LETTER TO THE EDITOR

ERULUS is a Plasma Membrane-Localized Receptor-Like Kinase that Specifies Root Hair Growth by Maintaining Tip-Focused Cytoplasmic Calcium Oscillations

Root hairs are single cell cylindrical projections that expand the effective radius of the root. In doing so,

they play crucial roles in the uptake of water and nutrients from the soil, especially under conditions in

which such resources are limiting (Carminati et al., 2017). Roots hairs expand by tip growth, a process

that involves the targeted delivery and secretion of vesicles to the cell apex. As a result, root hairs attain

lengths that are several times their widths (Chebli et al., 2013). In tip growing cells, cargo transported by

tip-targeted vesicles consist of an assortment of carbohydrate precursors that are needed for the assembly and remodeling of the apical cell wall (Gu and Nielsen, 2013). Research spanning several

decades has led to the identification of multiple components of the tip growth machinery including protein

modulators of cytoskeletal organization, membrane trafficking, cytoplasmic calcium ([Ca2+]cyt) signaling

and phosphoinositide metabolism (Cole and Fowler, 2006; Rounds and Bezanilla, 2013).

In recent years, plant malectin-like receptor kinases, also known as Catharanthus roseus receptor-

like kinases (CrRLK1Ls; Franck et al., 2018), have been shown to regulate tip growth in root hairs and

pollen tubes (Duan et al., 2010; Haruta et al., 2014; Bai et al., 2014; Ge et al., 2017; Schoenaers et al.,

2018). In one noteworthy study, Bai et al. (2014) reported that a CrRLK1L, which they named [Ca2+]cyt-associated protein kinase 1 (CAP1), modulates root hair growth by maintaining ammonium (NH4+)

homeostasis. CAP1 is also known as ERULUS (ERU), named after the son of FERONIA (FER), a widely

studied member of the CrRLK1L family (Haruta et al., 2014). In Arabidopsis thaliana, cap1/eru loss-of-

function mutants have short and irregularly shaped root hairs consistent with a role of CAP1/ERU as a

positive regulator of root hair growth (Haruta et al., 2014; Bai et al., 2014; Schoenaers et al., 2018). Bai et

al. (2014) proposed a model wherein CAP1/ERU functions in maintaining root hair growth under high

NH4+ environments by sensing cytoplasmic NH4+. Sensing of cytoplasmic NH4+ by CAP1/ERU then

triggers signaling events that lead to NH4+ sequestration into the vacuole making it less toxic to the cell.

The model postulates that toxic levels of NH4+ accumulate in the cytoplasm of cap1/eru loss-of-function

mutants, resulting in the disappearance of tip-focused [Ca2+]cyt gradients, and because of this lack of tip-

focused [Ca2+]cyt gradients, their root hairs cease to expand (Bai et al., 2014). In this letter, we question the proposed role of CAP1/ERU in NH4+ homeostasis based on our studies of a new eru-3 mutant allele,

showing that CAP1/ERU is instead localized to the plasma membrane (PM) and its function is linked to

tip-focused [Ca2+]cyt oscillations. This is further supported by recent work on the eru-2 mutant by

Schoenaers et al. (2018), as described below.

CAP1/ERU IS A PLASMA MEMBRANE-LOCALIZED PROTEIN

A major result used to support the CAP1/ERU- NH4+ homeostasis model was the observation that a CAP1/ERU-green fluorescent protein (GFP) fusion localized to the tonoplast. According to the model, the

Plant Cell Advance Publication. Published on May 25, 2018, doi:10.1105/tpc.18.00316

©2018 American Society of Plant Biologists. All Rights Reserved

2

tonoplast-localized CAP1/ERU is what senses cytoplasmic NH4+ resulting in its compartmentalization into

the vacuole (Bai et al., 2014).

We independently isolated the recessive eru-3 mutant in a forward genetic screen for root hair mutants that resembled wild-type root hairs treated with low concentrations of the actin-disrupting

compound latrunculin B. Here, we refer to our mutant as eru-3 following the nomenclature of Haruta et al.

(2014), in which two mutant alleles of eru were first described as eru-1 and eru-2. The cap1 mutant

(SALK_083442) studied by Bai et al (2014) is similar to eru-2, and therefore we refer to it here as

cap1/eru-2 (Figure 1A). When we expressed an ERU-GFP construct under the control of the constitutive

UBIQUITIN 10 (UBQ10) promoter (UBQ10:ERU-GFP) in the eru-3 mutants, their root hairs were restored

to wild type lengths indicating that the fusion protein was functional (Figure 1B, C).

We found that instead of localizing to the root hair tonoplast, ERU-GFP marked the plasma membrane (PM) at the site of root hair bulges. As root hairs transitioned to rapid tip growth, the ERU-GFP

signal intensified and formed a diffuse fluorescent cap at the root hair apex (Figure 1D). Distal to the root

hair tip, ERU-GFP decorated distinct and dynamic puncta that were reminiscent of post-Golgi and

endocytic vesicles (Figure 1D). As root hairs matured and ceased growth, the intensity of ERU-GFP at the

tip declined (Figure 1D). Time course and correlation analyses revealed that tip-directed accumulation of

ERU-GFP was most intense in root hairs that grew rapidly (Figure 1E, F) supporting the role of ERU as a

positive regulator of root hair tip growth.

It is important to note that Bai et al. (2014) used transient expression of a CAP1/ERU-GFP fusion in protoplasts and onion epidermal cells to conclude that it localized to the tonoplast, and the functionality of

their CAP1/ERU-GFP construct was not validated in root hairs. It is possible that their CAP1/ERU-GFP

was mislocalized because it was expressed in cell types (i.e., leaf protoplasts and onion epidermal cells)

in which ERU is not typically found. We attempted to express ERU-GFP in the eru-3 mutant under the

control of the native ERU promoter (ERUpro) consisting of 626 base pairs (bp) upstream of the ERU gene.

Unfortunately, we were unable to recover ERUpro:ERU-GFP lines. However, it was recently reported that

a 2,529-bp sequence that included the ERU promoter coupled to the ERU coding and GFP sequence

(ERUp:ERU-GFP) complemented cap1/eru-2 root hairs (Schoenaers et al., 2018). This group found that

expressed ERU-GFP localized to root hairs in a similar manner as our constitutively expressed ERU-

GFP, further supporting our conclusion that the PM is where the ERU protein resides.

CAP1/ERU FUNCTION IS LINKED TO CYTOPLASMIC CALCIUM OSCILLATIONS

Another major result of Bai et al. (2014) that we address in this letter is their finding that root hairs of

cap1/eru loss-of-function appeared to lack tip-focused [Ca2+]cyt gradients. We feel that it is important to

address these results because they provide an example of how [Ca2+]cyt imaging data on root hairs can be misinterpreted. For these experiments, it is critical to note that root hair growth ceases when the large

central vacuole protrudes toward the cell apex (Grierson et al., 2014). Furthermore, mature, non-growing

root hairs in which the vacuole protrudes to the apex have been shown to lack [Ca2+]cyt gradients (Wymer

et al., 1997). The images of cap1/eru-2 root hairs that Bai et al. (2014) presented as the basis for

3

extracting their [Ca2+]cyt data (Figure 2A, 3C in Bai et al., 2014) clearly showed the vacuole protruding to

the apex. Based on the above observations, we would not expect to find [Ca2+]cyt gradients in such root

hairs. We expressed the intensiometric [Ca2+]cyt reporter G-CAMP3 (Tian et al., 2009) in eru-3 to assess if

their root hairs lacked a [Ca2+]cyt gradient. We were careful to sample [Ca2+]cyt only in root hairs that had a

dense cytoplasm at the cell apex.

In contrast to the results of Bai et al. (2014), we found that eru-3 root hairs that still had a substantial cytoplasm at the apex did not lack tip-focused [Ca2+]cyt gradients. These eru-3 root hairs were still

elongating, albeit at a significantly reduced rate when compared to wild type (ca. 0.20 µm/min for eru-3

versus 1 µm/min for wild type). We did observe, however, that patterns of tip [Ca2+]cyt oscillations in these

slow growing eru-3 root hairs were compromised. Compared to wild type, root hairs of eru-3 had more

prolonged periods of elevated tip-focused [Ca2+]cyt followed by longer periods of dampened [Ca2+]cyt

(Figure 2A-C; Supplemental Movie 1). Quantitative analysis of [Ca2+]cyt following the Fast Fourier

Transform (FFT) methods described by Schoenaers et al. (2018) showed that eru-3 displayed low

frequency [Ca2+]cyt oscillations. The main frequency of [Ca2+]cyt oscillations in eru-3 root hairs was 0.003 ±

0.0002 Hz compared to 0.044 ± 0.0184 Hz in wild type (Figure 2D). Furthermore, the amplitude of

[Ca2+]cyt oscillation at the tips of eru-3 was about 3-fold higher than wild type (Figure 2E). These results

are in agreement with findings of Schoenaers et al. (2018) in which they showed decreased frequency and increased amplitude of pectin Ca2+-binding site oscillations in cap1/eru-2 root hairs. It is clear from

our results that ERU is important for normal tip-focused [Ca2+]cyt oscillations, a process that is crucial for

sustained root hair growth (Monshausen et al., 2008). Mechanistic links between PM-localized ERU and

the maintenance of [Ca2+]cyt oscillations are unknown. Demonstrating the true nature of tip-focused

[Ca2+]cyt defects in eru-3 root hairs, however, enables the development of more accurate models that

could be tested in the future to explain how ERU modulates tip growth.

In light of the ERU localization data presented here and those reported by Schoenaers et al. (2018),

the model by Bai et al. (2014), proposing that tonoplast-based NH4+ signaling is the major driver for ERU-mediated tip-focused [Ca2+]cyt oscillations and root hair growth, needs reexamination. Other CrRLK1Ls

such as FER, THESEUS1 (THE1), HERCULES1 (HERK1), ANXUR (ANX), and BUDDHA’s PAPER

SEAL (BUPSs) have all been shown to localize to the PM (Hématy et al., 2007; Guo et al., 2009;

Escobar-Restrepo et al., 2007; Duan et al., 2010; Boisson-Dernier et al., 2009; Miyazaki et al., 2009; Ge

et al., 2017). Our results and those of Schoenaers et al. (2018) clearly demonstrate that ERU is also a

PM-localized CrRLK1L and should no longer be referred to as a vacuolar membrane-localized protein. Taegun Kwona

J. Alan Sparksa

Fuqi Liaoa Elison B. Blancaflora,1

aNoble Research Institute, LLC Ardmore, OK 73401

1address correspondence to: eblancaflor@noble.org

4

SUPPLEMENTAL MATERIALS Supplemental Methods. Identification of the eru-3 mutant, UBQ10:ERU-GFP and UBQ10:G-CAMP3 constructs, and live cell microscopy of root hairs.

Supplemental Movie 1. Time lapse sequences of wild-type and eru-3 tip [Ca2+]cyt oscillations.

Supplemental Movie Legend.

ACKNOWLEDGMENTS This work was supported by the National Aeronautics and Space Administration (NASA Grant NNX12AM94G to E.B.B.) and the Noble Research Institute, LLC.

AUTHOR CONTRIBUTIONS TK and EBB drafted the manuscript. TK and JAS generated and analyzed plants expressing ERU-GFP and G-CAMP. TK, JAS and EBB performed root hair confocal imaging and forward genetic screens. FL quantified and interpreted [Ca2+]cyt oscillations using Fast Fourier Transform.

REFERENCES

Bai, L., Ma, X., Zhang, G., Song, S., Zhou, Y., Gao, L., Miao, Y., and Song, C.-P. (2014). A receptor-like kinase mediates ammonium homeostasis and is important for the polar growth of root hairs in Arabidopsis. Plant Cell 26: 1497–1511.

Boisson-Dernier, A., Roy, S., Kritsas, K., Grobei, M.A., Jaciubek, M., Schroeder, J.I., and Grossniklaus, U. (2009). Disruption of the pollen-expressed FERONIA homologs ANXUR1 and ANXUR2 triggers pollen tube discharge. Development 136: 3279.

Carminati, A., Passioura, J.B., Zarebanadkouki, M., Ahmed, M.A., Ryan, P.R., Watt, M., and Delhaize, E. (2017). Root hairs enable high transpiration rates in drying soils. New Phytol. 216: 771–781.

Chebli, Y., Kroeger, J., and Geitmann, A. (2013). Transport logistics in pollen tubes. Mol. Plant 6: 1037–1052. Cole, R.A. and Fowler, J.E. (2006). Polarized growth: maintaining focus on the tip. Curr. Opin. Plant Biol. 9: 579–

588. Duan, Q., Kita, D., Li, C., Cheung, A.Y., and Wu, H.-M. (2010). FERONIA receptor-like kinase regulates RHO

GTPase signaling of root hair development. Proc. Natl. Acad. Sci. 107: 17821–17826. Escobar-Restrepo, J.-M., Huck, N., Kessler, S., Gagliardini, V., Gheyselinck, J., Yang, W.-C., and

Grossniklaus, U. (2007). The FERONIA receptor-like kinase mediates male-female interactions during pollen tube reception. Science 317: 656–660.

Franck, C.M., Westermann, J., and Boisson-Dernier, A. (2018). Plant malectin-like receptor kinases: from cell wall integrity to immunity and beyond. Annu. Rev. Plant Biol. 69: null.

Ge, Z. et al. (2017). Arabidopsis pollen tube integrity and sperm release are regulated by RALF-mediated signaling. Science 358: 1596–1600.

Grierson, C., Nielsen, E., Ketelaarc, T., and Schiefelbein, J. (2014). Root hairs. Arab. Book: e0172. Gu, F. and Nielsen, E. (2013). Targeting and regulation of cell wall synthesis during tip growth in plants. J. Integr.

Plant Biol. 55: 835–846. Guo, H., Li, L., Ye, H., Yu, X., Algreen, A., and Yin, Y. (2009). Three related receptor-like kinases are required for

optimal cell elongation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. 106: 7648–7653. Haruta, M., Sabat, G., Stecker, K., Minkoff, B.B., and Sussman, M.R. (2014). A peptide hormone and its receptor

protein kinase regulate plant cell expansion. Science 343: 408–411. Hématy, K., Sado, P.-E., Van Tuinen, A., Rochange, S., Desnos, T., Balzergue, S., Pelletier, S., Renou, J.-P.,

and Höfte, H. (2007). A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis. Curr. Biol. 17: 922–931.

Miyazaki, S., Murata, T., Sakurai-Ozato, N., Kubo, M., Demura, T., Fukuda, H., and Hasebe, M. (2009). ANXUR1 and 2, sister genes to FERONIA/SIRENE, are male factors for coordinated fertilization. Curr. Biol. 19: 1327–1331.

Monshausen, G.B., Messerli, M.A., and Gilroy, S. (2008). Imaging of the Yellow Cameleon 3.6 indicator reveals that elevations in cytosolic Ca2+ follow oscillating increases in growth in root hairs of Arabidopsis. Plant Physiol. 147: 1690–1698.

Schoenaers, S. et al. (2018). The auxin-regulated CrRLK1L kinase ERULUS controls cell wall composition during root hair tip growth. Curr. Biol. 28: 722-732.e6.

Tian, L. et al. (2009). Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators. Nat. Methods 6: 875–881.

Wymer, C.L., Bibikova, T.N., and Gilroy, S. (1997). Cytoplasmic free calcium distributions during the development of root hairs of Arabidopsis thaliana. Plant J. 12: 427–439.

Figure 1. A Functional ERU-GFP Fusion Localizes to the Plasma Membrane and Post-Golgi/Endocytic Vesicles at the Root Hair Tip.(A) Schematic diagram of the domain organization of the ERU protein. Relative positions of T-DNA insertions of eru-1, cap1/eru-2, and eru-3 are indicated as vertical lines.(B) and (C) UBQ10:ERU-GFP complements the short root hair phenotypes of eru-3. Statistical significance for root hair length was determined by one-way ANOVA. Means ± S.E. (n = 215 for Col-0, 195 for eru-3 and 264 for eru-3+ERU-GFP root hairs from 5 independent 4 d-old seedlings per genotype). Different letters indicate significant difference (Tukey’s test, p < 0.001). Scale bar = 100 mm.(D) Localization of ERU-GFP in root hairs at various stages of development. Plasma membrane (pm); vacuole (v); tonoplast (t). In addition to the plasma membrane, ERU-GFP marks distinct puncta (arrowheads) in root hairs undergoing rapid tip growth. Bars = 10 mm.(E) Double Y-axis graph showing that fluorescence of ERU-GFP intensifies as root hairs transition to rapid tip growth. Relative fluorescence and root hair length were measured every 10 min. Mean± S.E. (n= 4 root hairs from 4 independent 4-d old seedlings) ± S.E. (F) Scatter plot showing that fluorescence of ERU-GFP is positively correlated with growth rate of root hairs (p < 2.2 × 10-6). The same data were plotted in (E) and (F).

Figure 2. ERU functions in maintaining normal tip-focused [Ca2+]cyt in Root hairs. (A) Representative heat maps of the root hair apex and normalized oscillograms of one wild-type and two eru-3mutants. Numbers in the pseudocolored images correspond to indicated positions on the oscillogram. Bars = 10 mm. The entire time-lapse sequence corresponding to each oscillogram can be seen in Supplemental Movie 1 with red indicating the highest [Ca2+]cyt dependent fluorescence.(B) Fourier spectra corresponding to wild type and eru-3 root hair tip-focused [Ca2+]cyt oscillations shown on the rightmost panels of (A). Main oscillation frequencies for each genotype are indicated by the arrows.(C) and (D) Bar graphs showing the average frequency and amplitude of the main Fourier peaks for wild-type and eru-3 root hairs. Means ± S.E. (n = 31 wild type and 36 eru-3 root hairs from 10 independent 5 d-old seedlings per genotype) . p< 0.0001*** Student’s T-test). See detailed methods in supplemental materials.

SUPPLEMENTAL METHODS

Identification of the eru-3 Mutant

An activation-tagged seed stock (CS31100) of Arabidopsis thaliana was obtained from the ABRC (The Ohio State University, Columbus, OH). Seeds were sterilized with 95% ethanol and 20% bleach, and washed at least 3 times in deionized water as described in Dyachok et al., (2016). Sterilized seeds were suspended in half strength MES (0.5 g/L; pH 5.7)-buffered MS medium (Murashige and Skoog, 1962) containing 1% sucrose and 0.5% agar after the solution had been autoclaved and cooled to 55 ºC (Sparks et al., 2016). The seed suspension was swirled to disperse seeds uniformly and poured into 10 cm × 10 cm Petri plates to form a polymerized gel layer that was about 2-3 mm thick. The plates were kept at 4 ºC for two days and transferred to a growth chamber under 14-h light (150 µmol quanta m-2 s-1) and 10-h dark cycle at 23 ºC. After keeping plates vertical for 5-6 days, seedlings were screened under a Nikon SMZ 1500 stereofluorescence microscope (Nikon Instruments, Melville, New York) for root hairs resembling those treated with latrunculin B (i.e., irregular and slightly wavy growth).

DNA was extracted from two week-old mutant seedlings that were backcrossed three times and TAIL PCR was performed as described previously (Liu and Whittier, 1995) using primers modified for the pSKI015 plasmid (Weigel et al., 2000). The modified primer sequences are: SP1, 5’-ACGT TCACTGAAGGGAACTC-3’; SP2, 5’- TGACAGTGACGACAAATCGTTG-3’; and SP3, 5’-GTCGAGGCTCAGCAGGAC CTG- 3’. The amplified bands were resolved on a 1% agarose gel, eluted from the gel and the nucleotides were sequenced.

UBQ10:ERU-GFP and UBQ10:G-CAMP3 Constructs

The constitutive promoter UBQ10 was used to drive expression of ERU-GFP and G-CAMP3 constructs in wild type and eru-3. The upstream sequence of the UBQ10 gene was amplified with primers PstIUBQ10F (5’- GCGCTGCAGGTCGACGAGTCAGTAATA AACGG-3’) and EcoRIUBQ10R (5’-CGCGAATTCCTGTTAATCAGAAAAACTCAGATT AATC-3’) using genomic DNA of Arabidopsis thaliana Col-0 as template. The 0.6-kb PCR product was digested with PstI and EcoRI (New England Biolabs) and cloned into the 35S:ABD2-GFP construct (Wang et al., 2008) that was pre-cut with the same enzymes. The resulting construct was named as UBQ10:GFP. The open-reading frame of ERU was amplified with primers lbl2F (5’-CATGAATTCATGGGAGGAGATTTTCGT CA-3’) and lbl2R (5’-GTAGAATTCCGGTATTG AATGCGACGG-3’) using genomic DNA as template. The 2.5 kb PCR product was cloned at the EcoRI site in the UBQ10:GFP plasmid to generate UBQ10:ERU-GFP. The open-reading frame of G-CAMP3 (Tian et al., 2009) was amplified from the plasmid (G-CaMP3; Plasmid #22692, AddGene; https://www.addgene.org) using primers GCAMP3F (5’-CATGA ATTCATGGGTT CTCATCATCATCATCA-3’) and GCAMP3R (5’-TACACTAGTTTACTTCGCTGTCA TCATTTGTAC-3’). The 1.4 kb PCR product of G-CAMP3 was digested with EcoRI and SpeI and cloned into the UBQ10:GFP plasmid to generate UBQ10:G-CAMP3. The resulting plasmids were fully sequenced prior to plant transformation.The constructs were introduced to wild type and eru-3 via Agrobacterium tumefaciens-mediated transformation using the floral dip method (Clough and Bent, 1998). Seedlings that were positive for GFP were selected under a fluorescence stereomicroscope, and seeds were propagated for root hair quantification and microscopy.

Live Cell Microscopy of Root Hairs

Live cell imaging using confocal microscopy was performed on 4-5-day-old seedlings grown on 48 mm × 64 mm coverslips as described in Dyachok et al., (2016). Briefly, coverslips containing the seedlings expressing UBQ10:ERU-GFP and UBQ10:G- CAMP3 were placed horizontally on the stage of a SPX-8 point scanning confocal microscope (Leica Microsystems, Buffalo Grove, Illinois) or an UltraView ERS spinning- disc confocal microscope (Perkin Elmer Life and Analytical Sciences, Waltham, Massachusetts) equipped with 40 × water or 100 × oil immersion objectives. GFP was imaged by illuminating roots growing along the coverslip surface with the 488 nm line of the SPX-8 white light laser or the UltraView ERS argon-krypton laser and emission detected

at 510 nm. Time-lapse movies or single time point images were collected using Volocity acquisition version 6.3.5 (Improvision) or SPX-8 LAS software, for the UltraView and SPX-8, respectively. Confocal images of root hairs were acquired at a fixed focal plane that spanned the median of the cell.

Correlation of fluorescence intensity of ERU-GFP with root hair growth rate was measured from 60-min time-lapse sequences using Python programming language (https://www.python.org). The 8-bit images with fluorescence values ranging from 0 to 255 were obtained with the spinning disc confocal microscope. Images were horizontally aligned so that base of root hair was positioned on the left side and the root hair apex on the right side. Root hair area was identified by applying a threshold of 35, which was a typical background fluorescence level with the spinning disc confocal microscope setting. Total fluorescence was measured by obtaining the sum of intensity values from the identified root hair area, and normalized to the maximum fluorescence value across the entire movie sequence. From the same time-lapse sequence, growth rate was measured by tracing the horizontal displacement of the root hair apex. Vertical shifting of the root hair apex was disregarded since it resulted from the growth of the primary root. Relative fluorescence and growth rate were measured 10 min interval (Figure 1E-F). The relationship between relative ERU-GFP fluorescence and root hair growth rate was determined by Pearson’s correlation analysis, and both correlation coefficient and P-value were reported from measurements of 4 root hairs of 4 seedlings grown independently for 4 days.

Measurements of tip [Ca2+]cyt oscillations in seedlings expressing UBQ10:G- CAMP3 were conducted only on root hairs that had a clear cytoplasm at the tip as judged by differential interference contrast (DIC) microscopy. Single optical sections were acquired on the SPX-8 confocal microscope every 1 s for 5 min using the same laser power and detector settings. Average fluorescence intensity was acquired by marking a 25 µm2

region at the root hair apex using the rectangular selection tool of the SPX-8 LAS software. Fluorescence intensity values were normalized to the lowest average fluorescence intensity value for each root hair trace as F-F0 (where F is the average fluorescence intensity at any given time point and F0 is the lowest average fluorescence value). Fast Fourier Transform (FFT) methods to detect major peak positions and amplitude of root hair tip [Ca2+]cyt oscillations were as described in Schoenaers et al., (2017, 2018).

Supplemental References Clough, S.J. and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium- mediated

transformation of Arabidopsis thaliana. Plant J. 16: 735–743. Dyachok, J., Paez-Garcia, A., Yoo, C.-M., Palanichelvam, K., and Blancaflor, E.B. (2016). Fluorescence

imaging of the cytoskeleton in plant roots. In Cytoskeleton Methods and Protocols, Methods in Molecular Biology. (Humana Press, New York, NY), pp. 139–153.

Liu, Y.-G. and Whittier, R.F. (1995). Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25: 674–681.

Schoenaers, S. et al. (2018). The auxin-regulated CrRLK1L kinase ERULUS controls cell wall composition during root hair tip growth. Curr. Biol. 28: 722-732.e6.

Schoenaers, S., Balcerowicz, D., Costa, A., and Vissenberg, K. (2017). The kinase ERULUS controls pollen tube targeting and growth in Arabidopsis thaliana. Front. Plant Sci. 8.

Sparks, J.A., Kwon, T., Renna, L., Liao, F., Brandizzi, F., and Blancaflor, E.B. (2016). HLB1 is a tetratricopeptide repeat domain-containing protein that operates at the intersection of the exocytic and endocytic pathways at the TGN/EE in Arabidopsis. Plant Cell 28: 746–769.

Tian, L. et al. (2009). Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators. Nat. Methods 6: 875–881.

Wang, Y.-S., Yoo, C.-M., and Blancaflor, E.B. (2008). Improved imaging of actin filaments in transgenic Arabidopsis plants expressing a green fluorescent protein fusion to the C- and N-termini of the fimbrin actin-binding domain 2. New Phytol. 177: 525–536.

Weigel, D. et al. (2000). Activation tagging in Arabidopsis. Plant Physiol. 122: 1003– 1014. Supplemental Movie Legend. Time lapse sequences of wild-type and eru-3 tip [Ca2+]cyt oscillations. Red indicates elevated [Ca2+]cyt. Total elapsed time of the movie is 5 min and images were captured every 1 s.

DOI 10.1105/tpc.18.00316; originally published online May 25, 2018;Plant Cell

Taegun Kwon, J. Alan Sparks, Fuqi Liao and Elison B. Blancaflorby Maintaining Tip-Focused Cytoplasmic Calcium Oscillations

ERULUS is a Plasma Membrane-Localized Receptor-Like Kinase that Specifies Root Hair Growth

 This information is current as of November 29, 2018

 

Supplemental Data /content/suppl/2018/05/25/tpc.18.00316.DC1.html

Permissions https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X

eTOCs http://www.plantcell.org/cgi/alerts/ctmain

Sign up for eTOCs at:

CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain

Sign up for CiteTrack Alerts at:

Subscription Information http://www.aspb.org/publications/subscriptions.cfm

is available at:Plant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists