department of Biological SciencesUniversity of Arkansas Fayetteville, AR 72701 USA

PAST PRESIDENTSJohn Clamp (2012–2013)Department of BiologyNorth Carolina Central University Durham, NC 27707 USA

Sina Adl (2011–2012)Department of Soil ScienceCollege of Agriculture & BioresourcesUniversity of SaskatchewanSaskatoon, SK, Canada

VICE-PRESIDENTAlan Warren (2013–2014)Life Sciences Department LS Genomics and Microbial DiversityDivision, Natural History MuseumLondon SW7 5BD, United Kingdom

SECRETARYDaniel J. G. Lahr (2013–2016)Department of ZoologyUniversity of São PauloSão Paulo, SP 05508-090, Brazil

TREASURERDenis Lynn (2012–2015)Department of ZoologyUniversity of British Columbia6270 University Blvd.Vancouver, BC V6T 1Z4, Canada

EXECUTIVE COMMITTEE MEMBERSMark A. Farmer (2010–2015)Department Cellular Biology724 Biological Sciences Bldg.University of GeorgiaAthens, GA 30602 USA

Alastair G. B. Simpson (2009–2014)Department of Biology Dalhousie University Life Sciences Center1355 Oxford StreetHalifax, NS B3H 4J1, Canada

Weibo Song (2011–2016)Laboratory of ProtozoologyOcean University of Qingdao266003 Qingdao, China

Sabine Agatha (2012–2017)Department of Organismic Biology University of SalzburgHellbrunnerstrasse 345020 Salzburg, Austria

Joel B. Dacks (2013–2018)Department of Cell BiologyFaculty of Medicine and Dentistry University of Alberta Edmonton, AB, Canada

STUDENT MEMBERTomáš Pánek (2011–2014)Department of Zoology, Faculty of Science, Charles UniversityVinicna 7, Prague 2 12844, Czech Republic

Aims and Scope

The Journal of Eukaryotic Microbiology publishes original research on protists, including lower algae and fungi. Articles are published covering all aspects of these organisms, including their behavior, biochemistry, cell biology, chemotherapy, development, ecology, evolution, genetics, molecular biology, morphogenetics, parasitology, systematics, and ultrastructure.

Copyright and Copying: © 2014 The International Society of Protistologists. All rights reserved. No part of this publication may be reproduced, stored or transmitted in any form or by any means without the prior permission in writing from the copyright holder. Authorization to copy items for internal and personal use is granted by the copyright holder for libraries and other users registered with their local Reproduction Rights Organization (RRO), e.g. Copyright Clearance Center (CCC), 222 Rosewood Drive, Danvers, MA 01923, USA (www.copyright.com), provided the appropriate fee is paid directly to the RRO. This consent does not extend to other kinds of copying such as copying for general distribution, for advertising or promotional purposes, for creating new collective works or for resale. Special requests should be addressed to: [email protected]

Disclaimer: The Publisher, The International Society for Protistologists and Editors cannot be held responsible for errors or any consequences arising from the use of information contained in this journal; the views and opinions expressed do not necessarily refl ect those of the Publisher, The International Society for Protistologists and Editors, neither does the publication of advertisements constitute any endorsement by the Publisher, The International Society for Protistologists and Editors of the products advertised.

ORIGINAL ARTICLE

Genetics and Morphology Characterize the DinoflagellateSymbiodinium voratum, n. sp., (Dinophyceae) as the SoleRepresentative of Symbiodinium Clade EHae Jin Jeonga, Sung Yeon Leea, Nam Seon Kanga, Yeong Du Yooa, An Suk Lima, Moo Joon Leea,

Hyung Seop Kimb, Wonho Yihb, Hiroshi Yamashitac & Todd C. LaJeunessed

a School of Earth and Environmental Sciences, College of Natural Sciences, Seoul National University, Seoul 151-747, Korea

b Department of Oceanography, Kunsan National University, Kunsan, 573-701, Korea

c Seikai National Fisheries Research Institute, Fisheries Research Agency, Fukai-Ohta, Ishigaki Okinawa 907-0451, Japan

d Department of Biology, 327 Mueller Laboratory, Pennsylvania State University, University Park, PA 16802, USA

Keywords

phylogeny; plastid genes; species;

systematics; taxonomy.

Correspondence

T. C. LaJeunesse, Department of Biology,

Pennsylvania State University,

University Park, PA 16802, USA

Telephone number: +1 814 863 2038;

FAX number: +1 814 865 9031;

e-mail: [email protected]

Received: 12 July 2013; revised 10 Septem-

ber 2013; accepted October 1, 2013.

doi:10.1111/jeu.12088

ABSTRACT

Dinoflagellates in the genus Symbiodinium are ubiquitous in shallow marine

habitats where they commonly exist in symbiosis with cnidarians. Attempts to

culture them often retrieve isolates that may not be symbiotic, but instead

exist as free-living species. In particular, cultures of Symbiodinium clade E

obtained from temperate environments were recently shown to feed phagotro-

phically on bacteria and microalgae. Genetic, behavioral, and morphological evi-

dence indicate that strains of clade E obtained from the northwestern,

southwestern, and northeastern temperate Pacific Ocean as well as the Medi-

terranean Sea constitute a single species: Symbiodinium voratum n. sp. Chlo-

roplast ribosomal 23S and mitochondrial cytochrome b nucleotide sequences

were the same for all isolates. The D1/D2 domains of nuclear ribosomal DNA

were identical among Western Pacific strains, but single nucleotide substitu-

tions differentiated isolates from California (USA) and Spain. Phylogenetic

analyses demonstrated that S. voratum is well-separated evolutionarily from

other Symbiodinium spp. The motile, or mastigote, cells from different cultures

were morphologically similar when observed using light, scanning, and trans-

mission electron microscopy; and the first complete Kofoidian plate formula

for a Symbiodinium sp. was characterized. As the largest of known Symbiodi-

nium spp., the average coccoid cell diameters measured among cultured iso-

lates ranged between 12.2 (� 0.2 SE) and 13.3 (� 0.2 SE) lm. Unique among

species in the genus, a high proportion (approximately 10–20%) of cells remain

motile in culture during the dark cycle. Although S. voratum occurs on surfaces

of various substrates and is potentially common in the plankton of coastal

areas, it may be incapable of forming stable mutualistic symbioses.

DINOFLAGELLATES in the genus Symbiodinium live

predominantly as endosymbionts, and are abundant

worldwide in shallow tropical and subtropical marine envi-

ronments where they commonly associate with Cnidaria

(Trench 1993). Symbiodinium are extensively researched

because of their importance to the survival and growth of

reef-building corals and because climate change continues

to negatively affect these symbiotic associations. Yet,

inadequate systematics and taxonomy have limited the

collective knowledge and slowed progress in our under-

standing of these organisms. Prior to the development

and application of DNA sequence data, investigations into

Symbiodinium systematics and taxonomy were limited pri-

marily to the study of their morphology, protein expression

patterns, and chromosome numbers (Blank and Huss

1989; Freudenthal 1962; Kevin et al. 1969; Loeblich and

Sherley 1979; Schoenberg and Trench 1980a,b,c; Spector

1984; Trench and Blank 1987; Trench and Thinh 1995).

Presently, these traditional approaches to taxonomy are

being combined with, and in some cases superseded by,

genetic data to establish an accurate and formal under-

standing of species diversity (Hansen and Daugbjerg

2009; LaJeunesse et al. 2012).

The discovery of relatively large differences in the

nucleotide sequences among conserved genes (e.g., SSU,

small subunit Rowan and Powers 1992; and later sup-

ported by large COX 1 sequence differences, Stern et al.

2010) confirmed that the genus Symbiodinium comprises

© 2013 The Author(s) Journal of Eukaryotic Microbiology © 2013 International Society of Protistologists

Journal of Eukaryotic Microbiology 2014, 61, 75–94 75

Journal of Eukaryotic Microbiology ISSN 1066-5234

Published bythe International Society of ProtistologistsEukaryotic Microbiology

The Journal of

many species, first indicated by the pioneering work of

Schoenberg and Trench (1980a,b,c). It is now accepted

that the genus comprises phylogenetically divergent

“clades” that differ in global distribution and abundance

(referred to as A–I sensu Pochon and Gates 2010; Rowan

and Powers 1991). However, these informal “clade” des-

ignations suppress awareness that Symbiodinium is a

large and diverse genus. Higher resolution genetic mark-

ers identify hundreds of ecologically distinct entities, many

of which occur in specific hosts, reef habitats, and geo-

graphic locations (LaJeunesse 2001, 2002; LaJeunesse

et al. 2010b, 2012; Pochon et al. 2007; Sampayo et al.

2009; Santos et al. 2002) and do not undergo genetic

exchange (Thornhill et al. 2013). Furthermore, it has

become apparent that “clades” differ markedly in their

species diversity and, therefore, are not equivalent entities

(e.g., LaJeunesse et al. 2010b).

Symbiodinium “clade E” (sensu LaJeunesse 2001) is

ecologically enigmatic and often mistaken by various

researchers for Gymnodinium sp. (e.g. Chang 1983; Fan

et al. 2007; Shao et al. 2004), probably because the masti-

gote has a Gymnodinium-like cell morphology and high

proportions of cells remain motile in culture. Present

knowledge of this ‘group’ exists because many research-

ers have isolated and cultured it from various coastal loca-

tions in the temperate zones of the Pacific Ocean. These

include isolates from the temperate anemone Anthopleura

elegantissima in Southern California (LaJeunesse and

Trench 2000; Polne-Fuller 1991), USA, and the stony coral

Alveopora japonica from Jeju Island, Korea (Jeong et al.

2012). However, all other strains were collected from the

environment as free-living cells from the surfaces of red

and brown macrophyte algae (Yamashita and Koike 2013),

or obtained from sea water samples collected in Cook’s

Straight, New Zealand (Chang 1983; CCMP 421, previ-

ously known as Gymnodinium varians); Jiaozhou Bay,

China (Gou et al. 2003; Santos 2004); the Zhujiang River

estuary (Pearl River), China (Shao et al. 2004); and also

Jeju Island off the southern coast of Korea (Jeong et al.

2012). A strain isolated from surface waters in the wes-

tern Mediterranean Sea was classified to clade E by

recent genetic analysis (culture AC561; Stern et al. 2012),

and indicates that this organism also occurs in the Atlantic

Ocean. Clade E has yet to be found from analyses of host

samples including reef corals, sponges, sea anemones, jel-

lyfish, nudibranchs, and clams, nor from symbiotic ciliates

and foraminifera (e.g. Chen et al. 2005; Finney et al. 2010;

Hill et al. 2011; LaJeunesse et al. 2004a,b, 2010b; Lien

et al. 2012; Pochon et al. 2001, 2007; Silverstein et al.

2011; Stat et al. 2009). Large densities of clade E (S. ‘cali-

fornium’ nomen nudum) may associate with individuals of

the anemone A. elegantissima found in the littoral zone of

southern California (LaJeunesse and Trench 2000), but

Sanders and Palumbi (2011), in their genetic analysis of

anemones from this region, detected only the clade B

species, Symbiodinium ‘muscatinei’ (nomen nudum). This

suggests that Symbiodinium clade E is rarely, if ever,

found at readily detectable concentrations within hosts

and may not form stable mutualisms with Cnidaria.

Although many Symbiodinium are metabolically impor-

tant to their hosts (Muscatine et al. 1981), others may

instead exist as normal free-living dinoflagellates (Gou

et al. 2003; Hirose et al. 2008; Jeong et al. 2012; LaJeu-

nesse 2002; Porto et al. 2008; Yamashita and Koike 2013).

Recently, Jeong et al. (2012) demonstrated that isolates of

clade E are phagotrophic and capable of voraciously con-

suming other micro-algae and bacteria, indicating that the

ecological breadth of some Symbiodinium spp. extends

well beyond mutualistic associations. Preliminary analysis

of sequences of the SSU and internal transcribed spacers

(ITS) of ribosomal DNA (rDNA) indicate that isolates of

Symbiodinium clade E are genetically very similar.

In this study, we gathered available strains of clade E

originating from different coastal regions in the temperate

Pacific Ocean and one strain from the Mediterranean Sea

(Fig. S1) and sequenced their ribosomal large subunit

(LSU) gene, as well as chloroplast 23S LSU (cp23S), the

noncoding region of the psbA minicircle (psbAncr) and mito-

chondrial cytochrome b (cob) gene markers. These genetic

markers provide data from independent nuclear and plastid

sources of the organism’s genome, and are commonly

used in the analysis of Symbiodinium diversity and ecology

(e.g., LaJeunesse et al. 2012; Sampayo et al. 2009). We

then used light microscopy (LM), scanning electron micros-

copy (SEM), and transmission electron microscopy (TEM)

to examine in detail the morphology among clade E strains.

We characterized the first complete thecal plate organiza-

tion of the mastigote life stage of a verified Symbiodinium

and compared this with the partial plate formula described

for Symbiodinium natans (clade A), the only other species

for which these data are available (Hansen and Daugbjerg

2009). Our results provide a basis for interpreting diversity

within clade E as being a single species and discuss

differences in morphology and Kofoidian plate tabulation

between representatives of distantly related Symbiodinium

clades.

MATERIALS AND METHODS

Origin of Symbiodinium clade E strains in culture

We obtained cultures identified as belonging to Symbiodi-

nium clade E originating from the northeastern, south-

western, and northwestern temperate Pacific and

Mediterranean Sea (Table 1; Fig. S1). Clonal cultures of

clade E from Korea were obtained from plankton samples

collected in waters off Jeju Island in 2008, 2011, and

2012 (SvFL 1 through SvFL 6; Jeong et al. 2012). A cul-

ture of clade E was also obtained from the tissues of the

stony coral A. japonica from the same region (SvIC 1). A

culture from Cook’s Strait, New Zealand, CCMP 421,

determined to be clade E (LaJeunesse 2001), was

obtained from the National Center for Marine Algae and

Microbiota (NCMA), Boothbay Harbor, Maine. The clade E

culture from the original collection of Robert K. Trench

(rt-383) was also obtained (LaJeunesse 2001). Two

cultures described as clade E were obtained from a recent

study in the northwest Pacific Ocean that examined the


Journal of Eukaryotic Microbiology 2014, 61, 75–9476

Symbiodinium voratum, n. sp. Jeong et al.

diversity and distribution of free-living Symbiodinium over

a broad latitude (strains MJa-B6-Sy and TSP-C2-Sy are

available from the Biological Resource Center, National

Institute of Technology and Evaluation, Japan, under the

accession numbers, NBRC-109931 and -109932, respec-

tively; Yamashita and Koike 2013). Finally, one culture orig-

inating from a surface plankton sample off the coast of

Spain in the Mediterranean Sea (RCC 1521) was obtained

from the Roscoff Culture Collection, France.

DNA extraction, PCR amplification, and sequencing

For strains SvFL 1 through SvFL 6, 50 ml was collected

from exponentially growing cultures and genomic DNA

extracted using AccuPrep Genomic DNA Extraction Kits

(Bioneer, Daejeon, Korea). Nucleic acids were extracted

from approximately 30 mg of pelleted cells from each of

the remaining strains listed in Table 1 using the Wizard

DNA prep protocol (Promega Corporation, Madison, WI).

Amplification of the SSU, ITS1-5.8S-ITS2, and LSU of

rDNA, PCR reactions, sequencing, and alignment were

performed according to Kang et al. (2011). Briefly, reaction

mixtures contained 19 PCR buffer with 1.5 mM MgCl2,

0.2 mM dNTPs, 0.5 lM each primer, 5 U of Taq DNA

polymerase (Bioneer, Daejeon, Korea), and 200 ng of tem-

plate DNA. The DNA was amplified in a Mastercycler ep

gradient (Eppendorf, Hamburg, Germany) using the follow-

ing cycling conditions: 3 min at 95 °C, followed by 35

cycles of 45 s at 95 °C, 40 s at the selected annealing

temperature, and 1 min at 72 °C, with a final extension of

5 min at 72 °C. The annealing temperature was adjusted

depending on the primers used, according to the manufac-

turer’s instructions. The annealing temperatures for the

pairs of EUKA/G23R, G17F/EUKB, Dino1209F/ITSR2, and

D1R/LSUB were 50 °C, 45 °C, 50 °C, and 49 °C.Extracted DNA was used as a template to amplify approxi-

mately 900 bp of the nuclear-encoded SSU, ITS1, 5.8S,

ITS2, and LSU rDNA gene using primers the following

respective primer pairs: EUKA (5-CTG GTT GAT CCT

GCCAG-3; Medlin et al. 1988) and G23R (5-TTC AGC

CTTGCG ACC ATA C-3; Litaker et al. 2003); G17F (5-ATA-

CCG TCC TAG TCT TAA CC-3; Litaker et al. 2003) and

EUKB (5-TGA TCC TTC TGC AGG TTC ACC TAC-3; Medlin

et al. 1988); Dino 1209F (5-GGG CAT CAC AGA CCT G-3)

and ITSR2 (5-TCC CTG TTC ATT CGC CAT TAC-3; Litaker

et al. 2003), and D1R (5-ACC CGC TGA ATT TAA GCA

TA-3; Scholin et al. 1994) and LSUB (5-ACG AAC GAT

TTG CAC GTC AG-3; Litaker et al. 2003). The D1/D2

domains of the LSU was amplified from CCMP 421, rt-

383, RCC 1521, MJa-B6-Sy, TSP-C2-Sy, and directly

sequences according to the reactions conditions given by

Zardoya et al. (1995) using the primers, 28Sforward (5′-CCCGCT GAA TTT AAG CAT ATA AGT AAG CGG-3′) and

28Sreverse (5′-GTT AGA CTC CTT GGT CCG TGT TTC AAG

A-3′) with an annealing temperature of 66 °C. PCR prod-

ucts were sequenced using an ABI PRISM 3700 DNA

Analyzer (Applied Biosystems, Foster City, CA).

The ecology, evolution, and systematics of Symbiodini-

um are studied primarily using genetics and, therefore,

genes from the chloroplast and mitochondrial genomes

were sequenced to provide a more complete genetic char-

acterization. The chloroplast cp23S and mitochondrial cob

Table 1. Strains of clade E Symbiodinium used to describe the species S. voratum using genetics, morphology, ecology, and/or behavior

Culture Collection region

Collection

location Latitude Longitude Sample origin Cultured by Year

CCMP 421 Southern Western

Pacific

Cooks Strait,

New Zealand

41°21′00″S 174°79′50″E Plankton tow Changa 1980

rt-383 Eastern North Pacific Santa Barbara,

CA

34°24′16″N 119°50′38″W Anthopleura

elegantissima

(sea anemone)

Polne-Fullerb 1989

RCC 1521 Mediterranean Sea Blanes, Spain 41°39′35″N 2°48′50″E Surface sample Ian Probert 2001

SvIC 1 Western North Pacific Jeju Island,

South Korea

33°16′36″N 126°10′14″E Alveopora japonica

(stony coral)

Hae Jin Jeongc 2008

SvFL 1 Western North Pacific Jeju Island,

South Korea

33°28′07″N 126°19′28″E Plankton tow Hae Jin Jeongc 2008

SvFL 2–5 Western North Pacific Jeju Island,

South Korea

33°16′40N 126°43′64E Plankton tow Hae Jin Jeongd 2011

SvFL 6 Western North Pacific Jeju Island,

South Korea

33°16′36 N 126°10′14 E Plankton tow Hae Jin Jeongd 2012

MJa-B6-Sy Western North Pacific Muroto Cape,

Kochi, Japan

33°15′N 134°10′W Jania sp. (calcified

red alga)

Hiroshi Yamashitae 2008

TSP-C2-Sy Western North Pacific Tsushima Is.

Nagasaki, Japan

34°11′N 129°17′W Padina sp.

(brown alga)

Hiroshi Yamashitae 2008

aChang (1983).bPolne-Fuller (1991).cJeong et al. (2012).dThis study.eYamashita and Koike (2013).



Jeong et al. Symbiodinium voratum, n. sp.

were amplified and directly sequenced for the cultures

CCMP 421, rt-383, RCC 1521, SvIC 1, SvFL 1, MJa-B6-Sy,

and TSP-C2-Sy (Table 1) according to Santos et al. (2002)

and Zhang et al. (2005), respectively. For sequences of

the cp23S, approximately 60 bases of the hyper-variable V

region removed to unambiguously align representatives

from different ‘clades’ (Santos et al. 2003). The noncoding

region of the psbA minicircle (psbAncr) was amplified and

sequenced using the primers and reaction conditions

given in LaJeunesse and Thornhill (2011) to further resolve

genetic differences between strains.

In several cases, LSU, cp23S, and cob, sequences were

also obtained from described species and those provision-

ally named without formal characterization (nomen nudum)

to include in subsequent phylogenetic analyses. All new

sequences were submitted to GenBank and the accession

numbers labeled as bolded font on each phylogenetic tree

(see below). Sequences from described and undescribed

species of Symbiodinium, generated during this research

(see above) or downloaded from GenBank, were then

included in phylogenetic analyses.

Sequence alignments and phylogenetic analysis

Sequences of LSU, cp23S, and cob were aligned by eye

or using the programs MEGA v.4 (Tamura et al. 2007) and

Clustal X2 (Larkin et al. 2007). Maximum Parsimony using

the software Paup 4.0b10 (Swofford 2000) was used with

default settings to perform phylogenetic analyses on

aligned sequence data under the criteria of maximum par-

simony (with indels included as a fifth character state).

Bayesian analyses were also conducted using MrBayes

v.3.1 (Huelsenbeck and Ronquist 2001; Ronquist and Huel-

senbeck 2003), with a default GTR + G + I model. The

“burnin” was set at 25% of one million iterated genera-

tions. For each alignment, four independent Markov Chain

Monte Carlo analyses were performed, as described by

Kang et al. (2010). Maximum likelihood (ML) analyses

were conducted using the RAxML 7.0.4 program with a

GTR + G model (Stamatakis 2006). We used 200 indepen-

dent tree inferences to identify the best tree. ML boot-

strap values were determined using 1,000 replicates.

Ecological detection through quantitative PCR

Preliminary analyses for the presence of clade E were

conducted on the scleractinian A. japonica, the source of

strain SvIC 1 (Table 1). The ITS2 rDNA sequences of

strains obtained from the environment (GenBank acces-

sion no. HF568830–HF568835, HE653238) and from the

tissues of A. japonica (SvIC 1; HE653239) were aligned

with those of related dinoflagellates available from Gen-

Bank using the program MEGA v.4 (Tamura et al. 2007).

The design of quantitative PCR (qPCR) Taqman probes

was based on ITS2 rDNA sequences of clade E as

described by Park et al. (2009). The specificity of the for-

ward and reverse primers (Table S1) was tested by their

ability to amplify 18 other nonclade E Symbiodinium iso-

lates by conventional PCR (Table S1).

The density of clade E cells in A. japonica was calculated

for single polyps (~1.5 cm) obtained from colonies at three

sites from sub-tidal waters off Jeju Island, Korea, in June

2012. The exterior of each polyp was washed thoroughly

with filtered seawater (FSW) to avoid possible contamina-

tion by exogenous Symbiodinium cells. Each polyp was

then transferred to a 1.5-ml tube and ground with a micro-

pestle, and 1 ml of FSW was added and the sample was

homogenized. A 100-ll aliquot from each tube was trans-

ferred to a 10-ml vial containing 4.9 ml FSW and was fixed

with 3% Lugol’s solution, and total symbiont cell numbers

were calculated from three replicate counts on 1-ml SR

chamber. For qPCR, DNA from the remaining 900-ll aliquotwas extracted using the same method described above.

qPCR reactions were performed on 1 ll template DNA

combined with 0.2 lM (final concentration) primers,

0.15 lM probe, 5 ll platinum qPCR supermix-UDG (Invitro-

gen, Eugene, OR), and PCR grade water (total final vol-

ume = 10 ll). The thermal cycling conditions consisted of

3 min at 95.8 °C following by 45 cycles of 10 s at 95 °C,20 s at 60 °C, and 20 s at 72 °C. Fluorescence in each reac-

tion tube was quantified each cycle, and the threshold for a

positive reaction was determined automatically by the

qPCR instrument (Rotor Gene 6000, Corbett Research, Syd-

ney, Australia). Positive qPCR products were purified using

an AccuPrep� Gel Purification Kit (Bioneer Corp., Daejeon,

Korea), and the product was sequenced and assessed using

BLAST homology searches to confirm amplification speci-

ficity with clade E sequences in the GenBank database.

Standard curves for TaqMan-based qPCR assays were

obtained using the method described in Park et al. (2009).

The cell number of the target species in field samples was

calculated from Ct values, and was measured by compari-

son with the standard curve generated using DNA extracts

from known cell quantities of cultured isolates (Table 1).

Morphology

We examined the general morphologies of strains SvFL 1,

CCMP 421, and rt-383 by means of LM. Mastigote length

and width were measured using analysis software on

images obtained with a compound microscope (Ziess-Axi-

overt 200M; Carl Zeiss Ltd, G€ottingen, Germany). Coccoid

cells were imaged under bright-field illumination at a magni-

fication of 400X using an Olympus BX51 compound micro-

scope (Olympus Corp., Tokyo, Japan) with a Jenoptik

ProgRes CF Scan digital camera (Jenoptik, Jena, Germany).

Cell sizes for 50 individuals per cultured isolate were calcu-

lated with the program ImageJ (Abramoff et al. 2004). To

avoid the effect of age on appearance and size, cells were

photographed at approximately the same stage in culture

(between day 10 and 15 after re-inoculation into fresh

media), during the middle of log phase growth. The location

of the nucleus was determined after staining 1% formalin

fixed cells for 10 min with 4′6-diamidino-2-phenylindole

(DAPI, 0.1 lg ml�1 final concentration) (Porter and Feig

1980). Light and epifluorescence micrographs were taken

of each cell using the video analyzing system (Sony DXC-

C33. Sony Co., Tokyo, Japan). The plastid structures of




coccoid cells from a dense culture of rt-383 where imaged

in 3-D by confocal laser scanning of chlorophyll a auto fluo-

rescence excited at 488 nm (LaJeunesse et al. 2010a).

We examined isolates SvFL 1 and CCMP 421 to com-

pare external and internal morphology using SEM and

TEM because they originate from different hemispheres

and their time in culture differed substantially (SvFL 1 was

isolated in 2008, whereas CCMP 421 was cultured more

than 30 yr ago in 1980; Table 1). For SEM, 5-ml aliquots

of cultures (~5,000 cells/ml) were fixed for 10 min in

osmium tetroxide at a final concentration of 0.5% (v/v) in

seawater. The processes of cell concentration, dehydra-

tion, drying, and imaging were identical to those described

by Kang et al. (2010).

For TEM, cells from dense cultures of strain SvFL 1 and

CCMP 421 were transferred to a 10-ml tube and fixed in

2.5% (v/v) glutaraldehyde (final concentration) in the culture

medium. After 1.5–2 h, the contents of the tube were

transferred to a 10-ml centrifuge tube, and concentrated at

1,610 g for 10 min in a Vision Centrifuge VS-5500 (Vision

Scientific Company, Bucheon, Korea). A pellet from the

tube was subsequently transferred to a 1.5-ml tube, and

rinsed in 0.2 M sodium cacodylate buffer at pH 7.4. After

several rinses in 0.2 M sodium cacodylate buffer, the cells

were postfixed for 90 min in 1% (w/v) osmium tetroxide in

deionized water. The pellet was then embedded in agar.

Dehydration was performed in a graded ethanol series

(50%, 60%, 70%, 80%, 90%, and 100% ethanol, followed

by two changes in 100% ethanol). The material was embed-

ded in Spurr’s low-viscosity resin (Spurr 1969). Serial sec-

tions were prepared on an RMC MT-XL ultramicrotome

(Boeckeler Instruments Inc., Tucson, AZ), and stained with

3% (w/v) aqueous uranyl acetate followed by lead citrate.

Sections were viewed with a JEOL-1010 transmission elec-

tron microscope (JEOL Ltd., Tokyo, Japan). Chromosome

number (� SE) was calculated from serial sectioning (80–100 nm) of the nuclei from five cells of the isolate SvFL 1.

Motility

Cell motility (the presence of mastigotes) was initially

determined by viewing the bottom of a test tube using an

inverted scope and various times in the light/dark cycle.

For calculating the proportion of motile cells for each cul-

ture by placing 10 ll onto a glass slide, then covered with

at 25 9 25 mm coverslip and sealed with VALAP (equal

parts vaseline, lanolin, and paraffin) to prevent evaporation

and drying of the sample. Under a magnification of 400X,

coccoid and spinning (mastigote) cells in several random

fields of view were counted and relative proportions calcu-

lated (see Fitt et al. 1981 for further details).

RESULTS

Ribosomal DNA sequences of Symbiodinium clade Estrains

The LSU sequences of the D1/D2 variable domain (an

alignment matrix of 630 bases) obtained from the Jeju

Island strains (SvFL 1–6 and SvIC 1) were identical to

CCMP 421 (KF364603), MJa-B6-Sy, and TSP-C2-Sy

(KF364604). Single-base substitutions separated these

from rt-383 (KF364605) and from RCC 1521(KF364606),

respectively (Fig. 1). RCC 1521 (Mediterranean Sea) and

rt-383 (Eastern Pacific Ocean, Southern California) differed

by 2 base substitutions. These either matched or differed

by one to several (3–4) bases when compared with

sequences deposited to GenBank (AB546600, DQ485149)

by researchers from Japan (Shihira-Ishikawa et al. unpubl.,

37.10 N 137.05 E) and the People’s Republic of China

(Gou et al. 2003), who investigated cultures obtained inde-

pendently. Phylogenetic analyses that compared our LSU

sequences with described and undescribed species from

clades A through I confirmed that these isolates comprise

a lineage, Symbiodinium clade E, that is distantly related

to clades A, D, and G (Fig. 1).

Our supplemental analyses of SSU and ITS rDNA were

consistent with the LSU. Further indicating that this line-

age is phylogenetically well-differentiated from all other

described Symbiodinium (Fig. S2 for SSU and Fig. S3 for

ITS1/5.8S/ITS2). SSU rDNA sequences were identical for

strains SvFL 1–6, CCMP 421, and rt-383 (Symbiodinium

“californium” nom. nud.) and only 1–3 base substitutions

different from sequences of the clade E previously depos-

ited in Genbank. The directly sequenced ITS1, 5.8S, and

ITS2 regions from SvFL 1–6 were identical to those of

CCMP 421 (EU074907), but differed from culture rt-383

(AF334659) by a single-base difference in the ITS2.

Because these rDNA regions were sequenced directly,

they represent the dominant and, therefore, evolutionarily

stable sequence variant in the genome (Sampayo et al.

2009; Thornhill et al. 2007).

Chloroplast and mitochondrial sequencesof Symbiodinium clade E strains

Sequences of the partial cp23S (an alignment matrix of

645 bases) and mitochondrial cob (an alignment matrix of

920 bases) were identical among isolates analyzed from

the northwestern, southwestern, and northeastern Pacific

provinces and Mediterranean Sea (Table 1 and Fig. 2A, B).

Both cp23S and cob sequences were aligned with the

voucher sequences of formally described species from

other clades and those provisionally named in the litera-

ture based on genetic and ecological evidence (nomen nu-

dum, indicated by quotation marks). The cp23S and cob

phylogenies were generally congruent, but not identical.

The cob phylogeny (Fig. 2B) placed clade E ancestral to

clade D similar to the phylogeny inferred by the LSU,

whereas the cp23S phylogeny instead placed clade D

ancestral to clade E (Fig. 1).

Analysis of partial psbAncr sequences found genetic

differences among four of five clade E isolates analyzed

(Fig. S4). Direct sequencing of this entire region was not

possible, probably because of the existence of large

insertion–deletions (indels) that we interpret as intrage-

nomic variantion based on previous cloning and sequenc-

ing analysis conducted on clonal cultures (see




SvIC 1

MJa-B6-SyTSP-C2-Sy [KF364604]

CCMP 421 [KF364603]rt-383 [KF364605]

RCC 1521 [KF364606]

SvFL1 to SvFL 6 [HF568830-HF568835]

10 changes

Pelagodinium “Gymnodinium” beii [AF060900]

Clade G

Clade I

subclade Fr2

subclade Fr3

subclade Fr4

subclade Fr5

Clade H

S. “trenchi” (Type D1a)[KF740689] Clade D

Clade C

Clade B

Clade A

(LSU)

1.00/96

1.00/95

1.00/98

1.00/100

1.00/100

0.99/94

1.00/100

1.00/100

1.00/100

1.00/100

1.00/1001.00/100

1.00/100

1.00/100

1.00/100

.83/78[AJ291537][AJ291538]

[AJ291539]

[AF27458] PK13

[AJ291520][AJ291513]

[AJ621129][AJ621148]

[AJ872077]

[AJ291529]

[AJ621147][AJ621145]

[FN561562][FN561559]

[AJ308895][AJ830916]

[AJ830912]

[AJ830908][AJ830911]

S. voratum n. sp.

S. pilosum (Type A2, rt-185) [KF740671]Type A4 [KF364602]

S. microadriaticum (Type A1) [KF364600]

(Type A3) [KF364601]

Clade E

1.00/100

S. minutum (Type B1) [AF424559]S. psygmophilum (Type B2) [AF427460]

S. kawagutii (Type F1) [AF427462]

S. goreaui (Type C1) [FJ529523]

Type F2 (LaJeunesse 2001) [KF740673]

Type C35a [FJ529529]Type C79 [FJ529528]

Type C33a [FJ529531]

Type C3n-t [FJ529530]

Type C8a [FJ529526]



F type in Alveopora japonica [KF740685]

Type C2 (LaJeunesse 2001) [KF740672]Type C15 [KF740678]

Type C33 [FJ529532]

Type C71a [KF740683]

Type C40 [KF740681]

Type C3u [KF740676]Type C7 [KF740677]

Type C140 [KF740684]

Type C21 [KF740679]

Polarella glacialis [AY571373]

Type D8/D13 [KF740686/7]

Type C1d [KF740675]Type C1c [KF740674]

Type C31 [KF740680]

Type C57 [KF740682]

Type D15 [KF740688]




LaJeunesse and Thornhill 2011). Haplotypes (i.e., geno-

types) from the northwest Pacific were most similar to

each other and suggests that population genetic struc-

ture may exist between geographically separate regions

of the temperate Pacific, and is supported by LSU differ-

ences (Fig. 1).

Morphology of clade E Symbiodinium: Lightmicroscopy

Mastigote and coccoid cells occurred in all cultures exam-

ined and appeared similar (Fig. 3). The mean cell length and

width of mastigotes from SvFL 1 and CCMP 421 growing in

log phase were comparable (Table 2). Light micrographs

revealed that the hemispherical episome of the mastigote is

slightly larger than the hemispherical hyposome; moreover,

the episome and hyposome were connected by a distinct

and wide cingulum (widest part ~5.1 lm; Fig. 3). The chlo-

roplasts were brownish–yellowish and arranged at the

periphery of the cell. A single distinct pyrenoid surrounded

by a starch sheath was located in the center of each cell.

The nucleus was located in the episome, equator, or hypo-

some (Fig. S5). The average dimensions of coccoid cells

among six isolates ranged between 12.2 (� 0.16 SE) and

13.3 (� 0.18 SE) lm long by 11.1 (� 0.12 SE) and 12.2

(� 0.20 SE) lm wide (Fig. 4); and are large relative to other

described species.

Surface morphology: Scanning electron microscopy

Thecal plate patterns of mastigotes from SvFL 1 (Fig. 5)

and CCMP 421 (Fig. 6) were indistinguishable; the plates

of both strains were arranged in the Kofoidian series of x,

elongated amphiesmal vesicle (EAV), 5′, 5a, 8″, 9s, two

cingulum rows 17–20c, 6″′, and 2″″ (Fig. 7). Moreover, the

cells of SvFL 1 and CCMP 421 had a narrow apical EAV,

with 9–13 knobs at the apex (Fig. 5F, 6F). The length and

width of the EAV were 1.8–3.1 and 0.1–0.3 lm, respec-

tively, in SvFL 1, and 2.0–3.2 and 0.2–0.3 lm in CCMP

421, respectively (Table 2). The small plate (x) of both

strains was associated with the ventral part of the EAV,

which was bordered by four other apical plates (2′–5′, seeFig. 5E, F, 6E, F, 7C). The rhomboid-shaped 1′ plate was

relatively large, whereas the quadrangular 2′ plate was rel-

atively small. The pentagonal 3′ plate touched the 2′, 4′,1a, and 2a plates; the pentagonal 4′ plate touched the 3′,5′, 2a, 3a, and 4a plates; and the pentagonal 5′ plate

touched the x, 4′, 4a, and 5a plates (Fig. 7C). Under the

conditions used in this study, some cells of CCMP 421

had six or seven apical plates, instead of the typical five

apical plates (Fig. S6).

We observed eight precingular plates (Fig. 5A–D, 6A–D,7A, B). The 1″, 4″, and 6″ plates were quadrangular, while

the 2″, 3″, 5″, 7″, and 8″ plates were pentagonal. We also

observed five intercalary plates. The hexagonal 1a plate

touched the 1′, 2′, 3′, 2a, 1″, and 2″ plates, while the

hexagonal 2a plate touched the 3′, 4′, 1a, 3a, 2″, and 3″plates. Furthermore, the heptagonal 4a plate touched

the blank; 4′, 5′, 3a, 5a, 5″, 6″, and 7″ plates (Fig. 5A–D,6A–D, 7A, B).

Cells of all strains had a wide cingulum, consisting of

two rows of pentagonal amphiesmal plates (Fig. 7A, B).

Both strains contained a total of 17–20 cingular plates

(Table 2). The cingulum of SvFL 1 was displaced by ~0.1–0.2 times the cell length, and by ~0.4–1.0 times the cingu-

lar width. The cingulum of CCMP 421 was displaced by

~0.1–0.2 times the cell length, and by ~0.6–1.1 times the

cingular width (Table 2).

The cells of both strains generally contained six postcin-

gular plates (Fig. 5G, 6G, 7D). However, under the culture

conditions used in this study, some cells of SvFL 1 con-

tained seven postcingular plates (Fig. S6A, B). With the

exception of the pentagonal 3″′ plate, all postcingular

plates were quadrangular (Fig. 5G, 6G, 7D). In both

strains, two antapical plates were present (Fig. 5G, 6G,

7D). The 2″″ plates of most cells were hexagonal, and

touched the 3″′, 4″′, 5″′, 6″′, and 1″″ plates, and also the

posterior sulcal plate (S.p.). However, some cells of SvFL

1 had heptagonal 2″″ plates, which touched the 3″′, 4″′, 5″′,6″′, 7″′, 1″″ plates, and also the S.p. (Fig. S7A, B). More-

over, some cells of SvFL 1 had three antapical plates (Fig.

S7C, D).

Cells of both strains contained approximately seven sul-

cal plates and two plates (S?) of unknown homology

(Fig. 7A) comprising the large, S.p. plate, one to three

accessory sulcal plates (S and S?) and approximately five

smaller unnamed plates (shaded gray) adjacent to or pos-

sessing pores for the transverse and longitudinal flagella

and peduncle (Fig. 5H, 6H, 7A). Mastigotes possessed a

well-formed peduncle extending near the base of the

longitudinal and transverse flagella.

Internal morphology: Confocal and transmissionelectron microscopy

A large portion of the cell’s outer interior is composed of

chloroplast membranes. Confocal imaging of the chloro-

plast through chlorophyll autoflorescence shows a highly

Figure 1 Consensus maximum parsimony tree based on 630 bp aligned positions of the D1/D2 region of the ribosomal large-subunit (LSU) region

for all the major Symbiodinium lineages (i.e., clades) with Pelagodinium (=Gymnodinium) beii and Polarella glacialis included as outgroup taxa. The

numbers associated with major branches indicate the Bayesian posterior probability (left; posterior probabilities ≥ 0.8 are shown) and bootstrap

values (right; based on 1000 replicates). Sequences of the strains analyzed in this study form a highly divergent monophyletic group distinct from

all other clades. The phylogenetic positions of the voucher sequences for both formally and informally described Symbiodinium spp. are shown in

addition to numerous undescribed species. Refer to Table 1 for the collection locations of each Symbiodinium voratum strain. The sequences for

bold-faced Genbank accession numbers were generated as part of this research.




branching-crenulated plastid structure involving diverticula

with ovate or oblong portions of thylakoid stacks intercon-

nected over most of the cell’s periphery (Fig. 8A). Chloro-

plast diverticula were also observed using TEM and

appressed against the cell’s plasma membrane (data not

shown).

A single pyrenoid (~2 lm) located toward the central

part of each cell was connected by two stalks to the adja-

cent chloroplast and surrounded by a distinct polysaccha-

ride cap (Fig. S8A, B). No chloroplast thylakoid lamellae

penetrated the pyrenoid. A large number of lipid globules

and starch were observed (data not shown). Furthermore,

an eyespot, or stigma (~1.0 lm) consisting of multiple lay-

ers (n = 4–5) of rectangular electron-translucent vesicles,

or crystalline deposits, was observed associated with the

plastid near the cytoplasmic surface of the hypocone in

sectioned mastigote cells (Fig. 8B, C).

Serial section reconstructions of nuclei (n = 5) from

strain SvFL 1 found 74 � 1.5 (SE) condensed chromo-

somes and a nucleolus (Fig. 8D, E). This number repre-

sents an average; the actual chromosome numbers were

72, 73, 73, 75, and 77.

Motility in culture

All of the cultured clade E strains we analyzed produced

high proportions of motile cells during exponential growth

during the middle of the light cycle (~70–90%). Further-

more, all isolates sustained some portion of cells in the

mastigote phase during the dark cycle (~10–20%). Propor-

tions of motile cells were reduced with increasing age of

the culture.

Associations with symbiotic Cnidaria: A preliminaryecological investigation

Clade E was detected at background concentrations using

qPCR in 2 of 7 A. japonica colonies all dominated by an

unidentified clade F Symbiodinium sp. (Rodriguez-Lanetty

et al. 2003). Furthermore, when detected, we calculated

that the proportion of clade E comprising the population

inside a single polyp (~1.5 cm) ranged from 0.03% to

0.06% (82/278,000 cells and 151/233,000 cells, respec-

tively). However, no other potential host sources, including

other Cnidaria, Mollusca, and Foraminifera were examined.

DISCUSSION

Symbiodinium isolates identified as clade E and originally

obtained from temperate locals in the Pacific Ocean and

Mediterranean Sea appear to comprise a single species.

While most other Symbiodinium “clades” (e.g., A, B, C,

and D) probably consist of multiple species (Finney et al.

2010; LaJeunesse et al. 2004a,b, 2010b, 2012; Sampayo

et al. 2009; Thornhill et al. 2013), the available genetic and

morphological evidence, as well as supporting ecological

and behavioral data, indicate that clade E represents a

single species.

TAXONOMIC SUMMARY

Phylum Dinoflagellata

Class Dinophyceae

Order Suessiales

Family Symbiodiniaceae

Genus Symbiodinium Freudenthal 1962

Symbiodinium voratum n. sp. Jeong, Lee, Kang, LaJeu-

nesse

DiagnosisMastigote cells are 10.8–16.2 lm in length and 7.8–11.5 lm in width. The cell episome is slightly larger than

the hyposome. Ellipsoid coccoid cells in exponentially

growing strains range in average length diameter from

12.2 (� 0.16 SE) to 13.3 (� 0.18) lm and width diameter

from 11.1 (� 0.12) to 12.2 (� 0.20) lm (individual cells

typically ranged in size from 9 to 16 lm). An EAV is pres-

ent on the apex. The cingulum consists of two rows of

pentagonal plates. The cingulum is displaced by 0.5–0.9 9 cingulum width. Plates are arranged as x, EAV, 5′,5a, 8″, 9s, 17–20c, 6″′, and 2″″. A single, two-stalked

pyrenoid is present and is without thylocoid intrusion. An

eyespot is located beneath the sulcus in motile cells. A

well-developed peduncle used in phagotrophic feeding

emerges between the longitudinal and transverse flagella.

The nucleus contains a nucleolus and 74 (� 1.5) con-

densed chromosomes. In culture, a portion of cells remain

motile throughout the light-dark cycle and is unique among

Symbiodinium.

Type materialA holotype SEM stub of cells from culture SvFL 1, fixed

with 0.5% (v/v) osmium tetroxide, has been deposited in

the Protist Type Specimen Slide Collection, United States

Natural History Museum, Smithsonian Institution, Wash-

ington, DC, USA, as USNM slide 1221049.

Type habitatThe type specimen was acquired from a plankton sam-

ple. In addition to being planktonic, S. voratum occurs in

benthic habitats, including corals and macro-algal surfaces,

but their relationship with these substrates requires fur-

ther study (Table 1). The phagotrophic capacity of this spe-

cies and ecological distribution suggests that it is

primarily, if not exclusively, free-living and occurs in sub-

tropical to temperate regions.

Figure 2 Maximum parsimony analysis of (A) partial chloroplast 23S (cp23S; 645 aligned positions) and (B) Cytochrome b (cob; 920 aligned posi-

tions) sequences obtained from cultured isolates of clade E and compared against voucher sequences for described and undescribed Symbiodini-

um spp. The numbers associated with major branches indicate the Bayesian posterior probability (left; posterior probabilities ≥ 0.85 are shown)

and bootstrap values (right; based on 1,000 replicates). Refer to Table 1 for the collection locations of each Symbiodinium voratum strain. The

sequences for bold-faced Genbank accession numbers were generated as part of this research.




“Gymnodinium” simplex [AJ872114]

S. pilosum (Type A2) [KF740694] (Type A3) [KF740695]

Type A4 [KF740696]


S. “trenchi” (Type D1a) [KF220382]

S. minutum (Type B1) [JX213587]S. psygmophilum (Type B2) [JX213589]

S. kawagutii (Type F1) [ KF740700]

S. goreaui (Type C1) [FJ529545]

.99/100

.98/98

.87/56

1.0/81.87/67

S. voratum n. sp. [KC795966]

(cp23S)

S. kawagutii (Type F1) [KF206029]

S. goreaui (Type C1) [KF206028]

S. “muscatinei”

S. minutum (Type B1) [JX213579]S. psygmophilum (Type B2) [JX213582]

S. “trenchi” (Type D1a) [KF193523]

S. pilosum (Type A2) [KF206026]Type A4 [KF206027]


Pelagodinium “Gymnodinium” beii [JN557967]

(mt cob)

.99/90

S. voratum n. sp.[KC795967]

1.0/100

1.0/100

1.0/100

1.0/100

1.0/100

1.0/100

1.0/100

1.0/naWashington [KF193518]California [KF193519]

Type D15 [KF193522]

Type D15 [KF220381]

SvIC 1

MJa-B6-SyTSP-C2-Sy

CCMP 421rt-383

RCC 1521

1.0/100

Polarella glacialis [JN558036]

5 changes

5 changes

SvFL1

Type F2 (LaJeunesse 2001) [KF740701]F type in Alveopora japonica [KF740702]

Type C35a [FJ529548]Type C79 [FJ529549]Type C33 [FJ529554]Type C33a [FJ529553]

Type C3n-t [FJ529555]Type C8a [FJ529550]Type C78a [FJ529551]Type C3 [FJ529546]


Type D8/D13 [KF220379/0]

Polarella glacialis [ JX262537]

Type F2 (LaJeunesse 2001) [KF740691]

(Type A3) [KF740690]

SvIC 1

MJa-B6-SyTSP-C2-Sy

CCMP 421rt-383

RCC 1521

SvFL1

Type D8/D13 [KF220320, KF220321]

Type C35a [FJ529537]Type C79 [FJ529538]


Type C3n-t [FJ529544]

Type C8a [FJ529539]


Type C3 [FJ529535]


F type in Alveopora japonica [KF740692]

.90/95

Clade D

Clade A

Clade B

Clade C

Clade F

Clade C & F

Clade D

Clade B

Clade A

Clade E

Clade E

Clade F

A

B

S. “muscatinei” Washington [KF740697]California [KF740698]

1.0/100

Type C7 [KF740699]




mastigote coccoid doublet

A

B

C

PY

PY

PY

Figure 3 Light micrographs of mastigote (motile), coccoid (spherical), and doublet (dividing) cells from several cultured isolates: (A) SvFL 1, (B)

CCMP 421 (previously Gymnodinium varians), and (C) Culture rt-383 (previously Symbiodinium “californium”). A single pyrenoid (PY) is generally

located in the center of the cell. All cell types contain a reticulated chloroplast located at the periphery of the cell. All scale bars = 2 lm.

Table 2. Morphological comparison mastigotes from strains SvFL 1 and CCMP421 compared with Symbiodinium natans (Hansen and Daugbjerg

2009) and Pelagodinium beii (modified from Siano et al. 2010)

Mastigote character traits SvFL 1 CCMP 421

Symbiodinium

natans Pelagodinium beii

AP length (lm) (living cells) 10.8–16.2 (13.1) 10.1–17.1 (12.8) 9.5–11.5 (10) 8.8–11.4 (10 � 0.8)

Cell width (lm) (living cells) 7.8–11.5 (9.5) 8.1–14.4 (10.3) 7.4–9.0 (8) 6.0–7.5 (6.6 � 0.4)

Ratio of length to width (living cells) 1.1–1.8 (1.4) 1.2–1.3 (1.2) NA NA

AP length (lm; SEM) 8.5–12.4 (10.5) 7.0–13.0 (11.7) 10.38a 8.9a

Cell width (lm) (SEM) 6.4–9.8 (8.2) 5.8–10.9 (9.2) 8.25a 5.79a

Ratio of AP to width (SEM) 1.2–1.4 (1.3) 1.2–1.4 (1.3) 1.26a 1.54a

EAV length (lm) 1.75–3.09 (2.45) 1.98–3.19 (2.64) 2.0 2.0a

EAV width (lm) 0.15–0.27 (0.2) 0.18–0.29 (0.22) 0.2 0.21a

Numbers of small knobs in EAV 9–13 9–13 12.0 16.0a

Cingulum displaced by cell length 0.13–0.21 (0.15) 0.10–0.19 (0.15) 0.23a 0.2a

Cingulum displaced by cingular width 0.48–0.85 (0.65) 0.55–1.10 (0.78) 1.0 0.51a

Numbers of cingular plates 17–20 17–20 20.0 19.0a

2a plate Hexagonal Hexagonal Pentagonalb Hexagonal (=24 plate)

4a plate Heptagonal Heptagonal Hexagonalb Pentagonal (=26 plate)

Numbers of apical plates (′) 5 5 4 4

Numbers of intercalary plates (a) 5 5 5 7 (=23,4,6,7/31–3 plate)

Numbers of precingular plates (″) 8 8 8 9 (=22/41–8 plate)

Numbers of postcingular plates (″′) 6 6 6 8 (=71–8 plate)

Numbers of antapical plates (″″) 2 2 2 4 (=81–4 plate)

Existence of eyespot Yes Yes Yes Yes

Plate formula x, EAV, 5′, 5a, 8″, 9s,

17-20c, 6″′, 2″″

x, EAV, 5′, 5a,

8″, 9s, 15-18c, 6″′, 2″″

x, EAV, 4′, 5a, 8″,

?s, ?c, 6″′, 2″″

x, EAV, 5′, 7a, 9″,

?s, 19c, 8″′, 4″″

AP = anteroposterior; EAV = elongated amphiesmal vesicle; NA = not available.aNot mentioned, but measured from figures.bNot mentioned, but seen in figures.Boldfaced type indicates were plate tabulation differs between species.

Mean values are shown in parentheses.




Type localityJeju Island, Korea (33°28′07″N, 126°19′28″E).EtymologyThe Latin name “voratum”, or to eat greedily, refers to

the phagotrophic nature of this organism in the presence

of bacteria and other eukaryotic microalgae (Jeong et al.

2012).

Gene sequencesThe combined nucleotide sequences of the nuclear

ribosomal SSU, ITS1/5.8S/ITS2, and LSU (3,201 bases;

HF568830), as well as the chloroplast 23S (KC795966),

and mitochondrial cob (KC795967) obtained from strain

SvFL 1 are voucher sequences that differentiate this

species from all other described Symbiodinium spp.

(Fig. 1, 2).

Other notesStrain rt-383 was first recognized as distinct from other

formally described species and provisionally designated

Symbiodinium “californium” by Banaszak et al. (1993), but

is now a synonym for S. voratum. Cultured strains of this

species CCMP 421, CCMP 3410 are housed at the Prova-

soli-Guillard NCMA (East Boothbay, ME); and at the NITE

biological Resource Center (Japan) under accession num-

bers NBRC-109931 and -109932.

The biology of Symbiodinium voratum

Genetics and species resolutionGenetic markers are used exclusively for identification

when researching the ecology and evolution of Symbiodi-

nium. For this reason, we included analysis of genes from

the nuclear, chloroplast, and mitochondrial genomes

shown to have utility in differentiating between ecologi-

cally distinct Symbiodinium spp. (LaJeunesse et al. 2012;

Sampayo et al. 2009). The only genetic variation we

detected occurred in the LSU (Fig. 1) and ITS2 involving

single-base differences between strains collected at loca-

tions separated by thousands of kilometers and from dif-

ferent ocean basins. Based on currently accepted

standards, these differences are too small to justify that

clade E comprises more than a single species (Haywood

et al. 2004; Stern et al. 2010, 2012). Future environmental

surveys of dinoflagellate biodiversity may uncover other

members of this group (Lin et al. 2009; Stern et al. 2010).

With access to more isolates and the application of higher

resolution genetic markers (e.g., microsatellites), evidence

may emerge to taxonomically split this species.

The rDNA and cp23S sequence divergence between S.

voratum and its nearest phylogenetic neighbors, members

in clades A, D, and G, is equivalent to the genetic differ-

ences observed between genera or families of other dino-

flagellates (Heywood et al. 2004; Rowan and Powers

1991; Stern et al. 2010, 2012). Conservative molecular

clock estimates place the time of divergence of S. vora-

tum (clade E) from all other Symbiodinium at between 50

and 65 Ma (Tchernov et al. 2004 based their calculation

on a molecular clock for LSU calibrated from the fossil

record of Alexandrium cysts; Pochon et al. 2006 based

their calculations on cp23S calibrated from geographic and

host paleontological evidence).

BiogeographySymbiodinium voratum appears to be distributed across

high sub-tropical and low temperate latitudes. The two

strains characterized from New Zealand and North Amer-

ica, respectively, indicate that S. voratum occurs in tem-

perate waters throughout the Pacific Ocean. The finding

of a strain (RCC 1521) in the Mediterranean Sea confirms

that it also occurs in the Atlantic region. The frequency

with which S. voratum is cultured suggests that it is espe-

cially common in coastal waters of the western temperate

Pacific Ocean (e.g., Fan et al. 2007; Gou et al. 2003; Shao

et al. 2004). During an extensive project that sought to

culture “free-living” Symbiodinium from coastal habitats

along a broad latitudinal gradient, strains of S. voratum

were only isolated from temperate locations near the main

islands of Japan (Yamashita and Koike 2013; Table 1). The

available biogeographic evidence, therefore, suggests that

S. voratum is cold water adapted and may tolerate tem-

peratures as low as 10–12 °C. This is supported by physi-

ological measurements taken on culture rt-383, which

showed that this strain grew optimally at 15–20 °C, but

also grew at 12 °C and 28 °C, albeit more slowly (McBride

et al. 2009). Additional physiological work on rt-383 and

other strains can better define the thermal tolerance of S.

voratum and may explain its observed geographic distribu-

tion and environmental abundances.

The genetic similarity among strains suggests that

this species is highly dispersive across large areas of the

8.0

9.0

10.0

10.0 11.0

cell length (µm)

cell

wid

th (µ

m)

8.0

9.0

7.0

7.0

13.012.0 14.0

11.0

13.0

12.0

14.0

S. minutum

SvIC 1

MJa-B6-SyTSP-C2-Sy

CCMP 421

rt-383

SvFL1

Figure 4 The range of known Symbiodinium cell sizes among cul-

tured isolates (gray shading). The average coccoid cell size for six iso-

lates of clade E Symbiodinium (symbols correspond to origin of

collection for each isolate as designated in Fig. S1) place them at the

upper-most size range. For comparison, the average sizes of Symbi-

odinium minutum (dark circles) are graphed (data from LaJeunesse

et al. 2012). These bounds in cell size represent a fourfold difference

in volumes between the smallest and largest of Symbiodinium. Error

bars represent standard error calculated from 50 measurements.




5aX

7’’

3’2’

8’’

1a

1’ 1’’2’’

SS?

CC

5’

8’’

1a

1’1’’

2’’

C CC C C

S?

S

6’’’S.p.

Tf

Lf 1’’’ 2’’’’

1’’’’2’’’’

CPe

Tf

1a

2a

3’’’ 4’’’

C C

C C

CC

5’’’2’’’

4’4a

2’’3’’

3a

4’’

5’’

6’’1’’

A B C

D E F

CCCC C

CCCCC

3’

4’

5’2’

x4’’’ 5’’’

2’’’’

6’’’

4’’ 5’’ 6’’ 7’’

3a 4a

4’5’ 5a

x5a

5’

7’’

4a4’

2a

2’’1a

1’

2’

3’

3a

8’’

6’’

3’’

1’’

HG6’’’

S.p. S1’’’

1’’’’2’’’

3’’’4’’’

5’’’ 2’’’’

S?S?

C

Pe

1’’’S.p.

S

C

1’1’’

EAV

S

Figure 5 Scanning electron micrographs of the motile cells of strain SvFL 1 from the northern temperate Pacific. (A) Ventral view showing the

episome, cingulum (C), sulcus (S), and hyposome. (B) Ventral-left lateral view showing the episome, cingulum, peduncle (PE), sulcus, and hypo-

some. (C) Dorsal view showing the episome, cingulum, and hyposome. (D) Lateral view. (E) Apical view showing the episome and elongated am-

phiesmal vesicle (EAV) plate. (F) Apical view showing the EAV plate with small knobs (arrowhead). (G) Antapical view showing the hyposome. (H)

Antapical-ventral view showing the sulcus and peduncle. All scale bars = 1 lm.




5a X

7’’

3’2’

8’’

1a

1’

1’’2’’

S?C

C

5’

8’’

1a1’

1’’ 2’’

C

C C C

S?

S?

6’’’S.p.

Tf

Lf

1’’’ 2’’’

1’’’’

C

Pe Tf

1a

2a

4’’’

CCC C

CC

5’’’

4’4a

3’’ 3a

4’’5’’ 6’’

2’’

A B C

D E F

C

CCC

3’

4’

5’

2’x

5’’’ 6’’’

1’

8’’7’’

5a4a

5’1a

x5a

5’

7’’

4a 4’2a

2’’1a

1’

2’

3’

3a

8’’

3’’

1’’

G H6’’’

S.p. S1’’’

1’’’’

2’’’

3’’’4’’’

5’’’ 2’’’’

S?

S? C

Pe

1’’’S.p. S

C

1’ 1’’

C C

1’’’S.p.

S6’’’

2a

2a

C

3’’

2’ 3’ 4’3a 3’

2’

7’’

8’’

5’5a

1a

1’

3’

C

1’’’’6’’’

8’’

EAV

4’’

Tf

Figure 6 Scanning electron micrographs of motile cells of strain CCMP 421 (previously Gymnodinium varians) from the southern temperate Paci-

fic Ocean. (A) Ventral view showing the episome, cingulum (C), peduncle (PE), sulcus (S), and hyposome. (B) Ventral-left lateral view showing the

episome, cingulum, sulcus, and hyposome. (C) Dorsal view showing the episome, cingulum, and hyposome. (D) Lateral view. (E) Apical view

showing the episome and elongated amphiesmal vesicle (EAV) plate. (F) Apical view showing the EAV plate with small knobs (arrowhead). (G)

Antapical view showing the hyposome. (H) Antapical-ventral view showing the sulcus and peduncle. All scale bars = 1 lm.




Pacific Ocean. Genetic partitioning was not evident with

conserved markers (cp23S and cob), but single-base differ-

ences in the LSU (and variation in the psbAncr Fig. S4) indi-

cate that geographically distant populations of S. voratum

are genetically distinct (Fig. 1). The strain of S. voratum

obtained in the Mediterranean Sea may be the result of a

recent introduction (Lilly et al. 2005), or is part of a native

population living millions of years in isolation from Pacific

populations. However, like most micro-eukaryotes, obtain-

ing sufficient specimens of S. voratum for genetic analy-

ses to measure dispersal and gene flow is presently

unfeasible.

A free-living photo-phagotrophic SymbiodiniumMany phototrophic dinoflagellates rely on phagotrophy to

supplement their dietary needs (Jeong et al. 2010; Stoec-

ker 1999). Recent characterization of phagotrophic feeding

by S. voratum (Jeong et al. 2012) suggests that this

species is capable of subsisting exclusively in the open

environment. S. voratum possesses a well-developed

peduncle used to consume bacteria or pierce the cell walls

and plasma membranes of other micro-algae to devour

their cytoplasmic contents (Jeong et al. 2012). Its isolation

from a dinoflagellate bloom in the Zhujiang (Pearl) River

estuary near Hong Kong (Fig. S1; Shao et al. 2004) sug-

gests that it may proliferate in response to the increased

presence of a prey species; and, if verified, would be the

first Symbiodinium to exhibit periodic “blooming” charac-

teristics of planktonic microalgae.

Most other Symbiodinium may have the capacity for

phagotrophic feeding. Symbiodinium natans (clade A),

Symbiodinium microadriaticum (clade A), and Symbiodini-

um kawaguti (clade F) possess a peduncle, and probably

all Symbiodinium in the mastigote stage have this feeding

appendage (Hansen and Daugbjerg 2009; Trench and

Blank 1987). Additional work with cultured strains of other

species under controlled experimental conditions is

needed to verify the generality of phagotrophic feeding

across members of the genus. Such investigations into

nutrient acquisition have the potential to change and

broaden our understanding of Symbiodinium ecology and

their role in microbial food webs.

The full ecological breadth of S. voratum remains

unknown and further investigations on the distribution of

this species may depend on using sensitive genetic assays.

Cells of S. voratum clearly associate with live substrates,

6’’’

5’’’

3’’’4’’’

S.p.

2’’’’1’’’’

1’’’

2’’’

S

S? C

6’’’ S.p.1’’’

1’’’’

S?

CC

S

C

2’’’’

2’’’

C

C

C8’’

5a

1’1’’

1a2’5’

x

2’’

C

2’’3’’

4’’

3a

5’’6’’

4a2a

4’3’

1a

C

CC

CCCC

CC C

C

3’’’ 4’’’5’’’

1’’’’ 2’’’’

4a4’

5’ 3’

2’

1’

1a

2a

3a

2’’

3’’

1’’8’’

7’’

6’’5’’

5a

4’’

A

DC

B

Figure 7 Drawings of motile cells showing the surface morphology.

(A) Ventral/Sulcal view. (B) Dorsal view. (C) Apical view. (D) Antapical

view. Cingulum (C), accessory sulcal plates (S), sulcal or cingulum

plates (S?), and posterior sulcal plate (S.p.) All scale bars = 2 lm.

A

C

D E59

686756

61

6362

50

69

65

64

66

58

B

n

Figure 8 Internal anatomy. (A) The branching-crenulated chloroplast

structures of cells from strain rt-383 imaged in 3-D using confocal

microscopy of chlorophyll autofluorescence. (B) Transmission electron

microscopy (TEM) of a transverse section of a mastigote cell from

strain CCMP 421 showing the position of the eyespot (stigma) near

the cell’s surface, and (C) magnified view indicated by the stippled

outline in panel B. Serial sectioning through the nucleus (D) and (E;

annotated) counted approximately 74 � 1.5 condensed chromo-

somes. Scale bar = 16 lm for panel A, 2 lm for B, and 1 lm for C.




such as red and brown macrophytes and cnidarian tissues

(Table 1). Our preliminary application of qPCR identified

background populations (< 0.06%) of S. voratum in some

colonies/polyps of A. japonica. This coral harbors a clade F

Symbiodinium sp. throughout its distribution around Korea

(Rodriguez-Lanetty et al. 2003; Fig. 1, 2A, B). Therefore, it

remains unclear to what extent S. voratum provides a

mutualistic benefit to A. japonica, if any, and whether S. vo-

ratum exists as a dominant stable symbiont in other yet

unexamined hosts (e.g., cnidarians, ciliates, soritid forami-

nifera, etc.). Recent infection studies found that culture

CCMP 421 was unable to establish symbiosis with the

anemone Aiptasia sp. (Xiang et al. 2013), while cells of rt-

383 repeatedly introduced to the scyphistomae of the jelly-

fish Cassiopeia sp. do not persist (LaJeunesse 2001). Both

of these Cnidaria can associate with a wide diversity of

Symbiodinium when manipulated experimentally, which

suggests that S. voratum is incapable of sustaining mutual-

istic partnerships with Cnidaria.

As with S. voratum, Symbiodinium spp. cultured from

various environmental sources are rarely, if ever, found as

endosymbionts. The putatively free-living species, Symbi-

odinium pilosum, will not proliferate in experimental apo-

symbotic hosts (LaJeunesse 2001; Schoenberg and

Trench 1980c); and while it has been obtained from vari-

ous cnidarian taxa (LaJeunesse 2001), it is yet to be found

as a dominate stable entity (or minor entity) in host tis-

sues (LaJeunesse 2002). This species is also large relative

to most other Symbiodinium (11–12 lm), suggesting that

smaller cell size volumes are necessary for a functioning

stable mutualism. The adaptation of certain Symbiodinium

to a ‘free-living’ existence may explain why many

environmentally obtained strains grow well in culture

media (Hirose et al. 2008; Porto et al. 2008; Yamashita

and Koike 2013), while species that persist in hosts as sta-

ble ‘true’ symbionts rarely flourish in vitro (Krueger and

Gates 2012; LaJeunesse 2002).

Motility in cultureSymbiodinium voratum is the only known species in cul-

ture to exhibit nocturnal motility. Time course data for

strain rt-383 in log phase (reproduced from Banaszak and

Trench 1995) are presented here to represent how iso-

lates of S. voratum sustain some portion of cells in the

mastigote phase through the entire dark cycle (Fig. 9).

The motility patterns for Symbiodinium microadriatium

and Symbiodinium minutum were also included to show

how the presence of mastigote cells for other Symbiodi-

nium spp. grown in culture appears about 1 h after the

light phase begins, then reaches peak motility early-to-

mid day, and diminishes to zero typically hours before

the start of the dark cycle (Fig. 9; Fitt et al. 1981; Fitt

and Trench 1983; Wang et al. 2008). The trace of a par-

ticular motility pattern appears to be species specific and

hence genetically controlled; however, the relative propor-

tion of cells motile in a culture are dependent on time

since inoculation, nutrient availability (kind of growth

media), and amount of irradiance (Fitt and Trench 1983;

Fitt et al. 1981; Yacobovitch et al. 2004). The high and

constant motility of S. voratum may be important to its

ecology.

Kofoidian plate tabulation and ultrastructural featuresWe preface this section by asserting that conventional

dinoflagellate morphological characters such as thecal

plate number and pattern are not easily resolved from the

mastigotes of small-celled Symbiodinium spp. (Trench and

Blank 1987). Furthermore, ultrastructural phenotype varies

substantially under different nutrient and light conditions

(Muller-Parker et al. 1996). Therefore, separate cultured

isolates, when compared morphologically, must be grown

under the same environmental conditions. Although some

Symbiodinium are easy to isolate and maintain in vitro,

most do not grow in currently available culture media.

Therefore, the use of comparative morphology will ulti-

mately have limited utility in the majority of formal species

descriptions of these dinoflagellates (LaJeunesse et al.

2012).

Our description of S. voratum provides the first com-

plete plate pattern generated from cultured isolates whose

identity was independently verified with phylogenetics. In

many cases, cultured strains of Symbiodinium have few

motile cells, and obtaining a complete plate reconstruction

is time and labor intensive. Loeblich and Sherley (1979)

documented the plate formula of a free-living Gymnodini-

um-like isolate and one obtained from the upside-down jel-

lyfish, Cassiopea sp. (isolate #395 = x [1 preapical plate],

EAV [ac], 5′, 5-6a, 9-10″, 8-9s, ~20c, 7-8″′, 3″″, and isolate

#406 = x [1 preapical plate], 5′, 4-6a, 10-11″, 8-9s, ~20c,8″′, 3″″, respectively). Each differs from S. voratum; how-

ever, because genetics were not applied to these isolates,

we are uncertain of their phylogenetic identity, and

0400 0800 1200 1600 2000 24000

20

40

60

80

100 S. voratumS. minutumS. microadriaticum

Figure 9 Percentage motility for Symbiodinium voratum (rt-383),

Symbiodinium minutum (rt-002), and Symbiodinium microadriaticum

(rt-061) growing exponentially in ASP-8A under a 14:10 h light-dark

cycle (80–160 lE/m2/s). Species can differ substantially in the propor-

tions of cells that exist in motile (mastigote) form during hours of the

light cycle. Motility rates reach high percentages (> 70%) in cultures

of S. voratum relative to other species. Uniquely, some S. voratum

cells in culture (approximately 10–20%) remain motile throughout a

24-h diurnal cycle. The diurnal motility patterns for S. microadriaticum

and S. minutum are shown for comparison. Gray portions of the graph

indicate periods of darkness. Data were obtained and figure redrawn

from Banaszak and Trench (1995) and Fitt et al. (1981).




whether or not these isolates were indeed Symbiodinium.

Symbiodinium natans (clade A) is the only other species

where a near-complete description of thecal plate num-

bers and arrangements was available (Table 2; Hansen

and Daugbjerg 2009).

The extent to which a plate comparison is possible, S.

voratum possesses one additional apical plate than S. na-

tans (x, EAV, 5′, 5a, 8″, 2 cingulum rows, 9s, 6″′, 2″″ for

S. voratum vs. x, EAV, 4′, 5a, 8″, ?c, ?s, 6″′, 2″″ for S. na-

tans). Furthermore, the anterior intercalary plate, 2a, of S.

voratum is hexagonal, but pentagonal for S. natans; and

the 4a plate of S. voratum is heptagonal, but hexagonal

for S. natans (Table 2). These differences seem minor

between two lineages whose sequence differences sug-

gests that they are evolutionarily highly divergent (> 45–50 Ma calculated by Pochon et al. 2006 for the divergence

time between clade A and clade E, using cp23S sequence

data; and > 65 Ma estimated by Tchernov et al. 2004,

using a LSU molecular clock). The existence of some api-

cal, postcingular, and antapical plate number variation

found among individual cells of strains CCMP 421 and

SvFL 1 further emphasized the need to evaluate interspe-

cific morphological variation before assigning taxonomic

significance to these features (Fig. S6, S7). The plate for-

mula for the outgroup species, Pelagodinium beii, differed

substantially from these Symbiodinium (Table 2). The

analyses of plate patterns from additional Symbiodinium in

culture will allow a more complete characterization of the

tempo and mode of morphological evolution between clo-

sely and distantly related species in this genus.

When viewed under TEM, the ultrastructure of S. vora-

tum resembled that of many other Symbiodinium (Hansen

and Daugbjerg 2009; Trench and Blank 1987). The finding

of clear diagnostic traits in ultrastructure remains a chal-

lenge even among distantly related species. Only through

extensive serial sectioning and meticulous 3-D reconstruc-

tion are significant differences in nuclear, chromosomal,

plastid, and mitochondrial volumes observed among spe-

cies (Blank and Huss 1989). However, analyses of chlorop-

lasts must be conducted on cells grown under the same

irradiance because plastid shape and volume can differ

significantly under low and high light (Muller-Parker et al.

1996). Similar to most Symbiodinium, S. voratum has a

two-stalked pyrenoid, but the pyrenoid of Symbiodinium

goreaui (in clade C) has three-stalks (Trench and Blank

1987). Thus, with further comparative work, there may

exist ultrastructural features that provide diagnostic traits

that identify membership to a particular “clade” (= sub-

genus). However, given the relative ease of DNA sequenc-

ing, genetics will likely remain the primary diagnostic for

accurate species delimitation.

The mastigotes of S. voratum like other Symbiodinium

possess a putative Type E eyespot near the sulcus that

comprises several layers of rectangular electron-translu-

cent vesicles with crystalline deposits (probably uric acid;

Clode et al. 2009; Moestrup and Daugbjerg 2007; Yamash-

ita et al. 2009). When motile, Symbiodinium mastigotes

exhibit phototaxis to the green portion of the spectrum

(Hollingsworth et al. 2005) and it is likely that this

structure receives and processes photons (Yamashita

et al. 2009). The behavioral significance of phototaxis to

Symbiodinium ecology is still unknown, but attraction to

photosynthetically active radiation is obviously important

to motile phototropic organisms.

Finally, the determination of chromosome number

among Symbiodinium may be the most useful data gener-

ated from the TEM of serial sections. Knowing chromo-

some number provides details important to comparative

genomic research (Bayer et al. 2012; Ladner et al. 2012).

We calculated that S. voratum possess approximately 72–74 chromosomes, a value similar to that estimated for S.

goreaui (74 � 2; Blank and Trench 1985) in clade C. Two

sub-species of S. microadriaticum (clade A) possess

approximately 97 or 98 (� 2) chromosomes, whereas S.

pilosum (also clade A) has approximately 78 (� 2). The

small variation in chromosome numbers found between

individual cells of S. voratum (Fig. 8G) and in other Symbi-

odinium (Blank and Trench 1985) may be explained by

cases when a single chromosome is sometimes con-

stricted to appear as two distinct entities (Udy et al.

1993). In conclusion, these data indicate that chromosome

number does not follow any large phylogenetic pattern

and that members of the same “clade” may have differ-

ent chromosome numbers.

ACKNOWLEDGMENTS

We thank Young Duk Koh for collecting samples and Eun

Young Yoon, Kyung Ha Lee, Young Jong Hwang, �Eric Pot-

vin, and John E. Parkinson for technical support. We also

thank Ian Probert and Florence Le Gall for providing culture

RCC 1521 from the Roscoff Culture Collection, Station Bio-

logique, France. Robert K. Trench, four anonymous review-

ers, and the handling Associate Editor provided constructive

comments on earlier drafts of this article. This research was

supported by the National Research Foundation/Ministry of

Science, ICT & Future Planning (NRF-C1ABA001-2010-0020

702), Mid-career Researcher Program (2012-R1A2A2A010

10987) and Ecological Disturbance Research Program,

Korea Institute of Marine Science & Technology Promotion/

KMLTM award to H. J. Jeong, and by Penn State and the

National Science Foundation, USA (OCE-0928764) to T. C.

LaJeunesse.

LITERATURE CITED

Abramoff, M. D., Magalhaes, P. J. & Ram, S. J. 2004. Image pro-

cessing with image. J. Biophotonics Int., 11:36–42.Banaszak, A. T., Iglesias-Prieto, R. & Trench, R. K. 1993. Scrippsi-

ella velellae sp. nov. (Peridiniales) and Gloeodinium viscum sp.

nov. (Phytodiniales), dinoflagellate symbionts of two hydrozoans

(Cnidarians). J. Phycol., 29:517–528.Banaszak, A. T. & Trench, R. K. 1995. Effects of ultraviolet (UV)

radiation on marine microalgal-invertebrate symbioses. I.

Response of the algal symbionts in culture and in hospite. J.

Exp. Mar. Biol. Ecol., 194:233–250.Bayer, T., Aranda, M., Sunagawa, S., Yum, L. K., DeSalvo, M. K.,

Lundquist, E., Coffroth, M. A., Voolstra, C. R. & Medina, M.

2012. Symbiodinium transcriptomes: genome insights into the




dinoflagellate symbionts of reef-building corals. PLoS ONE, 7:

e35269.

Blank, R. J. & Huss, V. A. R. 1989. DNA divergency and speciation

in Symbiodinium (Dinophyceae). Plant Syst. Evol., 163:213–232.Blank, R. J. & Trench, R. K. 1985. Speciation in symbiotic dinofla-

gellates. Science, 229:656–658.Chang, F. H. 1983. Winter phytoplankton and microzooplankton

populations off the coast of Westland, New Zealand, 1979. N.

Z. J. Mar. Freshw. Res., 17:279–304.Chen, C. A., Yang, Y. W., Wei, N. V., Tsai, W. S. & Fang, L. S.

2005. Symbiont diversity in scleractinian corals from tropical

reefs and subtropical non-reef communities in Taiwan. Coral

Reefs, 24:11–22.Clode, P. L., Saunders, M., Maker, G., Ludwig, M. & Atkins, C.

2009. Uric acid deposits in symbiotic marine algae. Plant Cell

Environ., 32:170–177.Fan, L., Sui, Z., Mao, Y. & Guo, H. 2007. Preliminary identification

of three new isolates in the genus Alexandrium (Dinophyceae)

from the China Sea area. J. Ocean Univ. China, 6:33–39.Finney, J. C., Pettay, T., Sampayo, E. M., Warner, M. E., Oxen-

ford, H. & LaJeunesse, T. C. 2010. The relative significance of

host-habitat, depth, and geography on the ecology, endemism

and speciation of coral endosymbionts. Microb. Ecol., 60:

250–263.Fitt, W. K. & Trench, R. K. 1983. The relation of diel patterns of

cell division to diel patterns of motility in the symbiotic dinofla-

gellate Symbiodinium microadriaticum Freudenthal in culture.

New Phytol., 94:421–432.Fitt, W. K., Chang, S. S. & Trench, R. K. 1981. Motility patterns of

different strains of the symbiotic dinoflagellate Symbiodinium

(=Gymnodinium) microadriaticum (Freudenthal) in culture. Bull.

Mar. Sci., 31:436–443.Freudenthal, H. D. 1962. Symbiodinium gen. nov. and Symbiodini-

um microadriaticum sp. nov., a zooxanthella: taxonomy, life

cycle, and morphology. J. Protozool., 9:45–52.Gou, W. L., Sun, J., Li, X. Q., Zhen, Y., Xin, Z., Yu, Z. G. & Li, R.

X. 2003. Phylogenetic analysis of a free-living strain of Symbi-

odinium isolated from Jiaozhou Bay, P.R. China. J. Exp. Mar.

Biol. Ecol., 296:135–144.Hansen, G. & Daugbjerg, N. 2009. Symbiodinium natans sp. nov.:

a free-living dinoflagellate from Tenerife (northeast-Atlantic

Ocean). J. Phycol., 45:251–263.Haywood, A. J., Steidinger, K. A., Truby, E. W., Bergquist, P. R.,

Bergquist, P. L., Adamson, J. & MacKenzie, L. 2004. Coparative

morphology and molecular phylogenetic analysis of three new

species of the genus Karenia (Dinophyceae) from New Zealand.

J. Phycol., 40:165–179.Hill, M., Allenby, A., Ramsby, B., Schonberg, C. & Hill, A. 2011.

Symbiodinium diversity among host clionaid sponges from

Caribbean and Pacific reefs: evidence of heteroplasmy and

putative host-specific symbiont lineages. Mol. Phyl. Evol.,

59:81–88.Hirose, M., Reimer, J. D., Hidaka, M. & Suda, S. 2008. Phyloge-

netic analyses of potentially free-living Symbiodinium spp. iso-

lated from coral reef sand in Okinawa, Japan. Mar. Biol.,

155:105–112.Hollingsworth, L. L., Kinzie III, R. A., Lewis, T. D., Krupp, D. A. &

Leong, J. A. 2005. Phototaxis of motile zooxanthellae to green

light may facilitate symbiont capture by coral larvae. Coral

Reefs, 24:523.

Huelsenbeck, J. P. & Ronquist, F. 2001. MrBayes: Bayesian infer-

ence of phylogeny. Bioinformatics, 17:754–755.Jeong, H. J., Yoo, Y. D., Kim, J. S., Seong, K. A., Kang, N. S. &

Kim, T. H. 2010. Growth, feeding and ecological roles of the

mixotrophic and heterotrophic dinoflagellates in marine plank-

tonic food webs. Ocean Sci. J., 45:65–91.Jeong, H. J., Yoo, Y. D., Kang, N. S., Lim, A. S., Seong, K. A.,

Lee, S. Y., Lee, M. J., Lee, K. H., Kim, H. S., Shin, W. G.,

Nam, S. W., Yih, W. H. & Lee, K. 2012. Heterotrophic feeding

as a newly identified survival strategy of the dinoflagellate Sym-

biodinium. Proc. Natl Acad. Sci. USA, 109:12604–12609.Kang, N. S., Jeong, H. J., Moestrup, Ø. & Park, T. G. 2011. Gyro-

diniellum shiwhaense n. gen., n. sp., a new planktonic hetero-

trophic dinoflagellate from the coastal waters of western Korea:

morphology and ribosomal DNA gene sequence. J. Eukaryot.

Microbiol., 58:284–309.Kang, N. S., Jeong, H. J., Moestrup, Ø., Shin, W. G., Nam, S. W.,

Park, J. Y., de Salas, M. F., Kim, K. W. & Noh, J. H. 2010.

Description of a new planktonic mixotrophic dinoflagellate Para-

gymnodinium shiwhaense n. gen., n. sp. from the coastal waters

off western Korea: morphology, pigments, and ribosomal DNA

gene sequence. J. Eukaryot. Microbiol., 57:121–144.Kevin, J. M., Hall, T. W., McLaughlin, J. J. A. & Zahl, P. A. 1969.

Symbiodinium microadriaticum Freudenthal, a revised taxo-

nomic description, ultrastructure. J. Phycol., 5:341–350.Krueger, T. & Gates, R. D. 2012. Cultivating endosymbionts –

host environment mimics support the survival of Symbiodinium

C15 ex hospite. J. Exp. Mar. Biol. Ecol., 413:169–176.Ladner, J. T., Barshis, D. J. & Palumbi, S. R. 2012. Protein evolu-

tion in two co-occurring types of Symbiodinium: an exploration

into the genetic basis of thermal tolerance in Symbiodinium

clade D. BMC Evol. Biol., 12:217.

Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGett-

igan, P. A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm,

A., Lopez, R., Thompson, J. D., Gibson, T. J. & Higgins, D. G.

2007. Clustal w and clustal x version 2.0. Bioinformatics,

23:2947–2948.LaJeunesse, T. C. 2001. Investigating the biodiversity, ecology,

and phylogeny of endosymbiotic dinoflagellates in the genus

Symbiodinium using the internal transcribed spacer region: in

search of a “species” level marker. J. Phycol., 37:866–880.LaJeunesse, T. C. 2002. Diversity and community structure of

symbiotic dinoflagellates from Caribbean coral reefs. Mar. Biol.,

141:387–400.LaJeunesse, T. C. & Thornhill, D. J. 2011. Improved resolution of

reef-coral endosymbiont (Symbiodinium) species diversity, ecol-

ogy, and evolution through psbA non-coding region genotyping.

PLoS ONE, 6:e29013.

LaJeunesse, T. C. & Trench, R. K. 2000. Biogeography of two

species of Symbiodinium (Freudenthal) inhabiting the intertidal

sea anemone Anthopleura elegantissima (Brandt). Biol. Bull.,

199:126–134.LaJeunesse, T. C., Fitt, W. K. & Schmidt, G. W. 2010a. The retic-

ulated chloroplasts of zooxanthellae (Symbiodinium) and differ-

ences in chlorophyll localization among life cycle stages. Coral

Reefs, 29:627.

LaJeunesse, T. C., Parkinson, J. E. & Reimer, J. D. 2012. A

genetics-based description of Symbiodinium minutum sp. nov.

and S. psygmophilum sp. nov. (Dinophyceae), two dinoflagel-

lates symbiotic with Cnidaria. J. Phycol., 48:1380–1391.LaJeunesse, T. C., Bhagooli, R., Hidaka, M., DeVantier, L., Done,

T., Schmidt, G. W., Fitt, W. K. & Hoegh-Guldberg, O. 2004a.

Closely related Symbiodinium spp. differ in relative dominance

in coral reef host communities across environmental, latitudinal

and biogeographic gradients. Mar. Ecol. Prog. Ser., 284:147–161.

LaJeunesse, T. C., Thornhill, D. J., Cox, E. F., Stanton, F. G., Fitt,

W. K. & Schmidt, G. W. 2004b. High diversity and host specific-




ity observed among symbiotic dinoflagellates in reef coral

communities from Hawaii. Coral Reefs, 23:596–603.LaJeunesse, T. C., Pettay, D. T., Sampayo, E. M., Phongsuwan,

N., Brown, B., Obura, D., Hoegh-Guldberg, O. & Fitt, W. K.

2010b. Long-standing environmental conditions, geographic iso-

lation and host–symbiont specificity influence the relative eco-

logical dominance and genetic diversification of coral

endosymbionts in the genus Symbiodinium. J. Biogeogr.,

37:785–800.Lien, Y. T., Fukami, H. & Yamashita, Y. 2012. Symbiodinium Clade

C dominates zooxanthellate corals (Scleractinia) in the temper-

ate region of Japan. Zool. Sci., 29:173–180.Lilly, E. L., Halanych, K. M. & Anderson, D. M. 2005. Phylogeny,

biogeography, and species boundaries within the Alexandrium

minutum group. Harmful Algae, 4:1004–1020.Lin, S., Zhang, H., Hou, Y., Zhuang, Y. & Miranda, L. 2009. High-

level diversity of dinoflagellates in the natural environment,

revealed by assessment of mitochondrial cox1 and cob genes

for dinoflagellate DNA barcoding. Appl. Environ. Microbiol.,

75:1279–1290.Litaker, R. W., Vandersea, M. W., Kibler, S. R., Reece, K. S.,

Stokes, N. A., Steidinger, K. A., Millie, D. F., Bendis, B. J., Pigg,

R. J. & Tester, P. A. 2003. Identification of Pfiesteria piscicida

(Dinophyceae) and Pfiesteria-like organisms using internal tran-

scribed spacer-specific PCR assays. J. Phycol., 39:754–761.Loeblich, A. R. III & Sherley, J. L. 1979. Observations on the

theca of the mobile phase of free-living and symbiotic isolates

of Zooxanthella microadriaticum (Freudenthal) comb.nov. J.

Mar. Biol. Assoc. U.K., 59:195–205.McBride, B. B., Muller-Parker, G. & Jakobsen, H. H. 2009. Low

thermal limit of growth rate of Symbiodinium californium (Dino-

phyta) in culture may restrict the symbiont to southern popula-

tions of its host anemones (Anthopleura spp.; Anthozoa,

Cnidaria). J. Phycol., 45:855–863.Medlin, L., Elwood, H. J., Stickel, S. & Sogin, M. L. 1988. The

characterization of enzymatically amplified eukaryokic 16S-like

rRNAcoding regions. Gene, 71:491–499.Moestrup, Ø. & Daugbjerg, N. 2007. On dinoflagellate phylogeny

and classification. In Brodie, J. & Lewis, J. (ed.), Unravelling the

Algae: The Past, Present, and Future of Algae Systematics.

Systematics Association Special Volumes. Vol. 75. CRC Press,

Boca Raton, FL. p. 215–230.Muller-Parker, G., Lee, K. W. & Cook, C. B. 1996. Changes in the

ultrastructure of symbiotic zooxanthellae (Symbiodinium sp.,

Dinophyceae) in fed and starved sea anemones maintained

under high and low light. J. Phycol., 32:987–994.Muscatine, L., McCloskey, L. R. & Marian, R. E. 1981. Estimating

the daily contribution of carbon to coral animal respiration. Lim-

nol. Oceanogr., 26:601–611.Park, T. G., Park, G. H., Park, Y. T., Kang, Y. S., Bae, H. M., Kim,

C. H., Jeong, H. J. & Lee, Y. 2009. Identification of the dinofla-

gellate community during Cochlodinium polykrikoides (Dinophy-

ceae) blooms using amplified rDNA melting curve analysis and

real-time PCR probes. Harmful Algae, 8:430–440.Polne-Fuller, M. 1991. A novel technique for preparation of axenic

cultures of Symbiodinium (Pyrrophyta) through selective diges-

tion by amoebae. J. Phycol., 27:552–554.Porter, K. G. & Feig, Y. S. 1980. The use of DAPI for identifying and

counting aquatic microflora. Limnol. Oceanogr., 25:943–948.Porto, I., Granados, C., Restrepo, J. C. & Sanchez, J. A. 2008.

Macroalgal-associated dinoflagellates belonging to the genus

Symbiodinium in Caribbean reefs. PLoS ONE, 3:e2160.

Pochon, X., Pawlowski, J., Zaninetti, L. & Rowan, R. 2001. High

genetic diversity and relative specificity among Symbiodinium-

like endosymbiotic dinoflagellates in soritid foraminiferans. Mar.

Biol., 139:1069–1078.Pochon, X., Montoya-Burgos, J. I., Stadelmann, B. & Palowski, J.

2006. Molecular phylogeny, evolutionary rates, and divergence

timing of the symbiotic dinoflagellate genus Symbiodinium.

Mol. Phyl. Evol., 38:20–30.Pochon, X., Garcia-Cuestos, L., Baker, A. C., Castella, E. & Paw-

lowski, J. 2007. One-year survey of a single Micronesian reef

reveals extraordinarily rich diversity of Symbiodinium types in

sorited foraminifera. Coral Reefs, 26:867–882.Pochon, X. & Gates, R. D. 2010. A new Symbiodinium clade (Din-

ophyceae) from soritid foraminifera in Hawai’i. Mol. Phylogenet.

Evol., 56:492–497.Rodriguez-Lanetty, M., Chang, S. J. & Song, J. I. 2003. Specificity

of two temperate dinoflagellate-anthozoan associations from

the north-western Pacific Ocean. Mar. Biol., 143:1193–1199.Ronquist, F. & Huelsenbeck, J. P. 2003. MRBAYES 3: Bayesian

phylogenetic inference under mixed models. Bioinformatics,

19:1572–1574.Rowan, R. & Powers, D. A. 1991. A molecular genetic classifica-

tion of zooxanthellae and the evolution of animal-algal symbio-

sis. Science, 251:1348–1351.Rowan, R. & Powers, D. A. 1992. Ribosomal-RNA sequences and

the diversity of symbiotic dinoflagellates (zooxanthellae). Proc.

Natl Acad. Sci. USA, 89:3639–3643.Sampayo, E., Dove, S. & LaJeunesse, T. C. 2009. Cohesive

molecular genetic data delineate species diversity in the dinofla-

gellate genus Symbiodinium. Mol. Ecol., 18:500–519.Sanders, J. G. & Palumbi, S. R. 2011. Populations of Symbiodini-

um muscatinei show strong biogeographic structuring in the

intertidal anemone Anthopleura elegantissima. Biol. Bull.,

220:199–208.Santos, S. R. 2004. Comment: phylogenetic analysis of a free-

living strain of Symbiodinium isolated from Jiaozhou Bay,

P.R. China. J. Phycol., 40:395–397.Santos, S. R., Gutierrez-Rodriguez, C. & Coffroth, M. A. 2003.

Phylogenetic identification of symbiotic dinoflagellates via

length heteroplasmy in domain V of chloroplast large subunit

(cp23S) ribosomal DNA sequences. Mar. Biotech., 5:130–140.Santos, S. R., Taylor, D. J., Kinzie III, R. A., Hidaka, M., Sakai, K.

& Coffroth, M. A. 2002. Molecular phylogeny of symbiotic dino-

flagellates inferred from partial chloroplast large subunit (23S)

rDNA sequences. Mol. Phylogenet. Evol., 23:97–111.Schoenberg, D. A. & Trench, R. K. 1980a. Genetic variation in

Symbiodinium (=Gymnodinium) microadriaticum Freudenthal,

and specificity in its symbiosis with marine invertebrates. I. Iso-

enzyme and soluble protein patterns of axenic cultures of S. mi-

croadriaticum. Proc. R. Soc. Lond. B, 207:405–427.Schoenberg, D. A. & Trench, R. K. 1980b. Genetic variation in


and specificity in its symbiosis with marine invertebrates. II.

Morphological variation in S. microadriaticum. Proc. R. Soc.

Lond. B, 207:429–444.Schoenberg, D. A. & Trench, R. K. 1980c. Genetic variation in


and specificity in its symbiosis with marine invertebrates. III.

Specificity and infectivity of S. microadriaticum. Proc. R. Soc.

Lond. B, 207:445–460.Scholin, C. A., Herzog, M., Sogin, M. & Anderson, D. M. 1994. Iden-

tification of group and strain-specific genetic makers for globally

distributed Alexandrium (Dinophyceae) II. Sequence analysis of a

fragment of the LSU rRNA gene. J. Phycol., 30:999–1011.Shao, P., Chen, Y. Q., Zhou, H., Yuan, J., Qu, L. H., Zhao, D. &

Lin, Y. S. 2004. Genetic variability in the Gymnodiniaceae ITS




regions: implications for species identification and phylogenetic

analysis. Mar. Biol., 144:215–224.Siano, R., Montresor, M., Probert, I., Not, F. & de Vargas, C.

2010. Pelagodinium gen. nov. and P. beii comb. nov. a dinofla-

gellate symbiont of planktonic foraminifera. Protist, 161:385–399.

Silverstein, R. N., Correa, A. M. S., LaJeunesse, T. C. & Baker, A. C.

2011. Novel algal symbiont (Symbiodinium spp.) diversity in reef

corals of Western Australia.Mar. Ecol. Prog. Ser., 422:63–75.Spector, D. L. 1984. Dinoflagellate nuclei. In: Spector, D. L. (ed.),

Dinoflagellates. Academic Press Inc., Orlando, FL, USA.

Spurr, A. R. 1969. A low viscosity epoxy resin embedding med-

ium for electron microscopy. J. Ultrastruct. Res., 26:31–42.Stamatakis, A. 2006. RAxML-VI-HPC: maximum likelihood-based

phylogenetic analyses with thousands of taxa and mixed mod-

els. Bioinformatics, 22:2688–2690.Stat, M., Pochon, X., Cowie, R. O. M. & Gates, R. D. 2009. Speci-

ficity in communities of Symbiodinium in corals from Johnston

Atoll. Mar. Ecol. Prog. Ser., 386:83–96.Stern, R. F., Horak, A., Andrew, R. L., Coffroth, M. A., Andersen,

R. A., Kupper, F. C., Jameson, I., Hoppenrath, M., Veron, B.,

Kasai, F., Brand, J., James, E. R. & Keeling, P. J. 2010. Environ-

mental barcoding reveals massive dinoflagellate diversity in

marine environments. PLoS ONE, 5:e13991.

Stern, R. F., Andersen, R. A., Jameson, I., Kupper, F. C., Coffroth,

M.-A., Vaulot, D., LeGall, F., Veron, Benoit, Brand, J. J., Skel-

ton, H., Kasai, F., Lilly, E. L. & Keeling, P. J. 2012. Evaluating

the ribosomal internal transcribed spacer (ITS) as a candidate

dinoflagellate barcode marker. PLoS ONE, 7:e42780.

Stoecker, D. K. 1999. Mixotrophy among dinoflagellates. J. Eu-

karyot. Microbiol., 46:397–401.Swofford, D. 2000. PAUP*, Phylogenetic Analysis Using Parsi-

mony (*and Other Methods), Version 4.0b10. Sinauer Associ-

ates, Sunderland, MA.

Tamura, K., Dudley, J., Nei, M. & Kumar, S. 2007. MEGA4:

molecular evolutionary genetics analysis (MEGA) software v.

4.0. Mol. Biol. Evol., 24:1596–1599.Tchernov, D., Gorbunov, M. Y., de Vargas, C., Yadav, S. N., Vardi,

A., H€aggblom, M. & Falkowski, P. 2004. Membrane lipids of

symbiotic algae are diagnostic of sensitivity to thermal bleach-

ing in corals. Proc. Natl Acad. Sci. USA, 101:13531–13535.Thornhill, D. J., LaJeunesse, T. C. & Santos, S. R. 2007. Measur-

ing rDNA diversity in eukaryotic microbial systems: how intrage-

nomic variation, pseudogenes, and PCR artifacts confound

biodiversity estimates. Mol. Ecol., 16:5326–5340.Thornhill, D. J., Lewis, A., Wham, D. C. & LaJeunesse, T. C. 2013.

Host-specialist lineages dominate the adaptive radiation of

reef coral endosymbionts. Evolution. DOI: 10.1111/evo.12270

(in press)

Trench, R. K. 1993. Microalgal-invertebrate symbioses: a review.

Endocyt. Cell Res., 9:135–175.Trench, R. K. & Blank, R. J. 1987. Symbiodinium microadriaticum

Freudenthal, S. goreauii sp. nov., S. kawagutii sp. nov., and S.

pilosum sp. nov.: Gymnodinioid dinoflagellate symbionts of mar-

ine invertebrates. J. Phycol., 23:469–481.Trench, R. K. & Thinh, L. V. 1995. Gymnodinium linucheae sp.

nov.: the dinoflagellate symbiont of the jellyfish Linuche ungui-

culata. Eur. J. Phycol., 30:149–154.Udy, J. W., Hinde, R. & Vesk, M. 1993. Chromosomes and DNA

in Symbiodinium from Australian hosts. J. Phycol., 29:314–320.Wang, L. H., Liu, Y. H., Ju, Y. M., Hsiao, Y. Y., Fang, L. S. &

Chen, C. S. 2008. Cell cycle propagation is driven by light-dark

stimulation in a cultured symbiotic dinoflagellate isolated from

corals. Coral Reefs, 27:823–835.

Xiang, T., Hambleton, E. A., DeNofrio, J. C., Pringle, J. R. &

Grossman, A. R. 2013. Isolation of clonal, axenic strains of the

symbiotic dinoflagellate Symbiodinium and their growth and

host specificity. J. Phycol., 49:447–458.Yacobovitch, T., Benayahu, Y. & Weis, V. M. 2004. Motility of

zooxanthellae isolated from the Red Sea soft coral Hetroxenia

fuscescens (Cnidaria). J. Exp. Mar. Biol. Ecol., 298:35–48.Yamashita, H. & Koike, K. 2013. The genetic identity of free-living

Symbiodinium obtained over a broad latitudinal range in the Jap-

anese coast. Phycol. Res., 61:68–80.Yamashita, H., Kobiyama, A. & Koike, K. 2009. Do uric acid

deposits in zooxanthellae function as eye-spots? PLoS ONE, 4:

e63003.

Zardoya, R., Costas, E., Lopez-Rodas, V., Garrido-Pertierra, A. &

Bautista, J. M. 1995. Revised dinoflagellate phylogeny inferred

from molecular analysis of large subunit ribosomal RNA gene

sequences. J. Mol. Evol., 41:637–645.Zhang, H., Bhattacharya, D. & Lin, S. 2005. Phylogeny of dinofla-

gellates based on mitochondrial cytochrome b and nuclear small

subunit rDNA sequence comparisons. J. Phycol., 41:411–420.

SUPPORTING INFORMATION

Additional Supporting Information may be found in the

online version of this article:

Fig. S1. Temperate Pacific Ocean and Mediterranean Sea

origins of cultured isolates assigned to Symbiodinium

clade E and used in this research to investigate genetic,

morphological, ecological, and behavioral traits (designated

by solid circles). Open white circles represent additional

locals where clade E was reported to be cultured from

water samples, but these cultures were not investigated

in this study.

Fig. S2. Consensus Bayesian tree based on 1,814 bp

aligned positions of the small subunit (SSU) region, using

the GTR + G + I model with Prorocentrum micans as an

outgroup taxa. The parameters were as follows: assumed

nucleotide frequency with equal; substitution rate matrix

with A–C substitutions = 0.0586, A–G substitu-

tions = 0.2383, A–T substitutions = 0.0869, C–G substitu-

tions = 0.0578, C–T substitutions = 0.5156, G–Tsubstitutions = 0.0428; proportion of sites assumed to be

invariable = 0.7004; and rates for variable sites assumed

to follow a gamma distribution with shape parame-

ter = 0.0800. The branch lengths are proportional to the

amount of character changes. The numbers above the

branches indicate the Bayesian posterior probability (left)

and maximum likelihood (ML) bootstrap values (right). Pos-

terior probabilities ≥ 0.5 are shown. The rDNA sequences

of the strains shown in bold were analyzed in this study.

Fig. S3. Consensus Bayesian tree based on 853 bp

aligned positions of the internal transcribed spacer 1

(ITS1), 5.8s, and internal transcribed spacer 2 (ITS2)

regions, using the GTR + G + I model and Akashiwo san-

guinea as an outgroup taxa. The parameters were as fol-

lows: assumed nucleotide frequency with equal;

substitution rate matrix with A–C substitutions = 0.1038,




A–G substitutions = 0.2646, A–T substitutions = 0.1320,

C–G substitutions = 0.0625, C–T substitutions = 0.3480,

G–T substitutions = 0.0892; proportion of sites assumed

to be invariable = 0.1153; and rates for variable sites

assumed to follow a gamma distribution with shape

parameter = 1.5640. The branch lengths are proportional

to the amount of character changes. The numbers above

the branches indicate the Bayesian posterior probability

(left) and maximum likelihood (ML) bootstrap values

(right). Posterior probabilities ≥ 0.5 are shown. Strain

EU074907 marked with an asterisk represents a combina-

tion of other similar species (EU074916, EU074917,

EU074919, EU074920, EU074921, EU074922, EU074923,

and EU074924).

Fig. S4. Partial psbA and psbAncr alignments identify four

distinct haplotypes (hap1–hap4). The start of gray areas

indicates regions where chromatograms change abruptly

from a high quality to non-interpretable multipeak

sequences.

Fig. S5. Position of the nucleus in mastigotes of SvFL 1.

(A–C) light micrographs of flagellated cells and (D–F) corre-sponding epi-fluorescent micrographs showing the variable

location of DAPI stained nuclei.

Fig. S6. Scanning electron micrographs of the motile cell

of CCMP 421. (A) Apical view showing the rare example

of a cell with seven apical plates. (B) Enlarged figure of

apical plate in S4. (C) Apical view showing a cell with six

apical plates. (D) Enlarged figure of apical plate in S6. All

scale bars = 1 lm.

Fig. S7. Scanning electron micrographs of motile cells of

SvFL 1. (A) Antapical view showing the hyposome. Micro-

graph showing a rare cell with seven postcingular plates

and heptagonal 2″″ plates. (B). Drawing of antapical view

of SvFL 1. (C) Micrograph showing an example of a cell

with three antapical plates. (D) Drawing of antapical view

of SvFL 1. All scale bars = 1 lm.

Fig. S8. The pyrenoid (PY) in the cells of isolates (A) SvFL1 and (B) CCMP 421 possessed two stalks. The thylakoids

from associated chloroplast do not intrude.

Table S1. Primers and TaqMan probes for qPCR detection

of Symbiodinium voratum (clade E).

Table S2. Symbiodinium spp. used to test the cross-reac-

tivity of clade E primers and Taqman probe in qPCR

detection.




A B C

D E F

nn n

S5

X

3`

4`

5`

1a

2a

3a

4a

3``

2``

4`` 5a

8`` 2`

1` 1``

6`

7`

6a

6`` 5``

S6

X

3`

4`

2`

1`

7`

5` 6`

B

X

3`

4`

5`

1a

2a

3a 4a

3``

2`` 7``

5a

8``

2`

1` 1``

6` 6a

4`` 5``

6``

X

3`

4`

5`

2`

1`

6`

C D

8``

6a 2a

1a

A

S10

D

S7

B

C 6’’’

3’’’’ 1’’’’

4’’’ 3’’’

2’’’ 5’’’

2’’’’

1’’’

S

S.p. 6’’’

3’’’’ 1’’’’

4’’’ 3’’’

2’’’ 5’’’

2’’’’

1’’’

S.p.

6’’’ 1’’’’

4’’’ 3’’’

2’’’

5’’’

2’’’’

1’’’ S.p. S 7’’’

6’’’ 1’’’’

4’’’ 3’’’

2’’’

5’’’

2’’’’

1’’’ S.p.

S 7’’’

A

Table S1. Primers and TaqMan probes for qPCR detection of Clade E Symbiodinium.

Species

Forward/Reverse/Probe

Code

Sequence (5` → 3`)

Symbiodinium voratum (Clade E)

Forward Reverse Probe

SVITSF SVITSR SVITSP

CGCTGCTGCATCAGAATTTGC GGCAGGCTGGCATGATTG CGGCGCGCTGAAC

Table S2. Symbiodinium spp. used to test the cross reactivity of Clade E primers and Taqman probe in qPCR detection. Culture code Species name Clade (type) Locality

SVFL 1 Symbiodinium voratum E Jeju, Korea SVIC Symbiodinium voratum E Jeju, Korea CCMP421 Symbiodinium voratum E New Zealand CCMP828 Symbiodinium sp. A Florida, USA CCMP832 Symbiodinium sp. A Great Barrier Reef CCMP2429 Symbiodinium pilosum A2 Australia CCMP2430 Symbiodinium sp. A Australia CCMP2461 Symbiodinium pilosum A2 Jamaica CCMP2458 Symbiodinium microadriaticum A1 Gulf of Aqaba CCMP2464 Symbiodinium microadriaticum A1 Florida, USA CCMP2467 Symbiodinium microadriaticum A1 Gulf of Aqaba CCMP2469 Symbiodinium microadriaticum A13 Jamaica CCMP830 Symbiodinium sp. B Bermuda CCMP1633 Symbiodinium sp. B Hawaii, USA CCMP2459 Symbiodinium psygmophillum. B2 Bermuda CCMP2462 Symbiodinium sp. B3 Bahamas CCMP2466 Symbiodinium goreaui C1 Jamaica CCMP2456 Symbiodinium sp. A4 Bermuda CCMP2556 Symbiodinium sp. D1a Florida, USA CCMP2455 Symbiodinium sp. F2 Jamaica CCMP2468 Symbiodinium kawagutii F1 Hawaii, USA

eukaryotic of microbiology al._jeumic_2014_s...species diversity and, therefore, are not equivalent...

Documents