epidemiological investigation of risk factors of …

EPIDEMIOLOGICAL INVESTIGATION OF RISK FACTORS OF MASTITIS IN DAIRY BUFFALO AND ANTIBIOTIC

RESISTANCE OF STAPHYLOCOCCUS AUREUS

ABID HUSSAIN 2010-VA-261

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF REQUIREMENTS FOR THE DEGREE

OF

DOCTOR OF PHILOSOPHY

IN

EPIDEMIOLOGY AND PUBLIC HEALTH

UNIVERSITY OF VETERINARY AND ANIMAL SCIENCES, LAHORE

2015

The Controller of Examinations, University of Veterinary and Animal Sciences, Lahore.

We, the supervisory committee, certify that the contents and form of the thesis,

submitted by Mr. Abid Hussain, Regd. No. 2010-VA-261 have been found satisfactory and

recommend that it be processed for the evaluation by the External Examiner(s) for the award of

the degree.

SUPERVISOR ____________________________ Prof. Dr. Mansur-ud-Din Ahmad MEMBER _____________________________ Dr. Muhammad Hassan Mushtaq MEMBER ______________________________ Prof. Dr. Muhammad Sarwar Khan

DEDICATED

To

My Teachers, Parents and Family

i

ACKNOWLEDGEMENTS

All praises to “ALLAH”, the Almighty, Most Gracious, the most Merciful and the Sustainer

of the worlds, Who created the jinn and humankind only for His worship and raised among the

inhabitants of Makkah the Holy Prophet “Muhammad” (peace be upon him.) from among

themselves, who recited to them His revelations and purified them, and taught them the Book (Holy

Quran) and the Wisdom. Foremost, thanks to Almighty Allah Who blessed me with good health

and valued teachers to accomplish my Ph.D studies. I feel great pleasure in expressing my

heartiest gratitude and a deep sense of obligation to my distinguished supervisor, Prof. Dr.

Mansur ud Din Ahmad, Department of Epidemiology and Public Health, for his able guidance,

keen interest, skilled advice, constructive criticism, constant encouragement, valuable suggestions

and kind supervision throughout the course of my study and research work. In addition, I owe my

thanks to my committee members, Dr. Muhammad Hassan Mushtaq Assistant Professor,

Department of Epidemiology and Public Health, and Prof. Dr. Muhammad Sarwar Khan,

Department of Clinical Medicine and Surgery, for their time and insights into this study. All these

respected teachers have contributed their thoughts, perspectives, insights, and experiences, which

have positively impacted the quality of my thesis. Special thanks to Prof. Dr. Michael Philipp

Reichel and Dr. Tanveer Hussain who helped me a lot during my research work. Many thanks go

to the labs of Epidemiology and Public Health. In the end, I could not envisage the endeavors that

my parents, made for my comfortable stay at the campus No acknowledgement could ever

adequately express my obligation to my affectionate parents for leading their children into

intellectual pursuits. “May Allah give them a long, prosperous and happy life” (Aa’meen). I also

extend my heartiest compliments to Dr. Noshaba Fakhar-ud-Din, Fatima Abid, Meerub Abid,

brother and sisters whose love and support made it possible to reach this position.

Abid Hussain

ii

TABLE OF CONTENTS

DEDICATION ………………………………………………………….. (i)

ACKNOWLEDGEMENTS ……………………………………………. (ii)

TABLE OF CONTENTS………………………………………………. (iii)

LIST OF TABLES ……………………………………………………… (iv)

LIST OF FIGURES …………………………………………………….. (v)

S. NO. CHAPTERS PAGE NO.

1 INTRODUCTION 1

2 REVIEW OF LITERATURE 6

3 EXPERIMENT-1 53

4 EXPERIMENT-2 105

5 EXPERIMENT-3 120

6 SUMMARY 154

iii

LIST OF TABLES

TABLE NO.

TITLE PAGE NO.

3.1 Prevalence of Clinical and Subclinical Mastitis in Lactating Buffaloes 73 3.2 Prevalence of Mastitis on basis of Herd size in Lactating Buffaloes 74 3.3 Prevalence of Mastitis on basis of Age wise in Lactating Buffaloes 75 3.4 Prevalence of mastitis on basis of breed in Lactating Buffaloes 76 3.5 Prevalence of mastitis on basis of parity in lactating buffaloes 77

3.6 Prevalence of mastitis on basis of stage of lactation in lactating buffaloes 78

3.7 Quarter wise prevalence of mastitis in lactating buffaloes 79

3.8 Prevalence of mastitis in lactating buffaloes having mastitis in 1, 2, 3 and 4 quarters 80

3.9 Univariable Analysis for Association of different Risk Factors with Mastitis

81

3.10 Univariable Analysis for Association of different Risk Factors with Mastitis

82

3.11 Univariable Analysis for Association of different Risk Factors with Mastitis 83

3.12 Multivariable Analysis of Potential Risk Factors with Prevalence of Mastitis

84

4.1 Isolation and identification of Staphylococcus aureus 110

4.2 Percentage (%) and number of Staphylococcus aureus resistant, intermediate and sensitivity to antibiotics (n=236) 110

5.1 Coagulase gene pairwise genetic distance among all Pakistani strains 136 5.2 FnbA Pairwise genetic distance between all Pakistani strains 137

5.3 The pairwise genetic distance relationship between isolated strains and some reference strains based on coagulase gene sequence 138

5.4 The pairwise genetic distance relationship between isolated strains and some reference strains based on fibronectin binding protein A 139

iv

LIST OF FIGURES FIGURE

NO. TITLE PAGE NO.

2.1 Anatomy of the Bovine Udder 09

4 .1 Pattern of resistance of Staphylococcus aureus against Antibiotics 111

4.2 Pattern of sensitivity of Staphylococcus aureus against Antibiotics 112

5.1 Agarose gel electrophoresis of coa gene PCR amplification products. 100 bp DNA ladder, lane 1-2: 540 bp, lane 3,6: 550 bp, lane 4-5,10: 525 bp, lane 7: 430 bp and lane 9: 840bp

128

5.2 Agarose gel electrophoresis of FnbA gene PCR amplification products. 100 bp plus DNA ladder, lane 1-10: 1150 bp. 129

5.3 Coa Phylogenetic tree (MEGA6.1, NJ method with 1000 bootstrap value) showing evolutionary relationship among all Pakistani strains 132

5.4

Phylogenetic tree (MEGA6.1, NJ method with 1000 bootstrap value), based on coagulase gene sequences, showing evolutionary relationship of Pakistani strains/isolates with selected reference strains from different geographical locations. Pakistani strains/isolates have been indicated by closed triangles

133

5.5 Fibronectin Binding Protein A, Phylogenetic tree (MEGA6.1, NJ method with 1000 bootstrap value) showing evolutionary relationship among all Pakistani strains

134

5.6

Phylogenetic tree (MEGA6.1, NJ method with 1000 bootstrap value), based on FnbA gene sequences, showing evolutionary relationship of Pakistani strains/isolates with selected reference strains from different geographical locations. Pakistani strains/isolates have been indicated by closed triangles

135

v

CHAPTER 1 INTRODUCTION

Pakistan is an agricultural country where livestock farming is its integral part and

considered to be the backbone of the rural economy. The livestock contribution in national GDP

is 11.8% while its share in agricultural value added stands at 55.9%. The agriculture sector involves

43.7% of the labour force in the country. As many as 8.4 million farming families are directly

engaged in livestock rearing nationwide that shows the critical dependence of nearly 40 million

rural people on the livestock sector for their livelihoods. Milk is by far single most commodity of

the livestock sector and the value of milk alone exceeds than the combined value of cash crops

such as wheat, rice, maize and sugarcane. Pakistan is third largest milk producing country in the

world with an annual production of 50.9 million tons. Milk production in Pakistan is mainly

dominated by 34.6 million buffaloes (Anonymous, 2014) having a share 75% of the total milk

produced in the country (Jamil et al. 2011; Hussain et al. 2012).

Dairy farming in Pakistan is primarily fragmented into traditional rural, progressive/semi-

commercial rural, peri-urban and commercial/corporate farming. However, the traditional rural

farming is the largest segment among all. The majority of dairy farmers are smallholders with

substantial number of landless farmers. The 61% of the farmers owned only 1-2 animals, 30% of

their owned 3-6 animals and the reaming 9% farmers have more than 6 animals herd size. A

number of notable livestock diseases, both infectious and non-infectious, are quite common in

Pakistan. These diseases are not only life threatening but also have substantial impact on the

production of dairy animals towards economic distress for the farmers. Among the infectious

diseases mastitis has been ranked on top for economic losses because of decreased milk production

1

INTRODUCTION

(Hussain et al. 2013; Farooq et al. 2008). It results not only in milk losses but also deteriorate its

quality.

Mastitis is a complex and multi factorial disease and prevalent around the globe in herds.

It is an inflammation of the parenchyma of the udder characterized by physical, chemical and

pathological changes in the milk and udder. Mastitis mostly occurs in two forms i.e. clinical and

subclinical. The clinical mastitis can easily be identified with abnormal milk, udder swelling and

disorder of the affected animal, while subclinical mastitis, mostly gone unnoticed by farmers

because of non-apparent milk changes (Radostits et al. 2000). For every case of clinical mastitis,

there are 20-40 times as many cases of subclinical mastitis and this subclinical mastitis causes

losses in the dairy industry (Erskine et al. 2002; Schultz et al. 1978).

Mastitis can be divided in the environmental and contagious form on the basis of its

etiological agents. The environmental mastitis is derived from the environment in which the animal

lives. Contagious mastitis can be transmitted from one buffalo to another during milking from

infected to healthy animal. The contagious pathogens are Streptococcus agalactiae,

Staphylococcus aureus and mycoplasma spp. Among the contagious mastitis pathogens,

Staphylococcus aureus is most frequently responsible for this disease. Staphylococcus aureus

produce toxins that destroy cell membranes and can directly damage milk producing tissue. The

leukocytes are attracted to the area of inflammation, where they attempt to fight the infection.

Initially, the bacteria damage the tissues lining the teats and gland cisterns within the quarter,

which eventually leads to formation of scar tissue. The bacteria then move up into the duct system

and establish deep-seated pockets of infection in the milk alveoli. This is followed by the formation

of abscesses that wall-off the bacteria to prevent spread but allow the bacteria to avoid detection

by the immune system. The abscesses prevent antibiotics from reaching the bacteria and are the

2

INTRODUCTION

primary reason (Petersson et al. 2010). S. aureus is modified to survive in the mammary gland and

usually causes a subclinical mastitis and can be shed in the milk, facilitating transmission to healthy

animals during the milking process (Radostits et al. 2007). The main reasons for the failure of any

of the antibiotic therapy in most cases of Staphylococcal mastitis are inadequate concentration of

antibiotics reaching at the site of infection, bacterial antibiotic resistance, L-forms of bacteria

(sensitive to beta-lactam antibiotics), bacterial dormancy and tissue barriers, as this organism lies

in deep seated foci. It causes pockets in the depth of udder surrounded by fibrous tissue where

antibiotics cannot gain access (Sandholm et al. 1991).

In principle, antibiotic sensitivity against the available chemotherapeutic agents in a region

or locality should be done from time to time to enable the veterinarians to prescribe the most

suitable antibiotics against the prevailing diseases.

The present study was planned with the following aims and objectives:

• To assess the prevalence of mastitis in buffaloes.

• To identify the epidemiological risk factors of mastitis.

• To assess the resistance of Staphylococcus aureus against commonly used

antibiotics.

• Molecular characterization of virulent gene of indigenous strains of Staphylococcus

aureus.

3

INTRODUCTION

REFERENCES

Anonymous. 2014. Agriculture Corner, Livestock. Pakistan Economic Survey. Government of

Pakistan, Finance division, Economic Advisor’s Wing Islamabad. 27-29.

Erskine R, Walker R, Bolin C, Bartlett P, White D. 2002. Trends in antibacterial susceptibility of

mastitis pathogens during a seven-year period. J Dairy Sci. 85: 1111-1118.

Farooq A, Inayat S, Akhtar M, Mushtaq M. 2008. Prevalence of mastitis and antibiotic sensitivity

of bacterial isolates recovered from Nili-Ravi buffaloes. J Anim Plan Sci. 18: 76-77.

Hussain R, Javed MT, Khan A, Mahmood F, Kausar R. 2012. Mastitis and associated histo-

pathological consequences in the context of udder morphology. Int J Agric Biol. 14: 947-

952.

Hussain R, Javed MT, Khan A, Muhammad G. 2013. Risk factors associated with subclinical

mastitis in water buffaloes in Pakistan. Trop anim health prod. 45(8): 1723-1729.

Jamil H, Samad H, Rehman N, Qureshi Z, Lodhi L. 2011. Effect of somatic cell types and culture

medium on in vitro maturation, fertilization and early development capability of buffalo

oocytes. Pak Vet J. 31: 105-108.

Petersson-Wolfe, CS, Mullarky IK, Jones GM. 2010. Staphylococcus aureus mastitis: cause,

detection, and control.

Radostits OM, Gay CC, Blood DC, Hincheliff KW. 2000. Mastitis In: Veterinary Medicine: A text

book of diseases of cattle, sheep, pig, goat and horses. Vol, Edition. W.B. Saunders,

London, 603-700.

Radostits OM, Gray CC, Hinchcliff KW, Constable PD. 2007. Mastitis. In: Veterinary Medicine.

A text book of the disease of Cattle, Horse, Sheep, Pigs and Goats.Vol, Edition. Sounder,

Spain, 673-749.

4

INTRODUCTION

Sandholm M, Louhi M, Espinasse. J. 1991. Bovine Mastitis: why does antibiotic therapy fail?

Mammites, desvaches, laitieres. 9: 88-106.

Schultz LH, Brown RW, Jesper DE, Berger MW, Natzke RP, Philpot WN, Smith JW, Thompson

PD. 1978. Current concept of bovine mastitis. 2nd ed. The Natl. Mastitis Council, Inc.

Washington D. C., USA. P. 6-9.

5

CHAPTER 2 REVIEW OF LITERATURE

2.1 Buffalo

In South Asia, the water buffalo is reared as a primary dairy animal. The water buffalo

(Bubalus bubalis) is also called as the ‘Black Gold’. Water buffalo plays a vital role in Asia and

Far-Eastern countries where 96.0% of its total population exists. At present, Pakistan has a buffalo

population of 34.6 million (Anonymous 2014). Buffalo is recognized as the world’s second most

important milk producing species. In buffalo milk production, it has been estimated that 95.0% of

world’s buffalo milk is produced in Asia (FAO, 2010). Pakistan is the fifth largest milk producer

in the world (FAO, 2010). In Pakistan, the increasing interest in buffalo breeding during recent

years owes to the increased demand of buffalo milk with more butterfat, protein and lactose, which

is essential for buffalo mozzarella cheese and makes it more valuable than bovine milk (Moroni et

al. 2006).

2.2 Mastitis

Mastitis is a complex and multifactorial disease and it is an important dairy health problem

with physical, chemical and pathological alterations in milk and udder. It is an inflammation of

the parenchyma of the udder and is characterized by physical, chemical and pathological changes

in the milk and udder. Udder inflammation may be caused by any injurious agent, including

physical trauma, chemical irritants, infectious agents and their toxins. Mastitis occurs worldwide

among dairy animals and it has an extreme zoonotic and economic impact (Radostits et al. 2007).

Mastitis mostly occurs in two forms i.e. clinical and subclinical. The clinical mastitis can

be easily identified with abnormal milk, udder swelling and the disorder of the affected animal

while in case of subclinical mastitis, there only increases in somatic cell count with no apparent

milk changes (Radostits et al. 2000). In subclinical mastitis, milk production may decrease and

6

REVIEW OF LITERATURE

bacteria are present in the milk. It has been reported from previous studies that annual losses due

to mastitis in dairy industry are approximately $2 billion and $526 million in the USA and India,

respectively (Varshney and Naresh 2004; Donovan et al. 2005). For every case of clinical mastitis,

there are 20-40 times as many cases of subclinical mastitis and this subclinical mastitis causes the

losses in the dairy industry (Erskine, 2002: Schultz et al. 1978). Mastitis can be divided in the

contagious and environmental form on the basis of its etiological agents. Among the etiological

agents, bacteria are the most common ones, the greatest share of which resides widely distributed

in the environment of dairy cows, and hence pose a common threat to the mammary glands

(Bradley, 2002). The cost of milk production increases due to the cost of treatment along with the

loss of milk due to reduced volumes and its poor quality (Radostits et al. 2007). Mastitis severely

affects milk quality and production of infected animals and has a tendency to spread rapidly within

the herds and to other animals. Compositional changes in the milk of infected animals with mastitis

depend upon the inflammatory response of mammary gland, extent and pathogenicity of infectious

agent along with amount of infected tissue, leakage of blood, various enzymes, proteins, salts,

decreased concentration of lactose and fat in milk (Osteras, 2000).

2.2.1 Anatomy of Udder

The glands and teats of domestic animals are collectively known as udder. A buffalo udder is

composed of two halves, each of which has two teats and each teat drains a separate gland (quarter).

The quarters are separated by connective tissue and each has a separate milk collecting system.

The two halves of the bovine udder are separated by the median suspensory ligament, which is

formed by two lamellae of elastic connective tissue originated from the abdominal tunic. The

posterior extremity of its ligament is attached to the prepubic tendon. The lateral suspensory

ligaments are composed largely of fibrous, non-elastic strands given rise to numerous lamellae that

7


penetrate the gland and become continuous with the interstitial tissue of the udder. The lateral

suspensory ligaments are attached to the prepubic and subpubic tendons, which in turn are attached

to the pelvic symphysis. The lateral and median suspensory ligaments are the primary structure

supporting the bovine udder. The bovine teat has a small cistern terminating at its distal extremity

in the streak canal, which is the opening to the exterior of the teat. Radiating downward from its

internal opening into the streak canal is a structure known as Furstenberg’s rosette, which is

composed of about seven or eight loose folds of double layered epithelium and underlying

connective tissue; each fold has a number of secondary folds. The primary structure responsible

for the retention of milk is a sphincter muscle surrounding the streak canal. Large ducts empty into

a gland cistern located above each teat. These ducts branch profusely, ultimately ending in

secretory units called alveoli. Alveoli are generally recognized as the basic functional units of the

lactating mammary gland (Husveth, 2011).

Milk is formed in the epithelial cells of the alveolus. The alveolus are approximately 100

to 300 µm in diameter. The size of the alveolus is affected by many factors, primarily the amount

of milk in the lumen. The alveoli are grouped together in units known as lobules, which are

surrounded by more extensive connective septa. The alveoli are surrounded by contractile

myoepithelial cells that are involved in the milk-ejection. Myoepithelial cells are also located along

the ducts (Husveth, 2011).

8


Figure: 2.1 Anatomy of the Bovine Udder.

9


2.3 Mastitis and its Pathogens

The major pathogens responsible for mastitis include Staphylococcus aureus,

Streptococcus uberis, Streptococcus agalactiae, Streptococcus dysgalactiae and Escherichia coli.

Staphylococcus aureus and Streptococcus agalactiae serve as contagious pathogens while

Escherichia coli, Streptococcus uberis, and Streptococcus dysgalactiaeact as environmental

pathogens (Waller et al. 2009). Among a very large number of pathogens causing mastitis in

buffalo and cow, Staphylococcus aureus and Streptococcus agalactiae are the most frequent

etiological agents and induce an extensive and wide variety of pathologies in lactating animals

(Marjan et al. 2009; Cheng et al. 2010). Intramammary infections with Staphylococcus aureus are

associated usually with increased somatic cell count. Staphylococcus aureus is contagious and

spreads easily within dairy herds (Barkema et al. 2006; Marjan et al. 2009). Prevalence of mastitis

pathogens varies from one dairy herd to other dairy herd, but bacterial pathogens are most

prominent and act as a first line of infection throughout the world (Bradley, 2002; Unnerstad et al.

2009). Mastitis causing bacteria are divided into two groups contagious and non-contagious, which

include gram positive bacteria, whose cell wall consists of peptidoglycan layers that withhold

crystal violet stain and gram negative that lack peptidoglycan layers and teichoic acid incorporated

within the peptidoglycan. The major gram positive bacteria include Staphylococcus aureus,

Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae (Piepers et al.

2009). In gram negative mastitis pathogens, Escherichia coli acts as the primary pathogen

(Unnerstad et al. 2009). Mastitis is mostly caused by a wide range of bacteria mainly

Staphylococcus aureus followed by Streptococcus agalactiae, Staphylococcus hyicus,

Staphylococcus epidermidis, Bacillus spp., Staphylococcus hominis, Escherichia coli,

Staphylococcus xylosus, Streptococcus dysgalactiae and Corynebacterial spp. (Ali et al. 2008;

10


Unnerstad et al. 2009; Waller et al. 2009). In spite of growth inhibitory properties of keratin,

bacteria are able to survive in teat canal causing inflammation (Trinidad et al. 1990). Milk is sterile

and free from pathogens when it is secreted by the mammary gland and it is infected with different

micro-organisms when flows out of the udder. Generally, various pathogenic and non-pathogenic

microorganisms excluding mastitis dairy animals cause changes in color, taste, aromas of milk and

certain pathogens result in food borne diseases. Pathogenic organisms which are responsible for

the deterioration of milk and its product quality, mainly enter into milk through improper milking,

handling, storage and finally unhygienic conditions of workers.

Staphylococcus aureus produce toxins that destroy cell membranes and can directly

damage milk producing tissue. The leukocytes are attracted to the area of inflammation, where

they attempt to fight the infection. Initially, the bacteria damage the tissues lining the teats and

gland cisterns within the quarter, which eventually leads to formation of scar tissue. The bacteria

then move up into the duct system and establish deep-seated pockets of infection in the milk alveoli.

This is followed by the formation of abscesses that wall-off the bacteria to prevent spread but allow

the bacteria to avoid detection by the immune system. The abscesses prevent antibiotics from

reaching the bacteria and are the primary reason (Petersson et al. 2010).

2.4 Economic Importance and Characterization of Mastitis

In Pakistan, economic losses due to mastitis have serious concerns (Farooq et al. 2008).

The importance of domestic animals may be realized from the fact that the rural population is

generating, 30-40% of their income from livestock and almost 35-40 million populations are

involved in the livestock industry (Anonymous 2013). Various expenses like decreasing in milk

production, treatment cost, increased labor charges are compound conditions where culling

becomes necessary. The improved management practices can reduce the prevalence of mastitis.

11


While investigating the total expenses that are involved in mastitis prevention and its treatment,

scientists have determined some strategies based on the direct impacts of disease. Miller et al.

(1993), determined cost of mastitis prevention was $14.50 per animal per year. Economic losses

due to mastitis may be divided into: 70.0% lower milk production, 8.0% discarded milk due to

veterinary medication, 8.0% treatment and veterinary charges and 14.0% premature culling

(Barkema et al. 2006; Halasa et al. 2007). Mastitis results in premature removal of herd, alters

reproduction, increases culling thus causing serious economic loss to farmers (Parker et al. 2008).

According to Wells et al. (1998), worldwide losses due to mastitis were estimated to be

approximately $35 billion annually. In the US, overall costs of mastitis were estimated to be $1.5–

2.0 billion per year, while losses from reduced milk production and higher replacement costs

associated with high somatic cell counts (SCC), due to subclinical mastitis were estimated at $960

million (Wells et al. 1998). In 2007, the USDA reported that mastitis was considered to be one of

the most costly diseases of the dairy industry (USDA, 2008). The average cost of generic clinical

mastitis (CM) per cow and year in high-yielding dairy cows, based on collecting data from 5 large

herds since 2004 to 2006 in New York State was $71, with an incidence of 39.7 CM cases per 100

cows per year and the average cost of a CM case was $179. This cost comprised of $115 due to

milk yield losses, $14 due to increased mortality, and $50 due to treatment-associated costs

(Barkema et al. 2006). In Africa, according to Mungube et al. (2005), production losses associated

with subclinical mastitis were estimated 5.6% of the Addis Ababa Milk Shed. Losses were highest

(9.3%) for urban dairy farms and small-scale farms (6.3%). The estimates of the financial losses

ranged from $29.1, for dairy herds in secondary towns, to $66.6 for urban dairy farms. A total loss

of $38 was estimated for each cow per lactation (Mungube et al. 2005).

12


2.5 Prevalence of Mastitis

According to a study conducted by Ali (2009), the overall prevalence of subclinical mastitis

was 23.9%. Sharma et al. (2007) reported the overall prevalence of subclinical mastitis (SCM) by

quarter was 42.0% in Chhattisgarh State, India by the Modified California Mastitis Test (MCMT).

Elbers et al. (1998), conducted a study in Southern part of Netherland and reported the incidence

rate was 12.7 quarter/year per. Hameed et al. (2012) conducted a study in Burewala Pakistan, and

reported a total of 673 animals (n=291 cattle, n=382 buffaloes) from 300 livestock farmers and

tested using the Surf Filed Mastitis Test (SFMT) for the presence of mastitis. A prevalence of

clinical and subclinical mastitis was 24.6 and 36.4% in buffaloes, respectively, and subclinical

mastitis was more vital in varying from 10–50%, 5–20% in cow and buffaloes respectively than

clinical mastitis (Joshi and Gokhale 2006) in India. Anwar et al. (2013) reported that

Staphylococcus aureus prevalence was highest and the most frequently bacterial species such as

in Nili Ravi and Kundhi 40.4% and 34.9%, while in the study by Hussain et al. (2013) the

subclinical mastitis prevalence was recorded to be 15.2% in Lahore, Pakistan. According to

Megersa et al. (2010), subclinical mastitis and clinical mastitis were 11.2%, 4.3% respectively in

Southern Ethiopia, while mastitis overall prevalence was 15.5%. Busato et al. (2000) described

the quarter wise subclinical mastitis prevalence was 21.2% and overall prevalence of subclinical

mastitis (SCM) was 36.5% in Switzerland while Buchaya et al. (2005) the quarter wise overall

prevalence of mastitis as 58.7% and the animal wise was 78.0% in Bangladesh.

2.6 Quarter wise prevalence

According to Bansal et al. (1995), subclinical mastitis was present in 23.9% of buffaloes

and 11.3% of buffalo’s udder quarters while Prabhakar et al. 1995 stated that the overall monthly

incidence was 4.1 percent and Khan et al. (2004), by using the Surf field mastitis test, recorded

13

http://scholar.google.com/scholar?cluster=15716398471321748692&hl=en&oi=scholarr

http://link.springer.com/search?facet-author=%22Bekele+Megersa%22

http://www.sciencedirect.com/science/article/pii/S0167587700001045


27.0, 4.0 and 10.0 % prevalence for subclinical mastitis, clinical mastitis and blind quarters,

respectively. Lalrinthuanga et al. (2003) revealed that 37.5% and 11.6% for mastitis by animal

and quarter, respectively while Ahmad et al. (1991) described the subclinical mastitis prevalence

was 7.0%. Physical examination of udders revealed (7.2%) blind teats. Islam, et al. (2011)

showed the overall clinical mastitis prevalence and subclinical mastitis as 4.5% and 37.2%,

respectively while another study by Islam et al. (2012) showed the overall prevalence of

subclinical mastitis (SCM) 29.0%. Zeryehun et al. (2013) revealed abnormalities of the udder as

evidence of mastitis 74.7% in cows and 9.6% clinical and 55.1% were subclinical mastitis while

the incidence of clinical mastitis was 22.8% (Peeler et al. 2000). Sargeant et al. (1998) mentioned

a prevalence of 19.8% of cows experiencing one or more cases of clinical mastitis during lactation

and the bacteria isolated was Staphylococcus aureus (6.7%). Oezencet al. (2008) investigated the

mastitis per quarter and animal 36.5%, 69.1%, respectively. Bachaya et al. (2011) investigated

Staphylococcus aureus was a predominant bacterial species recovered from mastitis and it shows

dominancy 48.6% and following bacterial species were isolated such as Staphylococcus aureus

(48.6%), Bacillus cereus (2.9%), Escherichia coli (10.0%), Micrococcus luteus (15.7%), Proteus

vulgaris (4.3%), Pseudomonas aeruginosa (1.4%), Streptococcus dysgalactiae (11.4%),

Streptococcus uberis (4.3%) and Citrobacter species (1.4%). Ali et al. (2011) stated the overall

prevalence of subclinical mastitis was 44.0% and it was the highest (58.0%) in dairy buffaloes.

The lowest prevalence was in organized farms with reasonable good management conditions

(32.0%). The overall prevalence of SCM was 36.5% of a CMT Test (Islam et al. 2012b). Khan

and Muhammad (2005) studied the overall subclinical mastitis prevalence 27.0%, clinical mastitis

4.0% and prevalence in buffaloes was 29.0%. Ahemd et al. (2012) studied the overall prevalence

of mastitis (clinical and subclinical) and found it in 60.3% buffaloes. The clinical mastitis

14


prevalence was higher in peri-urban 25.1% than rural 9.7% and incidence was highest during 4

to 6 months after calving both in peri-urban 45.8% and rural areas 45.1%. Mastitis was maximum

during third lactation both in peri-urban 19.0% and rural (23.0%) localities. In the folded thumb

milking method, prevalence was higher than suckling calves. Stage of lactation and lactation

number, source of milk let down, method of milking and floor condition have their effect on

mastitis (Bilal et al. 2004).

The clinical mastitis prevalence of individual quarter in buffaloes was 8.0%, while quarter-

based prevalence of subclinical mastitis was 16.0% in buffaloes (Hameed et al. 2012). The overall

quarter wise prevalence was 58.7% in buffaloes (Bachaya et al. 2005). According to Memon et

al. (2012), the prevalence of subclinical and clinical mastitis at quarters 20.2% and cow level 52.3%

was recorded, respectively. Occurrence of subclinical mastitis in the left rear quarter was high

26.7%, while Sharif et al. (2007) investigated that the overall quarter-wise prevalence was 37.7%

quarters and mastitic quarters maximum prevalence was found in right rear (30.4%) followed by

left front, right front and left rear with values of 24.5, 23.8 and 21.2%, respectively. Bilal et al.

(2004) observed the incidence of mastitis was higher in hindquarters 73.3 and 63.1% than in

forequarters 26.6 and 36.8% in peri-urban and rural areas, respectively while Sharma et al. (2007)

mentioned the overall quarter-wise prevalence of SCM was 39.0% by Modified Wide side Test,

42.0% of Modified California Mastitis Test and 45.0% of SCC, 1.9%. Oezenc et al. (2008)

investigated that mastitis was higher per quarter 36.5% and animal 69.1% while (Joshi and

Gokhale 2006) the prevalence was increased with lactation number and animals in 4th to 5th month

of lactation were more susceptible (59.5%) while hind quarters were more affected (56.5%) than

fore quarters (43.5%. The maximum quarter wise prevalence was in Nili Ravi and Kundhi 60.1%

and 77.3%, respectively, (Anwar et al. 2013). The incidence of mastitis in cows was higher in the

15


hind quarters than in the forequarters (Prem and chand et al. 1995) as well as in buffaloes hind

quarters the incidence of mastitis was higher than fore quarter, similarly, left quarters prevalence

(44.0%) was higher than right quarters (33.3%) (Shukla et al. 1997) while mastitis prevalence

was highest in the left fore quarters (29.3%) then left hind (28.0%), right hind (22.0%) and the

right fore (20.7%) quarters. Due to the common practice of milkmen milking the prevalence was

higher (Ramachandraiah et al. (1998). Lalrintluanga et al. (2003) screened the lactating cows an

quarter infections was 63.44%, more frequently than any other combination of quarters and left

hind quarters (30.2%) were more frequent and single factor as compared to the other three quarters

same as Bilal et al. (2004) mastitis incidence was higher in hind quarters (73.3 and 63.1%) than

in forequarters (26.6 and 36.8%).

2.7 Animal related risk factor of mastitis:

2.7.1 Age

Rahman et al. (2009) identified the risk factors about dairy farms and management and age

and lactation wise distribution of mastitis cases varied in different age groups, being highest in 6-

8 years of age group (40.5%) while according to Bilal (1999) the relative risk of clinical mastitis

increased with the age and it was maximum in buffaloes 10-11 years as well as Ahmed et al. (2012)

significantly associated (p<0.05) of age with the prevalence of mastitis and the prevalence (33.4%)

of mastitis of 5–7 years of age were low, while the animals aged between 14 to 16 mastitis was

highest (80.0%). According to Waage at el. (1998), mastitis increased as age of animal increased.

Hameed et al. (2012) described that age is considered as a risk factor of mastitis as well as by

Zeryehun et al. (2013) age was also considered as major intrinsic risk factors that influenced the

prevalence of mastitis resembles with Rady and Sayed (2009) who investigated that age is an

intrinsic risk factor of mastitis. According to Sharma et al. (2007) the prevalence was highest at 3

16


to 9 years of age. While Islam et al. (2012b) the prevalence of subclinical mastitis (SCM) was

significantly (p<0.01) higher (47.6%) in age group more than 13 years than others. Bilal (1999)

mentioned the relative risk for clinical mastitis increased with the age increase and it was

maximum in buffaloes 10-11 years while Lalrintluanga et al. (2003) screened the lactating cows

and higher number of cases were in 4-6 years age group (51.1%) while, Feroze (1992) noted that

age wise mastitis varied in different age group and mastitis was highest in 6-8 years age group

(40.5%).

2.7.2 Breed

The dairy buffalo breeds popular for milk production in Pakistan are Nili Ravi and Kundhi.

The breed characteristics of Nili Ravi buffaloes are as massive animals having curled horns with an

average weight 350-450 kg. The whole of the body skin is black in colour with five white marks on

the body (on forehead and all the four hooves). This striking feature of the breed is locally

pronounced as “Panj Kalyan” in native language. Males attain their maturity at the age of 30 months

and females at 36 months. The first calving has been recorded at 46 months of age with an average

milk yield of 1800-2500 liters per lactation with 6.5% butter fat. (Bilal et al. 2006; Shah et al. 1994).

Kundhi breed buffaloes are also massive animals having jet-black colour with an average

weight 300-400 kg. The have broader horns at the base and taper upward and inward, giving them

a fishhook shape. The average age of maturity of these animals is 30 months in males and 36

months in females. The milk yield per lactation is 1700-2200 liters with over 6.5% butter fat (Bilal

et al. 2006: Shah et al. 1994).

2.7.3 Parity

According to Ahmed et al. (2012) lactation number (parity) is significantly associated

(p<0.05) with the mastitis prevalence as well as Bilal et al. (2004) investigated that lactation

17


number has a significant effect on mastitis and during third lactation both in peri-urban (19.0%)

and in rural areas (23.0%) maximum cases of mastitis were seen. Lactation number was

considered as an intrinsic risk factor of mastitis (Hameed et al. 2012) same as parity was

considered as major intrinsic risk factor of mastitis (Zeryehun et al. 2013). According to Busato et

al. (2000) quarter level 21.2% for lactation period 7–100 days and 34.5% for 101 to 305 days post-

partum subclinical mastitis prevalence was increased while Oezenc et al. (2008) studied that during

the first 4 months of lactation after the 5th lactation prevalence was higher. According to Prem and

chand et al. (1995), incidence of mastitis increased as the lactation number increased while

according to study in Nepal by Joshi and Shrestha (1995), the prevalence of bovine clinical mastitis

was the highest (17.6%) during first lactation, declining in successive lactations. Ramachandraiah

et al. (1998) investigated that the subclinical mastitis was increased with the increase in lactation

number same as during third lactation mastitis increased (Bilal et al. 2004). Similarly,

Thirunvukkarasu and Prabaharan (1998) concluded that, lactation number has significantly

associated with mastitis (P<0.05).

2.7.4 Stage of lactation

Stage of lactation was investigated by Ahmed et al. (2012) that has significant association

(p<0.05) with the prevalence of mastitis and it was associated with the prevalence highest (54.5%)

during the initial stage of lactation (0 to 1 month) than by last 2 months (10–12 months) as 54.17%

and mid-stages (1–3 and 3–10 months) of lactation as 28.6% and 37.5%. Hameed et al. (2012)

concluded that the stage of lactation is a significant risk factor of mastitis and Sharma, et al. (2007)

described that the stage of lactation has an influence on infection rate and it was higher during the

late lactation followed by early and mid-stage of lactation. According to Bilal et al. (2004) stage

of lactation is a physiological factor and it has its effect on clinical mastitis in buffalo same as

18



Zadoks et al. (2001) lactation stage has a significant effect on mastitis and rate of S.

aureus infection. Megersa et al. (2010) investigated that late stage of lactation has an effect on

mastitis (OR = 4.3, 1.8, 10.4) of udder have a high risk than early lactation same as Kavitha et al.

(2009) who also reported that the first stage of lactation and the last part of dry period were more

prone to mastitis in buffaloes. Zeryehun et al. (2013) studied the prevalence of mastitis at the stage

of lactation was 87.2%, 65.9% and 73.1% in early, mid and late lactation, respectively, and this

variation was statistically significant (P<0.05) as Islam et al. (2012b) described the prevalence of

SCM was the highest in late lactation (72.4%) followed by early (40%) and mid lactation (27.6%).

Hussain et al. (2013) revealed the significant difference between lactation stage (P<0.001) same

as Lalrintluanga et al. (2003), who screened the lactating cows and incidence of mastitis was higher

in the early stage of third lactation (30.6%). Stage of lactation was found significantly associated

with mastitis (P<0.05) (Thirunvukkarasu and Prabaharan 1998). The mastitis cases were a higher

number (53.6%) during early stage of lactation than in middle and late stages and affected animals

showed a 20.6 % decrease in milk yield (Pyroala et al. 1991). Morin et al. (1998) examined the

cows for clinical parameters including various udder and milk characteristics, lactation number

and stage of lactation showed significant effect on clinical mastitis.

2.7.5 Udder and Teat injury

Hussain et al. (2013) revealed the significant difference between various groups, including

teat/udder pathology, teat (P<0.001) have a significant positive association with mastitis. Ahmed

et al. (2012) stated lesion on udder/teat were significantly associated (p<0.05) with mastitis.

According to Hameed et al. (2012), udder and teat injury is significant risk factors of mastitis same

as Biffa et al. (2005) revealed that the udder/teat injuries by ticks were the main risk factors of

mastitis while Zadoks et al. (2001) teat end callosity and infection with was not significant as risk

19

http://link.springer.com/search?facet-author=%22Bekele+Megersa%22


factors. Udder abnormalities and milking hygiene have significant association with mastitis

(P<0.05) (Thirunvukkarasu and Prabaharan 1998) while according to the Oltenacu et al. (1990),

the incidence rates of trampled teats, udder injuries and clinical mastitis as well as the inter

relationship between the 4 disorders depend upon the stall length, manure system, type of bedding

and calving disorders and cows in herds with liquid manure system were at higher risk of udder

injuries and mastitis. Lower risk of both udder injuries and mastitis was found for cows in herds

with short stall size (180 cm) as compared to herds with large stall size (205- 219 cm) length.

2.7.6 Udder and Teat edema

In a case-control study by Waage et al. (1998), udder edema, teat edema and milk leakage

were the significant risk factors and teat edema at calving as risk factors for clinical mastitis caused

by Staphylococcus aureus. Hussain et al. (2012b) used the univariate and bivariate logistic

regression including teat shape and udder shape with the occurrence of mastitis and determined

the association of some morphometric characteristics of the udder with mastitis in dairy cattle same

as Hussain et al. (2013) revealed significant difference between various groups, including teat

shape, and udder shape (P<0.001). Shukla et al. (1997) investigated the relationship of teat type,

teat length and quarters effect on the mastitis and the teat tips were categorized into four types viz.,

funnel, round, flat and plate shaped. Mastitis prevalence was maximum in case of funnel shaped

teat tip.

2.8 Management, Housing and Environmental Risk Factors related to Mastitis

2.8.1 Management and Farm Hygienic

According to investigation by Fadlelmoula et al. (2007), the management and hygienic risk

factors of mastitis were associated with mastitis prevalence and the results show that the

probability of mastitis was higher, in tie-stall housed cows, and with the use of the pipe milking

20


unit. In a Swedish study (Ekman et al. 2004), management practices like, use of wood shavings of

any kind reduced the risk of finding Staphylococcus aureus, but increased the probability of

Klebsiella spp., four times as compared to straw or peat. The correlation between sawdust and

acute cases of clinical mastitis caused by Klebsiella spp. was well known (Oz et al. 1985). Neaveet

al. (1969) evaluated the value of hygiene systems in the control of mastitis and how this control

can be improved by changes in hygiene and milking machines and by better use of therapy and

hygiene systems designed to prevent the transfer of pathogens and more particularly to eliminate

residual contamination at the completion of milking have been shown to reduce the number of new

infections. Furthermore, the combination of such hygiene systems with effective antibiotic therapy,

which reduces the duration of infection, generally resulted in a decrease of more than 50.0% in the

incidence of infection within a year. It is probable that further reduction in the incidence of

infection can be made by improving management techniques and it can be achieved by improving

methods of mechanical milking designed to prevent infection occurring during milking and by the

use of better teat dips than by the development of more comprehensive hygiene systems. Ahmed

et al. (2012) described the hygiene of milking process has significant association (p<0.05) with the

mastitis prevalence and it was concluded by Zaki et al. (2010) who described that both

environmental and hygienic measures surrounded the animals are major risk factors of mastitis.

Zeryehun et al. (2013) described the prevalence of mastitis in cows that were managed in poor

hygienic condition was 82.6%, while those managed in good hygienic condition showed an

infection rate of 59.6% and this prevalence were significantly different (P<0.05). Erskine et al.

(2002) performed milking hygiene and management practices of each herd and milking-machine

function was evaluated and it was concluded that management practices have a significant effect

on the control of mastitis.

21



2.8.2 Condition of floor

Hameed et al. (2012) revealed that bricks floor, uneven floor, poor drainage system are risk

factors of mastitis while Bilal et al. (2004) investigated the management factors like method of

milking and floor condition have their effect on clinical mastitis in buffalo and bricks and cemented

floor were more mastitis as compare to Kacha floors. Hameed et al. (2012) analyzed that poor

drainage system and low frequency of dung removal are a risk factor of mastitis.

2.8.3 Teat Dipping

An investigation by Kavitha et al. (2009) depicted that teat dipping has a significant effect

on mastitis furthermore, farmers’ education regarding the risk factors and about teat dipping is

essential as Peeler et al. (2000) described the teat dipping can reduce 50.0% of mastitis occurrence.

According to Neave et al. (1969), improved methods of mechanical milking designed to prevent

infection occurring during milking and by the use of better teat dips than by the development of

more comprehensive hygiene systems. Teat dipping treatments reduced occurrence of mastitis

(Galton et al. 2004; Philpot and Pankey 1978). Mastitis control practices like post milking

antiseptic teat dipping, prompt detection and treatment of clinical cases and dry therapy can

reduced the mastitis (Oliver, 1975).

2.8.4 Milker hands

Larsen et al. (2000) investigated the transmission of infection for bovine mastitis by

milkers with Staphylococcus aureus and Ali (2009) considered hand milking as a source of risk

factor of mastitis used as a lubricant during milking and milker’s hands is often heavily soiled with

milk during this process while in developing countries like Pakistan dairy animals are mostly hand

milked used as a lubricant during milking and milker’s hands are often soiled with milk during

this process.. Gonzalez et al. (1990) investigated that the milkers are the reservoir of source of

22



http://www.sciencedirect.com/science/article/pii/S002203027883673X

http://www.sciencedirect.com/science/article/pii/S002203027883673X



infection and its transmission to susceptible cows may be in direct contact with the milkers or by

mechanical transfer from cow to cow via the teat cups. Hand-milked dairy animals have higher

prevalence of mastitis than machine milked-animals (Lafi et al. 1994; Motie et al. 1985).

2.8.5 Methods for milk letdown

Mastitis prevalence was higher in animals milked with folded thumb pressure as compared

to milk let down through suckling calves (Bilal et al. 2004) as Hameed et al. (2012) mentioned

that hard milking, calf suckling, folded thumb milking techniques are risk factors of mastitis. In

Pakistan, Oxytocin injection is used commonly for the letdown of milk particularly in buffaloes.

At the time of milking by hand the calf is used in most of the animals. Newbould (1970)

recommended that the stimulus for these phenomena also affects the smooth muscles around the

proximal part of the teat duct near Furstenberg’ Rosette resulting in its dilation. Thus, instead of

keeping the duct closed, the smooth muscles around the duct under stimulation, open the proximal

end, and allow direct access for micro-organisms to the cistern. In theory at least, animals milked

by exogenous oxytocin are at a greater risk to develop mastitis than animals not receiving this milk

let down (Allen, 1990). On hand-milked animals, the technique of milking is also important in

relation to prevalence of mastitis and factors affecting the mastitis prevalence of clinical in

buffaloes by Bilal et al. (2004) encountered 4.2 magnitudes higher prevalence (39.2%) in buffaloes

milked by folded-thumb method (thumb-knuckle and finger method) than those milked by full-

hand method (9.0%). The relatively higher prevalence was ascribed to relatively larger herd size,

use of hired labor for milking (who cannot be desirably careful in milking) and more common

housing of animals on the brick floor. Kavitha et al. (2009) evaluated the milking method and the

incidence of clinical and subclinical mastitis was high when knuckling was practiced as compared

23


to stripping with the full-hand milking. An association between risk factor and mastitis were higher

infection rates when dairy animals are milked by milking machine (Oezenc et al. (2008).

2.9 Some other Determinants Related to Mastitis

2.9.1 Foot and mouth Disease, Pox and Reproductive disorders

Diseases like foot and mouth disease and pox are particularly known to predispose mastitis

in cattle and buffaloes. According to a study in Pakistan by Muhammad et al. (1998), an

investigation of an outbreak of pox in 6 small holder dairy farm (buffalo = 185; cattle = 7) a

cumulative incidence rate of 55.3% was recorded over a one month period. Milk from nearly 47.0%

of the affected teats and 23.0% of the adjacent unaffected ones reacted positive to California

mastitis test (CMT). According to Radostits et al. (2000) observation, foot and mouth disease,

vesicles may appear on the teat as to the involvement of the teat orifice the severe mastitis. Cows

with the retained placenta were three times more likely to develop mastitis during hospitalization

than animals without retained placenta. Ali (2009) investigated on the outbreak of pox in 6 small

holder dairy farms and a cumulative incidence rate of 55.3% was recorded over a one month period

and milk from nearly 47.0% of the affected teats and 23.0% of the adjacent unaffected ones reacted

positive to California mastitis test. According to Bilal (1999) dairy buffaloes having retained

placenta, metritis, vaginal prolapses and dystocia at calving are risk factors of mastitis and by

Barker (1998) clinical mastitis during the first 45 days of lactation shows 2.7 times higher risk of

abortion. Esmat and Badr (1996) studied lactation failure and purulent uterine discharge (metritis)

in 127 dairy cows from 3 dairy farms in relation to mastitis. Eighty seven cows (68.5%) had acute

mastitis and 23 (18.1%) subclinical one and bacteriological examination of the udder and uterine

secretion of cows showed mastitis-metritis syndrome.

24


2.9.2 Previous exposure to mastitis

Vaarst and Enevoldsen (1997) studied previous udder infections, which showed two-third

of the clinical mastitis cases, severe local inflammations were found in 21.0% of the cases and

some indications of generalized signs. Enevoldsea and Sorensen (1992) stated that previous

mastitis statuses are considered to be much more important predisposing factors as same as

Karimuribo et al. (2006) conducted a cross-sectional study and 4.0% of cows had clinical mastitis

during the previous year.

2.10 Diagnosis, Isolation and Identification of Staphylococcus aureus Mastitis

2.10.1 Mastitis diagnosis methods

Clinical and subclinical mastitis were diagnosed by using the California Mastitis Test

(CMT) and Surf Field Mastitis Test (SFMT) by Islam et al. (2009). According to Ali et al. (2008),

the diagnosis of subclinical mastitis was based on the results of the Surf Field Mastitis Test (SFMT).

Sharif et al. (2007) screened milk samples by SFMT for the presence of subclinical mastitis as well

as Sharif and Muhammad (2009) mentioned the most common mastitis pathogens are contagious

and environmental pathogens and most common causes of udder disease include Staphylococci

(Staphylococcus aureus & S. epidermidis). Soomro et al. (1997) used three chemical tests viz.,

Bromothymol blue test, chloride test and Whiteside test on milk for screening of subclinical

mastitis and revealed that 19.7%, 15.9% and 13.8% quarters were affected with subclinical mastitis.

Ali et al. (2011) identified the bacterial isolates of mastitis and found the highest prevalence was

of Staphylococci (28.3%). Chavoshi and Husaini (2012) determined the major causes of buffalo’s

subclinical mastitis are teat skin opportunistic bacteria.

25


2.10.2 Physical examination of udder

Clinical and subclinical mastitis prevalence in buffalo in Hyderabad, Pakistan was

investigated by Soomro et al. (1997) and the physical examination of the udder of these animals

revealed 6.0% clinical (chronic) and 1.0% congenital abnormalities of udder while Milne et al.

(2003) correlated the clinical signs with the bacteriological findings and reduced milk yield,

swollen or hard udders, watery milk and being systemically sick. Falkenberg et al. (2004)

evaluated clinical examination and the appearance of teat lesions and the status of the teat duct

especially the existence of hyperceratosis were defined and prevalence of Staphylococcus aureus

mastitis was high. Klass et al. (2004) conducted a study to evaluate the disease characteristics of

Staphylococcus aureus mastitis in buffaloes and visual inspection and palpation of udder and teat.

Sargeant et al. (1998) described the abnormal milk with a hard or swollen udder and milk plus

systemic signs of illness related to mastitis.

2.10.3 Isolation of Staphylococcus aureus

Rahman and Rahman (1985) examined the milk samples derived from apparently healthy

udders in Bangladesh and 350 representatives isolates showed distribution to be 42.0%

Staphylococci, 12.6% Streptococci, 22.0% Coliforms, 20.0% Gram-positive aerobic sporeformers,

1.4% Pseudomonads and 2% Corynebacteria, while Smith (2000) isolated Staphylococcus aureus

13.3% from mastitis cases. In Istanbul, Firat and Uysal (1986) collected milk samples and

examined the nature of mastitogens and found that 34.0% were coagulase-positive Staphylococci,

16.0% coagulase-negative Staphylococci, 51 (13.0%) gram-negative bacteria, 28 Streptococcus

agalactiae, 27 Streptococcus uberis, 22 Streptococcus faecalis, and 21 Streptococcus dysgalactiae.

Trinidad et al. (1990) reported that most common bacterial pathogen were Staphylococcus aureus

as it was from isolated from teat canal (31.0%) and from quarters (12.3%). Prabhakar et al. (1995)

26


described that Staphylococci were the major causative organisms (34.2% Staphylococcus aureus

and 13.2% coagulase-negative Staphylococci), followed by Str. agalactiae (14.7%), E. coli

(10.5%), Pseudomonas spp (7.9%), Str. pyogenes (3.9%), Klebsiella spp. (3.9%), Str. dysgalactiae

(2.6%), Proteus spp. (2.6%), Str. uberis, Diptheroids and mixed infections (1.3% each). No

organism could be isolated from 2.6% quarters. Gonalez et al. (1990) isolated Staphylococcus

aureus (43.0% of samples) S. epidermidis (21.0%), Str. Uberis (19.0%), Str. Agalactiae (13.0%),

Str. Dysgalactiae (9.0%), Corynebacterium pyogenes (1.3%), Corynebacterium bovis (7.0%) and

coliform (1.7%) from subclinical cases of mastitis in cows. Rady and Sayed (2009) recovered

Staphylococcus aureus from milk samples and prevalence was 52.5%. Hameed et al. (2008) also

reported that prevalence of Staphylococcus aureus was the highest 53.9% by a study conducted on

lactating buffaloes in Pakistan. According to investigation of Hussain et al. (2012a), the disease

characteristics of Staphylococcus aureus mastitis in buffaloes and isolates of Staphylococcus

aureus were obtained on the basis of growth on a Staph-110 medium, colony morphology and

hemolytic pattern on 5% sheep blood agar plates and isolates were identified by slide coagulase

test, tube coagulase test and Staphytect plus test. Ali et al. (2008) recovered the isolates of

Staphylococcus aureus and it was the most frequently bacterial species accounting for 49.5% of

all the isolates while Ericsson et al. (2009) the most frequently isolated bacterial species

were Staphylococcus aureus constituting 21.3% of the diagnoses.

2.11 Antibiotic Resistance Profiles of Staphylococcus aureus strains isolated from Mastitis:

The antibiotic resistance of Staphylococcus aureus strains isolated from mastitic milk is

well known around the globe. It may vary from country to country and depends on various factors.

Some of the resistant reports are as under. In Argentina, the antibiotic resistance of Staphylococcus

aureus was reported as 40.3%, 11.6% and 3.4% to penicillin, erythromycin and gentamycin,

respectively Gentilini et al. (2000). In India, Sharma et al. (2007) also reported the resistance

27


against ampicillin most. Sharma et al. (2007) revealed the antimicrobial susceptibility test for the

bacterial strains isolated from subclinical mastitis milk samples were sensitive to oxytetracycline

17.4% and resistant to streptomycin. In Brazil, Pianta and Fallavena (1980) observed 40.0%

resistance of S. aureus against oxytetracycline. A study was conducted in China (Sun et al.

(2013) and reported Staphylococcus aureus resistant to gentamycin, tetracycline and erythromycin.

2.12 Emergence of Antimicrobial Resistance

There are several factors responsible for the emergence of antimicrobial resistance. Some

of these include misuse of antibiotics, lack of access to appropriate treatment and failure to

complete treatment courses etc. In Staphylococci the resistance to multiple antimicrobial agents is

driven by the acquisition of distinct hereditary elements comprising plasmids, transposable genetic

elements and genomic islands. These elements incorporate resistance genes and are exchanged via

horizontal gene transfer between interrelated bacterial strains and even between different species

and genera (Chambers, 2001; Schito, 2006).

2.13 Staphylococcus aureus Genome

The Staphylococcus aureus genome consists of a single circular chromosome of about 2.7

to 2.9 Mbp containing about 2600 genes composed of core and auxiliary (accessory) genes. It has

a G+C content of 33.0%. In silico analysis, core genome makes up about 75.0% of the

Staphylococcus aureus genome and it is highly conserved between isolates. These genes are

associated with common species functions and are not essential for growth and survival, including

virulence genes. It included, binding proteins, exoenzymes, toxins, and capsule biosynthetic

cluster (Lindsay and Holden, 2004). The accessory genome accounts for about 25.0% of any

Staphylococcus aureus genome, and mostly consist of mobile genetic elements that transfer

horizontally between strains. These elements include bacteriophages, pathogenicity islands,

chromosomal cassettes, genomic islands, plasmids and transposons. Accessory genes typically

28


have a different G + C content than those in the core genome, often because they are obtained from

other species of bacteria. Many of these genetic elements are known to carry genes associated with

virulence, drug and metal resistance, with substrate utilization and miscellaneous metabolism.

Therefore, the distribution and horizontal spread of these elements can have important clinical

implications. The identification and characterization of these elements provide insights into how

Staphylococcus aureus causes disease, and their diversity (Shittu et al. 2007). Bacteria obtain

genetic information from other cells or the surrounding environment in three ways: (1) uptake of

free DNA from the environment (transformation), (2) bacteriophage transduction, and (3) direct

contact between bacterial cells (conjugation). Bacteriophages or bacterial viruses seem to have the

greatest impact on staphylococcal diversity and evolution. They are known to transfer genes such

as lukF-PV and lukS-PV that encode the Panton- Valentine leukocidin (PVL) components which

is strongly associated with severe forms of pneumonia (necrotic pneumonia) in human caused by

community-acquired S. aureus strains; the staphylokinase gene (sak) gene, which is a potent

plasminogen activator that could facilitate bacterial spreading through its fibrin-specific blood

clotting activities and the enterotoxin genes (Shittu et al. 2007; Malachowa and DeLeo, 2010). S.

aureus pathogenicity islands (SaPIs) often carry super antigen genes, such as toxic shock

syndrome (tst) and enterotoxins B and C, implicated in toxic shock and food poisoning. Three

families of genomic islands have been discovered in sequenced strains of Staphylococcus aureus

strains. They carry exotoxin and lipoprotein genes (Shittu et al. 2007). All the sequenced

Staphylococcus aureus strains are known to carry one or more free or integrated plasmids. All

types of Staphylococcus aureus plasmids frequently carry antibiotic resistance genes, or resistance

to heavy metals or antiseptics. Some virulence genes are also known to be carried on plasmids,

such as exfoliative toxin B and some super antigens (Lindsay and Holden, 2004). Other mobile

29


genetic elements found in the Staphylococcus aureus chromosome include Staphylococcal cassette

chromosomes (SCCs). They encode antibiotic resistance and/or virulence determinants. SCCs

encode the methicillin resistance gene (mecA) (Shittu et al. 2007; Malachowa and DeLeo, 2010).

2.14 Molecular optimization of Coagulase and Fibronectin binding protein A of

Staphylococcus aureus

New molecular techniques have emerged which are very helpful for detection,

identification and characterization of milk borne pathogens, e.g. PCR, RT-PCR, Microarray,

Multilocus Typing which are rapid, sensitive and specific and give a better differentiation among

species, serotypes or strains. Various molecular techniques have been used for identification of

Staphylococcus aureus. Among them, Polymerase Chain Reaction (PCR) is most currently used

for identification of Staphylococcus aureus. With the help of PCR, we will be able to detect a

single genome of Staphylococcus aureus with accuracy and sensitivity. Many infectious agents

that are missed by microbiological, serological tests and DNA probe are detected by PCR.

Therefore, now-a-days PCR based tests are mostly used for the clinical and epidemiological

investigation of pathogenic bacteria (Ahmadi et al. 2010; Firyal et al. 2009; Kalorey et al. 2007).

According to Sun et al. 2013, in china Staphylococcus isolates were electrophoresis (PFGE)

analysis, spa typing and minimal inhibitory concentration determination while Kumar et al. (2011)

studied in India that the Staphylococcus aureus recovered from the buffaloes distribution of

virulent genes such as Coagulase and Fibronectin binding protein A and genetic form of

Staphylococcus aureus isolates were further used for segregation or culling of infected animals

from harmful strains to reduce the dissemination of pathogenic microorganisms.

30


2.15 Staphylococcus aureus Virulence Determinants

Exoproteins of Staphylococcus aureus contribute to its facility to colonize and cause

disease in hosts. These virulent factors cause colonization through the damaged mucosa and skin,

propagation to the body, and evasion of host defense mechanisms. Approximately, 50 potential

virulence factors in S. aureus with a wide range of biologic activities have been reported.

Staphylococcal infections occur in a stepwise manner, each step involving one or several specific

virulence factors (Ferry et al. 2005). Nearly all strains secrete a group of enzymes and cytotoxins

include four hemolysins (alpha, beta, gamma, and delta), nucleases, proteases, lipases,

hyaluronidase, and collagenase. The main function of these proteins may be to convert local host

tissues into nutrients required for bacterial growth. Each of these toxins is known to have potent

effects on cells of the immune system, but many of them have other biological effects as well.

Their primary function in vivo may be to inhibit host immune responses to Staphylococcus aureus

(Dinges et al. 2000). The orchestrated expression of multiple virulence factors is the key to the

success of staphylococcal pathogenesis. Staphylococcus virulence factors are located either on the

chromosome or on mobile elements such as plasmids, transposons and bacteriophages. Acquisition

of genes mediating antibiotic resistance, such as the mecA gene conferring resistance to methicillin,

can further favor epidemic spread by promoting the acquisition of additional virulence factors.

Expression of most virulence factors in Staphylococcus aureus is controlled by the accessory gene

regulator (agr) locus, which encodes a two-component signaling pathway whose activating ligand

is a bacterial-density sensing peptide (auto inducing peptide) also encoded by agr (Lina et al. 2003).

A polymorphism in the amino acid sequence of the auto inducing peptide and of its corresponding

receptor (AgrC) has been described. Staphylococcus aureus strains can be divided into four major

groups on this basis: within a given group, each strain produces a peptide that can activate the agr

31


response in the other member strains, whereas the auto inducing peptides produced by the different

groups are usually mutually inhibitory (Ji et al. 1997). Links between a peculiar agr type and a

specific staphylococcal syndrome have been shown for toxic shock syndrome (TSS) and

staphylococcal scalded skin syndrome (SSSS). TSST-1- producing isolates belong to agr

specificity group III and mostly belong to a single clone, as shown by multilocus enzyme

electrophoresis (MLEE) (Musser et al. 1990; Ji et al. 1997). Most exfoliating-producing strains

responsible for SSSS belong to agr group IV, but these strains have not been investigated (Jarraud

et al. 2002). Staphylococcus aureus virulence factors include surface proteins that promote

colonization of host tissues, invasion factors that promote bacterial spread in tissues (leukocidin,

hyaluronidase), surface factors that inhibit phagocytic engulfment (capsule), biochemical

properties that enhance their survival in phagocytes (catalase production), and membrane

damaging toxins that lyse eukaryotic cell membranes (hemolysins, leukotoxin) (Turkyilmaz and

Kaya, 2006).

2.16 Transmission of Staphylococcus aureus

Staphylococcus aureus is transmitted from an infected to an uninfected mammary gland

during the milking process. Shared equipment, udder cloths, and even milkers’ hands can transmit

Staphylococcus aureus between cows, if good hygienic practices are not followed. Environmental

factors, such as bedding, housing, and foodstuffs can also be contaminated and play a role in

spreading Staphylococcus aureus infections. Thorne et al. (1960) isolated Staphylococcus aureus

from the floor of dairy barns. Also, Spencer et al. (1952) were able to maintain Staphylococcus

aureus in vitro on sterile straw for at least 49 days, which raises the possibility that bedding may

be a source of the organisms. However, in low Staphylococcus aureus prevalence herds, 0 of 183

bedding samples were positive for S. aureus, and 4 of 208 bedding samples from high

32


Staphylococcus aureus prevalence herds were positive for Staphylococcus aureus (Roberson et al.

1994). These findings suggest that bedding may play a limited role in spreading infection

(Roberson et al. 1999). To cause mastitis, Staphylococcus aureus must enter the mammary gland

through the teat sphincter. Contaminated wash cloths or milking equipment may bring the bacteria

to the teat canal. After bacteria gain access to teat ducts and grows in milk producing tissue,

mastitis occurs. After Staphylococcus aureus enters the teat canal, neutrophils respond to the

infection. If the leukocytes succeed, there will only be mild signs. If Staphylococcus aureus growth

continues and leukocytes are not able to prevent bacterial growth, swelling of the mammary gland

and changes in the milk will occur resulting in clinical mastitis. Infections caused by

Staphylococcus aureus strains that produce α-toxin can cause gangrenous mastitis, which can lead

to death due to toxemia or culling of the infected cow. In addition to the mammary glands,

Staphylococcus aureus has been found on other body sites of animals and humans. Haveri et al.

(2008) reported that the Staphylococcus aureus strains causing bovine intramammary infection

(IMI) were not different from those isolated from extra mammary sites. Teat skin and especially

teat canals were important potential reservoirs of Staphylococcus aureus causing IMI. Heifers that

had Staphylococcus aureus on their skin were at a higher risk to develop Staphylococcus aureus

mastitis than heifers without skin colonization (Sears et al., 2003). Roberson et al. (1994) reported

that milk from heifers that have Staphylococcus aureus on their teat skin could be another source

of S. aureus. Although some authors (Haveri et al. 2008; Thorne et al. 1960) have reported that

Staphylococcus aureus on the udder skin were genetically similar to Staphylococcus aureus

isolates from milk samples, it has also been reported that teat skin is not an important reservoir for

Staphylococcus aureus mastitis because less than 4% of cows had the same type of Staphylococcus

aureus on teat skin as the type that causes Staphylococcus aureus mastitis (Fox et al. 1992).

33


2.17 Control of Staphylococcus aureus

Correct milking procedures play a significant role in reducing new intramammary

infections. Washing the udder with water or sanitizing solution and drying with individual towels,

preferably disposable towels are recommended for preventing the spread of infection among dairy

animals (National Mastitis Council, 2003; Sears et al. 2003). To prevent spread, milkers should

wear disposable gloves and sanitize the equipment for each use (Roberson et al. 1999). Germicidal

teat dip after each milking is an effective method in preventing spread of infection from cow to

cow (National Mastitis Council, 2003). Both pre and post milking teat disinfection have significant

impacts on reducing new infections by Staphylococcus aureus and Streptococci (Vestweber et al.

1994). Quarters which were dipped before and after milking showed a lower rate of new infections

than quarters, which were dipped only post-milking (Vestweber et al. 1994). Back flushing, which

is an automated way of washing milking clusters with water and rinsing them with disinfectant

after the removal of milking uniform teats, may also decrease the spread of infection. However,

back flushing may be less beneficial in herds that follow effective post milking teat dipping.

Intramammary dry cow antibiotic therapy is one component of mastitis control programs. One of

the goals of dry cow therapy is to prevent new mastitis infections from occurring during the dry

period, as cows are susceptible to infection during this time and it may also cure existing infections.

Intramammary antibiotic dry cow therapy cure rates are higher than those achieved during lactation

because udders have less volume and antibiotic is present for a greater length of time. In some

countries, including the USA, it is recommended that all quarters should be routinely treated at

drying off (Robert et al. 2006), while other countries, such as Finland, Norway, and Switzerland

typically use selective treatment based on identification of udder infection (Pitkala et al. 2004;

Osteras et al. 2006). Cows with Staphylococcus aureus should be segregated and milked last to

34


prevent uninfected cows from getting infected (Vestweber et al. 1994; Roberson et al. 1994).

Culling is considered the most effective way to lower the prevalence of Staphylococcus aureus in

dairy herds (Radostits et al. 2000). Staphylococcus aureus may reside inside the udder and on teat

skin, and they provide the most important source of infection to other cows in the herd. With the

limited success of dry cow treatment of chronic infections, culling is the most reliable way to

remove the organism and reduce exposure to other cows and heifers. However, culling is primarily

recommended for chronically infected cases.

2.18. Statement of Problem

Mastitis is a complex and multi factorial disease and it is an important dairy health problem

with physical, chemical and pathological alterations in milk and udder. Mastitis mostly occurs in

two forms i.e. clinical and subclinical. Mastitis can be divided in the contagious and environmental

form on the basis of its etiological agents. Various microorganisms are responsible for mastitis,

including bacteria, Mycoplasma, yeast and fungi etc. Among all, bacteria are most frequently

responsible for this disease. Staphylococcus aureus is held accountable for 50.0% of cases of

mastitis in buffaloes (Shakoor, 2006). The main reasons for the failure of any of the antibiotic

therapy in most cases of Staphylococcus aureus mastitis are inadequate concentration of

antibiotics reaching at the site of infection, bacterial antibiotic resistance, L-forms of bacteria

(sensitive to beta-lactic antibiotics), bacterial dormancy and tissue barrier as this organism lies in

deep seated foci. It causes pockets in the depth of udder surrounded by fibrous tissue where

antibiotics cannot gain access (Sandholm et al. 1991). In principle, antibiotic sensitivity against

the available chemotherapeutic agents in a region or locality should be done from time to time to

enable the veterinarians to prescribe the most suitable antibiotics against the prevailing diseases.

In Pakistan mastitis losses might be higher, because prevention practices of mastitis are not

35


adopted by dairy farmers. The present study was planned with the following aims and objectives:

Assess the prevalence of mastitis in buffaloes and identify the epidemiological risk factors of

mastitis. To assess the resistance of Staphylococcus aureus against commonly used antibiotics.

Molecular characterization of virulent gene of indigenous strains of Staphylococcus aureus.

36


REFERENCES

Ahmad R, Javaid S, Lateef M. 1991. Studies on prevalence, etiology and diagnosis of subclinical

mastitis in dairy animals. Pak Vet J. 11: 138-140.

Ahmad S, Yaqoob M, Bilal MQ, Muhammad G, Yang LG, Khan MK, Tariq M. 2012. Risk factors

associated with prevalence and major bacterial causes of mastitis in dromedary camels

(Camelus dromedarius) under different production systems. Trop anim health prod. 44:

107-112.

Ahmadi M, Rohani SMR, Ayremlou N. 2010. Detection of Staphylococcus aureus in milk by PCR.

Compar Clinical Patho. 19: 91-94.

Ali L, 2009. Epidemiology of mastitis in dairy buffalo and cow in Tehsil Samundri of district

Faisalabad. University of Agriculture, Faisalabad.

Ali L, Muhammad G, Arshad M, Saqib M, Hassan IJ. 2008. Bacteriology of mastitis in buffaloes

in Tehsil Samundri of district Faisalabad, Pakistan Pak Vet J. 28(1): 31-33.

Ali M, Ahmad MD, Muhammad K, Anjum A. 2011. Prevalence of subclinical mastitis in dairy

buffaloes of Punjab, Pakistan. Okera. 150: 42-63

Allen J. 1990. Milk synthesis and secretion rates in cows with milk composition changed by

oxytocin. J. Dairy Sci. 73: 975-984.





Anonymous. 2006. Livestock census report of Pakistan, published by the Statistical Department,

Government of Pakistan, Islamabad.

37


Anwar K, Amin Y, Mujtaba M. 2013. Prevalence And Bacteriology Of Sub Clinical Mastitis In

Buffaloes In And Around Peshawar District, Khyber Pakhtunkhwa Pakistan. Inter J Engin.

2(7): 210-218.

Bachaya H, Raza M, Murtaza S, Akbar I. 2011. Subclinical bovine mastitis in Muzaffar Garh

district of Punjab (Pakistan). J Anim Plan Sci. 21: 16-19.

Bachaya HA, Iqbal Z, Jabbar A, Abbas R, Ali R. 2005. Sub-clinical bovine mastitis in Attock

District of Punjab (Pakistan). Int J Agric Biol. 6: 1034-1035.

Bansal BK, Singh KB, Rohan R, Joshi DV, Nauriyal DC, Rajesh MK. 1995. Incidence of sub-

clinical mastitis in some cow and buffalo herds in Punjab. J Res. 32: 79-81.

Barker AR, Schrick FN, Lewis MJ, Dowlen HH, Oliver SP. 1998. Adequate trace mineral

nutrition critical for optimum reproductive performance. J Dairy Sci. 81: 1285-1290.

Barkema HW, Schukken YH, Zadoks RN. 2006. The role of cow, pathogen, andtreatment regimen

in the therapeutic success of bovine Staphylococcus aureus mastitis. J Dairy Sci. 89: 1877–

1895.

Biffa D, Debela E, Beyene F. 2005. Prevalence and risk factors of mastitis in lactating dairy cows

in Southern Ethiopia. Int J Appl Res Vet Med. 3 (3): 189-198.

Bilal MQ, Suleman M, Razik A. 2006. Buffalo: Black gold of Pakistan.

Livestock research for rural development.

Bilal M, Iqbal M, Muhammad G, Avais M, Sajid M. 2004. Factors affecting the prevalence of

clinical mastitis in buffaloes around the Faisalabad district (Pakistan). Int J Agri Biol. 6: 1-

5.

Bilal MS, 1999. Descriptive epidemiology and ethnoveterinary practices of clinical mastitis in

buffaloes, Pakistan. Univ. of Agri., Faisalabad.

38


Bradley A. 2002. Bovine mastitis: an evolving disease. Vet J. 164: 116-128.

Breen J, Green M, Bradley A. 2009. Quarter and cow risk factors associated with the occurrence

of clinical mastitis in dairy cows in the United Kingdom. J Dairy Sci. 92: 2551-2561.

Busato A, Trachsel P, Schällibaum M, Blum J. 2000. Udder health and risk factors for subclinical

mastitis in organic dairy farms in Switzerland. Preventive Vet Med. 44: 205-220.

Cheng RJ, Dewhurst J, Larkin F, Buckley C, Thackaberry A, Nicol M, Edwards GR. 2010. Brief

communication: Investigation of N isotopic fractionation indairy cows using milk samples

collected at the morning and afternoon milkings 70: 65-66.

Chavoshi M, Husaini J. 2012. Buffalo Subclinical Mastitis Bacterial Pathogens in Iran. In 2012

2nd International Conference on Biomedical Engineering and Technology IPCBEE. 34.

Dinges MM, Orwin PM, Schlievert PM. 2000. Exotoxins of Staphylococcus aureus. Clin

Microbiol. Rev. 13: 16-34.

Donovan DM, Kerr DE, Wall RJ. 2005. Engineering disease resistant cattle. Transgenic

research, 14(5), 563-567.

Chambers HF. 2001. The changing epidemiology of Staphylococcus aureus? Emerg Infect Dis. 7:

178–182.

Ekman T, Bengtsson B, Lindberg A, Waller K, Unnerstad H, Artursson K, Jovanovic J, Ost M.

2004. Microbial etiology and correlation with environmental factors in cases of acute

clinical mastitis in Swedish dairy cows. In: Annual meeting of National Mastitis Council,

Feb. 1-4, 2004. Charlotte, North Carolina (USA). P: 308-309.

Elbers A, Miltenburg J, De Lange D, Crauwels A, Barkema H, Schukken Y. 1998. Risk factors

for clinical mastitis in a random sample of dairy herds from the southern part of The

Netherlands. J Dairy Sci. 81: 420-426.

39


Enevoldsen C, Sorensen JT. 1992. Effects of dry period length on clinical mastitis and other major

clinical health disorders. J Dairy Sci. 75: 1007-1014.

Ericsson Unnerstad H, Lindberg A, Persson Waller K, Ekman T, Artursson K, Nilsson OM,

Bengtsson B. 2009. Microbial etiology of acute clinical mastitis and agent specific risk

factors. Vet Microb. 137: 90-97.


mastitis pathogens during a seven year period. J Dairy Sci. 85: 1111-1118.

Esmat M, Badr A. 1996. Some studies on mastitis-metritis agalactia syndrome in cows. In:

Proceedings of the Fourth Scientific Congress, Veterinary Medicine and Human Health, 3-

5 April 1996, Cairo University, Cairo, Egypt. 303-309.

Fadlelmoula A, Fahr R, Anacker G, Swalve H, für Landwirtschaft TL. 2007. The management

practices associated with prevalence and risk factors of mastitis in Large Scale Dairy Farms

in Thuringia-Germany 1: Environmental Factors Associated With Prevalence of Mastitis.

Australian J Basic Appl Sci. 1: 619-624.

Falkenberg U, Tenhagen BA, Baumgartner B, Heuwieser W. 2004. Relationship between

morphological characteristics of the teat duct and prevalence of intramammary infections

with Streptococcus agalactiae in dairy cow. Dtsch. Tierarztl Wochenschr, . 111: 355-358.

Farooq A, Inayat S, Akhtar M, Mushtaq M. 2008. Prevalence of mastitis and antibiotic sensitivity

of bacterial isolates recovered from Nili-Ravi buffaloes. The J Anim Plan Sci. 18: 76-77.

Feroze KQ. 1992. Studies on some epidemiological aspects of bovine mastitis in Gujrat district

Univ. Agri., Faisalabad., Pakistan.

Ferry T, Perpoin T, Vandenesch F, Etienne J. 2005. Determinants in Staphylococcus aureus and

their involvement in clinical syndromes. Curr Infect Dis Rep. 7:420–428.

40


Firat G, Uysal Y. 1986. Identification and antibiotic susceptibility of aerobic microorganisms

isolated from the milk of cows with clinical and subclinical mastitis in the Istanbul area.

Pendik Hayvan Hastaliklari Merkez Avastirma Enstitusu Dergisi. 18: 12-27.

Firyal S, Awan AR, Muhammad G, Babar ME, Ali A, Asif M, Pasha HM, Khan AA, Iftikhar R.

2009. Investigation on Means of transmission of Staphylococcus aureus in Buffalo and

Cow Herds through Coagulase Genotyping. Pak J Zool Suppl Ser. 9: 385-388.

Food and Agriculture Organization (FAO). 2010. The technology of traditional milk products in

developing countries. Anim Prod Health. 85: 9–24.

Fox L. 2009. Prevalence, incidence and risk factors of heifer mastitis. Vet microb. 134: 82-88.

Galton D. 2004. Effects of an automatic postmilking teat dipping system on new intramammary

infections and iodine in milk. J Dairy Sci. 87: 225-231.

Gentilini E, Denamiel G, Llorente P, Godaly S, Rebuelto M, DeGregorio O. 2000. Antimicrobial

Susceptibility of Staphylococcus aureus Isolated from Bovine Mastitis in Argentina. J

Dairy Sci. 83: 1224-1227.

Gonzalez RN, Timoney JF, Netherton BF, Watts JL, Sears PM, Hayes GL. 1990. Epidemiology

of human group G Streptococci mastitis in dairy cows. J. Dairy Sci. 73: 187.

Halasa T, Huijps K, Osteras O, Hogeveen H. 2007. Economic effects of bovine mastitis and

mastitis management: A review Vet Quart. 29: 18-31.

Hameed S, Arshad M, Ashraf M, Avais M, Shahid M. 2008. Prevalence of common mastitogens

and their antibiotic susceptibility in tehsil Burewala, Pakistan. Pak J Agri Sci. 45(2): 181-

183.

41


Hameed S, Arshad M, Ashraf M, Avais M, Shahid M. 2012. Cross Sectional Epidemiological

Studies on Mastitis in Cattle and Buffaloes of Tehsil Burewala, Pakistan. Pak J Anim Plan

Sci. 22(3): 371-376.

Haveri M, Hovinen M, Roslof A, Pyorala S. 2008. Molecular types and genetic profiles of

Staphylococcus aureus strains isolated from bovine intramammary infections and

extramammary sites. J Clin Microbiol. 46(11): 3728.

Hussain A, Shakoor A, Yousaf A, Rehman S, Zaman M. 2012a. Clinical and Subclinical

Staphylococcus aureus Mastitis in Dairy Buffaloes: Diseases Characteristics and

Antibiotics Susceptibility Profiles of Isolates. J Anim Plan Sci. 22: 217-220.

Hussain R, Javed MT, Khan A, Mahmood F, Kausar R. 2012b. Mastitis and associated histo-

pathological consequences in the context of udder morphology. Int J Agric Biol. 14: 947-

952.

Hussain R, Javed MT, Khan A, Muhammad G. 2013. Risks factors associated with subclinical

mastitis in water buffaloes in Pakistan. Trop anim health prod. 45(8): 1723-1729.

Hussain R, Khan A, Javed MT, Rizvi F. 2012c. Possible risk factors associated with mastitis in

indigenous cattle in Punjab, Pakistan. Pak Vet J. 32: 605-608.

Husveth F. 2011. Physiological and reproductional aspects of animal production. Debreceni

Egyetem.

Islam M, Islam M, Rahman M, Islam M. 2011. Prevalence of Subclinical Mastitis in Dairy Cows

in Selected Areas of Bangladish. Bangladesh J Vet Med. 9: 73-78.

Islam M, Rahman A, Rony S, Islam M. 2012. Prevalence and risk factors of mastitis in lactating

dairy cows at Baghabari milk shed area of Sirajganj. Bangladesh J Vet Med 8: 157-162.

42


Islam M, Rehman A, Alam MS, Rahman MM, Sultana T, Roh YS, Kim B. 2009. Identification

and Antibiotic Sensitivity of the Causative Organisms of Subclinical Mastitis in Sheep and

Goats. Pak Vet J. 32: 179-182.

Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, Nesme X, Etienne J,

Vandenesch F. 2002. Relationships between Staphylococcus aureus GeneticBackground,

Virulence Factors, agr Groups (Alleles), and Human Disease. InfectImmun. 70(2): 631–

641.

Ji G, Beavis R, Novick RP. 1997. Bacterial interference caused by autoinducing peptide variants.

Science. 276: 2027–2030.

Joshi S, Gokhale S. 2006. Status of mastitis as an emerging disease in improved and periurban

dairy farms in India. Annals of the New York Academy of Sciences. 1081: 74-83.

Kalorey DR, Shanmugam Y, Kurkure NV, Chousalkar KK, Barbuddhe SB. 2007. PCR-based

detection of genes encoding virulence determinants in Staphylococcus aureus from bovine

subclinical mastitis cases. J Vet sci. 8: 151-154.

Karimuribo E, Fitzpatric T, Bell C, Swai D, Kambarage N, Ogden, MJBryant, French N. 2006.

Clinical and sub-clinical mastitis in smallholder dairy farms in Tanzania: Risk, intervention

and knowledge transfer. Prev Vet Med. 74: 84-98.

Kavitha KL, Rajesh K, Suresh K, Satheesh K, Sundar NS. 2009. Buffalo mastitis risk factors.

Buff Bull. 28: 134-137.

Khan A, Muhammad G. 2005. Quarter-wise comparative prevalence of mastitis in buffaloes and

crossbred cows. Pak Vet J. 25: 9-12.

Khan AZ, Khan A, Hayat C, Munir Z, Ayaz U. 2004. Prevalence of mastitis in buffaloes and

antibiotic sensitivity profiles of isolates. Pak J Life Sci. 2: 73-75.

43


Klaas IC. 2004. Systematic clinical examinations for identification of latent udder types in Danish

dairy herds. J Dairy Sci. 87: 1217-1228.

Kotowski K. 1987. Bacterial flora isolated from clinical cases of bovine mastitis and its antibiotic

sensitivity. Medycyna Vetery-naryjna Rychtal, Poland. 43: 278-280.

Kumar R, Yadav B, Anand S, Singh R. 2011. Molecular surveillance of putative virulence factors

and antibiotic resistance in Staphylococcus aureus isolates recovered from intra-mammary

infections of river buffaloes. Microbial pathogenesis. 51: 31-38.

Lafi S, Al-Rawashdeh O, Ereifej K, Hailat N. 1994. Incidence of clinical mastitis and prevalence

of subclinical udder infections in Jordanian dairy cattle. Preventive Veterinary Medicine.

18: 89-98.

Lalrintluanga C, Ralte EL. 2003. Incidence of mastitis, bacteriology and their antibiogram in dairy

cattle in Aizawl, Mizoram. Indian Vet J. 80: 931-932.

Larsen H, Sloth K, Elsberg C, Enevoldsen C, Pedersen L, Eriksen N, Aarestrup FM, Jensen N.

2000. The dynamics ofStaphylococcus aureus intramammary infection in nine Danish

dairy herds. Veterinary microbiology. 71: 89-101.

Lina G, Boutite F, Tristan A, Bes M, Etienne J, Vandenesch F. 2003. Bacterialcompetition for

human nasal cavity colonization: role of staphylococcal agr alleles. Appl Environ

Microbiol. 69: 18-23.

Lindsay JA, Holden TG. 2004. Staphylococcus aureus: superbug, super genome?Trends Microbiol.

12(8): 378-385.

Malachowa N, DeLeo FR. 2010. Mobile genetic elements of Staphylococcus aureus. Cell Mol

Life Sci. 67(18): 3057-3071.

44


Marjan JTPS, Nelianne J, Verkaik WJB, GrootVWND, Acton DS, Belkum AV. 2009. Induction

of Staphylococcus aureus specific IgA and agglutinationpotency in milk of cows by

mucosal immunization. Vaccine. 27: 4001–4009.

Megersa B, Tadesse C, Abunna F, Regassa A, Mekibib B, Debela E. 2010. Occurrence of mastitis

and associated risk factors in lactating goats under pastoral management in Borana,

Southern Ethiopia. Trop Anim Healt Prod. 42: 1249-1255.

Memon J, Kashif J, Yaqoob M, Liping W, Yang Y, Hongjie F. 2012. Molecular Characterization

and Antimicrobial Sensitivity of Pathogens from Sub-Clinical and Clinical Mastitis in

Eastern China. Pak Vet J. 33(2): 170-174.

Miller RH, Paape MJ, Filep R, Link S. 1993. Flow cytometric analysis of neutrophils in cows'

milk. Am J Vet Res. 54: 1975–1979.

Milne M, Biggs A, Fitzpatrick J, Innocent G, Barrett D. 2003. Use of clinical information to

predict the characteristics of bacteria isolated from clinical cases of bovine mastitis. Vet

record. 152: 615-617.

Morin DE, Constable PD, McCoy GC. 1998. Use of clinical parameters for differentiation of gram-

positive and gram-negative mastitis in dairy cows vaccinated against lipopolysaccharide

core antigens J Am Vet Med Assoc. 212: 1423-1431.

Moroni P, Rossi S, Pisoni C, Bronzo G,Castiglioni VB,Boettcher PJ. 2006.Relationship between

somatic cell count and intramammary infection in buffaloes. J Dairy Sci. 89: 998–1003.

Motie A, Ramudit S, Mohabir R. 1985. Subclinical mastitis in dairy cattle in Guyana. Trop Anim

Healt Prod. 17: 245-246.

Muhammad G, Zargham KM, Athar M. 1998. Clinico-Epidemiological and Therapeutic

Observations on Pox Outbreak in Small Holder Dairy Farms. Buff J. 14: 259-268.

45


Mungube E, Tenhagen BA, Regassa F, Kyule M, Shiferaw Y, Kassa T, Baumann M. 2005.

Reduced milk production in udder quarters with subclinical mastitis and associated

economic losses in crossbred dairy cows in Ethiopia. Trop anim healt prod. 37(6): 503-512.

Musser JM, Schlievert PM, Chow AW, Ewan P, Kreiswirth BN, RosdahlVT, Naidu AS, Witte W,

Selander RK. 1990. A single clone of Staphylococcus aureus causes the majority of cases

of toxic shock syndrome. Proc Natl Acad Sci. 87: 225–229.

Neave F, Dodd F, Kingwill R, Westgarth D. 1969. Control of mastitis in the dairy herd by hygiene

and management. J Dairy Sci. 52: 696-707.

Newbould FHS. 1970. Some factors of potential importance in the pathogenesis of bovine

Staphylococcal mastitis. In: McFeely, RA, GE Morse and EI Williams (eds) Prod. VI

International 221 Conference on Cattle Diseases sponsored by WorldAssociation for

Buiatrics. August 16-20, 1970. Bellevue Stratford Hotel Philadelphia (USA). P: 9-14.

Oezenc E, Vural MR, Seker E, Ucar M. 2008. An evaluation of subclinical mastitis during

lactation in Anatolian buffaloes. Turk J Vet Anim Sci. 32: 359-368.

Oliver J. 1975. Some problems of mastitis control in hand dairy herds. In Dodd FHTK Griffin and

Kingorill RG. 188-192. In Proceedings of International Dairy Federation Seminar on

Mastitis Control. National Institute of Research in Dairying at Reading University, UK.

Oltenacu PA, Bendixen PH, Vilson B, Ekerbo I. 1990. Tramped teats, clinical mastitis disease in

tied cows. Environmental risk factors and interrelationship with other diseases. Acta

Veterinaria Scandinavia. 31: 471-478.

Osteras O. 2000. The Cost of Mastitis, an Opportunity to Gain More Money. In:Proceedings of

the British Mastitis Conference 2000, Shepton Mallet, U.K. P. 67-77.

Oz HH, Farnsworth RJ, Larson VL. 1985. Environmental mastitis. Vet Bull. 55: 830-840.

46


Parker K, Compton C, Anniss F, Heuer C, McDougall S. 2008. Quarterlevel analysis of subclinical

and clinical mastitis in primiparous heifers following the use of a teat sealant or an

injectable antibiotic, or both, precalving. J Dairy sci. 91: 169-181.

Peeler E, Green M, Fitzpatrick J, Morgan K, Green L. 2000. Risk factors associated with clinical

mastitis in low somatic cell count British dairy herds. J Dairy sci. 83: 2464-2472.

Philpot W, Pankey J. 1978. Hygiene in the prevention of udder infections. V. Efficacy of teat dips

under experimental exposure to mastitis pathogens. J Dairy sci. 61: 956-963.

Pianta C, Fallavena LC. 1980. Bovine mastitis in Rio Grande do Sul, Brazil. Sensitivity of

Staphylococcus aureus to antibiotics in current use. Boletim-do-Instituto-de-Pesquisas-

Veterina-rias. Desiderio-Finamor. 7: 67-72.

Piepers S, De Vliegher NS, de Kruif A, Opsomer G, Barkema HW. 2009. Impact of

intramammary infections in dairy heifers on future udder health, milk production, and

culling. Vet Microbiol. 134: 113–120.

Pitkala A, Haveri M, Pyorala, Myllys SV,Honkanen BT. 2004. Bovine mastitis in finland 2001,

prevalence, distribution of bacteria, and antimicrobial resistance. J Dairy Sci. 87(8): 2433-

2441.

Prabhakar S, Singh K, Joshi D. 1995. Incidence and etiology of clinical mastitis in buffaloes. Buff

Bull. 14: 63-67.

Prem C, Behra GD, Chakravarty AK, Chand P. 1995. Comparative incidence of mastitis in relation

to certain factors in cattle and buffaloes Indian J Anim Sci. 65: 12-14.

PyoralaS, Kaartinen L, Kack H, Rainio V. 1994. Effecacy of two therapy regimensfor treatment

of experimentally induced Escherichia coli mastitis in cows. J Dairy Sci. 77: 453-461.

47


Radostits OM, Gay CC, Blood DC, Hincheliff KW. 2000. Mastitis In: VeterinaryMedicine: A text

book of diseases of cattle, sheep, pig, goat and horses. Vol, Edition. W.B. Saunders,,

London, 603-700.

Radostits OM, Gray CC, Hinchcliff KW, Constable PD. 2007. Mastitis. In: Veterinary Medicine.

A text book of the disease of Cattle, Horse, Sheep, Pigs and Goats., Vol, Edition. Sounder,

Spain, 673-749.

Rady A, Sayed M. 2009. Epidemiological Studies on Subclinical Mastitis in Dairy cows in Assiut

Governorate. Vet World. 2: 373-380.

Rahman M, Islam M, Uddin M, Aktaruzzaman M. 2009. Prevalence of subclinical mastitis in

dairy cows reared in Sylhet district of Bangladesh. Inter J Bio Res. 1: 23-28.

Rahman MM, Rahman MA. 1985. Detection of mastitis organisms in udder secretions and their

behaviour towards various antibiotics Pak J Sci Indust Res. 28: 195-197.

Ramachandraiah K, Kumar K, Sreemannarayana O. 1998. Subclinical mastitis in an organized

buffalo farm. Buff Bull. 17: 85-87.

Roberts MC.2006. Update on acquired tetracycline resistance genes. FEMS Microbiol. Lett.

245:195-203.

Roberson J. 1999. Epidemiology of Staphylococcus aureus on dairy farms. Annual

meetinfeetingational mastitis council incorporated. 38: 38-47.

Roberson J, Fox L, Hancock D, Gay J,Besser T. 1994. Ecology of Staphylococcus aureus isolated

from various sites on dairy Farms. J Dairy Sci. 77(11): 3354-3364.

Sandholm M, HonkanenBT, Kaartinen L, Pyorala S. 1995. The bovine udder and mastitis, why

does antibiotics therapy fail? Mammites desvaches laitieres. 9: 88-106.

48


Sargeant JM, Scott HM, Leslie KE, Ireland MJ, Bashiri A. 1998. Clinical mastitis in dairy cattle

in Ontario: frequency of occurrence and bacteriological isolates. The Canad Vet J. 39(1):

33-38.

Schito GC. 2006. The importance of the development of antibiotic resistance inStaphylococcus

aureus. Clin Microbiol Infect. 12(1): 3–8.

Schultz LH, Brown RW, Jesper DE, Berger MW,Natzke RP, Philpot WN, Smith JW, Thompson

PD. 1978. Current concept of bovine mastitis. 2nd ed. The Natl. Mastitis Council, Inc.

Washington D. C., USA. Pp. 6-9.

Sears PM, McCarthy KK. 2003. Management and treatment of staphylococcal mastitis. The

Veterinary Clinics of North America.Food Animal Practice, 19(1): 171-173.

Shah SI. 1994. Animal Husbandry. National Book Foundation, Islamabad.

Sharif A, Ahmad T, Bilal M, Yousaf A, Muhammad G. 2007. Effect of severity of sub-clinical

mastitis on somatic cell count and lactose contents of buffalo milk. Pak Vet J. 27(3): 142-

144.

Sharif A, Muhammad G. 2009. Mastitis control in dairy animals. Pak Vet J. 29(3): 145-148.

Sharma N, Maiti S, Sharma KK. 2007. Prevalence, Etiology and Antibiogram of Microorganisms

Associated with Subclinical mastitis in buffaloes in Durg, Chhattisgarh State (India). Intern

J Dairy Sci. 2(2): 145-151.

Shittu AO, Udo EE, Lin JB. 2007. Insights on virulence and antibiotic resistance: A review of the

accessory genome of Staphylococcus aureus. Wounds 19(9): 237-244.

Shukla SK, Dixit VP, Thaliyal DC, Grag SK, Kumar A. 1997. A note on the incidence of bovine

mastitis in relation to teat shape, size and quarters affected. Indian Vet. J. 74: 989-990.

49


Smith AK. 2000. Bacterial agents causing contagious and environmental bovine mastitis in Trakya

district and their susceptibility to antibiotics Veteriner, Fakultesi, Dergisi, Istanbul. 26:

353-365.

Soomro SA, Mirbahar KB, Memon MA, Memon MI. 1997. Prevalence of clinical and sub clinical

mastitis in buffalo at Hyderabad, Sindh. Pak J Agri Engg Vet Sci. 13: 28-30.

Spencer GR, Lasmanis J. 1952. Reservoirs of infection of micrococcus pyogenes in bovine mastitis.

American Journal of Veterinary Research, 13(49), 500-503. Sykes R. 2001. Penicillin:

from discovery to product. Bull. World Health Organ. 79 (8): 778–779.

Sun DD, Ma XX, Hu J, Tian Y, Pang L, Shang H, Cui LZ. 2013. Epidemiological and molecular

characterization of community and hospital acquired Staphylococcus aureus strains

prevailing in Shenyang, Northeastern China. The Brazilian J Infect Diseases. 17: 682-690.

Thirunvukkarasu M, Prabaharan R. 1998. Epidemiologic measures of association between the

incidence of mastitis and some of its predisposing factors. Indian Vet. J. 75: 718-722.

Thorne H, Wallmark G. 1960. Studies on staphylococcal mastitis in an individual herd with special

reference to phagetypes of isolated staphylococci. Acta VetScand. 1(2): 114-120.

Trinidad P, Nickerson S, Alley T. 1990. Prevalence of intramammary infection and teat canal

colonization in unbred and primigravid dairy heifers. J Dairy sci. 73: 107-114.

Turkyilmaz S, Kaya O. 2006. Determination of some virulence factors in Staphylococcus spp.

isolated from various clinical samples. Turk J Vet Anim Sci. 30: 127-132.

Unnerstad HE, Lindberg A, Waller KP, Ekman T, Artursson K, Nilsson M, Bengtsson B. 2009.

Microbial etiology of acute clinical mastitis and agent specific risk factors. Vet Microbiol.

137: 90–97.

50


USDA. 2008. Dairy 2007, Part III: Reference of Dairy Cattle Health and Management Practices

in the United States, 2007 USDA–APHIS–VS, CEAH. Fort Collins, CO #N482.0908

Vaarst M, Enevoldsen C. 1997. Patterns of clinical mastitis manifestations in Danish organic dairy

herds. J Dairy Res. 64: 23-37.

Varshney JP, Naresh R. 2004. Evaluation of homeopathic complex in the clinical management of

udder diseases of riverine buffaloes, Homeopathy, 93(1): 17-20.

Vestweber J.1994. Staphylococcus aureus mastitis. part II. diagnostic aids, therapy and control.

Compendium on CE. 16(2): 217-220.

Waage S, Sviland S, Odegaard S. 1998. Identification of risk factors for clinical mastitis in dairy

heifers. J Dairy Sci. 81: 1275-1284.

Waller PK, Bengtsson B, Lindberg A, Nyman A, Unnerstad EH. 2009. Incidence of

mastitis and bacterial findings at clinical mastitis in Swedish primiparous cows.Influence

of breed and stage of lactation. Vet. Microbiol. 134: 89-94.

Wells S, Ott S, Hillberg Seitzinger A. 1998. Key health issues for dairy cattle new and old. J Dairy

Sci. 81(11): 3029-3035.

Zadoks R, Allore H, Barkema H, Sampimon O, Wellenberg G, Grohn Y, Schukken Y. 2001. Cow

and QuarterLevel Risk Factors for Streptococcus uberis and Staphylococcus aureus

Mastitis. J Dairy sci. 84: 2649-2663.

Zahid AI. 2004. Studies on comparative incidence of subclinical and clinical mastitis and in vitro

antibiotic susceptibility of isolates from Holstein-Friesian, Jersey cows and buffaloes. Pak

Vet J. 24: 76-81.

51


Zaki MM, El Zorba HY, Kaoud HA. 2010. Environmental organisms as risk factors in the

occurrence of mastitis in dairy buffaloes with suggested methods of control. A field study.

Global Vet. 5(2): 97-105.

Zeryehun T, Aya T, Bayecha R. 2013. Study on prevalence, bacterial pathogens and associated

risk factors of bovine mastitis in small holder dairy farms in and around Addis Ababa,

Ethiopia. J Anim Plan Sci. 23(1): 50-55.

52

CHAPTER 3 EXPERIMENT -1

RISK FACTORS ASSOCIATED WITH MASTITIS IN DAIRY BUFFALOES

ABSTRACT

The cross sectional study was carried out between January to December 2012 to investigate the

prevalence of mastitis in dairy buffaloes and risk factors. Total sample size for this survey consists

of 1,036 lactating buffaloes. The farms were categorized as small scale 5-10, medium scale 11-30

and large scale having more than 30 dairy animals. The overall prevalence of mastitis was recorded

as 49%. Among mastitis cases the prevalence of clinical mastitis was 10.2% as a whole. The

overall prevalence of subclinical mastitis was 38.8% as diagnosed with a California mastitis test.

In a univariable analysis: area, herd size, age, breed, parity, stage of lactation, reproductive

disorders, udder shape, previous exposure to mastitis, ease of milking, udder edema, lesion on

udder/teat, swelling on udder/teat, condition of floor, frequency of dung removal, exposure to

FMD, udder wash, teat dipping, milking techniques and tick infestation were significantly

associated (𝑃𝑃< 0.25) with a prevalence of mastitis. These 20 significant variables were further

selected for multivariable analysis to estimate the independence of the effect of the variables. The

final model identified area, age, breed, parity, stage of lactation, udder shape, ease of milking,

previous exposure to mastitis, udder edema, lesion on udder/teat, exposure to FMD, teat dipping

and tick infestation were significantly associated with the prevalence of mastitis in buffaloes (p<

0.05). Mastitis can be minimized by improving management and animal related potential risk

factors.

Keywords: Mastitis, Buffaloes, Prevalence, Risk factors, Age, Breed, Parity

53

EXPERIMENT -1

INTRODUCTION

Milk produced from dairy animals provides an important dietary source of rural as well as

urban population. However, milk production often does not fulfil the country’s requirements due

to various factors. Mastitis is reported to be one of the common problem of dairy industry all over

the world. The economic losses due to mastitis occur because discarded milk, reduction in the

quality of milk and the cost of treatment (Radostits et al. 2007; Fekadu, 1995). In Pakistan mastitis

has also been reported as top ranking disease responsible for economic losses (Hussain et al. 2005).

It has been reported that annual losses due to mastitis in USA are approximately $2 billion while

in India $526 million (Donovan et al. 2005; Varshney and Naresh 2004). Mastitis can affect any

herd at any time, therefore all herds are potentially susceptible.

Mastitis can be caused by a number of pathogens. Broadly mastitis can be defined as two

categories i.e contagious and environmental. The contagious mastitis is caused by S. aureus, Str.

agalactiae, etc. It can spread from the infected quarters to other quarters or animals during milking

(milker hands or machines). The environmental mastitis can be caused by many other organisms

such as Str. uberis, Str. dysgalactiae, coliforms, etc. which are commonly present in the

environment (bedding, flooring, droppings). It can infect the glands between milking as well as

during the dry period (Radostits et al. 2007). Mastitis is a multifactorial disease, closely related to

the production system and environment in which the dairy animals are kept (Mekibib et al. 2010).

That’s why monitoring udder health performance is impossible without reliable and affordable

diagnostic methods (Zadoks and Schukken, 2006). Furthermore, it can be divided into two group

clinical, subclinical mastitis. Mustafa (2003) reported that only a small proportion of udder

infection results in "clinical mastitis" whereby there are changes in udder condition and milk

quality. The vast majority of cases exists as subclinical; with estimated 20-40 cases for every

54

EXPERIMENT -1

clinical mastitis case within the herd. Therefore mastitis problems may be present within a herd

despite no visible presence within the animal or the milk. Subclinical mastitis is responsible for

the greatest financial losses associated with mastitis. It is estimated to cause 70% of the total losses.

These losses however, are difficult to demonstrate producers since they are associated with

decreased milk production caused by the effects of chronic inflammation of the mammary gland.

Bovine mastitis can be caused by physical or chemical agents but the majority of cases are

infectious and usually caused by bacteria. The disease has been reported by several authors on the

prevalence and mastitis in different parts of the world (Biffa et al. 2005; Hussain et al. 2013;

Chishty et al. 2007). Several of these studies have shown mastitis is caused by a range of bacteria

and Staphylococcus aureus is major pathogenic. Moreover, there are no proper control measures

in order to contain the disease because of its multifactorial nature. Milk contaminated from

affected dairy animals with bacteria may render it inappropriate for human consumption. Zoonotic

diseases potentially transmitted by raw milk include brucellosis, caseous lymphadenitis,

leptospirosis, listeriosis, melioidosis, Q-fever, staphylococcal food poisoning, toxoplasmosis and

tuberculosis (Mungube et al. 2005; Radostits et al. 2007). These conditions are associated with

public health risks brought about by contaminated raw milk and antibiotic residues as a

consequence of drug therapy (Andrew et al. 2009).

Mastitis in dairy herds occurs as a complex interaction between the host, the environment

and agent. The most common risk factors for mastitis in dairy herds can be divided in two groups:

animal related risk factors and environmental and management risk factors. Animal related risk

factors include: breed, age, parity/lactation number, stage of lactation, lesions on udder/teat,

swelling on udder/teat, udder shape Teat shape, udder edema, treat edema, and ease of milking.

Management, environmental and housing related risk factors included: stimulus for milk letdown,

55

EXPERIMENT -1

number of animals milked by the same milker, udder washing, milking technique, dairy husbandry

system, condition of floor, tick infestation, the source of drinking water, frequency of dung

removal per day, farm hygiene and husbandry practices. Other risk factors associated with mastitis

included: previous exposure to mastitis, reproductive disorders, History of exposure to foot and

mouth disease and pox lesions on udder and teat (Nigo et al. 2013; Sarker et al. 2013; Elbaby et

al. 2013). Many studies report risk factors for mastitis are associated with farm management,

hygiene management, the breeding environment, milking technology, feeding, the calving, season

and preventive health management (Bludau et al. 2014). In an individual herd, animal related

factors are breed, parity, period of lactation, udder and teat morphology, age at calving, milk

leakage, udder edema, milk production, number of milk somatic cells and reproductive disorders

(Nyman et al. 2007). Moreover, the stage of lactation, lactation number, trauma to udder, teat and

teat canal, loose teat sphincters, lesions on teat skin, immunological status of each mammary gland,

bulk of infection in the environment and managemental conditions are amongst the determinants

which dictate the level of mastitis incidence (Radostits et al. 2007).

In developing countries like Pakistan owing to small herd sizes, dairy animals are mostly

hand milked. Mastitis in hand milked animals were nearly twice as frequent as in machine-milked

ones (25.1 VS 14.6%) Motie et al. (1985). Infectious agents of mastitis may be transmitted from

infected to healthy animals through the milker's hand (Oliver, 1975) especially because milk is

often used as a lubricant for milking. The infection originates either from the infected udder or the

contaminated environments and the major sources of pathogens and means of transmission include

infected quarters and soiled udder, contaminated milking machines, teat cups, milker’s hands,

washing clothes, flies and surgical instruments. Several studies have investigated various risk

factors for mastitis (Barnouin et al. 2005; O’Reilly et al. 2006). The results of these studies differ,

56

EXPERIMENT -1

but some risk factors are in concordance. However, these studies were conducted in different

countries under varying conditions, which may explain different results, and no specific studies on

risk factors for mastitis have been performed under the climatic, housing and dairy breed

conditions.

Mastitis prevalence was found to be significantly influenced by stage of lactation, parity,

breed, milk yield, anatomical abnormality of the udder, and some management aspects including

nutrition (Almaw et al. 2008). There are numerous risk factors identified by many researchers that

influence the occurrence of mastitis such as age, parity, lactation stage, milk yield, breed, previous

mastitis record, floor type, disinfection of fingers and teat dipping, etc. (Karimuribo et al. 2006;

Madut et al. 2009). There are some reports on the magnitude of the disease, but information

relating to its risk factors is insufficient (Kahir et al. 2008). Such information is important to

envisage when designing appropriate strategies that would help to reduce its prevalence and effects.

However, virtually all of the published information about the risk factors for mastitis refers to dairy

breeds of cattle, and little information available for water buffaloes. Though a high probability

exists that these identified risk factors may also be observed among these species, the degree of

influence by these factors is still unknown.

57

EXPERIMENT -1

MATERIALS AND METHODS

Study Area

The present study was conducted in two districts Lahore and Bhimber of Pakistan. Lahore

is a capital of Punjab province and it lies between longitudes 74° 20' 37 east and latitude 31° 32'

59 north and the altitude is 209 meters above the sea level. The Lahore features hot, semi-arid

climate with an average of temperature 1100F in summer and 350F in winter and average annual

rainfall is from 470.1 to 738 millimeters. While, Bhimber is a district of Azad Kashmir and lies

74° 4' 0 east and latitude 32° 58' 60 north and average altitude is 314 meters from sea level.

Bhimber is semi-hilly and mountainous area with some stretches of plains. The weather of

Bhimber is an arid climate with average temperature 1020F in summer and 22 0F in winter. It has

a very diverse climate; ranging from sub-humid subtropical, to moist temperate, dry cold temperate,

very cold temperate. The mean annual rainfall varies from 800 to 1100 millimeters. Buffalo

population in Lahore and Bhimber was 403128 and 147539, respectively (Anonymous, 2006).

Study Population and Design

The present cross sectional study was carried out between January to December 2012 to

investigate the mastitis prevalence in dairy buffaloes and epidemiological investigation of risk

factors. The study area was consist of two district i,e Lahore and Bhimber. The total buffalo

population in Pakistan is 34.6 million Buffalo. There is no registration of dairy farmers to kept

small dairy herds at their premises. Unfortunately, list of herds was not available due to this reason

convenience sampling was adopted. From the study area the population of district Lahore was

higher as compared to district Bhimber. But due to limited sources total 50 dairy herds from two

district, 25 from each were selected. The total sample size for this study was consisted of 1,036

lactating buffaloes.

58

EXPERIMENT -1

Inclusion and exclusion criteria

All the lactating buffaloes were included. Dry buffaloes and heifers were excluded from

the study.

Questionnaire and data collection

The questionnaire was designed with the guideline of Nigo et al. (2013), Ali (2009), Biffa

et al. (2005), Sarker et al. (2013), Mustafa et al. (2013), Elbaby et al. (2013) and Kiveria et al.

(2006). A questionnaire was designed for collection of data farm demography, climate and

management practices. It was having some dichotomous, polychotomous questions and farmer’s

interviewing and farm records were used for collection of data. The related data were obtained

from farm owners’ interviews and farm records. All the risk factors were arranged into categories

in three groups, i.e. Animal related risk factors, management (environmental and housing) related

risk factors and others associated risk factors of mastitis. Animal related risk factors include: breed,

age, parity/lactation number, stage of lactation, lesion on udder/teat, swelling on udder/teat, udder

shape Teat shape, udder edema, treat edema, and ease of milking. Management, environmental

and housing related risk factors included: stimulus for milk letdown, number of animals milked by

the same milker, udder washing, milking technique, condition of floor, tick infestation, the source

of drinking water, frequency of dung removal per day. Other risk factors associated with mastitis

included: previous exposure to mastitis, reproductive disorders, history of exposure to foot and

mouth disease and pox lesions on udder and teat.

Physical Examination of the Udder and Teat in Clinical Mastitis

In case of clinical mastitis udder and teats were examined visually and thoroughly palpated

for detecting any possible fibrosis, visible injury, cardinal signs, tick infestation and viscosity. The

size and consistency of the udder and quarters were inspected for the presence of any anatomical

59

EXPERIMENT -1

malformation, such as disproportional symmetry, swelling, firmness and blindness. Information

regarding previous history of mastitis and quarters effected were obtained and recorded on the

questionnaire by interviewing farm owners. Information or the presence of clots, flakes, watery,

any bloody secretions and physical appearance of milk secretion were examined from each quarter

according to guidelines of Mekibib et al. (2010), Kivaria et al. (2007) and Elbably et al. (2013).

California Mastitis Test

Screening of subclinical mastitis was performed by the California Mastitis Test (CMT)

with the guideline of Iqbal et al. (2006). About 5 ml milk was mixed with equal volume of CMT

reagent in mastitis paddle. Mixing was accomplished by gentle circular motion of the paddle in a

horizontal plane. The reaction developed almost immediately with milk containing a high

concentration of somatic cells. The peak of reaction was obtained within 10 seconds and scored.

Statistical analysis

All the collected data through questionnaire was entered into an Excel sheet of Microsoft

Office Excel (2003) and transferred for analysis to R software and SPSS version 16.0. Firstly, all

the data were labelled into sub heading and analyzed by using descriptive statistics for the

frequency and cross tabulation tables. In Univariable analysis p ≤ 0.25 was considered significant

while risk factors significant in the univariable analysis were furtherly selected as potential

candidates for multivariate analysis using the Binary Logistic Regression with the forward

Stepwise method. All the risk factors in the Logistic Regression, having p ≤ 0.05 were considered

significantly associated with mastitis and the strength of association was determined by the Odds

Ratio (OR) at 95% Confidence interval (CI).

60

EXPERIMENT -1

RESULTS

Descriptive Epidemiology

Prevalence of Clinical and Subclinical Mastitis

A total of 1036 buffaloes were examined for mastitis. Of the population studied, the

animals examined in district Lahore were 598 buffaloes belonging to 25 herds, while the remaining

438 were from 25 herds maintained in Bhimber district. The overall prevalence of mastitis was

recorded 49.0% (508/1036 animals). The prevalence of mastitis recorded in Lahore was 55.5%

(332/598 animals) while in district Bhimber it was 40.2% (176/438 animals) (Table 3.1).

Among mastitis cases the prevalence of clinical mastitis was 10.2% (106/1036 animals) as

a whole. However, the prevalence of clinical mastitis in district Lahore was 11.9% (71/598 animals)

whereas it was 8.0% (35/438 animals) in district Bhimber. The overall prevalence of subclinical

mastitis was 38.8% (402/1036) as diagnosed with a California mastitis test. The district wise

prevalence was subclinical mastitis was 43.6% (261/598 animals) and 32.2% (141/438 animals)

in the districts of Lahore and Bhimber, respectively.

Among the total of 508 cases of mastitis 20.9% (106/508) were of clinical mastitis while

the remaining 79.1% (402/508) was subclinical mastitis. The clinical and subclinical mastitis on

district wise among the mastitis cases was 21.4% (71/332) and 78.6% (261/332) in Lahore while

in Bhimber it was 19.9% (36/176) and 80.1% (141/176), respectively.

Prevalence of Mastitis on the basis of Herd Size

The herds were categorized into three groups i.e. Small comprising of 5-10 animals,

medium sized 11-30 animals and large having more than 30 animals. The overall prevalence of

mastitis was 40.2%, 46.5% and 52.6% in small, medium and large herds, respectively. In district

61

EXPERIMENT -1

Lahore the herd wise mastitis prevalence was 45.7%, 52.5 % and 56.8%, while in district Bhimber

it was 29.9%, 40.3% and 44.0%, respectively (Table 3.2).

Age wise distribution of mastitis

The dairy animals were categorized into three age groups; G1 (3-5 years), G2 (6-8 years)

and G3 (9 and above). The prevalence of mastitis recorded in was 38.2%, 40.8% and 68.9% in

G1, G2 and G3, respectively. In district Lahore the prevalence of mastitis in different age groups

was 44.8%, 46.7%, 71.0% of G1, G2 and G3, respectively. Similarly, in Bhimber it was 29.4%,

36.1% and 64.5% in G1, G2 and G3, respectively (Table 3.3).

Breed wise distribution of mastitis

The dairy buffaloes were categorized into three groups on the basis of their breed B1 (Nili

Ravi), B2 (Kundhi) and B3 (Non-descriptive). The prevalence of mastitis in buffaloes on the basis

of the breed was recorded 52.2%, 40.0% and 44.7% in B1, B2 and B3, respectively. In the district

Lahore prevalence of mastitis was recorded 58.1%, 50.0%, and 47.4% while in Bhimber it was

44.1%, 28.3% and 39.3%, respectively (Table 3.4).

Parity wise prevalence of mastitis

The dairy buffaloes were categorized into three groups on the basis of their parity P1 (1

parity) P2 (2-5 parity) and P3 (>6 parity). The overall prevalence of mastitis on the basis of parity

was recorded 26.1%, 48.4% and 58.0% in P1, P2 and P3, respectively. In district Lahore

prevalence of mastitis was recorded 32.1%, 54.2% and 65.1% in P1, P2 and P3, respectively.

Similarly, the prevalence of mastitis on the basis of lactation number was recorded in Bhimber

17.5%, 41.1% and 47.1% in P1, P2 and P3, respectively (Table 3.5).

62

EXPERIMENT -1

Stage of lactation wise prevalence of mastitis

The dairy animals were divided into three categories (early, mid and late) on the basis of

their lactation stage. The overall prevalence of mastitis was recorded as 43.5%, 55.4% and 43.8%,

in early, mid and late stage of lactation, respectively. In the district Lahore prevalence of mastitis

on the basis of stage of lactation was recorded 46.7%, 63.0% and 50.8%, while in district Bhimber

it was 39.2%, 44.6% and 34.9% in early, mid and late, respectively (Table 3.6).

Quarter level prevalence

The quarter wise prevalence of mastitis among LF, RF, LR, and RR was recorded at 9.4%,

28.0%, 8.2% and 19.4%, respectively. In district Lahore the quarter wise prevalence of mastitis

was 11.0%, 30.8%, 10.5% and 22.7%, while in district Bhimber it was 7.1%, 24.2%, 5.0% and

14.8%, respectively (Table 3.7). The one quarter, two quarters, three quarters and four quarters

prevalence were recorded 38.5%, 5.8%, 4.1% and 0.7%, respectively. In district Lahore the quarter

level prevalence of mastitis was recorded 42.1%, 7.2%, 5.4% and 0.8%, while in district Bhimber

it was 33.6%, 3.9%, 2.3% and 0.5%, respectively (Table 3.8).

Udder Shape

In dairy buffaloes the udder shape was categorized in two i.e. pendulous and normal. The

prevalence of mastitis was the highest in pendulous udder (51.6%) than normal (43.0%) (Table

3.10). In the district Lahore prevalence of mastitis on the basis of udder shape was 58.0% (243/419)

and 49.7% (89/179) in pendulous and normal udder, respectively. In district Bhimber it was

recorded as 42.9% (132/308) and 33.8% (44/130) in pendulous and normal udder, respectively.

63

EXPERIMENT -1

Teat Shape

Teats shape was categorized into three types on the basis of shape, i.e., funnel, round, and

flat. The whole prevalence of mastitis in funnel, round and flat teats was recorded 51.1%, 47.2%

and 49.3%, respectively (Table 3.10). In the Lahore prevalence of mastitis was recorded 54.9%

(73/133), 53.8% (98/182) and 56.9% (161/283) while in Bhimber it was 45.7% (43/94), 38.1%

(51/134) and 39.1% (82/210) in funnel, round and flat teats, respectively.

Ease of milking

In dairy buffaloes ease of milking was categorized in two (soft milking and hard milking).

The prevalence of mastitis in soft milking was highest 44.7% (421/941) and lowest in hard

milking 91.6% (87/95) (Table 3.10). In district Lahore the prevalence of mastitis was in soft

milking (51.3% (278/542/) and in hard milking it was 96.4% (54/56). In district Bhimber the

prevalence of mastitis was in soft milking 35.9% (143/399) and in hard milking it was 84.6%

(33/39).

Milking Techniques

The milking techniques were categorized such as complete hand milking and knuckling.

The prevalence of mastitis in animals milked by knuckling was 51.3% as compared with complete

hand milking was 43.3% (Table 3.11). In district Lahore the prevalence of mastitis on the basis of

milking techniques was recorded relatively higher in knuckling milking 57.5% (233/405) than

complete hand milking 51.3% (99/193). Similarly, in district Bhimber the prevalence of mastitis

was higher 43.8% (145/331) in knuckling than complete hand milking 29.0% (31/107).

Number of animals milked by same milker

The dairy buffaloes were categorized on the basis of the number of animals milked by the

same milker into three groups G1 (1-5), G2 (6-10), G3 (>11). The whole prevalence of mastitis

64

EXPERIMENT -1

was recorded 53.9% and 47.7% and 49.4% in G1, G2 and G3, respectively (Table 3.11). In the

Lahore prevalence of mastitis was recorded 57.2% (91/159), 53.7% (182/339) and 59.0% (59/100)

and in Bhimber it was 28.6% (6/21), 41.8% (145/347) and 35.7% (25/70) in G1, G2, and G3,

respectively.

Frequency of dung removal

In dairy buffaloes the frequency of dung removal was categorized in two i.e. once in a day

and twice in a day. The prevalence of mastitis was recorded higher in once in a day (49.8%) than

twice in a day (43.0%) (Table 3.11).

Condition of floor

The floor bedding on dairy farms were categorized as concrete and soiled bedding. The

prevalence of mastitis was higher in soiled (50.4%) than concrete floor 45.4% (Table 3.11). In

district Lahore the prevalence of mastitis was on soiled floor 69.1% (284/411) and on concrete

floor 55.2% (48/87). The prevalence of mastitis was on solid floor 39.5% (96/243) and on concrete

floor 41.0% (80/195) in district Bhimber.

Source of water

There were three categories of source of water, such as pond, canal and sub-surface water

prevalence of mastitis was 50.8%, 46.0%, and 56.3%, respectively (Table 3.11). In district Lahore

the prevalence of mastitis was recorded at 55.4% (113/204), 52.5% (155/295) and 64.6% (64/99)

in the pond, canal and sub-surface water, respectively. While in district Bhimber it was 43.3%

(55/127), 38.6% (100/259) and 40.4% (21/52/) in river, pond and sub-surface water, respectively.

65

EXPERIMENT -1

Tick infestation

The prevalence of mastitis on basis of tick present on farm was recorded 55.8% while it

was 41.8% where ticks were not present (Table 3.11). In district Lahore the prevalence of mastitis

was 64.8% (184/284), while in district Bhimber it was 45.7% (116/254) were ticks were present.

The prevalence of mastitis without tick infestation was 47.1% (148/314) and 32.6% (60/184) in

district Lahore and Bhimber, respectively

Reproductive disorders

The prevalence of mastitis on the basis of reproductive disorders was recorded 62.8%

while the prevalence of mastitis was 45.0% where reproductive disorders was absent (Table 3.9).

In district Lahore the prevalence of mastitis was 50.7% (231/456) with history of reproductive

disorder and it was 71.1% (101/142) without reproductive disorder. While in district Bhimber it

was 50.0% (46/92) where reproductive disorder was present and it was 37.6% (130/346) where

reproductive disorder was absent.

Exposure to FMD

The prevalence of mastitis on the basis of history of exposure to FMD was recorded 58.4%

while prevalence of mastitis was 47.2% where FMD history was not reported (Table 3.11). In

district Lahore the prevalence of mastitis was 70.4% (69/98) where FMD history was present and

it was 52.6% (263/500) where FMD was not reported. In district Bhimber it was 41.2% (28/68)

with history of FMD exposure and it was 40% (148/370) without FMD history.

Previous exposure of mastitis

The overall prevalence of mastitis was 74.9% in buffaloes having previous exposure to mastitis

while it has 47.3% in buffaloes without previous record of mastitis (Table 3.10). In district Lahore

it was recorded as 81.6% (84/103) in previously exposed to mastitis and 50.1% (248/495) not

66

EXPERIMENT -1

exposed to mastitis. In district Bhimber it was 65.8% (50/76) in previously exposed to mastitis

and it was 34.8% (126/362) in not exposed to previous mastitis.

Univariable and Multivariable Analysis of Risk Factors

In total 25 variables were studied and analyzed by univariable analysis. Out of these 25

variants; 23 variables were further selected for multivariable analysis to estimate the independence

of the effect of the variables on the basis of selection criteria (Table 3.9, 10, 11). The final model

identified 12 variables as potential risk factors of mastitis in buffaloes (Table 3.12).

Area

In univariable analysis the prevalence of mastitis was significantly associated (p< 0.001) in district

Lahore as compared to district district Bhimber (Table 3.9). Similarly in multivariable analysis

area was significantly associated (p< 0.017) with the prevalence of mastitis (Table 3.12).

Herd size

With univariable analysis the prevalence of mastitis was significantly associated (p< 0.02)

with larger herds (OR of 1.65, 95% CI 1.07-2.54) when compared with small herds, while medium

herd was not statistically significant with a prevalence of mastitis (Table 3.9). In multivariable

analysis herd size was not statistically significant (p>0.05).

Breed

The univariable analysis showed that the Kundhi breed had less prevalence of mastitis as

compared with Nili Ravi breed was associated significantly (p> 0.002). The odds ratio of

Kundhi was 0.61 times less than the odds of Nili Ravi breed when compared with Kundhi

breed. Similarly, Kundhi breed was associated significantly (p>0.193) with a prevalence of

mastitis when compared with Non-descriptive breed (Table 3.9). The multivariable analysis

showed that the Nili Ravi breed was highly associated (p<0.003) with a prevalence of mastitis

67

EXPERIMENT -1

when compared with Kundhi breed. The odds of Kundhi breed showed that prevalence of mastitis

is 0.61 times less than Nili Ravi breed (Table 3.12).


The univariable analysis showed that older age buffaloes (>8 years) were significantly

associated (p< 0.001) with the prevalence of mastitis than young (3-5 years) and adult (>5-8 years)

groups having OR 3.59 with 95% confidence interval (CI) of 2.63-4.89 (Table 3.9). In old age

buffaloes, there is three times risk of mastitis as compared to young buffaloes. The multivariable

analysis showed that older age buffaloes were highly significant (p< 0.001) with a prevalence of

mastitis having OR 2.22 with 95% confidence interval (CI) of 1.44-3.43 when compared to young

buffaloes. Similarly, adult buffaloes also had significance (p< 0.008) associated with prevalence

of mastitis when compared to young buffaloes. The odds of adult buffaloes exposure was 0.53 (CI

95%: 0.34-0.85) times less than the exposure in young buffaloes (Table 3.12).


The univariable analysis showed the prevalence of mastitis was highly significant (p<

0.001) with the increase in the parity number OR of 16.43 with 95% confidence interval of 5.91-

45.68. (Table 3.9). The multivariable analysis showed that prevalence of mastitis was statistically

significant (p<0.001) when increase parity number with OR. 9.14 having 95% confidence interval

of 2.9-28.82 (Table 3.12).


The univariable analysis showed that mid lactation stage was significant (p< 0.003)

associated with prevalence of mastitis when compared to the early lactation stage with OR 1.61 at

95% CI of 1.17-2.21 (Table 3.9). The prevalence of mastitis was non-significant (p>0.942) in late

lactation stage when compared to early stage. The odds of late lactation were (OR 1.01) having

68

EXPERIMENT -1

less than one times prevalence of mastitis (95% CI of 0.72-1.42). The multivariable analysis

showed that mid lactation stage significantly higher (p>0.003) with a prevalence of mastitis (OR

1.85; 95% CI, 1.23-2.79) while late lactation stage was not statistically associated with prevalence

of mastitis (p>0.05) (Table 3.12).


The reproductive disorder was associated with the prevalence of mastitis (p<.001) in

univariable analysis. Buffaloes with reproductive disorder were two times more prone to mastitis

as compared to healthy buffaloes (OR 2.064) (Table 3.9). In multivariable analysis,

reproductive disorder was not associated with prevalence of mastitis (p>0.05).

Udder Shape

The univariable analysis showed that pendulous udder was strongly associated with

prevalence of mastitis when compared to normal udder (Table 3.10).

Teat Shape

In the univariable analysis flat teats were associated (p< 0.125) with a prevalence of

mastitis in funnel teat shape when compared to funnel shaped teat OR (1.06) (Table 3.10). In

multivariate analysis teat shape was not associated with prevalence of mastitis (p<0.05).

Previous exposure to Mastitis

The previous exposure of mastitis was highly associated (p<.000) with a prevalence of

mastitis having OR. 3.846 in univariable analysis (Table 3.10). In multivariable analysis the

buffaloes with previous exposure to mastitis were three times more prone to infection as compared

to new exposure of mastitis OR. 3.44 (955 CI; 2.14-5.53). Similarly, previous exposure to mastitis

was strongly associated with prevalence of mastitis (p<.001) (Table 3.12).

69

EXPERIMENT -1

Ease of milking

The univariable analysis showed that soft teat consistency may be due to loose teat

sphincter was highly significant (p<.000) with a prevalence of mastitis when compared with hard

teat consistency having OR.13.432 (95% CI; 6.43-28.02) (Table 3.11). In multivariable analysis,

soft teat was highly significant (p<. 001) associated with prevalence of mastitis having OR. 14.48

(95% CI; 6.43-32.58) (Table 3.12).

Udder Odema

The univariable analysis showed that udder edema was strongly associated (p<.000) with

the prevalence of mastitis having OR.13.747 at 95% CI of 5.92-23.95 (Table 3.10). In

multivariable analysis udder edema was significant (p>0.023) with prevalence of mastitis having

OR. 4.92 (1.25-19.36 at 95% CI) (Table 3.12).

Lesions on udder and teat

The lesions on the udder or teat were statistically associated (p<.000) with the

prevalence of mastitis while buffaloes having a lesion on udder and teat were 13 times more

prone to mastitis as compared to not lesion on the udder or teat in univariable analysis (OR

13.061; 6.25-27.26) (Table 3.10). In multivariable analysis lesions on the udder or teat were

highly significant (p<. 001) with a prevalence of mastitis having OR 6.84 (2.88- 16.21) at 95%

confidence interval (CI) (Table 3.12).

Swelling on udder and teat

The swelling on udder and teat was highly associated (p<.000) with the prevalence of

mastitis having OR. 11.917 (Table 3.10) in univariable analysis while in multivariable analysis, it

was not associated with prevalence of mastitis.

70

EXPERIMENT -1

Condition of floor

The univariable analysis showed that soiled floor was significant (p<.086) associated with

prevalence of mastitis having OR.1.222 (95%CI; 0.929-1.609) (Table 3.11). But in

multivariable analysis condition of floor was non-significant.


The frequency of dung removal has significant (p>0.171) effect on prevalence of mastitis

in univariable analysis (Table 3.11) while in multivariable analysis it was not associated with

prevalence of mastitis.

Source of water

In univariable and multivariable analysis the source of water has non-significant effect on

prevalence of mastitis.

Exposure to FMD

The exposure to FMD was associated with the prevalence of mastitis (p<.008) with having

OR. 1.57 (Table 3.11) by univariable analysis. The multivariable analysis, exposure to FMD was

as that prevalence of mastitis was significant p< 0.020. Buffaloes with a history of FMD exposure

were 1.67 more prone to mastitis as compared to healthy buffaloes (OR 1.67; 95% CI; 1.08-2.58)

(Table 3.12).

Udder wash

The univariable analysis showed buffaloes without udder washing at milking time have

significant effect on prevalence of mastitis (p<.042) (Table 3.11).

Teat dipping

The univariable analysis showed buffaloes without teat dipping were associated with

prevalence of mastitis (p<.042) than teat dipped buffaloes. Buffaloes without teat dipping were

71

EXPERIMENT -1

1.40 times more susceptible to mastitis (95% CI; 1.01-1.95) (Table 3.11). In the multivariable

analysis, prevalence of mastitis had a significant effect (p>0.03). Buffaloes without teat dipping

were 1.76 times more susceptible to mastitis (95% CI; 1.04-2.97) (Table 3.12).

Milking Techniques

Milking method knuckling was found to be highly associated (p>0.019) with the

prevalence of mastitis by univariable analysis as compared with complete hand milking (OR 1.38;

95% CI, 1.05-1.80) (Table 3.11).

Tick infestation

The tick infestation was strongly associated with the prevalence of mastitis (p<.000)

having OR. 1.757, when compared to non-tick infestation buffaloes (Table 3.11) by univariable

analysis. Similarly, in multivariable analysis the prevalence of mastitis was highly significant

(p<.001). Buffaloes with tick infestation were two times more prone to mastitis when compared

with non-tick infestation (OR. 2.83; 95% CI; 1.99-4.01) (Table 3.12).

72

EXPERIMENT -1

Table 3.1: Prevalence of Clinical and Subclinical Mastitis in Lactating Buffaloes

Districts Mastitis Total examined Frequency Prevalence

(%) 95% CI

Lahore

Clinical 598 71 11.8 9.5-14.6

Subclinical 598 261 43.6 39.7-47.6

Total 598 332 55.5 51.5-59.4

Bhimber

Clinical 438 35 8.0 5.7-10.8

Subclinical 438 141 32.2 27.9-36.7

Total 438 176 40.2 35.5-44.8

Overall

Clinical 1036 106 10.2 8.4-12.1

Subclinical 1036 402 38.8 35.8-41.8

Total 1036 508 49.0 46-52

73

EXPERIMENT -1

Table 3.2: Prevalence of Mastitis on basis of Herd size in Lactating Buffaloes

Districts Herd Size Total examined Mastitic Prevalence

(%) 95% CI

Lahore

5-10 animals 35 16 45.7 29.2-62.2

11-30 animals 204 107 52.5 45.6-59.2

More then 30 359 204 56.8 51.7-61.9

Total 598 332 55.5 51.5-59.5

Bhimber

5-10 animals 67 20 29.9 19.8-41.6

11-30 animals 196 79 40.3 33.6-47.2

More then 30 175 77 44.0 36.8-51.4

Total 438 176 40.2 36.4-44.1

Overall

5-10 animals 102 41 40.2 31-49.9

11-30 animals 400 186 46.5 41.6-51.4

More then 30 534 281 52.6 48.4-56.8

Total 1036 508 49.0 46-52

74

EXPERIMENT -1

Table 3.3: Prevalence of Mastitis on basis of Age in Lactating Buffaloes

Districts Age Total examined Mastitic Prevalence

(%) 95% CI

Lahore

3-5 years 172 77 44.8 37.4-52.2

6-8 years 195 91 46.7 39.7-53.7

9 and above 231 164 71.0 64.9-76.6

Total 598 332 55.5 51.5-59.5

Bhimber

3-5 years 187 55 29.4 23.2-36.2

6-8 years 144 52 36.1 28.6-44.2

9 and above 107 69 64.5 55.1-73.1

Total 438 176 40.2 35.7-44.9

Overall

3-5 years 382 146 38.2 36.6-44.8

6-8 years 316 129 40.8 35.5-46.3

9 and above 338 233 68.9 63.8-73.7

Total 1036 508 49.0 46-52

75

EXPERIMENT -1

Table 3.4: Prevalence of Mastitis on basis of Breed in Lactating Buffaloes

Districts Breed Total examined Mastitic Prevalence

(%) 95% CI

Lahore

Nili Ravi 425 247 58.1 53.4-62.7

Kundhi 116 58 50.0 41- 59

Non-descriptive 57 27 47.4 34.70-60.3

Total 598 332 55.5 51.5-59.4

Bhimber

Nili Ravi 311 137 44.1 38.6-49.6

Kundhi 99 28 28.3 20-37.4

Non-descriptive 28 11 39.3 22.7-58.1

Total 438 176 40.2 35.7-44.9

Overall

Nili Ravi 736 384 52.2 48.6-55.8

Kundhi 215 86 40.0 33.6-46.7

Non-descriptive 85 38 44.7 34.4-55.3

Total 1036 508 49.0 46-52

76

EXPERIMENT -1

Table 3.5: Prevalence of Mastitis on basis of Parity in Lactating Buffaloes

Districts Parity Total examined Mastitic Prevalence

(%) 95% CI

Lahore

1 Parity 81 26 32.1 24.6-41.7

2-5 Parity 282 153 54.2 49.3-59.1

6> Parity 235 153 65.1 59.8-70.1

Total 598 332 55.5 52.2-58.8

Bhimber

1 Parity 57 10 17.5 10.4-27.1

2-5 Parity 226 93 41.1 35.8-46.6

6> Parity 155 73 47.1 40.6-53.7

Total 438 176 40.2 36.4-44.1

Overall

1 Parity 138 36 26.1 19.3.33.9

2-5 Parity 508 246 48.4 44.1-52.8

6> Parity 390 226 58.0 53-62.8

Total 1036 508 49.0 46-52

77

EXPERIMENT -1

Table 3.6: Prevalence of Mastitis on basis of Stage of Lactation in Lactating Buffaloes

Districts Lactation stage

Total examined Mastitic Prevalence

(%) 95% CI

Lahore

Early 135 63 46.7 38.1-55.4

Mid 276 174 63.0 57.2-68.6

Late 187 95 50.8 43.6-57.9

Total 598 332 55.5 51.5-59.4

Bhimber

Early 97 38 39.2 29.8-49.1

Mid 195 87 44.6 37.7-51.6

Late 146 51 34.9 27.5-42.9

Total 438 176 40.2 35.5-44.8

Overall

Early 232 101 43.5 37.2-49.9

Mid 471 261 55.4 50.9-59.9

Late 333 146 43.8 38.6-49.2

Total 1036 508 49.0 46-52

78

EXPERIMENT -1

Table 3.7: Quarter wise Prevalence of Mastitis in Lactating Buffaloes

Districts Quarter Total Quarter examined

Mastitic Quarter

Prevalence (%) 95% CI

Lahore

LF 598 66 11.0 8.7-13.7

LR 598 184 30.8 27.2-34.6

RF 598 63 10.5 8.2-13.1

RR 598 136 22.7 19.5-26.2

Bhimber

LF 438 31 7.0 4.9-9.8

LR 438 106 24.2 20.4-28.4

RF 438 22 5.0 3.2-7.4

RR 438 65 14 11.7-18.4

Overall

LF 1036 97 9.4 7.7-11.2

LR 1036 290 28.0 25.3-30.7

RF 1036 85 8.2 6.6-10.1

RR 1036 201 19.4 17.1-21.9

79

EXPERIMENT -1

Table 3.8: Prevalence of Mastitis in Lactating Buffaloes having Mastitis in 1, 2, 3 and 4 Quarters

Districts No. of Quarter Total buffalo examined Total positive Prevalence (%)

Lahore

One quarter 598 252 42.1

Two quarter 598 43 7.2

Three quarter 598 32 5.4

Four quarter 598 05 0.8

Bhimber





Overall





80

EXPERIMENT -1

Table 3.9: Univariable Analysis for Association of different Risk Factors with Mastitis *Significant: 𝑃𝑃< 0.25

Risk Factors Level Total examined +Ve No. -Ve No. OR 95% CI P-value

Area Lahore 598 332 266

0.54 .42- .69 <0.001* Bhimber 438 176 262

Herd Size

Small (5-10) 102 41 61 Ref. - -

Medium (11-30) 400 186 214 1.29 .83-2.01 0.25*

Large (> 31) 534 281 256 1.65 1.07-2.54 0.02*

Breed Nili Ravi 736 384 352 Ref. - -

Kundhi 215 86 129 0.61 .45-0.83 0.002*

Non-descriptive

85 38 47 0.74 .47-1.16 0.193*

Age 3-5 year 382 146 236 Ref. - -

6-8 year 316 129 187 1.12 0.82-1.51 0.48 >9 338 233 105 3.59 2.63-4.89 <0.001*

Parity 1st 138 36 102 Ref. - -

2 to 5 508 246 262 1.64 1.01-2.65 0.044* >6 390 226 164 3.96 2.36-6.64 <0.001*

Stage of

Lactation

Early 232 101 131 Ref. - -

Mid 471 261 210 1.61 1.17-2.21 0.003* Late 333 146 187 1.01 .72-1.42 0.942

Reproductive

Disorder

No 802 361 441 2.064 1.53-2.78 0.000* Yes 234 147 87

81

EXPERIMENT -1

Table 3.10: Univariable Analysis for Association of different Risk Factors with Mastitis

*Significant: 𝑃𝑃< 0.25

Risk Factors Level Total examined +Ve No. -Ve No. OR 95% CI P-value

Teat shape

Funnel 227 116 111 Ref. - -

Round 316 149 167 0.85 0.61-1.2 0.364

Flate 493 243 250 1.06 0.75-1.49 0.125*

Udder shape Normal 309 133 176

0.709 .543-.927 0.012* Pendolous 727 375 352

Previous mastitis No 857 374 483

3.846 2.67-5.53 .000* Yes 179 134 45

Ease of milking Soft 941 421 520

13.432 6.43-28.02 .000* Hard 95 87 08

Udder odema No 996 471 525

13.747 4.21-44.87 .000* Yes 40 37 3

Lesion on udder

and teat

No 943 423 520 13.061 6.25-27.26 .000*

Yes 93 85 08

Swelling on

udder and teat

No 940 421 519 11.917 5.92-23.95 .000*

Yes 96 87 09

82

EXPERIMENT -1

Table 3.11: Univariable Analysis for Association of different Risk Factors with Mastitis


Risk Factors Level Total

examined +Ve No. -Ve No. OR 95% CI P-value

Condition of

floor

Concrete 282 128 154 1.222

.929-

1.609 0.086*

Soiled 754 380 374

Frequency of

dung removal

Once in a day 922 459 463 1.315

.888-

1.947 0.171*

Twice in a day 114 49 65

Source of

water

Pond 331 168 163 Ref. - -

Canal 554 255 299 0.86 .62-1.19 0.357

Sub-surface 151 85 66 1.25 .85-1.1 0.259

Exposure to

FMD

No 870 411 459 1.57 1.12-2.19 0.008*

Yes 166 97 69

Udder wash No 704 330 374

0.763 .588- .922 0.043* Yes 332 178 154

Teat dipping Yes 171 96 75

1.407 1.01-1.95 0.042* No 865 412 453

Milking

technique

Complete

hand 300 130 170

1.381 1.05-1.80 0.019*

Knuckling 736 378 358

Tick

infestation

No 498 208 290 1.757 1.37-2.24 .000*

Yes 538 300 238

No. of animal

milked by

same milker

G1 (1-5) 180 97 83 Ref. - -

G2 (6-10) 686 327 359 0.5963 - 0.408

G3 (> 11 170 84 86 0.7580 - 0.485

83

EXPERIMENT -1

Table 3.12: Multivariable Analysis of Potential Risk Factors with Prevalence of Mastitis


Potential risk

factors

Level Regression

Coefficient

Standard

error

OR 95% CI P-value

(Wald)

P-value

(LR)

Age 3-5 year Ref. < 0.001*

6-8 year -0.6274 0.2349 0.53 0.34-0.85 0.008

<9

0.7963 0.2214 2.22 1.44-3.42 < 0.001

Breed Nili Ravi Ref. 0.008*

Kundhi -0.6162 0.2068 0.54 0.36-0.81 0.003

Non-

descriptive

-0.3717 0.2957 0.69 0.39-1.23 0.209

Parity 1st Ref. < 0.001*

2-5 0.8927 0.3150 2.44 1.32-4.53 0.005

>6 1.8057 0.3310 6.08 3.18-11.64 < 0.001

Lactation stage Early Ref. 0.01*

Mid 0.6156 0.2101 1.85 1.23-2.79 0.003

Late 0.2972 0.2185 1.35 0.88-2.07 0.174

Previous exposure

to mastitis

No Ref. < 0.001*

Yes 1.2357 0.2418 3.44 2.14-5.53 < 0.001

Exposure to FMD No Ref. 0.022*

Yes 0.5111 0.2229 1.67 1.08-2.58 0.022

Lesion on

uddder/teat

No Ref. < 0.001*

Yes 1.9225 0.4404 6.84 2.88-16.21 < 0.001

Udder odema No Ref. 0.009*

Yes 1.5940 0.6986 4.92 1.25-19.36 0.023

Tick infestation No Ref. < 0.001*

yes 1.0394 0.1788 2.83 1.99-4.01 < 0.001

Ease of milking Hard Ref. < 0.001*

Soft 2.6727 0.4138 14.48 6.43-32.58 < 0.001

Teat Dipping No Ref. 0.033*

Yes 0.5656 0.2666 1.76 1.04-2.97 0.034

Area Lahore Ref. 0.017*

Bhimber -0.4346 0.1829 0.65 0.45-0.93 0.017

84

EXPERIMENT -1

DISCUSSION

Prevalence of Clinical and Subclinical

In the present study the overall prevalence of mastitis was 49.0%. Among these 49.0%

clinical mastitis was 10.2%, while subclinical mastitis was 38.8%. The finding of previously study

conducted in Khyber Pakhtunkhwa province of Pakistan by Ali et al. (2014), who reported that

overall prevalence of clinical and subclinical mastitis was 13.6% and 41.8 %, respectively which

is close to the present study. Prevalence of mastitis in present study agreed with a prevalence of

mastitis from previous studies carried in Sudan by Nigo et al. (2013), Junaidu et al. (2011) in

Nigeria and Hashemi et al. (2011) in Iran. The findings in the present study are in accordance to

Ali (2009) who reported prevalence of clinical mastitis was 14.0% to 31.75% in Faisalabad,

Pakistan, while, the finding of some previous studies (Mustafa et al. 2014: Bilal et al. 2004) who

reported the prevalence of mastitis in buffaloes was more than 40.0% in Lahore and Faisalabad,

Pakistan, respectively.

The results of the present study about the prevalence of subclinical mastitis (38.0%) are in

accordance with previous studies by Ayano et al. (2013) in Ethiopia, Nigo et al. (2013) in Sudan,

Hashmi and Muneer (1981) in Lahore, Pakistan, Anwar and Chaudhry (1983) who reported

prevalence of subclinical mastitis was 31.0% to 47.0% in cattle and buffaloes in Lahore, Pakistan.

The prevalence of subclinical mastitis was reported by Mustafa et al. (2014) as 59.6%, which was

higher than present study. However, the prevalence of subclinical mastitis in this study is relatively

higher than Sarkar et al. (2013) and Rahman et al. (2009) in Bangladesh who reported prevalence

of subclinical mastitis as 9.0% to 20.0%. In present study significant statistical association of

mastitis with locality (p-value =.000), is supported by a previous two studies Nigo et al. (2013) in

Sudan and Biffa et al. (2005) in Ethiopia, p-value =.003 and p-value=.001, respectively.

85

EXPERIMENT -1

Area wise prevalence of mastitis

In the present study, the prevalence of mastitis was different in both localities 55.5% and 40.2%

in Lahore and Bhimber, respectively. Our finding is supported by previous studies conducted by

Nigo et al. (2013) in Sudan and Biffa et al. (2005) in Ethopia who reported that the prevalence of

mastitis was different in different localities. Basically, mastitis is a complex disease involving

interactions of several factors, mainly of management, environment, and other factors relating to

animal and causative organisms. Its prevalence is expected to vary from place to place. In this

study, the prevalence of mastitis varies from previous studies. It might be due to different

geographical locations, animal genetics, milking methods and management practices that applied

in farms in different localities. This difference in prevalence of mastitis in area wise may be due

to different management practices and environmental contamination.

Various studies has been conducted on prevalence of mastitis and with the passage of time

prevalence of mastitis is increases. Previously a study was conducted in 2011 in district Lahore

and prevalence of mastitis was recorded in buffalo as 40.7% (Ali et al. 2011). The present study

shows, trend of mastitis in increases in Lahore. Increased prevalence is related with increased

buffalo population and poor management practices on dairy farms. The prevalence of mastitis was

high in district Lahore as compared to district Bhimber. The reason behind could be geographical

location. The district Lahore have large population as compared to District Bhimber. District

Lahore is an urban area and dairy farms are located close to urban population and industrial area

and dairy farms are in form of large size population colonized as compared to district Bhimber.

Quarter wise prevalence

In our study, quarter level prevalence was recorded (16.2%) while district wise it was 18.17%

and 12.9%, Lahore and Bhimber, respectively. The quarter wise prevalence of mastitis among LF,

86

EXPERIMENT -1

RF, LR, and RR was recorded at 9.4%, 28.0%, 8.2% and 19.4%, respectively. The mastitis was

higher in hind quarters as comparable to forequarters. Results of the present study were in line

with previous studies of Bilal and Muhammad (2004), Nigo et al. (2013), Gebrekrustos et al.

(2012), Shari et al. (2005) and Chishty et al. (2007) who reported that in hindquarters prevalence

of mastitis was higher than that of front quarters. Single quarter involvement was seen in maximum

number of animals and this is congruent with the finding of Ali (2009) and Hussain et al. (2013)

who reported that single quarter involvement was high and very rare involvement of the all quarters.

In the present study quarter wise prevalence of mastitis showed that highest prevalence was in

single and two quarters, which were in accordance to Iqbal and Siddique (2004), Mahantesh et al.

(2014) who reported that mastitis involvement was more in a single quarter (52.7%), Similarly

Singh and Shankar have recorded higher incidence of mastitis in a single quarter (17.4%), as

compared to two (2.6%), three (0.3%), and four quarters (2.7%). The present study was in line to

Ali et al. (2014), Mustafa et al. (2014), Hussain et al. (2013), Bilal et al. (2004) who reported that

prevalence of mastitis was higher in rear quarters than in fore quarters in buffaloes. Bilal and

Muhammad (2004) reported a higher incidence in hind quarters (63.1%) and forequarters (36.8%)

in buffaloes. Results of the present study are in accordance with previous studies (Egan and

Meancy1987) who reported that the higher prevalence in left rear quarter (34.0%) followed by the

right front (28.0%), right rate (21.8%) and left front (15.3%). Further, among hind quarters, left

hind quarters were found to be more susceptible to infection. The prevalence of mastitis in left rear

quarters was higher than in other quarters. The possible explanation about the left rear quarters

may be due to practices adopted by farmers. In Pakistan, the farmers, mostly milked the buffaloes

from the left side. When milker milked the right rear quarter his hand touches the left quarter

continuously. If the milker’s hand is contaminated it can transmit the infectious to the left rear

87

EXPERIMENT -1

quarter. In our view, buffalo hind quarters are large size and have high milk production as

compared to front quarters. The hind quarters are more exposed to dirt when they lie down on the

floor as well as they are more contaminated with fecal materials. It may be due to reasons that

unhygienic conditions of the legs and presence of contaminated dung can help in the occurrence

of mastitis. Also, they are in direct touch with the hind limbs at milking time. The difference in

quarter wise prevalence of mastitis is probably due to the fact that predisposing factors like teat

size, injury, defective sphincters, and so forth could vary from quarter to quarter.

Previous exposure to Mastitis

In our study previous exposure of mastitis was statistically significant (p<. 001) with a

prevalence of mastitis having OR 3.84 at 95% CI of 2.67-5.53) by univariable analysis. In

multivariable analysis, it was highly significant (p<. 001) having OR 3.44 of 2.14-5.53. The

present study significant association (p<.000) of previous exposure to mastitis was in accordance

with previous studies (Abera et al. 2012; Nigo et al. 2013; Biffa et al. 2005) who reported a

significant association (p<.000) of previous exposure to mastitis with a prevalence of mastitis.

Elbably et al. (2013) described that previous exposure to mastitis was at greatest risk of being re-

infected, and stress factors could put the glands at greater risk of re-infection. In our study, the

dairy animals with previous history of mastitis are three times more susceptible to mastitis as

described by Biffa et al. (2005) who reported that dairy animals with a history of previous mastitis

are two to five times more susceptible to mastitis than those without a history of previous mastitis.

Previously affected dairy animals are at greater risk of being re-infected, suggesting that repeated

challenges of the mammary tissues with microorganisms coupled with other stress factors could

put the glands at greater risks of re-infection. Findings of the present study are in line with previous

studies (Erskine et al. 2002; Lents et al. 2002) who reported that treatment of clinical mastitis may

88

EXPERIMENT -1

suppress the clinical signs, but infective agents are not completely eliminated and infection may

remain in subclinical form.

Herd size wise distribution of mastitis

In the present study, the prevalence of mastitis was increased as the herd size increased.

These findings are in accordance to Ali et al. (2014), Nigo et al. (2013), Kivaria et al. (2013) and

Islam et al. (2010) who reported that the prevalence of mastitis was high in large size herds as

compared to small size herds. In the univariable analysis, the large herd size was significantly (p<

0.02, having OR 1.65 at 95% CI of 1.07-2.54) associated with prevalence of mastitis which is in

accordance to Ali et al. (2014), Kivaria et al. (2013), Nigo et al. (2013) and Islam et al. (2010)

who reported significant (p< 0.05) association of large herd's size with a prevalence of mastitis.


In the present study, the prevalence of mastitis was in G1 (3-5 years) G2 (6-8 years) D3 (9

and above), 38.2%, 40.8% and 68.9%, respectively. It has been observed from the present results

that prevalence of mastitis increased with increase in age. Findings of the present study are in line

to previous study conducted by Ali et al. (2014), Ali (2009), Ayano et al. (2013), Kurjogi et al.

(2014), Naghmana et al. (1984), Biffa et al. (2005) and Rasool et al. (1985) who reported that rate

of mastitis increase with age. Similarly, Bhikane et al. (2002), Kumar and Sharma (2002) and

Elbably et al. (2013) reported the prevalence of mastitis in the age of 9 years old was higher than

younger animals. The univariable analysis shows that age wise was mastitis is highly significant

(p< 0.000). The logistic regression showed in final Step that it age group 6-8 years was highly

significant (p< 0.000) with OR. 2. 22 (1.44-3.43). In present results, age was shown significantly

(p<0.000) associated with prevalence of mastitis which is close to previous study conducted by

Makibib et al. (2010) who reported that age was significant (p < 0.05) associated with prevalence

89

EXPERIMENT -1

of mastitis. This study agreed that increase in prevalence rates with the advancing age may be

due to gradual suppression of the immune system of the body and structural changes in the udder

and teats. This higher prevalence at this age might be due to decreased immunity of dairy animals

and resistance of bacteria to antibiotics that were indiscriminately used for the treatment of mastitis

during previous infections.


In the present study it has been observed that the prevalence of mastitis increases as the

parity number increases. The prevalence of mastitis continuously increased with increase in parity

number. Our findings are in line with the finding of Biffa et al. (2005), Ali et al. 2014 and Chishty

et al. (2007), who reported prevalence of mastitis increased with parity number. The present study

reveals parity numbers were highly significant (p< 0.000, OR 16.43 having 95% CI of 5.91-45.68)

with a prevalence of mastitis and these findings are similar to finding of previous studies (Elbably

et al. 2013; Biffa et al. 2005; Ali, 2009) who reported parity has a significant association with the

prevalence of mastitis. This increase in mastitis could be due to increasing ease of penetration of

teat duct by a pathogen and accumulation of previous infection as it was confirmed by Tadesse

and Chanie (2012) that old dairy animals especially after four calving are more prone to mastitis.


In the present study, it has been observed that the prevalence of mastitis was high in mid

lactation as compared to early and late stage of lactation. The present study finding is in line with

Breen et al. (2009); Almaw et al. (2007) and Abera et al. (2012) who reported prevalence of

mastitis was higher in mid lactation than early and late stage of lactation. In our study, the mid

stage of lactation was significantly (p<.003) associated with prevalence of mastitis when

compared, having OR 1.61 at 95% CI of 1.17- 2.21. Regarding stage of lactation current results

90

EXPERIMENT -1

agreed with the findings of Hussain et al. (2013), Almaw et al. (2007) and Abera et al. (2012) who

reported that the stage of lactation was significantly (P-value 0.01) associated with prevalence of

mastitis. This may be due to high milk production in mid lactation, incomplete milking,

continuously milking for a long time, and putting pressure on a teat, changes in both immune

function and nonspecific host defense mechanism.

Udder Shape

In the present study the prevalence of mastitis was higher in pendulous udder (51.6%)

rather than normal udder (43.0%) respectively. The relationship between udder shape and

prevalence of mastitis was significant (P<0.012). The present studies were similar to previous

studies conducted by Ali (2009), Compton et al. (2008), Breen et al. (2009) and Hussain et al.

(2013) that mastitis was higher in pendulous udder than normal udder. Our univariable analysis is

close to Sarkar et al. (2013) and Ali (2009) who reported that pendulous type of udder had

significant (p<0.05) association with prevalence of mastitis and pendulous udders because

pendulous udder sweep the ground all the time that facilitate ascending entry of mastitic pathogens.

Additionally, the pendulous type of udder does not wear well and hanging down due to bigger

size, and it is more likely to become injured than an udder held up close to the body. It might be

due to the reason that, pendulous udder get injuries and abrasion which may facilitate pathogens

to grow.

Teat Shape

The overall prevalence of mastitis funnels, round and flat shaped teats was recorded 51.1%,

47.2% and 49.3%, respectively. In the present study, mastitis prevalence was high in flat and

round teat than funnel shaped teat. In the present study, flat teats were associated (p<0.125) with

a prevalence of mastitis in funnel shaped teats when compared having OR 1.06 at 95% CI of 0.75-

91

EXPERIMENT -1

1.49. The results of the present study are in accordance to previous studies conducted by Ali (2009)

who reported a significant association of teat shape with a prevalence of mastitis. The reasons for

flat shaped teat may have more chances of exposure to environmental contamination and injuries.

Lesion on udder and teat

The overall prevalence of mastitis in the present study, on the basis of lesion on udder and

teat was 18.3%. Similarly, Matios et al. (2009) and Chishty et al. (2007) reported teat injuries and

lesions predispose the udder to infection that might be the reason of higher prevalence of mastitis

in injured teats. Furthermore, it was reported by Uddin et al. (2009) and Sori et al. (2005) that teat

injury provides a medium for the growth of the pathogenic bacteria, which affect the udder and in

case of injuries, the risk of an infection increases. Results of the present study are in accordance

to Elbably et al. (2013) and Bekele and Molla (2001) who suggested that heavy tick infestation

and teat lesions might be responsible for udder infection and also lead to udder abnormalities and

deformities of teats. The lesions on udder and teat were highly significant (p<.000, OR 13.06 at

95% CI of 6.25-27.26) on the prevalence of mastitis, same as in multivariable analysis, it was

highly significant (p<. 001, OR 6.84 at 95% CI of 2.88-16.21) and these findings were in

accordance to Biffa et al. (2005) and Ali (2009) who reported mastitis was significantly associated

with udder/teat injuries. In Pakistan, as part of the traditional dairy husbandry practices, calves are

kept away from their dams over a long period of time and are only allowed to suckle for a short

duration and inadequate milk supply, calves suck vigorously, inducing teat injuries and hence

exposing dams to teat injuries.

Udder edema

The udder edema was strongly associated (p<. 000) with the prevalence of mastitis having

OR 13.747 while in logistic regression it was significant p<0.02 to OR 4.92 (1.25-19.36). Findings

92

EXPERIMENT -1

of the present study are in line with Ali (2009) who reported a highly significant association

between mastitis status and predisposing factors like udder edema and teat edema.

Milking Techniques

The prevalence of mastitis in animals milked by knuckling was high (51.3%) as compared

with complete hand milking (25.6%). Milking method, knuckling was found to be highly

associated (p>0.019) with the prevalence of mastitis by univariable analysis as compared with

complete hand milking (OR 1.38; 95% CI, 1.05-1.80). The present study is in accordance to

Chishty et al. (2007) and Ali, (2009) who reported that there is a significant association between

knuckling milking and prevalence of mastitis in buffaloes. This high prevalence of mastitis in

buffaloes milked by folding thumb might be due to trauma inflicted by knuckling milking. The

use of knuckling technique predisposed the mastitis. Moreover, the use of folded thumb the teat

cistern is injured and has often been considered to be conducive to the development of adverse

effects of the teat canal.

Ease of milking

The soft milking was highly significant (p<.000) when compared with hard milking having

OR 13.43 at 95% CI of 6.43-28.02. In logistic regression it was highly significant (p<.001) with

OR 14.48 at 95% CI of 6.43-32.58). Similarly, in previous studies (Chishty et al. 2007 and Ali,

2009) who reported highly significant association between the soft milking and prevalence of

mastitis. This high prevalence of mastitis in soft milking might be due to loose sphincter of teat

and infectious agents can easily enter and grow in teat canal and udder.

93

EXPERIMENT -1

Teat dipping

The teat dipping was significantly (p< .042, OR 1.40) associated with prevalence of

mastitis. Present study agreed with Hillerton et al. (1993) and Hu et al. (1990) who reported

mastitis prevalence can be minimized by using teat dipping before and after milking.

Number of animals milked by same milker

In the present study, the prevalence of mastitis was recorded 53.9%, 47.7% and 49.4%

in G1, G2 and G3, respectively. It has been observed that the prevalence of mastitis increases

with increasing number of animals milked by same milker. In general, mastitis was increased as

the number of animals milked by same milker increased, but it had non-significant effect on

prevalence of mastitis. The present study findings are accorded with Oliver, (1975) and Ali, (2009)

who reported the prevalence of mastitis increases with increasing number of animals milked by

same milker. In developing countries like Pakistan, dairy animals are milked mostly by the hand

milking method and milk is often used as a lubricant during milking and milker’s hands are often

heavily soiled with milk during this process. It is predominantly caused by contagious mastitis

pathogens which are usually transmitted at the time of milking. Infectious agents of mastitis may

be transmitted from infected to uninfected animals through milkers hands, especially owning to

the proclivity of using milk foam in the milking as a lubricant.


The prevalence of mastitis was recorded highest in dung is removed once in a day, 49.8%

than twice in a day (43.0%). The univariable analysis showed that a frequency of dung removal

has a significant effects on prevalence of mastitis (P<0.171, OR 1.31 at 95% CI of 0.88-1.94).

Similar results by Carrol (1977) that with once in a day cleaning of sheds, the incidence of mastitis

in buffaloes was 21.1%, whereas when cleaning of sheds was done twice a day, 15.8% of animals

94

EXPERIMENT -1

developed mastitis. In the present study, findings have a significant effect on mastitis same as to

Nago et al. (2013) and Ali (2009). Environmental mastitis pathogens with reservoirs in dung, floor,

bedding etc. Are only occasionally associated with mastitis. Therefore, mastitis control practices

directed against environmental mastitis pathogens are not likely to be as potentially rewarding as

practices aimed at controlling contagious pathogens.

Condition of floor

The prevalence of mastitis was higher on soiled floor, 50.4% than concrete floor 45.4%.

The univariable analysis showed that condition of floor has no significant effect (p<.086) with

mastitis. Similarly, Ali (2009) and Mukabib et al. (2010) reported non-significant association

condition of floor with a prevalence of mastitis in buffaloes. In Pakistan mostly dairy animals are

managed on soiled floor. In soiled floor buffaloes udders and legs are not properly clean before

milking and infection can easily transmit at milking time from diseased to healthy animal.

Source of water

The prevalence of mastitis was 50.8%, 46.0% and 56.3% pond, canal, subsurface water,

respectively. In pond and canal the prevalence of mastitis was higher as compare to subsurface

water. Similarly, previous studies by Nigo et al. (2013), Kivaria et al. (2004) who reported that

river and pond mostly have stagnant water where microorganism can be multiplied and be

transmitted from infected animals to non-infected animals. The source of water has no significant

effect on prevalence of mastitis.

Tick infestation

The prevalence of mastitis on basis of tick infestation was 55.8% in exposed animals.

High tick infestation might have contributed to the occurrence of injuries which causes mastitis.

95

EXPERIMENT -1

Tick infestation in this study showed a significant association with mastitis (p<.000), similar to

Tolosa et al. 2013 and Biffa et al. (2005) who reported a significant association (P <0.01) with a

prevalence of mastitis. The present study agreed with previous studies by Almaw et al. (2008),

Bekele and Molla (2001) and Elbably et al. (2013) who reported that ticks transmit the mastitis

widely throughout the world and ticks left small abrasion and lesion on teat and udder skin which

may let the ease of organisms penetration inside udder.


The prevalence of mastitis on the basis of reproductive disorder was recorded 62.8%

which were highly significant (p<.000) with mastitis. Ali (2009) determined a significant

association with the reproductive disorders and mastitis prevalence in buffaloes. The association

between prevalence of mastitis and reproductive disorders was in line with the findings reported

previously by Esmatand Badr (1996) and Ali, (2009) who reported that reproductive disorders

were three times more likely to develop mastitis. Dairy Buffaloes with the retained placenta were

likely to develop mastitis. According to Bilal (1999) dairy buffaloes having retained placenta,

metritis, vaginal prolapses and dystocia at calving are risk factors of mastitis.

Exposure to FMD

In present study exposure to FMD in both univariable and multivariable analysis has significant

effect on mastitis. Diseases like FMD and pox are particularly known to predispose mastitis in

cattle and buffaloes. According to Radostits et al. (2000) observation, foot and mouth disease,

vesicles may appear on the teat as to the involvement of the teat orifice to mastitis.

In conclusion, dairy buffaloes should be regularly screened and monitored for prevention

and control of mastitis. The husbandry management practices should be kept in consideration

while combating mastitis. Basically mastitis is interaction effects of various management practices,

96

EXPERIMENT -1

such as the interaction of teat dipping before and after milking and proper sanitation of the farm

have significant effects on mastitis prevention. The control strategies should be based on the

improvement of management practices since these factors predispose animals to mastitis. The

study showed that various risk factors are significantly associated with the prevalence of mastitis,

which need to be considered in the control of the disease. Particularly, special importance should

be given to prevention and control of subclinical mastitis. Knowledge of the potential risk factors

is vital for the control of bovine mastitis. In general, mastitis can be prevented by implementation

of various hygienic and preventive measures.

REFERENCES

Abera M, Elias B, Aragaw K, Denberga Y, Amenu K, Sheferaw D. 2012. Major causes of mastitis

and associated risk factors in smallholder dairy cows in Shashemene, southern Ethiopia.

African J Agri Res. 7(24): 3513-3518.

Ali T, Rahman A, Qureshi MS, Hussain MT, Khan MS, Uddin S, Han B. 2014. Effect of

management practices and animal age on incidence of mastitis in Nili Ravi buffaloes. Trop

Anim Health Prod. 46(7): 1279-1285.

Ali MA, Ahmad MD, Muhammad K, Anjum AA. (2011). Prevalence of sub clinical mastitis in

dairy buffaloes of Punjab, Pakistan. Pakistan J Anim Plant Sci. 21(3): 477-480.

Ali L. 2009. Epidemiology of mastitis in dairy buffalo and cow in Tehsil Samundri of district

Faisalabad. University of Agriculture Faisalabad.

Almaw G, Zerihun A, Asfaw Y. 2007. Bovine mastitis and its association with selected risk factors

in smallholder dairy farms in and around Bahir Dar, Ethiopia. Tropical animal health and

production. 40(6): 427-432.

97

EXPERIMENT -1

Andrew S, Moyes K, Borm A, Fox L, Leslie K, Hogan J, Oliver S, Schukken Y, Owens W,

Norman C. 2009. Factors associated with the risk of antibiotic residues and intramammary

pathogen presence in milk from heifers administered prepartum intramammary antibiotic

therapy. Vet Microb. 134(1): 150-156.

Anonymous, 2006. All Pakistan livestock senses. Pakistan Bureau of Statistics. Govt. of Pakistan.

18-20.

Anwar M, Chaudhary A. 1983. Subclinical mastitis in buffaloes around Lahore. Pak Vet J. 3(3):

142-144.

Ayano A, Hiriko F, Simyalew A, Yohannes A. 2013. Prevalence of subclinical mastitis in lactating

cows in selected commercial dairy farms of Holeta district. J Vet Med Anim Healt. 5(3):

67-72.

Bhikane AU, Anantwar LU, Yadav GU, Markandeya NM, Deshmukh YT. 2002. Proceedings

Indian Veterinary Congress, IX: Annual Conference of Indian Association for the

Advancement of Veterinary Research (IAAVR). 3 Round Table on Mastitis. P. 133–134,

Barnouin J, Bord S, Bazin S, Chassagne M. 2005. Dairy management practices associated with

incidence rate of clinical mastitis in low somatic cell score herds in France. J Dairy sci.

88(10): 3700-3709.

Bekele T, Molla B. 2001. Mastitis in lactating camels (Camelusdromedarius) in Afar Region,

north-eastern Ethiopia. Berliner und Munchener Tierarztliche Wochenschrift. 114(6): 169-

172.

Biffa D, Debela E, Beyene F. 2004. Prevalence and risk factors of mastitis in lactating dairy cows

in Southern Ethiopia. Inter J Appl Res Vet Med. 3(3): 189-198.

98

EXPERIMENT -1

Bilal M, Iqbal M, Muhammad G, Avais M, Sajid M. 2004. Factors affecting the prevalence of

clinical mastitis in buffaloes around Faisalabad district (Pakistan). Int J Agri Biol. 6(1):

185-187

Bludau MJ, Maeschli A, Leiber F, Steiner A, Klocke P. 2014. Mastitis in dairy heifers: Prevalence

and risk factors. The Vet J. 202(3): 566-572.

Breen JE, Green MJ, Bradley AJ. 2009. Quarter and cow risk factors associated with the

occurrence of clinical mastitis in dairy cows in the United Kingdom. J Dairy Sci. 92(6):

2551-2561.

Carroll EJ. 1977. Environmental factors in bovine mastitis. J Am Vet Med Assoc. 170: 1160-1163.

Chishty M, Arshad M, Avais M, Ijaz M. 2007. Cross sectional epidemiological studies on mastitis

in cattle and buffaloes of tehsil Gojra Pakistan. Buff Bull. 26: 50-55.

Compton C, Scott M. 2008.Heifer mastitis-a review of recent studies. Proceedings of the society

of dairy cattle veterinarians of the New Zealand Veterinary Association. 77-90.

Donovan D, Kerr DE, Wall RJ. 2005. Engineering disease resistant cattle, Transgenic Research,

14, 563-567.

Egan J, Meaney W. 1987. Corynebacterium pyogenes mastitis in spring-calving dairy-cows and

heifers. Irish Vet J. 41(6): 286-290.

Elbably M, Emeash H, Asmaa N. 2011. Risk Factors Associated with Mastitis Occurrence in Dairy

Herds in Benisuef, Egypt. World Vet J. 3(1): 05-10.

Esmat M, Badr A. 1996. Some studies on mastitis-metritis agalactia syndrome in cows. Veterinary

Medical J Giza. 44 (2): 303-309.

99

EXPERIMENT -1

Erskine R, Bartlett P, VanLente J, Phipps C. 2002. Efficacy of systemic ceftiofur as a therapy for

severe clinical mastitis in dairy cattle. J Dairy Sci. 85(10): 2571-2575.

Fekadu K. 1995. Survey on the prevalence of bovine mastitis and the predominant causative agents

in Chaffa valley. Proceedings of the 9th Conference of Ethiopian Veterinary Association:

Addis Ababa, Ethiopia. 101–111.

Gebrekrustos M, Aferaa B, Tassew H. 2012. Prevalence of mastitis and its relationship with risk

factors in smallholder dairy farms in and around Mekelle. Red Vet. 13(9): 1-25

Hashemi M, Kafi M, Safdarian M. 2011. The prevalence of clinical and subclinical mastitis in

dairy cows in the central region of Fars province, south of Iran. Iran J Vet Res. 12(3): 236-

241.

Hashmi H, Muneer M. 1981. Subclinical mastitis in buffaloes at Lahore. Pak Vet J. 1(4): 164-166.

Hillerton JE, Shearn MF, Teverson RM, Langridge S, Booth JM. 1993. Effect of pre-milking teat

dipping on clinical mastitis on dairy farms in England. J Dairy Res. 60(01): 31-41.

Hortet P, Beaudeau F, Seegers H, Fourichon C. 1999. Reduction in milk yield associated with

somatic cell counts up to 600 000 cells/mL in French Holstein cows without clinical

mastitis. Live Prod Sci. 61(1): 33-42.

Hu S, Fang W, Lu H, Jiang C, Zhu P, Ye J, Ye D, Yan H. 1990. Effect of teat dipping and dry cow

therapy on mastitis in a commercial dairy herd in China. Preventive Vet Med. 10(1): 91-

96.

Hussain M, Malik MA, Fatima Z, Yousaf M. 2005. Participatory surveillance of livestock diseases

in Islamabad capital territory. Inter J Agri Bio. 7: 567-570.

100

EXPERIMENT -1

Hussain R, Khan A, Javed MT, Rizvi F. 2013. Possible risk factors associated with mastitis in

indigenous cattle in Punjab, Pakistan. Pak Vet J. 32(4): 605-608.

Iqbal M, Amjed M, Khan MA, Qureshi MS, Sadique U. 2006. Comparative efficiency of some

indirect diagnostic tests for the detection of sub-clinical mastitis in cows and buffaloes. Pak

Vet J. 26(2): 73-79.

Iqbal lJ, Siddique M. 1992. Some epidemiological aspects of mastitis in cows and

biocharacterization of isolated Staphylococci. M. Sc. Thesis, Univ. Agri., Faisalabad,

Pakistan.

Islam M, Rahman A, Rony S, Islam M. 2010. Prevalence and risk factors of mastitis in lactating

dairy cows at Baghabari milk shed area of Sirajganj. Bangladesh J Vet Med. 8(2): 157-162.

Junaidu A, Salihu M, Tambuwal F, Magaji A, Jaafaru S. 2011. Prevalence of Mastitis in Lactating

Cows in some selected Commercial Dairy Farms in Sokoto Metropolis. Adv Appl Sci Res.

2(2): 290-294.

Kahir MA, Rahman AA, Rahman MS. 2008. Prevalence and risk factors of subclinical bovine

mastitis in some dairy farms of Sylhet district of Bangladesh. 31(4): 497-504.

Karimuribo ED, Fitzpatrick JL, Bell CE, Swai ES, Kambarage MD, Ogden NH, Bryant MJ, French

P. 2006. Clinical and subclinical mastitis in smallholder dairy farms in Tanzania: risk,

intervention and knowledge transfer. Preventive Vet med. 74(1): 84-98.

Kurjogi MM, Kaliwal BB. 2014. Epidemiology of bovine mastitis in cows of Dharwad district.

International Scholarly Research Notices. 1:1-9.

101

EXPERIMENT -1

Kivaria F, Noordhuizen J, Msami H. 2007. Risk factors associated with the incidence rate of

clinical mastitis in smallholder dairy cows in the Dar es Salaam region of Tanzania. Vet J.

173(3): 623-629.

Kumar R, Sharma A. 2002. Prevalence, etiology and antibiogram of mastitis in cows and buffaloes

in Hisar, Haryana. Indian J Anim Sci. 72(5): 361-363.

Lents C, Wettemann R, Paape M, Vizcarra J, Looper M, Buchanan D, Lusby K. 2002. Efficacy

of intramuscular treatment of beef cows with oxytetracycline to reduce mastitis and to

increase calf growth. J Anim Sci. 80(6): 1405-1412.

Madut NA, Gadir AEA, El-Jalii IM. 2009. Host determinants of bovine mastitis in semi-intensive

production system of Khartoum state, Sudan. J Cell and Anim Bio. 3(5): 071-077.

Mekibib B, Furgasa M, Abunna F, Megersa B, Regassa A. 2010. Bovine mastitis: prevalence, risk

factors and major pathogens in dairy farms of Holeta Town, central Ethiopia. Vet World.

3(9): 397-403.

Motie A, Ramudit S, Mohabir R. 1985. Subclinical mastitis in dairy cattle in Guyana. Tropical

animal health and production. 17(4): 245-246.

Moges N, Asfaw Y, Belihu K. 2011. A cross sectional study on the prevalence of sub clinical

mastitis and associated risk factors in and around Gondar, Northern Ethiopia. International

J of Anim Vet Advan. 3(6): 455-459.

Mungube E, Tenhagen BA, Regassa F, Kyule M, Shiferaw Y, Kassa T, Baumann M. 2005.

Reduced milk production in udder quarters with subclinical mastitis and associated

economic losses in crossbred dairy cows in Ethiopia. Trop Anim Healt Prod. 37(6): 503-

512.

102

EXPERIMENT -1

Mustafa YS, Awan FN, Zaman T. 2014. Prevalence and antibacterial susceptibility in mastitis in

buffalo and cow in district Lahore Pakistan. Buff Bull. 32(4): 312-319.

Mustafa A. 2003. Mastitis in dairy cows; Dairy cattle production 342-450A. Macdonald Campus

of Mcgill University, Faculty of Agricultural & Environmental Sciences, Department of

Animal Science.

Naghmana S. 1984. Bacteriological survey of chronic mastitis in cattle and buffaloes. M. Sc.

Thesis, UA, Faisalabad.

Nigo KLS, Abdelhamid AME, Mohamed RB. 2013 Epidemiological and Bacteriological

Investigation of Bovine Mastitis in Khartoum State-Sudan. Sudan J Sci Tech. 14(2): 1-15.

Nyman AK, Ekman T, Emanuelson U, Gustafsson A, Holtenius K, Waller KP, Sandgren CH. 2007.

Risk factors associated with the incidence of veterinary-treated clinical mastitis in Swedish

dairy herds with a high milk yield and a low prevalence of subclinical mastitis. Preventive

Vet Med. 78(2): 142-160.

Oliver J. 1975. Some problems of mastitis control in hand dairy herds. In Dodd FH, TK Griffin,

and RG Kingorill (eds). Proc. International Dairy Federation Seminar on Mastitis Control.

April 7- 11, 1975 organized by the National Institute of Research in Dairying at Reading.

188-192.

O'Reilly K, Green M, Peeler E, Fitzpatrick J, Green L. 2006. Investigation of risk factors for

clinical mastitis in British dairy herds with bulk milk somatic cell counts less than 150,000

cells/ml. Vet Rec. 158(19): 649-653.

103

EXPERIMENT -1

Radostits OM, Gay CC, Hinchcliff KW, Constable PD. 2007. Veterinary Medicine. A Textbook

of the Diseases of Cattle, Sheep, Pigs, Goats and Horses. 10th ed., Saunders Elsevier, Spain.

1045-1046.

Rahman M, Bhuiyan M, Kamal M, Shamsuddin M. 2009. Prevalence and risk factors of mastitis

in dairy cows. Bangladesh Vet. 26(2): 54-60.

Rasool G, Jabbar M, Kazmi S, Ahmed A. 1985. Incidence of sub-clinical mastitis in Nili-Ravi

buffaloes and Sahiwal cows. Pak Vet J. 5: 76-78.

Sarker SC, Parvin MS, Rahman AA, Islam MT. 2013. Prevalence and risk factors of subclinical

mastitis in lactating dairy cows in north and south regions of Bangladesh. Trop Anim Healt

and Prod. 45(5): 1171-1176.

Sori H, Zerihun A, Abdicho S. 2005. Dairy cattle mastitis in and around Sebeta, Ethiopia. J appl

Res Vet Med. 3(4): 332.

Tadesse A, Chanie M. 2012. Study on the Occurrence of Bovine Mastitis in Addis Ababa Dairy

Farms and Associated Risk Factors. Advances in Biological Research. 6 (4): 151-158.

Tolosa T, Verbeke J, Piepers S, Supré, K, De Vliegher S. 2013. Risk factors associated with

subclinical mastitis as detected by California Mastitis Test in smallholder dairy farms in

Jimma, Ethiopia using multilevel modelling. Preven Vet Med. 112(1): 68-75.

Uddin M, Kamal M, Haque M. 2009. Epidemiological study of udder and teat diseases in dairy

cows. Bangladesh J Vet Med. 7(2): 332-340.

Zadoks RN, Schukken YH. 2006. Use of molecular epidemiology in veterinary practice.

Veterinary Clinics of North America: Food Animal Practice. 22(1): 229-261.

104

EXPERIMENT-2

CHAPTER 4 EXPERIMENT-2

ANTIBIOTICS RESISTANCE AND SENSITIVITY OF STAPHYLOCOCCUS AUREUS

CAUSING MASTITIS IN BUFFALOES

ABSTRACT

The present study was conducted to determine the antibiotic sensitivity of Staphylococcus aureus

isolated from mastitis buffaloes. Clinical mastitis was diagnosed on the basis of physical

examination of the udder, teats and milk. Subclinical mastitis was diagnosed with the help of

California Mastitis Tests. Among a total of 1036 buffaloes, 508 were found to have mastitis

(49.0%). A total of 673 mastitic milk samples from different animal quarters were collected from

different livestock farms having 106 and 567 clinical and subclinical mastitis, respectively. The

prevalence of mastitis was 49.0% with 95% Confidence interval of 46.4-51.5, while prevalence

per quarter was 16.2% with 95% Confidence interval of 15.3-17.2. From these 673 milk samples,

Staphytect plus test confirmed 236 (35.0% at 95% CI 32- 38.2) isolates as coagulase positive

Staphylococcus aureus. Antibiotic sensitivity of all coagulase positive Staphylococcus aureus was

performed by disk diffusion method. The sensitivity of gentamycin, oxytetracycline,

erythromycin, kanamycin, chloramphenicol, tylosin, ciprofloxacin, doxycycline, amoxicillin,

streptomycin and trimethoprim to Staphylococcus aureus was 80.1%, 75.4%, 74.6%, 73.3%,

72.4%, 71.6%, 69.9%, 69.1%, 63.2%, 56.0% and 54.7%, respectively. While on the other hand,

the resistance pattern of gentamycin, oxytetracycline, erythromycin, kanamycin, chloramphenicol,

tylosin, ciprofloxacin, doxycycline, amoxicillin, streptomycin and trimethoprim was 11.0%,

19.9%, 15.3%, 20.8%, 20.8%, 28.4%, 22.9%, 17.3%, 36.8%, 34.3% and 45.3%, respectively.

105

EXPERIMENT-2

Keywords: Mastitis, Buffaloes, Staphylococcus aureus, California mastitis Test, Antibiotics.

INTRODUCTION

Pakistan is rich in livestock, which contributes 11.8% of total GDP with 35 million rural

populations engaged in raising livestock (Anonymous, 2014). The buffalo population in this

country is 34.7 million heads (Anonymous, 2014). Buffaloes are recognized as the second most

important milk producing species around the world (FAO, 2010). Among the various diseases

which affect milk production, mastitis is a major one (Shakoor, 2006). Mastitis is basically a

tenderness of the mammary gland and is characterized by physical, chemical and pathological

changes in the milk and glandular tissue. In the case of subclinical mastitis, milk is apparently

normal with an increase in the somatic cell count (Radostits et al. 2000). In Pakistan, mastitis

eradication may not be possible, but hygienic management practices can reduce the incidence

(Rahman et al. 2009). It has been observed by Mustafa et al. (2011) that the prevalence of mastitis,

both clinical and subclinical in buffalo was 40.4% and 59.6%, respectively.

A wide variety of organisms are associated with mastitis, however the most frequent

pathogens are bacteria, such as Staphylococcus aureus, Escherichia coli, Streptococcus

dysagalactiae, Streptococcus uberis, Streptococcus agalactiae (Radostits et al. 2000). However,

more than 50% of cases of mastitis are caused by Staphylococcus aureus (Shakoor, 2006).

Staphylococcus aureus creates pockets in the inner lining of mammary gland, which is bounded

by fibrous tissue and where antibiotics cannot respond. In Pakistan, antibiotic therapy during dry

period and teat dipping are not in practice, that’s why losses due to mastitis are higher (Arshad,

1999). The cure rate of Staphylococcus aureus mastitis was 52.0% (Sol et al. 2000).

Changes in the nature of proteins expressed by the organism, mutation or horizontal

changes in its genome may lead to bacterial resistance. It is common that with the passage of time

106

EXPERIMENT-2

bacteria may develop resistance to currently available antibacterial drugs by either new mutations

or the exchange of genetic information that is, putting old resistant genes into new hosts (Tenover,

2006). For example, methicillin resistance of Staphylococcus aureus is primarily due to changes

in the penicillin binding protein that consequently inhibit cell wall synthesis. Expression of

the different gene results in an alternative penicillin binding protein that has a low affinity for most

ß-lactam antibiotics, thereby allowing, these strains replicate in the presence of methicillin and

related antibiotics. The objectives of the present study were to determine the prevalence of mastitis

in buffalo and the evaluation of commonly used antibiotics in the treatment of mastitic buffaloes.


Sampling procedure and sampling area

A cross sectional study was carried out for investigation of the prevalence of mastitis in

dairy buffaloes. The present study was conducted in the peri-urban area of district Lahore and

district Bhimber.

Selection Criteria and Diagnosis of Mastitis

Only lactating buffaloes were incorporated in the present study and those which were

pregnant, in the dry period and heifers were excluded. Animals suffering with clinical mastitis

were diagnosed upon physical examination by the presence of clinical signs such as swelling of

the udder and teat, udder edema, udder and teat injury, abnormal milk secretion etc. Animals with

normal udder quarters were screened by California Mastitis Test (CMT) (Iqbal et al. 2006). A total

of 4144 quarters of buffaloes was examined by CMT from 1036 lactating buffaloes. Animal and

quarter wise prevalence of mastitis was recorded in a questionnaire.

107

EXPERIMENT-2

Collection, Transportation and Culturing of Samples

The recommendation of National Mastitis Council (1990) was considered for the

collection, transportation, culturing and isolates of Staphylococcus aureus. All milk samples were

collected in sterilized screw capped vials and samples transported by placing them in the crushed

ice to the Microbiology Laboratory in the Department of Epidemiology and Public Health,

University of Veterinary and Animal Sciences, Lahore. Conventional methods were used for the

isolation and identification of Staphylococcus aureus.

Staph. 110 medium was used as a selective medium for growth of Staphylococcal species.

Biochemical tests performed were Gram’s staining, catalase test, coagulase test, Mannitol salt ager

and Staphytect plus test (Oxoid UK). After confirmation, pure culture of Staphylococcus aureus

was preserved in 20% glycerol for further study.

Antibiotic Sensitivity of Staphylococcus aureus

According to the guideline of Clinical Laboratory Standard Institute (CLSI. 2005), the disk

diffusion method was performed for antibiotic sensitivity. Staphylococcus aureus ATCC 25923

was used as the quality control organism and trimethoprim, erythromycin, ciprofloxacin,

doxycycline, amoxicillin, streptomycin, tetracycline, tylosin, gentamycin, kanamycin,

chloramphenicol were used in antibiotics sensitivity testing, taking into account the previous

historical records over one decade that these antibiotics were commonly used in the treatment of

buffalo mastitis (Hussain et al. 2013; Hameed et al. 2008).

108

EXPERIMENT-2

RESULTS

A total of 673 milk samples from 1036 lactating buffaloes was collected. The animal wise

prevalence of mastitis was 49.0% with 95% confidence interval of 46.4-51.5. While the prevalence

of clinical and subclinical mastitis was 10.2% and 38.8%, respectively. The table (4.1) indicates

that, only 236 confirmed as Staphylococcus aureus by coagulase test, mannitol salt agar and

staphytect plus test. All these 236 isolates of Staphylococcus aureus were subjected to antibiotic

sensitivity test by disk diffusion method. The zones of inhibition of antibiotics were recorded with

antimicrobial zone gauge. The resistance and sensitivity of Staphylococcus aureus to antibiotics

has been shown in a number (n=236) and percentage (%) in table 4.2, respectively. The resistant

pattern of gentamycin, erythromycin, doxycycline, oxytetracycline, kanamycin, chloramphenicol,

ciprofloxacin, tylosin, streptomycin, amoxicillin and trimethoprim was 11.0%, 15.3%, 17.3%,

19.9%, 20.8%, 20.8%, 22.9%, 28.4%, 34.3% 36.8% and 45.3%, respectively (Table 4.2). The

sensitivity of gentamycin, oxytetracycline, erythromycin, kanamycin, chloramphenicol, tylosin,

ciprofloxacin, doxycycline, amoxicillin, streptomycin and trimethoprim to Staphylococcus aureus

was 80.1%, 75.4%, 74.6%, 73.3%, 72.4%, 71.6%, 69.9%, 69.1%, 63.2%, 56.0% and 54.7%,

respectively.The graphical presentation of resistance and sensitivity of Staphylococcus aureus

has been shown in figure 4.1 and 4.2.

109

EXPERIMENT-2

Table No. 4.1. Isolation and identification of Staphylococcus aureus

Gram’s Staining

Catalase test Slide coagulase test

Staphytect plus test

Mannitol salt ager test

+Ve -Ve +Ve -Ve +Ve -Ve +Ve -Ve +Ve -Ve 407 - 407 - 236 171 236 171 236 171

Table No. 4.2. Percentage (%) and numbers of Staphylococcus aureus resistant, intermediate

and sensitivity to antibiotics (n=236)

Antibiotics Resistant Intermediate Sensitive

Gentamycin 11.0% (26) 9.0% (21) 80.1% (189)

Oxytetracycline 19.9% (47) 4.6% (11) 75.4% (178)

Erythromycin 15.3% (36) 10.2% (24) 74.6% (176)

Kanamycin 20.8% (49) 6.0% (14) 73.3% (173)

Chloramphenicol 20.8% (49) 6.8% (16) 72.4% (171)

Tylosin 28.4% (67) 0.0% (0) 71.6% (169)

Ciprofloxacin 22.9% (54) 7.2% (17) 69.9% (165)

Doxycycline 17.3% (41) 13.5% (32) 69.1% (163)

Amoxicillin 36.8% (87) 0.0% (0) 63.2% (149)

Streptomycin 34.3% (81) 9.7% (23) 56% (132)

Trimethoprim 45.3% (107) 0.0% (0) 54.7% (129)

110

EXPERIMENT-2

Figure 4.1. Pattern of resistant of Staphylococcus aureus against Antibiotics.

45.3

0%

36.8

0%

34.3

0%

28.4

0%

22.9

0%

20.8

0%

20.8

0%

19.9

0%

17.3

0%

15.3

0%

11%

111

EXPERIMENT-2

Figure 4.2. Pattern of sensitivity of Staphylococcus aureus against Antibiotics.

80.1

0%

75.4

0%

74.6

0%

73.3

0%

72.4

0%

71.6

0%

69.9

0%

69.1

0%

63.2

0%

56%

54.7

0%

112

EXPERIMENT-2

DISCUSSION

Mastitis is economically unbearable and complicated disease in dairy industry worldwide.

Staphylococcus aureus is considered as a leading causative organism of mastitis in dairy animals.

Due to the complex nature of Staphylococcus aureus, the treatment and control of mastitis are

failed. The drug resistance is a significant feature of Staphylococcus aureus (Wyder et al. 2011).

Antibiotic resistance is an emerging problem all over the world. Mastitis in dairy animals is the

common reason for antibiotic use in dairy animals. Staphylococcus aureus resistance is increased

in case of mastitis to several antibiotics. In this study, the resistance to trimethoprim is high as

compared to other drugs, it might be due to its constant use in the last decades. In Pakistan, all

these tested antibiotics are in practice in case of mastitis treatment, but among them trimethoprim,

amoxicillin, streptomycin, ciprofloxacin and oxytetracycline are regularly used in mastitis

treatment.

In the present study, trimethoprim sensitivity against Staphylococcus aureus was 54.7%

and its resistance was 45.3%. Our finding is accordance in with many studies (Wang et al. 2015;

Kurjogi et al. 2011; Hussain et al. 2013; Ikiz et al. 2013) who reported the sensitivity of

trimethoprim was 50 to 77%. In this study, the resistance to trimethoprim is high as compared to

other drugs, it might be due to its constant use in the last decades. Amoxicillin sensitivity in the

present study was 63.2%, which is similar to previous studies (Farooq et al. 2008, Idriss et al.

2014; Jeykumar et al. 2013; Khan et al. 2004) who reported amoxicillin as a suitable drug for

treatment of mastitis. Tylosin was 71.6% sensitive in the present study, which was not in line with

the study of Brinda et al. (2010) who reported its sensitivity 28%. This might be due to frequent

use to tylosin in their localities. In the present study, streptomycin sensitivity against

Staphylococcus aureus mastitis was 56%, same as in previous studies (Idriss et al. 2014; Kurjogi

et al. 2011; Farooq et al. 2008) reported their sensitivity from 50 to 80%. Staphylococcus aureus

113

EXPERIMENT-2

sensitivity against antibiotic may be attributed to geographical variation. In the present study,

ciprofloxacin sensitivity against Staphylococcus aureus mastitis was 69.9%. Same as in some

previous studies (Wang et al. 2015; Jeykumar et al. 2013; Li et al. 2009; Unakal et al. 2010; Khan

et al. 2004) reported their sensitivity from 50 to 90%. Staphylococcus aureus sensitivity might be

attributed to the extent from locality to locality.

In the current study, Staphylococcus aureus was 75.4% sensitive and less resistance to

oxytetracycline (19.9%). These findings are in accordance with previous studies who reported

that Staphylococcus aureus was 59 to 88% sensitive to oxytetracycline (Jeykumar el al. 2013; Li

et al. 2009; Khan et al. 2004; Zahid et al. 2004; Ikiz et al. 2013). The results of the current study

revealed that the isolates were 74.6% sensitive to erythromycin. It is in line with many previous

studies (Khan et al. 2004; Alekish et al. 2013; Brinda et al. 2010; Gianneechini et al. 2002; Unakal

et al. 2010) who reported erythromycin sensitivity ranging from 78 to 95%. The sensitivity of

ciprofloxacin was Staphylococcus aureus was 69.9%, which is in compliance with the studies

(Jeykumar et al. 2013; Khan et al. 2005; Mustafa et al. 2014; Hussain et al. 2013) who reported

ciprofloxacin as the drug of choice. In the present study, doxycycline sensitivity was 69.1%, which

is similar to previous studies conducted by Wang et al. (2015) and Alekish et al. (2013) who

reported the sensitivity of doxycycline in mastitis was 50 to 70%. In this study Staphylococcus

aureus was 73.3% sensitive to kanamycin similarity, in previous studies (Idriss et al. 2014; Farooq

et al. 2008; Anjum et al. 2010) described kanamycin as the drug of choice in mastitis. Some other

studies (Mustafa et al. 2014; Kurjogi et al. 2011; Brinda et al. 2010; Anjum et al. 2010) who also

reported their sensitivity less than 40%. Staphylococcus aureus isolated from buffalo mastitis was

72.4% sensitive to chloramphenicol, which is close to the previous finding by Wang et al. (2015),

Li et al. (2009) and Khan et al. (2004) who reported 52 to 91% respectively. The present study

reveals, the sensitivity of gentamycin to Staphylococcus was 80.1%. Gentamycin has been shown

114

EXPERIMENT-2

as the drug of choice against Staphylococcus aureus similarly, many studies (Akram et al. 2013;

Jeykumar et al. 2013; Anjum et al. 2010; Hameed et al. 2008; Iqbal et al. 2004) who reported

gentamycin as a drug of choice in case of Staphylococcus aureus and its sensitivity was 80%.

In conclusion, for successful treatment of mastitis, antibiotic susceptibility testing should

be done to regulate the effectiveness of antibiotics. Proper isolation and identification of the

causative organisms and proper selection of antibiotics play important role in minimizing and

control of the mastitis. In our study the resistant pattern of trimethoprim, amoxicillin, streptomycin

and ciprofloxacin was high as compared to other used antibiotics. Thus, select the appropriate

antibiotic and mastitis treatment should be started after antibiotic sensitivity testing. Furthermore,

there is a need to routinely investigate and record the resistance and sensitivity of Staphylococcus

aureus mastitis in dairy buffaloes.

REFERENCES

Akram N, Chaudhary H, Ahmed HS, Ghuman MA, Nawaz G, Hussain S. 2013. Isolation of

bacteria from mastitis affected bovine milk and their antibiogram. European J Vet

Med. 2(1):38-46.

Alekish MO, Al-Qudah KM, Al-Saleh A. 2013. Prevalence of antimicrobial resistance among

bacterial pathogens isolated from bovine mastitis in northern Jordan. Revue Med

Vet, 164(6): 319-326.

Anjum AA, Qamar MF, Ali AM. 2010. Bacteriology of mastitic milk of cattle and in Vitro

antibiogram of the pathogens isolated, in District Hafizabad, Pakistan. Biologia

Pak. 56(2):117-122.



115

EXPERIMENT-2

Arshad MF, Qamar K, Siddique M, Sindhu ST. 1999. Studies on some epidemiological aspects of

bovine mastitis. In: Proc. National Seminar on Epidemiology of livestock and Poultry

Diseases. 19-20 January, 1995. Collage of Veterinary Sciences, Lahore. 16-17.

Brinda M, Herman V, Faur B. 2010. Antimicrobial sensitivity of some Staphylococcus aureus

strains from bovine mastitis. Lucrari Stiinţifice Medicina Vet. 43(1): 102-105.

Clinical Laboratory Standards Institute (CLSI). 2005. Performance Standards for Antimicrobial

Susceptibility testing. CLSI Approved Standards M100-S15. Clinical and Laboratory Standards

Institute, Wayne, PA. CDC. USA.

Farooq AA, Inayat S, Akhtar MS, Mushtaq M. 2008. Prevalence of mastitis and antibiotic

sensitivity of bacterial isolates recovered from Nili ravi buffaloes. J Anim Plan Sci. 18: 76-

78.

Food and Agriculture Organization (FAO). 2010. The technology of traditional milk products in

developing countries. Animal Production and Health Papers. 85: 9–24.

Gianneechini RE, Concha C, Frankn A. 2002. Antimicrobial susceptibility of udder pathogens

isolated from dairy herds in the west ttoral region of Uruguay. Acta Vet Scand. 43(1): 31-

42.

Hameed S, Arshad M, Ashraf M, Avais M, Shahid MA. 2008. Prevalence of common mastitogens

and their antibiotic susceptibility in tehsil burewala, Pakistan. Pak J Agri Sci. 45(2): 181-

183.

Hussain A, Ahmed MD, Mushtaq MH, Khan MS,Nisar M,Sabir N, Khan SA. 2013. Antibiogram

Analysis of Staphylococcus aureus Isolated from Mastitic Milk Samples of Buffaloes in

District Bhimber Azad Kashmir. Buff Bull. 32: 1021-1028.

116

EXPERIMENT-2

Idriss S, Foltys V, Tancin V, Kirchnerova K, Tancinova G, Zaujec K.2014. Mastitis pathogens and

their resistance against antimicrobial agents in dairy cows in Nitra, Slovakia. Slovak J

Anim Sci. 47(1): 33-38.

Ikiz S, Beren B, Enver B, Omer C, Guven K, Naciye YO, Melih U, Ozge Y, Mehmet CG, Ahmet

S. 2013. Presence and antibiotic susceptibility patterns of contagious mastitis agents

(Staphylococcus aureus and Streptococcus agalactiae) isolated from milks of dairy cows

with subclinical mastitis. Turk J Vet Anim Sci. 37(5): 569-574.

Iqbal M, Amjed M, Khan MA, Qureshi MS, Sadique U. 2006. Comparative efficiency of some

indirect diagnostic tests for the detection of sub-clinical mastitis in cows and buffaloes. Pak

Vet J. 26 (2): 73-79.

Iqbal M, Khan MA, Daraz N. 2004. Bacteriology of mastitic milk and in vitro antibiogram of the

isolates. Pak Vet J. 24(4): 161-164.

Jeykumar M, Vinodkumar G, Bashir BP, Krovvidi S.2013. Antibiogram of mastitis pathogens in

the milk of crossbred cows in Namakkal district, Tamil Nadu. Vet World. 6(6): 354-356.

Khan A, Muhammad G, Ali T, Khan A. 2005. Prevalence of mastitis in cross bred cows and

buffaloes and antibiotics sensitivity profiles of isolates. Pak Vet J. 26 74-76.

Khan AZ, Khan A, Hayat C, Munir Z, Ayaz U. 2004. Prevalence of mastitis in buffaloes and

antibiotic sensitivity profiles of isolates. Pak. J Live. 2 (1): 73-75.

Kurjogi MM, Kaliwal BB. 2011. Prevalence and antimicrobial susceptibility of bacteria isolated

from bovine mastitis. Adv Appl Sci Res. 2(6): 229-235.

Li JP, Zhou HJ, Yuan L, He T, Hu SH. 2009. Prevalence, genetic diversity, and antimicrobial

susceptibility profiles of Staphylococcus aureus isolated from bovine mastitis in Zhejiang

Province, China. Journal of Zhejiang University Science B. 10(10): 753-760.

117

EXPERIMENT-2

Mustafa Y, Awan FN, Zaman T, Chaudhry S, Zoyfro V. 2011. Prevalence and antibacterial

susceptibility in mastitis in buffalo and cow in and around the district Lahore, Pakistan.

Pak. J. Pharm. 24(2): 29-33.

Mustafa YS, Awan FN, Zaman T. 2014. Prevalence and antibacterial susceptibility in mastitis in

buffalo and cow in district Lahore Pakistan. Buff bull. 32(4): 307-310.

National Mastitis Council, Inc. 1990. Microbiological procedures for the diagnosis of bovine udder

infection. National Mastitis Council, Inc. Wilson Boulevard Arngton, Virginia, USA.

Radostits OM, Gay CC, Blood DC, Hinchcliff KW. 2000. Veterinary Medicine: A Textbook of

the Diseases of Cattle, Sheep, Pigs, Goats and Horses. 9th Ed. W. B. Saunders Co.,

Philadelphia, USA. p. 603-610.

Rahman M, Bhuiyan M, Kamal M, Shamsuddin M. 2009. Prevalence and risk factors of mastitis

in dairy cows. Bangladesh Vet. 26(2): 54-60.

Shakoor A. 2006. Preparation and Evaluation of Staphylococcus aureus Vaccines for the Control

of Mastitis in Dairy Buffaloes (Bubalis Bubalis). University of Agriculture, Faisalabad.

Sol J, Sampimon O, Barkema H, Schukken Y. 2000. Factors associated with cure after therapy of

clinical mastitis caused by Staphylococcus aureus. Journal Dairy Sci. 83(2): 278-284.

Tenover FC. 2006. Mechanisms of antimicrobial resistance in bacteria. The American J med.

119(6): 3-10.

Unakal C, Kaliwal B. 2010. Prevalence and antibiotic susceptibility of Staphylococcus aureus

from bovine mastitis. Vet World. 3(2): 65-67.

Wang D, Wang Z, Yan Z, Wu J, Ali T, Li J, Lv Y, Han B. 2015. Bovine mastitis Staphylococcus

aureus: Antibiotic susceptibility profile, resistance genes and molecular typing of

118

EXPERIMENT-2

methicillin-resistant and methicillin-sensitive strains in China. Infection, Genetics and

Evolution. 31: 9-16.

Wyder, AB, Boss R, Naskova J, Kaufmann T, Steiner A, Graber HU. 2011. Streptococcus spp.

and related bacteria: their identification and their pathogenic potential for chronic mastitis-

a molecular approach. Res Vet Sci. 91: 34-357.

Zahid I 2004. Studies on comparative incidence of subclinical and clinical mastitis and in vitro

antibiotic susceptibility of isolates from Holstein-Friesian and Jersey cows and buffaloes.

Pak Vet J. 24(2): 76-81.

119

EXPERIMENT-2

CHAPTER 5 EXPERIMENT-3

MOLECULAR CHARACTERIZATION OF COAGULASE AND FIBRONECTIN

BINDING PROTEIN A GENES OF STAPHYLOCOCCUS AUREUS ISOLATED FROM

MASTITIS IN RIVER BUFFALOES

ABSTRACT

Mastitis is a major dairy herd problem mainly caused by Staphylococcus aureus. Virulent

coagulase and fibronectin binding protein A genes of S. aureus from mastitic buffalo milk samples,

collected from 50 dairy herds located in Lahore and Bhimber districts. A total of 1036 buffaloes

and 4144 quarters were screened for clinical and subclinical mastitis. Among total of 673 milk

samples, S. aureus was isolated from 236 samples. The S. aureus isolates were subjected to

molecular characterization of coagulase and fibronectin binding protein A genes and phylogenetic

tree (using MEGA6.1 software package) was constructed. It revealed that the coa gene of S. aureus

isolated from mastitic buffalo milk samples, could be grouped in two clades which were closely

related to S. aureus isolates from Japan, India and Taiwan, while S. aureus isolates from Germany,

UK and USA were distantly related. Phylogenetic tree based on fnbA gene sequences indicated

that all Pakistani isolates were clustered together in one clade in closeness with isolates from

Switzerland and Ireland. While isolates from Thailand and USA were placed distantly. These

results indicated the genetic relatedness of Pakistani isolates with other reported isolates from

different parts of the world. This particular knowledge may support in effective diagnosis,

treatment and control of mastitis in river buffaloes in Pakistan. These findings will also be helpful

in future for designing suitable mastitis control strategies in the country.

Keywords: Buffalo, Mastitis, Staphylococcus aureus, Coagulase, Fibronectin binding protein A.

120

EXPERIMENT - 3

INTRODUCTION

Mastitis is an inflammation of the parenchyma of the udder which also results in physical,

chemical and pathological changes in the udder. Inflammation of the udder may be caused by any

kind of injuries such as physical trauma, chemical irritants, toxins or infectious agents. The bovine

mastitis is one of the major disease responsible for reduction in milk production (Hussain et al.

2012). Mastitis is manifested in two forms, i.e. clinical and subclinical. The clinical mastitis is

manifested by abnormal milk with or without udder swelling, while in subclinical mastitis milk

production may decrease and bacterial counts increase in milk with no physical abnormality

(Radostits et al. 2000). However, subclinical mastitis is diagnosed by somatic cell count by various

methods such as White Side Test, California Mastitis Test and Surf Filed Mastitis Test. The

prevalence of subclinical mastitis is 20-40 times more as compared to clinical mastitis (Erskine,

2002).

S. aureus is considered the most common causative agent of mastitis in dairy animals and

it possesses property of genetic heterogeneity. Its genetic variability has contributed to the

emergence of distinct epidemiologic profiles of strains prevalent in a herd (Fitzgerald et al. 2003;

Karimuribo et al. 2005; Tollersrud et al. 2000). S. aureus does not have a host preference among

animal species (Aires-de-Sousa et al. 2007; Mork et al. 2005). Staphylococcus aureus is

responsible for a variety of infections in human and animals (Bartlett and Hulten, 2010; Gu et al.

2013; Khan et al. 2013) and treatments become more difficult due to its emerging strains. S. aureus

can be divided into a number of subtypes, among them only a few are responsible for mastitis in

different geographical locations of the world (Aarestrup et al. 1994; Hookey et al. 1999). Rapid

and accurate identification of S. aureus is important for the control and prevention of the infectious

mastitis (Hookey et al. 1998).

121

EXPERIMENT - 3

Pathogenesis of mastitis may be caused by extracellular toxins, enzymes and surface

antigens (Luong et al. 2003; O’Riordan and Lee, 2004). Coagulase gene of S. aureus is considered

an important virulence factor. Amplification of S. aureus coagulase gene (coa) has been

recommended as an accurate method for identification of virulent strains of S. aureus (Morandi et

al. 2010; Sabat et al. 2006; Goh et al. 1992). Sequencing of the coagulase gene shows great

diversity in S. aureus population (Costa et al. 2012). Information regarding the genetic diversity

of Staphylococcus aureus isolated from mastitis in cow is available but such information regarding

S. aureus from buffalo mastitis is limited (Faryal et al. 2009). Various studies described that bovine

mastitis is caused by a wide variety of Staphylococcus aureus genotypes (Smith et al. 2005).

Staphylococcus aureus from mastitis represents a genetic heterogeneity (Fagiolo and Lai, 2007;

Fournier et al. 2008). It has more than 50 virulence factors, which enable it to attach to a variety

of hosts, and cause a multitude of diverse infections and the fibronectin binding protein A (fnbA)

is one of them. Pathogenicity of Staphylococcus aureus is due to the expression of cell surface

protein that can bind to host proteins (Broughan et al. 2011; Burke et al. 2010; Nashev et al. 2004;

Novick, 2000). Among different virulent genes, either fnbA or fnbB gene of Staphylococcus aureus

is considered a major virulence factor causing bovine mastitis. In pathogenesis, the first step of

infection starts with the adherence of the pathogen to the teat canal of the udder (Ahmed et al.

2001; Arrecubieta et al. 2008). Effective entrance of bacteria into host occurs by possible when

there is the formation of a bridge between bacterial fibronectin binding proteins (fnbps) and host

fibronectin (Fowler et al. 2000). The present study was designed to find the genetic diversity of

Staphylococcus aureus isolated from buffaloes with mastitis on the basis of fnbA gene. So the

present study was designed to find the genetic diversity of S. aureus isolated from buffaloes with

mastitis on the basis of coagulase gene.

122

EXPERIMENT - 3


Collection of milk samples

The present study was carried out in District Lahore (Punjab) and Bhimber (Azad Jammu

and Kashmir), Pakistan. Lactating buffalo disregards of the parity were selected while buffaloes

in the dry period and heifer were excluded. A total of 4144 quarters from 1036 buffaloes was

screened for the presence of clinical and subclinical mastitis. Fifty dairy herds were screened (25

from each district). The data were collected and categorized into three groups (small, medium and

large having 5 to 10, 11 to 30, and more than 31 dairy buffaloes, respectively) during the study

period. Clinical mastitis was diagnosed on the basis of signs and symptoms while subclinical

mastitis was diagnosed California Mastitis Test (CMT) as discussed by Iqbal et al. (2006). All the

milk samples positive for clinical or subclinical mastitis were collected in sterilized screw capped

vials and transported to the Microbiology Laboratory, Department of Epidemiology and Public

Health, University of Veterinary and Animal Sciences, Lahore in a cooler to maintain temperature

below 4oC. The samples were processed within 12 h after collection from the field.

Isolation and identification of S. aureus

Each of the collected samples was streaked on Staph-110 and sheep blood agar plates.

Gram’s staining followed by a biochemical test, e.g., Catalase test, Coagulase test, Staphytect plus

test and Mannitol fermentation were performed for the characterization of the S. aureus isolates.

Pure cultures of S. aureus were preserved in 20% glycerol and kept at -80oC till further use.

DNA Extraction

After microbiological examination of Staphylococcus aureus, pure cultures were

preserved in 20% glycerol in eppendrof tubes and freeze down at -80 ºC freezer for further

123

EXPERIMENT - 3

investigations. Before DNA extraction freeze down samples were streaked on Sheep blood

ager and after 24 hour incubation 4 to 5 fresh colonies of Staphylococcus aureus were

dissolved in normal saline. DNA extraction was performed as prescribed by Genomic DNA

Purification Kit (Thermo Scientific USA). For DNA extraction mixed 200 μl of sample

with 400 μl of lysis solution and incubates at 65°C for 5 min. Then instantly add 600 μl of

chloroform, gently emulsified by inversion and centrifuge the sample at 10,000 rpm for 2

min. Precipitation solution was prepared by mixing 720 μl of sterile deionized water with

80 μl of supply 10X concentrated precipitation solution. Transfer the upper aqueous DNA

to a new tube and add 800 μl of freshly prepared precipitation solution, mixed gently by

several inversions for 1-2 min and centrifuge at 10,000 rpm (~9400 x g) for 2 min.

Supernatant discarded completely and dissolved DNA pellet in 100 μl of NaCl solution by

vortexing gently. Add 300 μl of cold ethanol, let the DNA precipitate (10 min at -20°C)

and spin down (10,000 rpm for 3-4 min). Removed ethanol and wash pellet once with 70%

cold ethanol and dissolve DNA in 100 μl of sterile deionized water by vortexing.

DNA Quantification and storage

DNA quantification of the every sample was done with the help of Gel

electrophoresis using 0.8 % Agarose gel and DNA ladder 100 bp (Fermentas USA). All

extracted DNA samples were adjusted at same concentration level i.e.50 ng/uL. DNA

quantification was also done with Nanodrop Thermo (Fermentas USA) for further

confirmation. Extracted DNA was dissolved in nucleus free water and working aliquots

were made while stock DNA samples were being stored at -20 ºC freezer.

124

EXPERIMENT - 3

Selection of Primers

Primers for gene coagulase and fibronectin binding protein A were synthesized from

GeneWorks Australia as reported previously by Kumar et al. (2011).

S.no. Primer Name Nucl. No Sequence (5'--------3')

1 Staph_Coag-F 22 AACAAAGCGGCCCATCATTAAG

2 Staph_Coag-R 23 TAAGAAATATGCTCCGATTGTCG

3 FBNA-F 17 GCGGAGATCAAAGACAA

4 FBNA-R 18 CCATCTATAGCTGTGTGG

Primers Optimization and PCR Amplification

PCR reactions were carried out in 25 μL reaction mixtures, using 50 ng of DNA, 10 mM

of Tris HCl (pH 8.8 at 25 oC), 50 mM of KCl, 0.08%, MgCl2 (2 mM), 250 μM of each dNTPs, 0.2

μM of forward and reverse primers and 0.5 U of Taq DNA polymerase (Thermo Fisher Scientific

Inc. USA). DNA isolated from pure culture of Staphylococcus aureus ATCC 25923 was taken as

positive control while nuclease free water was taken as negative control. The PCR mixture without

template was taken as PCR control to check for the possibility of any contamination.

DNA amplification was carried in thermocycler (Kyratec SC 200) with following cyclic

conditions: Initial denaturation at 95 oC for 5 min followed by 30 cycles of denaturation at 94 oC

for 30 sec, annealing at 52 oC and 57 oC for 30 sec for Coagulase and Fibronectin binding protein

A gene, respectively. Then extension at 72 oC for 30 sec. A final extension at 72 oC was carried

out for 5 min. All the PCR products were run on 1.2 % agarose gel stained with ethidium bromide

and visualized under UV light in Gel Documentation System (BioRad USA) and gel photographs

were saved for future reference.

125

EXPERIMENT - 3

Sequencing and Phylogenetic Analysis

Positive PCR products were precipitated with 70 % ethanol (80µL) and finally dissolved

in 20 µL of double distilled deionized water. The representative samples of coa and fnbA (coa =11

and fnbA =07) gene were sent to Australian Genome Research Facility Ltd (AGRF), University of

Adelaide for Sanger’s sequencing. Sequences were edited using Codon Code Aligner and highest

similarities of coa gene with that of other strains were searched using the BLAST tool of GenBank,

NCBI. (Woo et al. 2001). Phylogenetic trees of all sequences were constructed using MEGA6.1

by Neighbor Joining method (Sudhir and Sudhindra, 2000) with 1000 bootstrap values (Tamura et

al. 2011). Alignments, pairwise distance estimations, and similarities/variations at nucleotides

levels of all Pakistani sequences and those reported from NCBI GeneBank were also performed

by using MEGA6.1 software.

126

http://www.ncbi.nlm.nih.gov/pubmed/?term=Woo%20PC%5BAuthor%5D&cauthor=true&cauthor_uid=11477139

EXPERIMENT - 3

RESULTS

Identification of S. aureus isolates from mastitic milk samples

A total of 4144 quarters from 1036 buffaloes was screened and 673 (106 clinical and 567

subclinical) milk samples from 508 buffaloes were examined for mastitis. Out of 106 clinical

mastitis milk samples examined, 71 belonged to Lahore and 35 to Bhimber; whilst, out of 567

subclinical mastitis milk samples that were examined, 365 belonged to Lahore and 202 to Bhimber.

Among these 673 milk samples, 437 isolates of Staphylococci were recovered. All these 437

isolates of Staphylococci were Gram positive, catalase positive and showed hemolytic property on

5% sheep blood agar. Out of these isolates, only 236 were confirmed coagulase positive S. aureus.

Amplification of coa and FnbA gene PCR Products

Among the total 236 S. aureus isolated, PCR was performed on 11 isolates. These 11

representative isolates were selected on from different location/sampling pockets. The results of

amplification of coa gene has been shown in figure 5.1. The PCR products were categorized into

five classes on the basis of their molecular size on electrophoresis of agarose gel. The

approximately the product size was from 430 to 840 bp. But the majority of isolates having product

size 575 bp. In case of FnbA gene all the strains having same product size 1150 bp on agarose gel.

127

EXPERIMENT - 3

Figure 5.1. Agarose gel electrophoresis of coa gene PCR amplification products. 100 bp DNA ladder, lane 1-2: 540 bp, lane 3,6: 550 bp, lane 4-5,10: 525 bp, lane 7: 430 bp and lane 9: 840.

128

EXPERIMENT - 3

Figure 5.2 Agarose gel electrophoresis of FnbA gene PCR amplification products. 100 bp plus DNA ladder, lane 1-10: 1150 bp.

129

EXPERIMENT - 3

Phylogenetic tree of coa gene of S. aureus isolates/strains from Pakistan and different

geographical locations

Coagulase gene from S. aureus strains were amplified and PCR products of 430 to 840 bp

were confirmed on agarose gel. PCR products were sequenced and nucleotide sequences were

compared with other coagulase gene sequences in the GenBank. Phylogenetic tree was constructed

by aligning coagulase gene sequences of the present study isolates with selected coagulase gene

sequences in the GenBank. Phylogenic tree of all Pakistani (n=11) sequences was constructed

separately (Figure 5.3) and then combined with all other sequences (n=9) in the NCBI GenBank

database. Phylogenetic tree showed that all Pakistani isolates were grouped together in two clades

with high bootstrap values showing high genetic relatedness with some isolates from Japan

(GenBank accession numbers AB373752 and AB373753), while some isolates from India

(JX240355) and Taiwan (CP003603 and CP003166) were relatively distantly placed as compared

to above mentioned Japanize isolates. Isolates from Germany (AJ306908), UK (FN433596 and

BX571856) and USA (CP006044) were placed distantly as compared to isolates from Japan, India

and Taiwan (Figure 5.4).

Phylogenetic tree of fnbA gene of S. aureus isolates/strains from Pakistan and different

geographical locations

The isolated sequence was compared with other fnbA gene sequences found in NCBI

GenBank. PCR product size was approximately 1150bp and phylogenetic tree was constructed by

aligning fnbA gene sequences with fnbA gene sequences found in GenBank. Phylogenic tree of all

Pakistani (n= 7) sequences was constructed separately (Figure. 5.5) and combined with all other

sequences founded from NCBI GenBank (n=10). Phylogenetic tree showed that all Pakistani

isolates were grouped together in one clades with high bootstrap values showing closeness with

130

EXPERIMENT - 3

isolates from Switzerland (AM07599 and AM076025) and Ireland (AM749008 and AM749014)

while isolates from Thailand (JN848748 and JN848745) and USA (JF809640 and JF809661) were

placed distantly (Figure 5.6).

Pairwise similarities and divergence among substitutions of Coagulase gene

Table 5.3 shown the similarities and divergence among Pakistani and NCBI reported

strains from the world. All the Pakistani strains of coagulase gene were 99.98-100% similar while

their divergence was 0.02%. The Japanizes strains were close to Pakistan strains and their

similarity and divergence was 99.97% and 0.03%, respectively. The Pakistani strains were 99.93%

similar and 0.07% divergent from Indian and German strains. Similarly, the Pakistani strains were

99.94% similar and 0.06% were divergent from the UK and Taiwan reported strains.

Pairwise similarities and divergence among substitutions of FnbA

In table 5.4 the similarities and divergence among Pakistani and NCBI reported strains has

been shown. All the Pakistani strains of FnbA were 99.96-100% similar while their divergence

was 0.04%. The Switzerland strains were close to Pakistan strains and their similarity and

divergence was 97.1% and 2.9%, respectively. The Pakistani strains were 96-97.2% similar and

2.8-3.2% divergent from strains reported from Ireland. The Pakistani strains were 91.3-91.8%

similar and 8.2-8.7% were divergent from Thailand and USA reported strains.

131

EXPERIMENT - 3

Figure 5.3. Coa Phylogenetic tree (MEGA6.1, NJ method with 1000 bootstrap value) showing

evolutionary relationship among all Pakistani strains.

132

EXPERIMENT - 3

Figure 5.4. Phylogenetic tree (MEGA6.1, NJ method with 1000 bootstrap value), based on coagulase gene sequences, showing evolutionary relationship of Pakistani strains/isolates with selected reference strains from different geographical locations. Pakistani strains/isolates have been indicated with closed triangles.

133

EXPERIMENT - 3

Figure 5.5. Fibronectin Binding Protein A, Phylogenetic tree (MEGA6.1, NJ method with 1000 bootstrap value) showing evolutionary relationship among all Pakistani strains.

134

EXPERIMENT - 3

Figure 5.6. Phylogenetic tree (MEGA6.1, NJ method with 1000 bootstrap value), based on

FnbA gene sequences, showing evolutionary relationship of Pakistani strains/isolates with selected reference strains from different geographical locations. Pakistani strains/isolates have been indicated with closed triangles.

135

EXPERIMENT - 3

Table 5.1. Coa Pairwise genetic distance among all Pakistani strains.

S. No.

Name of isolates 1 2 3 4 5 6 7 8 9 10 11

1 S.aureus/coa/76/LH(Pak) 0.00 0.00 0.00 0.01 0.01 0.01 0.01 0.01 0.01 0.01



4 S.aureus/Coa/66/BM(Pak) 0.00 0.00 0.00 0.01 0.01 0.01 0.01 0.01 0.01 0.01




8 S.aureus/coa/32/BM(Pak) 0.02 0.02 0.02 0.01 0.00 0.00 0.00 0.00 0.00 0.00




136

EXPERIMENT - 3

Table 5.2. FnbA Pairwise genetic distance among all Pakistani strains

S. No. Name of isolates 1 2 3 4 5 6 7

1 S.aureus/FnbA /76/LH(Pak) 0.00 0.00 0.00 0.00 0.00 0.01

2 S.aureus/FnbA /32/BM(Pak) 0.00 0.00 0.00 0.00 0.00 0.01

3 S.aureusFnbA /23/BM(Pak) 0.00 0.00 0.00 0.00 0.00 0.01




7 S.aureus/FnbA /66/BM(Pak) 0.04 0.04 0.04 0.04 0.04 0.04

137

EXPERIMENT-2

Table 5.3. Pairwise genetic distance relationship between isolated strains and some reference strains based on coagulase gene sequence.

S. No.

Name of isolates 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

1 S.aureus/coa/76/LH(Pak)

0.00

0.00

0.00

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.02

0.02

0.02

0.02

0.02

0.02


0.00

0.00

0.00

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.02

0.02

0.02

0.02

0.02

0.02


0.00

0.00

0.00

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.02

0.02

0.02

0.02

0.02

0.02

4 S.aureus/Coa/66/BM(Pak)

0.00

0.00

0.00

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.01

0.02

0.02

0.02

0.02

0.02

0.02


0.02

0.02

0.02

0.01

0.00

0.00

0.00

0.00

0.00

0.00

0.01

0.01

0.02

0.02

0.01

0.01

0.02

0.02


0.02

0.02

0.02

0.01

0.00

0.00

0.00

0.00

0.00

0.00

0.01

0.01

0.02

0.02

0.01

0.01

0.02

0.02


0.02

0.02

0.02

0.01

0.00

0.00

0.00

0.00

0.00

0.00

0.01

0.01

0.02

0.02

0.01

0.01

0.02

0.02

8 S.aureus/coa/32/BM(Pak)

0.02

0.02

0.02

0.01

0.00

0.00

0.00

0.00

0.00

0.00

0.01

0.01

0.02

0.02

0.01

0.01

0.02

0.02


0.01

0.01

0.01

0.02

0.00

0.00

0.00

0.00

0.00

0.00

0.01

0.01

0.02

0.02

0.01

0.01

0.02

0.02


0.01

0.01

0.01

0.02

0.00

0.00

0.00

0.00

0.00

0.00

0.01

0.01

0.02

0.02

0.01

0.01

0.02

0.02


0.02

0.02

0.02

0.01

0.00

0.00

0.00

0.00

0.00

0.00

0.01

0.01

0.02

0.02

0.01

0.01

0.02

0.02

12 S.aureus/coa/Japan(AB373752)

0.03

0.03

0.03

0.02

0.02

0.02

0.02

0.02

0.02

0.02

0.02

0.00

0.01

0.02

0.01

0.01

0.01

0.02

13 S.aureus/coa/Japan(AB373753)

0.03

0.03

0.03

0.02

0.02

0.02

0.02

0.02

0.02

0.02

0.02

0.00

0.01

0.02

0.01

0.01

0.01

0.02

14 S.aureus/coa/India(JX240355)

0.07

0.07

0.07

0.07

0.06

0.06

0.06

0.06

0.05

0.05

0.06

0.05

0.05

0.03

0.01

0.01

0.02

0.03

15 S.aureus/coa/UK(FN433596)

0.06

0.06

0.06

0.07

0.06

0.06

0.06

0.06

0.05

0.05

0.06

0.07

0.07

0.11

0.03

0.03

0.02

0.00

16 S.aureus/coa/Taiwan(CP003603)

0.06

0.06

0.06

0.05

0.04

0.04

0.04

0.04

0.04

0.04

0.04

0.03

0.03

0.02

0.10

0.00

0.02

0.03

17 S.aureus/coa/Taiwan(CP003166)

0.06

0.06

0.06

0.05

0.04

0.04

0.04

0.04

0.04

0.04

0.04

0.03

0.03

0.02

0.10

0.00

0.02

0.03

18 S.aureus/coa/Germany(AJ306908)

0.07

0.07

0.07

0.07

0.07

0.07

0.07

0.07

0.07

0.07

0.07

0.05

0.05

0.09

0.07

0.08

0.08

0.02

19 S.aureus/coa/UK(BX571856) 0.0

6 0.0

6 0.0

6 0.0

7 0.0

6 0.0

6 0.0

6 0.0

6 0.0

5 0.0

5 0.0

6 0.0

7 0.0

7 0.1

1 0.0

0 0.1

0 0.1

0 0.0

7 The number of base substitutions per site from averaging over all sequence pairs within each group is shown. The diagonal bold faced numbers show the mean inter populational evolutionary diversity estimates.

138

EXPERIMENT - 3

Table 5.4. Pairwise genetic distance relationship between isolated strains and some reference strains based on fibronectin binding protein A.

S.

No. Name of isolates 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

1 S.aureus/FnbA /76/LH(Pak) 0.00 0.00 0.00 0.00 0.00 0.01 0.02 0.02 0.02 0.02 0.02 0.04 0.04 0.04 0.04 0.04 2 S.aureus/FnbA /32/BM(Pak) 0.00 0.00 0.00 0.00 0.00 0.01 0.02 0.02 0.02 0.02 0.02 0.04 0.04 0.04 0.04 0.04 3 S.aureusFnbA /23/BM(Pak) 0.00 0.00 0.00 0.00 0.00 0.01 0.02 0.02 0.02 0.02 0.02 0.04 0.04 0.04 0.04 0.04 4 S.aureus/FnbA /65/LH(Pak) 0.00 0.00 0.00 0.00 0.00 0.01 0.02 0.02 0.02 0.02 0.02 0.04 0.04 0.04 0.04 0.04 5 S.aureus/FnbA /67/LH(Pak) 0.00 0.00 0.00 0.00 0.00 0.01 0.02 0.02 0.02 0.02 0.02 0.04 0.04 0.04 0.04 0.04 6 S.aureus/FnbA /79/LH(Pak) 0.00 0.00 0.00 0.00 0.00 0.01 0.02 0.02 0.02 0.02 0.02 0.04 0.04 0.04 0.04 0.04 7 S.aureus/FnbA /66/BM(Pak) 0.04 0.04 0.04 0.04 0.04 0.04 0.02 0.02 0.02 0.02 0.02 0.04 0.04 0.04 0.04 0.04 8 S.aureus/FnbA /Switerland(AM07599) 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.00 0.00 0.02 0.02 0.04 0.04 0.04 0.04 0.04 9 S.aureus/FnbA /Switerland(AM076025) 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.01 0.00 0.02 0.02 0.04 0.04 0.04 0.04 0.04

10 S.aureus/FnbA /Switerland(AM076007) 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.01 0.00 0.02 0.02 0.04 0.04 0.04 0.04 0.04 11 S.aureus/FnbA /Ireland(AM749008) 0.32 0.32 0.32 0.32 0.32 0.32 0.31 0.28 0.28 0.28 0.00 0.04 0.04 0.04 0.04 0.04 12 S.aureus/FnbA /Ireland(AM749014) 0.32 0.32 0.32 0.32 0.32 0.32 0.31 0.28 0.28 0.28 0.00 0.04 0.04 0.04 0.04 0.04 13 S.aureus/FnbA /USA(JF809633) 0.87 0.87 0.87 0.86 0.87 0.86 0.86 0.82 0.82 0.82 0.83 0.83 0.00 0.00 0.00 0.00 14 S.aureus/FnbA /USA(JF809640) 0.87 0.87 0.87 0.87 0.87 0.86 0.86 0.83 0.83 0.82 0.84 0.84 0.00 0.00 0.00 0.00 15 S.aureus/FnbA /USA(JF809661) 0.86 0.86 0.86 0.86 0.86 0.86 0.86 0.82 0.82 0.81 0.83 0.83 0.00 0.01 0.00 0.00 16 S.aureus/FnbA /Thailand(JN848748) 0.87 0.87 0.87 0.86 0.87 0.86 0.86 0.82 0.82 0.82 0.83 0.83 0.00 0.01 0.00 0.00 17 S.aureus/FnbA /Thailand(JN848745) 0.87 0.87 0.87 0.86 0.87 0.86 0.86 0.82 0.82 0.82 0.83 0.83 0.00 0.01 0.00 0.00

The number of base substitutions per site from averaging over all sequence pairs within each group is shown. The diagonal bold faced numbers show the mean inter populational evolutionary diversity estimates.

139

EXPERIMENT-2

DISCUSSION

Mastitis is common in dairy herds around the globe. It leads to economic losses and is a

serious threat to animal and public health. Udder infection with Staphylococcus aureus considered

to be the leading cause. Mastitis can be minimized by investigation of particular pathogens and

their virulence factors involved in pathogenesis. The molecular characterization of pathogens is an

essential part to track the spread of contagious infections from one region to others or among dairy

herds (Khan et al. 2013). With the development of molecular techniques and their application, now

it is possible to differentiate between pathogenic and nonpathogenic strains of S. aureus.

Staphylococcus is a normal inhabitant of the skin and nails. The isolation of Staphylococcus aureus

from milk alone is unequivocal to determine its role in the pathogenesis. S. aureus virulent gene

surveillance could be helpful in detecting genetic diversity among these major mastitis causing

pathogens. In the present study the identification of virulent strains coagulase and fibronectin

binding protein A were targeted. Coagulase enzyme activity is the principle criteria for diagnosis

of S. aureus from other coagulase negative Staphylococcus because coagulase can convert

fibrinogen to fibrin.

In S. aureus identification, coagulase production (coagulase test) has been considered as

an important criteria for phenotypic identification (Upadhyay et al. 2012; Gharib et al. 2013). In

molecular investigation coagulase gene amplification has been considered as a more accurate

method for Staphylococcus aureus typing. But in case of molecular identification, the presence of

coagulase gene is highly polymorphic and does not give similar amplicons in amplification. This

amplicon difference in coagulase gene size is due to that 3’ end contains a series of 81bp tandem

repeats and number of which may differ between strains (Upadhyay et al. 2012: Goh et al. 1992).

Coagulase gene consists of three distinct regions: (i) the N-terminus containing the prothrombin-

140

EXPERIMENT - 3

binding site, (ii) a central region which is highly conserved, and (iii) a C-terminal region, each

encoding 27-amino acid residues (Janwithayanuchit et al. 2006).

The present study showed that prevalence of coagulase positive S. aureus was quite

common in both localities studied (i.e. Lahore and Bhimber) and molecular characterization of S.

aureus coa gene showed genetic variation. Similarly, prevalence of S. aureus mastitis in buffaloes

is of great concern in Asian countries and these animals are major contributor to the milk industry

(Aires-de-Sousa et al. 2007; El- Jakee et al. 2010). Present study agreed with previous study that

PCR amplifications of coa gene, revealing extensive polymorphism with predominance of one or

more of coa gene amplified products responsible for mastitis in buffaloes (Sindhu et al. 2010). The

phenotypic and genotypic variation was observed in some of the cases. These observations are

supported by previous reports as a mutation in the coding sequence or a plasmid number (Kumar

et al. 2010). Virulence factor diversity and their various combinations might cause changes in the

level of pathogenicity, and spreading of infections within and between animals (Fournier et al.

2008; Kumar et al. 2010). The end region of coa gene differs among S. aureus isolates, both in

their number and in location (Goh et al. 1992), so the coagulase is an important feature used

worldwide for epidemiological investigations of S. aureus. It is also the easiest gene to analyze

polymorphism and generates multiple distinct polymorphism patterns.

The present study results showed heterogeneity in the coa gene of S. aureus strains in

Pakistan and it was in accordance with the heterogeneity reported elsewhere in other strains of S.

aureus (Aarestrup et al. 1995; Khan et al. 2013; Momtaz et al. 2011; Su et al. 2000). Less variation

in coa gene of S. aureus was found in the present study, which agrees with Mork et al. (2005) that

small number of closely related genotypes of S. aureus are responsible for mastitis in a locality.

The coagulase gene is polymorphic and genetically variable and this polymorphism is due to multi

141

EXPERIMENT - 3

allelic forms at the 3' end of the gene, which differs in their sequence and restriction sites (Wisal

et al. 2005). The PCR amplicons variation in size of coagulase gene could be due to polymorphism

among different isolates obtained from different herds and previous studies have also confirmed

PCR product variation using molecular analysis of the coagulase gene (Kalorey et al. 2007;

Reinoso et al. 2008; Khan et al. 2013); however, the reason of this polymorphism is still unknown

(Saei et al. 2009). Present study agreed with the previous study conducted by Khan et al. (2013)

in Pakistan that this polymorphism may be due to mutations by which different nucleotides are

inserted or deleted particularly in the 3´ end the coagulase gene. The different coa gene products

and their polymorphism for Staphylococcus aureus and it showed great genotypic variability

among the organisms (Sanjiv et al. (2008).

In the present study, coagulase strains produced five types of amplicon (430, 525, 540, 550

and 840 bp) and only one was dominant (525bp). These five types of amplicons are in accordance

with findings of Sanjiv et al. (2008) reported that a single coa genotype was dominant from 5

genotypes and PCR amplification produced 400, 500, 600, 900 and 1000-bp amlicons with 600-

bp being the most common in a geographical region. In the present study, PCR product size ranged

from 430 to 840 bp which is close in size from PCR product variation (500 to 580 bp) reported by

Hookey (1998), confirming the polymorphic nature of coagulase gene found in different strains

of S. aureus. In 2004, similarly finding were observed by Salasia et al. in Germany and amplicons

of 510, 600, 680, 740, or 850 bp size, but only one was dominant.

Previous studies suggested that mastitis is caused by S. aureus strains harboring more than

one coa genotype and that only 1 or 2 genotypes were dominated (Aslantas et al. 2007; da Silva

and da Silva, 2005; Nashwa et al. 2011). Momtaz et al. (2011) suggested that mastitis in cattle is

142

EXPERIMENT - 3

caused by certain strains of S. aureus, mostly carrying a coagulase gene, and this information might

be helpful for control and management of mastitis caused by S. aureus.

Fibronectin Binding Protein A

In the present study, the molecular characterization of Staphylococcus aureus fnbA gene

shows genetic variation and can be helpful in the reduction of mastitis and control of this disease.

Some virulent factors are accountable for the adhesion and studies showed that the rate of infection

by fnbA genes is 100% (Nashev et al. 2004). Fibronectin binding proteins play an important role

in virulence action of Staphylococcus aureus infection (Foster and Hook, 1998; Aricola et al. 2005).

FnbA genes 99% were detected by Mishaan et al. (2005) from orthopedic infections while in

another study rate of fnbA gene infection was 76.1% (Zmantar et al. 2008). The genetic component,

namely fnbA, is responsible for both clinical and subclinical mastitis. Moreover, the distribution

of pathogenic characteristics is equally responsible for maintaining mastitis and this information

provides clues for control of such harmful bacterial strains. (Kumar et al. 2011). The variability in

phenotypic and genotypic patterns may be due to the different sites in which the Staphylococcus

aureus is isolated such as clinical and subclinical mastitis milk.

In the present study, PCR product size was 1150bp which is close to 1279bp (Yapar and

Avkan, 2011) and 1280bp Kumer et al. 2011 and it was different in size (191bp) Kouidhi et al.

2010) and 128bp (Atshan et al. 2012) that confirming the polymorphic nature of fnbA gene found

in different strains of Staphylococcus aureus. The present study agreed with previous study

conducted by Kumar et al. (2010) that animals infected with harmful strains could be helpful in

the culling and control of mastitis. It could be recommended from this studies that healthy

buffaloes must be milked first and those having mastitis milked at last or with a separate milking

unit as it is suggested by Voelk et al. (2014). Similarly, other additional management practices

143

EXPERIMENT - 3

may be beneficial, such as treating or culling, biosecurity measures, wearing gloves, fore stripping,

teat cleaning, and post milking teat disinfection.

The present study results showed heterogeneity in Staphylococcus aureus strains of

Pakistan based on fnbA gene sequence and is an important factor in controlling human and bovine

Staphylococcus aureus infections. This heterogeneity could cause mutations in gene of S. aureus.

Similarly, heterologous expression of fnbA gene of Staphylococcus aureus has been reported by

Que et al. (2001). Almost all strains of Staphylococcus aureus have fibronectin-binding proteins

A encoded by fnbA gene (Jonsson et al. 1991). The evidence for the virulent nature of fnbA gene

had been demonstrated by Kuypers and Proctor (1989). Staphylococcus aureus fnbA gene is the

key factor for pathogenesis and because it can form biofilm and adhesion to host (Kouidhi et al.

2010; Palmqvist et al. 2005). Adhesion formation is considered as a major virulence factor

(Vaudaux et al. 1990).

It is concluded from present study that sequence analysis of virulent genes of S. aureus is

very important for epidemiological investigation of outbreak (mastitis). S. aureus isolates showed

genetic diversity in their virulent genes, but only a few gene variants were predominant. The

present study also revealed that the strain variation of S. aureus could be occurring within and

between herds and also between different locations.

144

EXPERIMENT - 3

REFERENCES

Aarestrup FM, Dangler C, Sordillo L. 1995. Prevalence of coagulase gene polymorphism in

Staphylococcus aureus isolates causing bovine mastitis. Can J Vet Res. 59: 124.

Aarestrup FM, Scott N, Sordillo L. 1994. Ability of Staphylococcus aureus coagulase genotypes

to resist neutrophil bactericidal activity and phagocytosis. Infect imm. 62: 5679-5682.

Ahmed S, Meghji S, Williams RJ, Henderson B, Brock JH, Nair SP. 2001. Staphylococcus aureus

fibronectin binding proteins are essential for internalization by osteoblasts but do

not account for differences in intracellular levels of bacteria. Infect Imm. 69(5):

2872–2877.

Aires-de-Sousa M, Parente CE, Vieira-da-Motta O, Bonna IC, Silva DA, de Lencastre H. 2007.

Characterization of Staphylococcus aureus isolates from buffalo, bovine, ovine, and

caprine milk samples collected in Rio de Janeiro State, Brazil. Appl environ microb. 73:

3845-3849.

Aricola CR, Campoccia D, Gamberini D, Baldassarri L, Montanar L. 2005. Prevalence of cna,

fnbA and fnbB adhesions genes among Staphylococcus aureus isolates from

orthopedic infections ass0ciated to different types of implant. FEMS. Microbiol.

Lett. 246: 81–86.

Arrecubieta C, Matsunaga I, Asai T, Naka T, Deng MC, Lowy FD. 2008. Vaccination with

clumping factor A and fibronectin binding protein A to prevent Staphylococcus

aureus infection of an aortic patch in mice. J Infect Dis. 198(4): 571–575.

Aslantas O, Cemil DR, Hulya TLU, Zafer CN, Yaflar E, Gokhan DOR. 2007. Coagulase Gene

Polymorphism of Staphylococcus aureus Isolated from Subclinical Bovine Mastitis.

Turk J Vet Anim Sci. 31(4): 253-257.

145

EXPERIMENT - 3

Bartlett AH, Hulten KG. 2010. Staphylococcus aureus pathogenesis: secretion systems, adhesins,

and invasins. The Pediatric infect disease J. 29: 860-861.

Broughan J, Anderson R, Anderson AS. 2011. Strategies for and advances in the development of

Staphylococcus aureus prophylactic vaccines. Expert Rev Vaccine. 10(5): 695-708.

Burke FM, McCormack N, Rindi S, Speziale P, Foster TJ. 2010. Fibronectin-binding protein B

variation in Staphylococcus aureus. BMC Microbiology. 10: 160.

Costa EO, Ponce SR, Watanabe H, Valle ET. 1999. Avaliaçao da terapia de mastite clínica:

eficacia terapeutica medida em numero de dias em tratamento. Napgama, 2(2): 10-

14.

da Silva ER, da Silva N. 2005. Coagulase gene typing of Staphylococcus aureus isolated from

cows with mastitis in southern Brazil. Can J Vet Res. 69: 260–264.

El-Jakee J, Nagwa AS, Gad WA, El-Said, Bakry MA, Samy AA, Khairy EA. 2010. Diversity of

Staphylococcus aureus isolated from human and bovine estimated by PCR gene

analysis. J Am Sci. 6(11): 487-498.


mastitis pathogens during a seven-year period. Journal of dairy science. 85: 1111-1118.

Fagiolo A, Lai O. 2007. Mastitis in buffalo. Ital J Anim Sci 6: 200–206.

Firyal S, Awan AR, Muhammad G, Babar ME, Ali A, Asif M, Pasha HM, Khan AA, Iftikhar R.

2009. Investigation on Means of transmission of Staphylococcus aureus in Buffalo

and Cow Herds through Coagulase Genotyping. Pak J Zool Suppl Ser. 9: 385-388.

Fitzgerald J, Hartigan P, Meaney W, Smyth C. 2000. Molecular population and virulence factor

analysis of Staphylococcus aureus from bovine intramammary infection. J appl microb. 88:

1028-1037.

146

EXPERIMENT - 3

Foster TJ, Hook M. 1998. Surface protein adhesions of Staphylococcus aureus. Trends Microbiol

12: 484–488.

Fournier C, Kuhnert P, Frey J, Miserez R, Kirchhofer M, Kaufmann T. 2008. Bovine

Staphylococcus aureus: association of virulence genes, genotypes and clinical

outcome. Res Vet Sci. 85: 439-348.

Fowler T, Wann ER, Joh D, Johansson S, Foster TJ, Hook M. 2000. Cellular invasion by

Staphylococcus aureus involves a fibronectin bridge between the bacterial

fibronectin-binding MSCRAMMs and host cell beta1 integrins. Eur J Cell Biol. 79:

672–679.

Gharib AA, Adel AMA, Bendary MM. 2013. Detection of the Coa Gene in Staphylococcus aureus

from different sources by polymerase chain reaction. Inter J Microb Res. 4(1): 37-42.

Goh SH, Byrne SK, Zhang JL, Chow AW. 1992. Molecular typing of Staphylococcus aureus on

the basis of coagulase gene polymorphisms. J Clin Microbiol. 30:1642–1645.

Gu CQ, Hu XY, Xie C-q, Zhang WP, Wang DH, Zhou Q, Cheng GF. 2013. Observation on

arthritis in broiler breeder chickens experimentally infected with Staphylococcus aureus.

Pak Vet J. 33(2): 195-199.

Hookey JV, Edwards V, Cookson BD, Richardson JF. 1999. PCR RFLP analysis of the coagulase

gene of Staphylococcus aureus: application to the differentiation of epidemic and

sporadic methicillin-resistant strains. J Hosp Infect. 42: 205–212.

Hussain R, Khan A, Javed MT, Rizvi F. 2012. Possible risk factors associated with mastitis in

indigenous cattle in Punjab, Pakistan. Pak Vet J. 32 (4): 605-608.

Hennekinne JA, Ostyn A, Guillier F, Herbin S, Prufer AL, Dragacci S. 2010. How should

staphylococcal food poisoning outbreaks be characterized? Toxins. 2: 2106-2116.

147

EXPERIMENT - 3

Janwithayanuchit I, Ngamululert S, Paungmoung P, Rangsipanuratn W. 2006. Epidemiologic

Study of methicillin-resistant Staphylococcus aureus by Coagulase Gene

polymorphism. Sci Asia. 32: 127-132.

Jonsson K, Signas C, Muller HP, Lindberg M. 1991. Two different genes encode fibronectin

binding proteins in Staphylococcus aureus. The complete nucleotide sequence and

characterization of the second gene. Eur J Biochem. 202: 1041–1048.

Kalorey DR, Shanmugam Y, Kurkure NV, Chousalkar KK, Barbuddhe SB. 2007. PCR based

detection of genes encoding virulence determinants in Staphylococcus aureus from

bovine subclinical mastitis cases. J Vet Sci. 8: 151–154.

Karimuribo ED, Fitzpatrick JL, Bell CE, Swai ES, Kambarage MD, Ogden NH, Bryant MJ, French

P. 2006. Clinical and subclinical mastitis in smallholder dairy farms in Tanzania: risk,

intervention and knowledge transfer. Preventive Vet med. 74(1): 84-98.

Kenar B, KuyucuogluY, Seker E. 2012. Antibiotic susceptibility of coagulase-negative

staphylococci isolated from bovine subclinical mastitis. Turk Pak Vet J. 32(3): 390-

393.

Khan A, Hussain R, Javed MT, Mahmood F. 2013. Molecular analysis of virulent genes (coa and

spa) of Staphylococcus aureus involved in natural cases of bovine mastitis. Pak J Agri Sci.

50: 739-743.

Kouidhi B, Zmantar T, Hentati H, Bakhrouf A. 2010. Cell surface hydrophobicity, biofilm

formation, adhesives properties and molecular detection of adhesins genes in

Staphylococcus aureus associated to dental caries. Microbial Pathog. 49: 14-22.

148

EXPERIMENT - 3

Kuypers JM, Proctor RA. 1989. Reduced adherence to traumatized rat heart valves by a low-

fibronectin-binding mutant of Staphylococcus aureus. Infect Immun. 57: 2306–

2312.

Kumar R, Yadav B, Anand S, Singh R. 2011. Molecular surveillance of putative virulence factors

and antibiotic resistance in Staphylococcus aureus isolates recovered from intra-mammary

infections of river buffaloes. Microbial pathogenesis. 51: 31-38.

Kumar R, Yadav BR, Anand SK, Singh RS. 2010. Prevalence of adhesin and toxin genes among

isolates of Staphylococcus aureus obtained from mastitic cattle. World J Microbiol

Biotechnol. 10: 483-487.

Luong TT, Dunman PM, Murphy E, Projan SJ, Lee CY. 2006. Transcription profiling of the mgrA

regulon in Staphylococcus aureus. J bacteriology. 188: 1899-1910.

Mishaan AMA, Mason EO, Martinez AG, Hammerman W, Propst JJ, Lupski JR. 2005. Emergence

of a predominant clone of community acquired Staphylococcus aureus

amongchildren in Houston, Texas J Ped Infect Dis. 24: 201-206.

Momtaz H, Tajbakhsh E, Rahimi E, Momeni E. 2011. Coagulase gene polymorphism of

Staphylococcus aureus isolated from clinical and sub-clinical bovine mastitis in

Isfahan and Chaharmahal va Bakhtiari provinces of Iran. Comp. Clin Pathol.

20:519–522.

Mork T, Tollersrud T, Kvitle B, Jorgensen J, Waage S. 2005. Comparison of Staphylococcus

aureus genotypes recovered from cases of bovine, ovine, and caprine mastitis. J

Clin Microbiol. 43: 3979–3984.

Morandi S, Brasca M, Lodi R, Brusetti L, Andrighetto C, Lombardi A. 2010. Biochemical profiles,

restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA

149

EXPERIMENT - 3

(RAPD) and multilocus variable number tandem repeat analysis (MLVA) for typing

Staphylococcus aureus isolated from dairy products. Res Vet Sci. 88: 427-435.

Nashev D, Toshkava K, Salasia SIO, Hassan AA, Lammler C, Zschock M. 2004. Distribution of

virulence genes of Staphylococcus aureus isolated from stable nasal carriers. FEMS.

Microbio Lett. 233: 45-52.

Novick RP. 2000. Pathogenicity factors and their regulation, p. 392–407. In V. A. Fischetti, R. P.

Novick, J. J. Ferretti, D. A. Portnoy, and J. I. Rood (ed.), Gram-positive pathogens.

ASM Press, Washington, D.C.

O’Riordan K, Lee JC. 2008. Staphylococcus aureus capsular polysaccharides. Clin Microb Rev.

17: 218–234.

Palmqvist N, Foster T, Fitzgerald JR, Josefsson E, Tarkowski A. 2005. Fibronectin-binding

proteins and fibrinogen-binding clumping factors play distinct roles in

staphylococcal arthritis andsystemic inflammation. J Infect Dis. 191(5): 791-798.

Radostits OM, Gay CC, Blood DC, Hinchcliff KW. 2000. Veterinary Medicine: A Textbook of

the Diseases of Cattle, Sheep, Pigs, Goats and Horses. 9th Ed. W. B. Saunders Co.,

Philadelphia, USA. P. 603-610.

Reinoso E, El-Sayed A, Lammler C, Bogni C, Zschock M. 2008. Genotyping of Staphylococcus

aureus isolated from humans, bovine subclinical mastitis and food samples in Argentina.

Microb Res. 163: 314-322.

Sabat A, Malachowa N, Miedzobrodzki J, Hryniewicz W. 2006. Comparison of PCR based

methods for typing Staphylococcus aureus isolates. J clin microb. 44: 3804-3807.

150

EXPERIMENT - 3

Saei HD, Ahmadi M, Mardani K, Batavani RA. 2009. Molecular typing of Staphylococcus aureus

isolated from bovine mastitis based on polymorphism of the coagulase gene in the

North West of Iran. Vet Microbio. 137: 202–206.

Salasia SI, Khusnan Z, Lamme RC, Zschock M. 2004. Comparative studies on pheno- and

genotypic properties of Staphylococcus aureus isolated from bovine subclinical mastitis in

central Java in Indonesia and Hesse in Germany. J Vet Sci. 5: 103–109.

Sanjiv K, Kataria AK, Sharma R, Singh G. 2008. Epidemiological typing of Staphylococcus

aureus by DNA restriction fragment length polymorphism of coa gene. Vet arhiv. 78: 31-

33.

Sindhu N, Sharma A, Jain VK. 2010. Coagulase gene based molecular detection of Staphylococcus

aureus directly from mastitic milk samples of murrah buffalo. Buff Bull. 29(1): 52-

59.

Smith EM, Green LE, Medley GF, Bird HE, Fox LK, Schukken YH, Kruze JV, Bradley AJ,

Zadoks RN, Dowson CG. 2005. Multilocus sequence typing of intercontinental

bovine Staphylococcus aureus isolates. J Clin Microbiol. 43: 4737–4743.

Su C, Kanevsky I, Jayarao BM, Sordillo LM. 2000. Phylogenetic relationships of Staphylococcus

aureus from bovine mastitis based on coagulase gene polymorphism. Vet

Microbiol. 71: 53–58.

Sudhir K, Sudhindra RG. 2000. Efficiency of the Neighbor Joining Method in Reconstructing

Deep and Shallow Evolutionary Relationships in Large Phylogenies. J Mol Evol.

51: 544–553.

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2011. MEGA 6.1: molecular evolutionary

genetics analysis version 6.0. Molecular biology and evolution. 30: 2725-2729.

151

EXPERIMENT - 3

Tollersrud T, Kenny, Reitz AJ, Lee JC. 2000. Genetic and serologic evaluation of capsule

production by bovine mammary isolates of Staphylococcus aureus and other

Staphylococcus spp. from Europe and the United States. J Clin Microbiol. 38:

2998–3003.

Upadhyay A, Kataria AK, Sharma R. 2012. Coagulase gene-based typing of Staphylococcus

aureus from mastitic cattle and goats from arid region in India. Comp Clinl

Pathol. 21(5): 605-610.

Vaudaux P, Yasuda H, Velazco MI. 1990. Role of host and bacterial factors in modulating

staphyl0c0ccal adhesion to implanted polymer surfaces. J Biom Appl. 5(2): 134–

153.

Voelk V, Graber HU, Borne BHP, Sartori C, Steiner A, Bodmer M, Landerer MCH. 2014. A

longitudinal study investigating the prevalence of Staphylococcus aureus genotype

B in seasonally communal dairy herds. J Dairy Sci. 97: 4184–4192.

Wisal M, Hamid M, Hadia E, Jalii I, Ali A. 2005. Coagulase gene polymorphism of Staphyloco-

ccus aureus strains isolated from human, animals and environment. Pak J Biol Sci. 8: 278-

280.

Woo P, Leung A, Leung K, Yuen K. 2001. Identification of slide coagulase positive, tube

coagulase negative Staphylococcus aureus by 16S ribosomal RNA gene sequencing.

Molecular Pathology. 54(4): 244-247.

Yapar N, Avkan VO. 2011. An investigation of genes coding fibronectin binding proteins in

Staphylococcus aureus isolated from carriers aged between 6 and 14 years. Turk J

Med Sci. 41 (3): 543-547.

152

EXPERIMENT - 3

Zmantar T, Chaieb K, Makni H, Miladi H, Abdallah FB, Mahdouani K. 2008. Detection by PCR

of adhesins genes and slime production in clinical Staphylococcus aureus. J Basic

Microbiol. 48: 308-314.

153

EXPERIMENT-2

CHAPTER 6 SUMMARY

Mastitis is one of the commonest problem in dairy herds; responsible for toll of economic

losses. The etiology is complex and considered to be the outcome of the interaction of various

factors associated with the host, pathogens and the environment. The present study was carried out

in two districts with different ecology i.e. Lahore and Bhimber. In the present study, prevalence of

mastitis, its risk factors, S. aureus (most common pathogen of mastitis), antibiotic sensitivity and

virulent factor coagulase and Fibronectin binding protein A were focused.

A cross sectional study was carried out between January to December 2012 to estimate the

prevalence of mastitis and to investigate various epidemiological risk factors. A total of 1036

buffaloes was examined for mastitis. Of the population studied, the animals examined in district

Lahore were 598 buffaloes belonging to 25 herds, while the remaining 438 were from 25 herds

maintained in Bhimber district. The overall prevalence of mastitis was recorded 49%. The

prevalence of mastitis in Lahore was 55.5%, while in district Bhimber it was 40.2%. Among

mastitis cases the prevalence of clinical mastitis was 10.2% as a whole. However, the prevalence

of clinical mastitis in district Lahore was 11.8%, whereas it was 8% in district Bhimber. The

overall prevalence of subclinical mastitis was 38.8%. The district wise prevalence of subclinical

mastitis was 43.6% and 32.2% in districts of Lahore and Bhimber, respectively. The overall

prevalence of mastitis was 40.2%, 46.5% and 52.6% in small, medium and large herds,

respectively. The quarter level prevalence was recorded as 16.20% (673/4144 quarters from 1036

animals). The district wise prevalence of mastitis at quarter level was recorded 18.17% in district

Lahore while it was 12.87% in district Bhimber. The buffaloes having mastitis in one quarter, two

quarters, three quarters and four quarters were 78.5%, 12%, 8% and 1.5%, respectively. The

154

SUMMARY

prevalence of mastitis was increased as the age of buffaloes increased. The prevalence of mastitis

was highest in Nili Ravi 52.2% as compared to Kundhi and non-descriptive 40% and 44.7%,

respectively.

In Univariable analysis: area, herd size, age, breed, parity, stage of lactation, reproductive

disorders, udder shape, previous exposure to mastitis, ease of milking, udder edema, lesion on

udder/teat, swelling on udder/teat, condition of floor, frequency of dung removal, exposure to

FMD, udder wash, teat dipping, milking techniques and tick infestation were significantly

associated (𝑃𝑃 < 0.25) with a prevalence of mastitis. These 20 significant variables were further

selected for multivariable analysis to estimate the independence of the effect of the variables. The

final models identified were area, age, breed, parity, stage of lactation, udder shape, ease of milking,

previous exposure to mastitis, udder edema, lesions on udder/teat, exposure to FMD, teat dipping

and tick infestation were significantly associated (p< 0.05) with a prevalence of mastitis.

A total of 673 mastitic quarter milk samples from different buffalo quarters were collected

from different livestock farms having 106 and 567 clinical and subclinical mastitis, respectively.

These milk samples were subjected to microbiological examination. From these milk samples, 236

isolates were confirmed as coagulase positive S. aureus. The sensitivity of gentamycin,

oxytetracycline, erythromycin, kanamycin, chloramphenicol, tylosin, ciprofloxacin. doxycycline,

amoxicillin, streptomycin and trimethoprim to S. aureus was 80.1%, 75.4%, 74.6%, 73.3%,

72.4%, 71.6%, 69.9%, 69.1%, 63.2%, 56% and 54.7%, respectively. While on the other hand the

resistant pattern of gentamycin, oxytetracycline, erythromycin, kanamycin, chloramphenicol,

tylosin, ciprofloxacin, doxycycline, amoxicillin, streptomycin and trimethoprim was 11%, 19.9%,

15.3%, 20.8%, 20.8%, 28.4%, 22.9%, 17.3%, 36.8%, 34.3% and 45.3%, respectively.

155

SUMMARY

The identification of virulence factors such as the coa and fnbA is necessary for minimizing

and control strategies of mastitis. The virulent genes were amplified by using gene specific primers.

In case of coa gene the PCR amplicon products were categorized into five classes on the basis of

their molecular size on electrophoresis of agarose gel. Approximately the product size was from

430 to 840 bp. But, the majority of isolates were having product size 575 bp. In case of fnbA gene

all the strains having same product size 1150 bp on agarose gel. The PCR products were sent to

Australian Genome Research Facility Ltd, University of Adelaide for sequencing. In phylogenetic

analysis it revealed that the coa gene of S. aureus strains, isolated were grouped in two clades

which were closely related to S. aureus isolates from Japan, India and Taiwan, while S. aureus

isolates from Germany, UK and Canada were distantly related. These findings will be helpful in

future for mastitis control strategies. In case of fnbA gene sequences showed, that all Pakistani

isolates were grouped in one clades with high boot strap values showing closeness with isolates

from Switzerland and Ireland. While isolates from Thailand and USA were placed distantly.

The pairwise distance of coa showed that similarities and divergence showed that all the

Pakistani strains of coagulase gene were 99.98-100% similar while their divergence was 0.02%.

The Japanizes strains were close to Pakistan strains and their similarity and divergence was 99.97%

and 0.03%, respectively. The Pakistani strains were 99.93% similar and 0.07% divergent from

Indian and German strains. Similarly, Pakistani strains were 99.94% similar and 0.06% were

divergent from the UK and Taiwan reported strains. The pairwise distance of fnbA showed that

similarities and divergence showed that all the Pakistani strains of fnbA were 99.96-100% similar

while their divergence was 0.04%. The Switzerland strains were close to Pakistan strains and their

similarity and divergence was 97.1% and 2.9%, respectively. The Pakistani strains were 96-97.2%

156

SUMMARY

similar and 2.8-3.2% divergent from strains reported from Ireland. The Pakistani strains were 91.3-

91.8% similar and 8.2-8.7% were divergent from Thailand and USA reported strains.

Mastitis can be minimized by improving the management and animal related these

potential risk factors. Screening of lactating buffaloes should be done on a regular basis. Pre and

post teat dipping is recommended. Wear the gloves or hand wash before and after milking. The

mastitis treatment should be started after antibiotic sensitivity and select the appropriate antibiotic.

These molecular information of virulent genes of S. aureus could be helpful in the control of

mastitis and development of vaccines.

157

epidemiological investigation of risk factors of …

Documents