enhancing methane production during the anaerobic digestion of crude

8/13/2019 Enhancing Methane Production During the Anaerobic Digestion of Crude

1/6

Enhancing methane production during the anaerobic digestion of crude

glycerol using Japanese cedar charcoal

Ryoya Watanabe a,b, Chika Tada a,, Yasunori Baba a, Yasuhiro Fukuda a, Yutaka Nakai a,

a Laboratory of Sustainable Environmental Biology, Graduate School of Agricultural Science, Tohoku University, Yomogida 232-3, Naruko-onsen, Osaki, Miyagi 989-6711, Japanb Dept. of Civil and Environmental Engineering, Tohoku University, 6-6-06 Aoba, Sendai, Miyagi 980-8579, Japan

h i g h l i g h t s

The use of Japanese cedar charcoal as

a support could enhance methane

production.

It was achieved to operate the highest

OLR of crude glycerol in the previous

studies.

Methane production yield containing

charcoal was about 1.6 times higher

than without.

Propionate degradation was

enhanced on charcoal by attached

microorganisms.

The use of Japanese cedar charcoal in

anaerobic digestion is a sustainable

practice.

g r a p h i c a l a b s t r a c t

a r t i c l e i n f o

Article history:

Received 8 August 2013

Received in revised form 3 October 2013

Accepted 9 October 2013

Available online 16 October 2013

Keywords:

Anaerobic digestion

Methane

Glycerol

Charcoal

Microbial community

a b s t r a c t

The use of Japanese cedar charcoal as a support material for microbial attachment could enhance

methane production during anaerobic digestion of crude glycerol and wastewater sludge. Methane yield

from a charcoal-containing reactor was approximately 1.6 times higher than that from a reactor without

charcoal, and methane production was stable over 50 days when the loading rate was 2.17 g chemical

oxygen demand (COD) L1 d1. Examination of microbial communities on the charcoal revealed the

presence of UnculturedDesulfovibriosp. clone V29 and Pelobacter seleniigenes, known as 1,3-propandiol

degraders. Hydrogenotrophic methanogens were also detected in the archaeal community on the

charcoal. Methanosaeta, Methanoregula, and Methanocellus were present in the charcoal-containing

reactor. The concentration of propionate in the charcoal-containing reactor was also lower than that in

the control reactor. These results suggest that propionate degradation was enhanced by the consumption

of hydrogen by hydrogenotrophic methanogens on the charcoal.

2013 Elsevier Ltd. All rights reserved.

1. Introduction

Biodiesel fuel is increasingly being produced for use in public

transportation (Dube et al., 2007). However, glycerol is generated

during the manufacture of biodiesel, and an efficient waste-treat-

ment system for the glycerol byproduct is required (Du et al.,

2003; Vicente et al., 2004).

Because crude glycerol contains a high concentration of organic

matter, large amounts of methane (CH4) can be generated from

small volumes of glycerol during anaerobic digestion (Yang et al.,

2008). Most studies of the anaerobic digestion of glycerol have

used loading rates of approximately 1.0 g chemical oxygen demand

(COD) L1 d1 (Astals et al., 2012; Nakamura et al., 2008; Robra

et al., 2010). Further study is needed to determine the treatment

capability when operating at higher glycerol loading rates.

0960-8524/$ - see front matter 2013 Elsevier Ltd. All rights reserved.http://dx.doi.org/10.1016/j.biortech.2013.10.030

Corresponding authors. Tel.: +81 229 84 7395; fax: +81 229 84 7391.

E-mail addresses: [email protected] (C. Tada), [email protected]

(Y. Nakai).

Bioresource Technology 150 (2013) 387392

Contents lists available at ScienceDirect

Bioresource Technology

j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / b i o r t e c h
http://dx.doi.org/10.1016/j.biortech.2013.10.030mailto:[email protected]:[email protected]://dx.doi.org/10.1016/j.biortech.2013.10.030http://www.sciencedirect.com/science/journal/09608524http://www.elsevier.com/locate/biortechhttp://www.elsevier.com/locate/biortechhttp://www.sciencedirect.com/science/journal/09608524http://dx.doi.org/10.1016/j.biortech.2013.10.030mailto:[email protected]:[email protected]://dx.doi.org/10.1016/j.biortech.2013.10.030http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://crossmark.crossref.org/dialog/?doi=10.1016/j.biortech.2013.10.030&domain=pdfhttp://-/?-


2/6

Immobilization of microorganisms on waste or other support

material is a widely used technique in anaerobic digestion for pro-

ducing biogas. Parameters such as specific surface area, porosity,

surface roughness, pore size, and the orientation of the packing

material influence the performance of anaerobic filter reactors

(Elmitwalli et al., 2000; Picanco et al., 2001; Yang et al., 2004).

Manufactured materials including activated carbon, polyurethane,

and clay have been used as support materials for microorganisms

(Hansen et al., 1999).

To safely reuse digested fluids as liquid fertilizer on agricultural

fields, it is necessary to use natural support materials for microbial

colonization. Most trees in Japans forest plantations are Japanese

cedar (Cryptomeria japonica) (Ministry of Agriculture, 2011).

Japanese cedar is no longer used as a building material, and the

condition of plantation forests has consequently deteriorated.

Improved forestry management, including thinning of Japanese

cedar trees, is now required, necessitating innovative uses for the

thinned trees. Carbonization is one technique that has been consid-

ered; the pore size of Japanese cedar charcoal is larger than that of

oak charcoal, and the pores are linear and regularly spaced (Saito

and Arima, 2007). Charcoal produced from Japanese cedar has

the ability to absorb chloroform and trichloroethylene in drinking

water (Abe et al., 2001).

In this study, the use of Japanese cedar charcoal as a support

material for microorganisms during anaerobic digestion of glycerol

was investigated. The functions of microorganisms attached to the

support material were examined by gene analysis.

2. Methods

2.1. Wastewater sludge substrate and crude glycerol

The wastewater sludge used as substrate was obtained from a

noodle factory (Table 1). Crude glycerol (47 8.6% pure glycerol,

11.3 mg L1 P2O5, 20.0 g L1 K2O) was obtained from a biodiesel

production company in Osaki City, Japan. The COD of the crude

glycerol was 1477 235 g L1. Total solids (TS), volatile total solids

(VS), and density were 7.5%, 72.1%, and 1.02 g cm3, respectively.

2.2. Effect of support material injection

Two single-step anaerobic bioreactors (1.5 L active volume

each) were employed in the study (Fig. 1). Charcoal (pore

size= 50lm) from thinned Japanese cedar was placed into one

reactor and the other was used as a control. Each reactor was

inoculated with 1000 mL of seed sludge harvested from a full-scale

anaerobic digester. The seed sludge was fed with a synthetic

medium as described in a previous report (Yang et al., 2004). The

two reactors were operated in semi-continuous mode with a hydraulic

retention time of 30 days. Temperature was maintained at 35 C.

2.3. Conditions of crude glycerol loading

Crude glycerol was dosed into the reactor every day during the

experiment. The first period of operation ran from days 0 to 12,

during which crude glycerol was added at 0.375 mL d1 (0.54

g-COD L1 d1). The second period of operation ran from day 13

to day 34, during which crude glycerol was added at 0.75 mL d1

(1.09 g-COD L1 d1). The final period of operation was performed

from day 35 to day 85, during which crude glycerol was added at

1.5 mL d1 (2.17 g-COD L1 d1).

2.4. Chemical analysis

Total solids were analyzed according to Japanese standard

methods (JSWA, 1997). Total C and total N were measured with

an on-line TOC-VCSH (Shimadzu, Kyoto, Japan) operated at

680 C using high-purity air as the carrier gas at a flow rate of

150 mL min1. Volatile fatty acids (VFAs) were determined by

high-performance liquid chromatography (HPLC) (Jasco, Tokyo,

Japan) equipped with an ion-exchange column (RSpak KC-811;

Shodex, Japan) at 60 C using 3 mM HClO4 as eluent at a flow rate

of 0.8 ml min1 and a UV detector (870-UV; Jasco). COD was

measured using a colorimetric method with Hach 01500 mg L1

vials (Jirka and Carter, 1975). Samples were centrifuged for

15 min at 3000 rpm and the supernatant as filtered through

0.45-lm cellulose filters.

Gas samples were collected in gas bags (PVDF); CH4 and CO2contents were determined using a gas chromatograph (GC-8A, Shi-

madzu, Kyoto, Japan) with a thermal conductivity detector

equipped with a Porapak-Q column (Shinwakakou, Kyoto, Japan).

2.5. Scanning electron microscopy

At the end of operation, the surfaces of the support materials

were observed via scanning electron microscopy (SEM) (SU8000,

Hitachi, Tokyo, Japan). Tissue of Japanese cedar was fixed for 3 h

in 4% glutaraldehyde containing 0.1 M sodium cacodylate buffer

at 4 C (Ramage et al., 2002). Tissue samples were then dehydrated

through an ethanol gradient as follows: 50% for 40 min, 70% for

40 min, 80% for 40 min, 90% for 40 min, and 100% for 40 min (this

last dehydration step was repeated twice). After dehydration,samples were treated with a mixture of 100% ethanol and t-butyl

alcohol (1:1) for 30 min, and then three times (30 min each) with

t-butyl-alcohol. Finally, samples were frozen in saturatedt-butyl-

alcohol at 4 C. Operation of the SEM was commissioned to Tohoku

University, Sendai, Japan.

2.6. Polymerase chain reactiondenaturing gradient gel

electrophoresis and sequencing

Fluid samples were collected from each reactor after 25 d

(crude glycerol addition = 0.75 mL d1) and after 53 d (crude

glycerol addition = 1.5 mL d1). Samples of the attached support

materials were collected at the end of the operation. DNA was

extracted using a Power Soil

DNA Isolation Kit (Mo Bio Laboratories,Inc., Carlsbad, CA, USA) according to the manufacturers instruc-

tions. The bacterial 16S rRNA gene sequences were amplified by

polymerase chain reaction (PCR) with the primer sets 968F

(50-AACGCGAAGAACCTTAC-30) and 1401R (50-CGGTGTGTA

CAAGGCCCGGGAACG-30) (Heuer et al., 1997). The bacterial PCR

reaction consisted of 25 cycles of 30 s at 94 C, 30 s at 55 C, and

1 min at 72 C. Archaeal 16S rRNA gene sequences were amplified

by PCR with the primer set 1106F (50-TTWAGTCAGGCAACGAGC-30)

and 1378R (50-TGTGCAAGGAGCAGGGAC-30) (Lu et al., 2009). The

archaeal PCR reaction consisted of 30 cycles of 30 s at 94 C, 30 s

at 52 C, and 1 min at 72 C. For denaturing gradient gel electro-

phoresis (DGGE), primers 968F and 1106F contained a 40-bp GC

clamp (CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCG)

(Cheng et al., 2009). DGGE of the PCR-amplified 16S rRNA geneswas performed using a D-code multiple system (Bio-Rad, Hercules,

Table 1

Characteristics of waste sludge from noodle production.

Parameter Unit Average

TS % 6.4 5.6

pH 6.88 0.11

VFA g L 1 0.72 0.35

T-CODcr g L 1 18.3 3.1

Total-C g L 1 0.87 0.7

Total-N g L 1 0.21 0.17

388 R. Watanabe et al. / Bioresource Technology 150 (2013) 387392


3/6

CA, USA). Polyacrylamide gels, consisting of 8% acrylamidebis-

acrylamide mixture (37.5:1.0) in 0.5

TAE buffer with a gradientof 3070% denaturant, were prepared according to the manufac-

turers guidelines (Muyzer et al., 1993). One hundred percent dena-

turing acrylamide was defined as 7 M urea and 40% formamide,such that 30% denaturant corresponded to 2.1 M urea and 12%

Fig. 1. Schematic of two single-step anaerobic reactors; (a) control, (b) Japanese cedar charcoal containing reactor.

Fig. 2. Cumulative methane production in each reactor during the operational period at different operational loading rates (OLRs).

Table 2

Volatile fatty acid (VFA) concentration and composition in each reactor during the operational period.

VFA (g L-1)

Control Japanese cedar charcoal

Acetate Propionate Isobutyrate Acetate Propionate Isobutyrate

Day 13 0 0 4.35 0 0 2.88

25 0 0 3.51 0 0 3.61

37 0 0 3.14 0 0 2.96

45 0 0 2.30 0 0 3.19

53 0.53 0.49 1.79 0.19 0 2.91

61 0.20 0 2.59 0.61 0.08 2.44

73 1.89 1.97 0.33 1.06 0.37 1.60

81 0.16 4.51 0.46 0.95 0.65 1.60

R. Watanabe et al. / Bioresource Technology 150 (2013) 387392 389
http://-/?-http://-/?-http://-/?-


4/6

formamide. Gels were run for 12 h at 100 V in 1TAE buffer at a

constant temperature of 60 C. After electrophoresis, the gels were

stained for 15 min in 1 TAE buffer containing 100 ng mL1

GelStar Nucleic Acid Gel Stain (Lonza Rockland, Rockland, ME,

USA), the DNA bands were excised and transferred to 1.5-mL tubes

containing 70 lL TE buffer. Part of each aliquot (1 lL) was used as

the template for PCR to sequence the DNA bands using primer sets

without the GC clamp. (Oishi et al., 2012). The PCR product was

purified in a polyethylene glycol (13% PEG-6000, 1.6 M NaCl)

precipitation. The purified DNA was sequenced using a Big Dye

Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster

City, CA, USA) and an ABI Prism-310 automated sequence analyzer

(Applied Biosystems, Foster City, CA, USA). The determined sequences

were compared with known 16S rRNA sequences by a nucleotide-

nucleotide BLAST search (http://blast.ddbj.nig.ac.jp/top-j.html ).

3. Results and discussion

3.1. Degradation efficiency following addition of support materials

Cumulative methane production in the experimental and con-

trol reactors is illustrated in Fig. 2. There was little difference be-

tween the two reactors during the first and second periods of

operation; however, during the final period of operation, methane

production in the charcoal-containing reactor was higher than that

in the control. Cumulative methane production in the charcoal-

containing reactor was more than 1.6 times higher than that in

the control reactor.Nakamura et al. (2008)examined thermophilic

anaerobic digestion (55 C) of mixed materials including glycerol

and food waste operated at a loading of 1.02.0 g-COD L1 d1,

and found that methane production and pH decreased when COD

loading increased to 2.0 g-COD L1 d1.Yang et al. (2008)reported

methanogenic fermentation of glycerol under mesophilic condi-

tions using a polyurethane support for 120 days, but their loading

rate was only 0.7 g-COD L1 d1.

In this study, methane production from the reactor containingJapanese cedar charcoal was stable for 50 days when the loading

rate was increased to 2.17 g-COD L1 d1. This is the highest organ-

ic loading rate using crude glycerol currently reported. Stable oper-

ating conditions were also achieved for longer than previously

reported.

Some VFAs (acetic acid, propionic acid, isobutyric acid, butyric

acid, valeric acid, isovaleric acid) were detected in both reactors.

The dominant VFAs were acetic acid, propionic acid, and isobutyric

acid; details on the contents of these compounds are presented in

Table 2. Propionic acid was detected in the control reactor at a con-

centration of 490 mg L1 after 53 days, but was not observed in the

charcoal-containing reactor until day 61. The propionic acid con-

centration increased to 4510 mg L1 by day 81 in the control reac-

tor and to 650 mg L1

in the charcoal-containing reactor.A decrease in methane production was seen in the control reac-

tor due to the increasing levels of propionic acid, consistent with

other reports that methane production decreases when propionate

accumulates (Gallert and Winter, 2008). The accumulation of pro-

pionate began earlier in the control than in the charcoal-containing

reactor, which also had a lower concentration of propionate. These

results suggest that propionate was more efficiently degraded in

the presence of charcoal.

The pH values of the control and charcoal-containing reactors at

the end of the experiment were 5.87 and 6.72, respectively, and pH

was maintained at >6.7 in the charcoal-containing reactor. The

optimum pH for propionate degradation is reported to be between

6.8 and 7.3 (Fukuzaki et al., 1990). Using charcoal as a support

material resulted in pH conditions better suited for methane pro-duction. The cost of alkaline agents required to maintain pH above

B1

B2

B3

B4

B5

(a) Bacterial (b) Archaeal

A1A2

A3

A4

A5

Fig. 3. Results of denaturing gradient gel electrophoresis (DGGE) analysis for (a)

bacterial and (b) archaeal communities on Japanese cedar charcoal.

C1 C2 J1 J2

B1

B2

B3

B4

B5

B6B7

B8

B10

Fig. 4. Results of denaturing gradient gel electrophoresis (DGGE) analysis for

bacterial communities in the fluid of each reactor for different levels of crude

glycerol using the primer sets 968F and 1401R, (C1: control, 0.75 mL d

1, C2:control, 1.5 mL d1, J1: Japanese cedar, 0.75 mL d1, J2: Japanese cedar, 1.5 mL d1).

http://-/?-http://-/?-


5/6

6.87.3 can be prohibitive to the operation of anaerobic digestion

processes. Furthermore, the addition of alkaline agents raises the

concentrations of sodium and other salts, raising the risk of salt

damage when the digested liquid is used as fertilizer for vegetable

cultivation (Shannon and Grieve, 1999). The use of Japanese cedar

charcoal as a support material reduces the need for the addition of

alkaline agents to maintain pH, and thus minimizes the salt con-

centration in the digested liquid. The use of charcoal can alsoreplenish carbon when the digested liquid is applied to paddy

fields (Zhang et al., 2010).

3.2. Differences in the microbial communities of the two reactors

The SEM photos of Japanese cedar charcoal before and after cul-

tivation revealed rods and cocci of several microorganisms adhered

to the pores of the charcoal. During the final period of operation,

five bands for both the bacterial and the archaeal community were

detected from the charcoal (Fig. 3). Bands B02 and B03 were related

to uncultured Desulfovibrio sp. clone V29 (94% similarity) and

Pelobacter seleniigenes(95% similarity), respectively.These bacteria

are reported to be involved in the degradation of 1,3-propanediol

to propionic acid (Oppenberg and Schink, 1990; Qatibi et al., 1991).In the archaeal community, A02 was related to Methanoregula

formicicumSMSP (98% similarity), and A05 was related to Methano-

cellus sp. SMA-21 (93% similarity), both of which are hydrogeno-

trophic methanogens. Propionic acid degradation is accelerated

in the presence of H2-utilizing methanogen cells (Fukuzaki et al.,

1990). These methanogens are believed to contribute to the degra-

dation of propionate acid by consuming hydrogen.

The bacterial community in the fluid of each reactor during the

second and final periods of operation is presented in Fig. 4. Bands

B1, B2, and B3 were only detected in the fluid of the charcoal-con-

taining reactor. Band B1 was related to Serratia liquefaciens (97%

similarity), B2 to Klebsiella pneumonia (99% similarity), and B3 to

Klebsiella sp. (98% similarity); Klebsiella variicola (96% similarity)

was detected in liquid from the control reactor (Table 3).Klebsiellaspp. have also been reported to degrade glycerol to 1,3-propane-

diol (Nakamura and Whited, 2003; Nemeth et al., 2003; Wu

et al., 2008). These results suggest that the bacterial communities

on charcoal enhance the conversion of glycerol to propionate

(Fig. 5).

The archaeal communities in the reactor fluids during the sec-

ond and final periods of operation are illustrated in Fig. 6. Bands

A1, A2, and A5 were related toMethanospillumsp. (94% similarity),

M. formicicum (95% similarity), andMethanoculleus sp. IIE1 (98%

similarity), respectively, which are hydrogenotrophic methano-

gens (Table 4). Bands A3 and A4 were aceticlastic methanogens re-

lated toMethanosaeta concilii (98% similarity) and Methanosarcina

sp. SMA-21 (97% similarity), respectively. There was little differ-

ence in the archaeal communities between the control and exper-

imental reactors. Analysis of VFAs showed the progressive

degradation of propionate, suggesting the presence of hydrogeno-

trophic methanogens; Gibbs free energy indicates that hydrogen is

consumed when propionate is degraded (McCarty, 1981).

The degradation of propionate was faster, and the methane

yield was greater, in the charcoal-containing reactor than in the

control reactor (Table 2, Fig. 1). These findings suggested that

much of the methane originated from hydrogen and that a greater

number of hydrogenotrophic methanogens was present in the

charcoal-containing reactor than in the control. Further quantita-tive study, such as real-time PCR, is necessary to evaluate these

inferences.

Table 3

Sequence analysis of excised bacterial bands that appear in Fig. 4.

Band Reactor Accession

number

Closest relative Similarity

(%)

B1 J AB004752 Serratia liquefaciens 97

B2 J EU360793 Klebsiella pneumoniae 99

B3 J JN049594 Klebsiella sp. 98

B4 J,C HQ407284 Klebsiella variicola 96

B5 C CU466930 Candidatus Cloacamonacidam inovorans

95

B6 J AF327558 Endosymbiont of Folsomia

candida

99

B7 J,C AY169413 Finegodia magna 87

B8 C FR737799 Staphylococcus epidermidis 88

B9 C JF802205 Delta proteobatcerium S3R1 89

J: Japanese cedar charcoal; C: control.

Fig. 5. The process of bacterial conversion of glycerol to propionate.

C1 C2 J1 J2

A1

A3

A4

A5

A2

Fig. 6. Results of denaturing gradient gel electrophoresis (DGGE) analysis of

archaeal communities in the fluid of each reactor for different levels of crude

glycerol (C1: control, 0.75 mL d1, C2: control, 1.5mL d1, J1: Japanese cedar,

0.75mL d1, J2: Japanese cedar, 1.5 mL d1).

Table 4

Sequence analysis of excised archaeal bands that appear in Fig. 6.

Band Reactor Accession

number

Closest relative Similarity

(%)

A1 J,C AJ133792 Methanospirillumsp. 94

A2 J AB479390 Methanoregula formicicum

SMSP

95

A3 J,C CP002565 Methanosaeta conciliiGP-6 98

A4 J,C JF812255 Methanosarcina sp. SMA-21 97

A5 J,C AB089178 Methanoculleus sp. IIE1 98

J: Japanese cedar charcoal; C: control.

R. Watanabe et al. / Bioresource Technology 150 (2013) 387392 391
http://-/?-http://-/?-http://-/?-


6/6

In this analyses revealed differences in the microbial commu-

nity when charcoal was included as a microbial substrate for the

anaerobic digestion of glycerol. Operation of two horizontal-flow

anaerobic immobilized biomass reactors containing either charcoal

or expanded clay and polyurethane foam generated different

microbial communities on the different support materials (Lima

de Oliveira et al., 2009).Yang et al. (2004)also reported on effects

of support materials on the performance of methanogenic fluidized

bed reactors. Four kinds of support materials (carbon filter, rock

wool, loofah sponge, and polyurethane foam) were evaluated,

and microbial analyses indicated differences among the archaeal

communities (Yang et al., 2004). These reports suggest that the

presence of charcoal causes changes in the microbial community,

as observed in the present study.

4. Conclusions

Charcoal produced from Japanese cedar was determined to be a

useful support material, allowing the attachment of microbes that

produced methane from glycerol. Propionate degradation was en-

hanced by hydrogenotrophic methanogens attached to charcoal.

Cumulative methane production in the charcoal-containing reactor

was about 1.6 times higher than control, and this production re-

mained stable during 50 days at 2.17 g-COD L1 d1.

The use of Japanese cedar charcoal in anaerobic digestion of

glycerol is a sustainable practice that not only enhances the pro-

duction of methane but also allows for the use of digested liquid

on rice paddies and arable fields.

References

Abe, I., Fukuhara, T., Maruyama, J., Tatsumoto, H., Iwasaki, S., 2001. Preparation of

carbonaceous adsorbents for removal of chloroform from drinking water.

Carbon 39 (7), 10691073.

Astals, S., Nolla-Ardevol, V., Mata-Alvarez, J., 2012. Anaerobic co-digestion of pig

manure and crude glycerol at mesophilic conditions: biogas and digestate.

Bioresour. Technol. 110, 6370.

Cheng, Y.F., Mao, S.Y., Liu, J.X., Zhu, W.Y., 2009. Molecular diversity analysis ofrumen methanogenic Archaea from goats in eastern China by DGGE methods

using different primer pairs. Lett. Appl. Microbiol. 48 (5), 585592 .

Du, W., Xu, Y., Liu, D., 2003. Lipase-catalyzed transesterification of soya bean oil for

biodiesel production during continuous batch operation. Biotechnol. Appl.

Biochem. 38 (2), 103106.

Dube, M.A., Treblay, A.Y., Liu, J., 2007. Biodiesel production using a membrane

reactor. Bioresour. Technol. 98 (3), 639647.

Elmitwalli, T.A., van Dun, M., Bruning, H., Zeeman, G., Lettinga, G., 2000. The role of

filter media in removing suspended and colloidal particles in an anaerobic

reactor treating domestic sewage. Bioresour. Technol. 72 (3), 235242.

Fukuzaki, S., Nishio, N., Shobayashi, M., Nagai, S., 1990. Inhibition of the

fermentation of propionate to methane by hydrogen, acetate, and propionate.

Appl. Environ. Microbiol. 56 (3), 719723.

Gallert, C., Winter, J., 2008. Propionic acid accumulation and degradation during

restart of a full-scale anaerobic biowaste digester. Bioresour. Technol. 99 (1),

170178.

Hansen, K.H., Angelidaki, I., Ahring, B.K., 1999. Improving thermophilic anaerobic

digestion of swine manure. Water Res. 33 (8), 18051810.

Heuer, H., Krsek, M., Baker, P., Smalla, K., Wellington, E.M., 1997. Analysis ofactionmycetes communities by specific amplification of genes encoding 16S

rRNA and gel-electrophiretic separation in denaturing gradients. Appl. Environ.

Microbiol. 63 (8), 32333241.

Jirka, A., Carter, M., 1975. Micro-semi-automated analyses of surface and

wastewaters for chemical oxygen demand. Anal. Chem. 47, 13971402.

JSWA, 1997. Examination method for wastewater and sludge. Japan Sewage Works

Association, Tokyo, p. 812 (in Japanese).

Lima de Oliveira, L., Silveira Duarte, I.C., Sakamoto, I.K., Amncio Varesche, M.B.,

2009. Influence of support material on the immobilization of biomass for the

degradation of linear alkylbenzene sulfonate in anaerobic reactors. J. Environ.

Manage. 90 (2), 12611268.

Lu, Y., Lai, Q., Zhang, C., Zhao, H., Ma, K., Zhao, X., Chen, H., Liu, D., Xing, X.H., 2009.

Characteristics of hydrogen and methane production from cornstalks by an

augmented two- or three-stage anaerobic fermentation process. Bioresour.Technol. 100 (12), 28892895.

McCarty, P. L., 1981. History and overview of anaerobic digestion. In Second

International Symposium on Anaerobic Digestion.

Ministry of Agriculture, Forestryand Fisheries, Japan, 2011. Annual Report on Forest

and Forestry in Japan.

Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial

populations by denaturing gradient gel electrophoresis analysis of polymerase

chain reaction-amplified genes coding for 16S ribosomal-RNA. Appl. Environ.

Microbiol. 59 (3), 695700.

Nakamura, C.E., Whited, G.M., 2003. Metabolic engineering for the microbial

production of 1,3-propanediol. Curr. Opin. Biotechnol. 14 (5), 454459.

Nakamura, K., Kishi, Y., Ikegami, M., 2008. Application of waste glycerin liquid

produced from biodiesel productionto methane fermentation. J. Jpn. Soc. Waste

Manage. Experts 19 (1), 916.

Nemeth, A., Kupcsulik, B., Sevella, B., 2003. 1,3-propanediol oxidoreductase

production with Klebsiella pneumonia DSM2026. World J. Microbiol.Biotechnol. 19 (7), 659663.

Oishi, R., Tada, C., Asano, R., Yamamoto, N., Suyama, Y., Nakai, Y., 2012. Growth of

ammonia-oxidizing archear and bacteria in cattle manure compost under

various temperatures and ammonia concentrations. Microb. Ecol. 63 (4), 787

793.

Oppenberg, B., Schink, B., 1990. Anaerobic degradation of 1,3-propanediol by

sulfate-reducing and fermenting bacteria. Antonie Van Leeuwenhoek 57 (4),

205213.

Picanco, A.P., Vallero, M.V., Gianotti, E.P., Zaiat, M., Blundi, C.E., 2001. Influence of

porosity and composition of supports on the methanogenic biofilm

characteristics developed in a fixed bed anaerobic reactor. Water Sci. Technol.

44 (4), 197204.

Qatibi, A.I., Bories, A., Garcia, J.L., 1991. Sulfate reduction and anaerobic glycerol

degradation by a mixed microbial culture. Curr. Microbiol. 22 (1), 4752.

Ramage, G., Saville, S.P., Wickes, B.L., Lopez-Ribot, J.L., 2002. Inhibition ofCandidaalbicans biofilm formation by farnesol, a quorum-sensing molecule. Appl.Environ. Microbiol. 68 (11), 54595463.

Robra, S., Serpa da Cruz, R.S., de Oliveira, A.M., Almeida Neto, J.A., Santos, J.V., 2010.

Generation of biogas using crude glycerin from biodiesel production as

supplement to cattle slurry. Biomass Bioenerg. 34 (9), 13301335.

Saito, Y., Arima, T., 2007. Features of vapor-grown cone-shaped graphitic whiskersdeposited in the cavities of wood cells. Carbon 45 (2), 248255 .

Shannon, M.C., Grieve, C.M., 1999. Tolerance of vegetable crops to salinity. Sci.

Hortic. 78, 538.

Vicente, G., Martinez, M., Aracil, J., 2004. Integrated biodiesel production: a

comparison of different homogeneous catalysts systems. Bioresour. Technol.

92 (3), 297305.

Wu, K.J., Saratalae, G.D., Lo, Y.C., Chen, W.M., Tseng,Z.J., Chang, M.C., Tsai, B.C., Su, A.,

Chang, J.S., 2008. Simultaneous production of 2,3-butanediol, ethanol and

hydrogen with a Klebsiella sp. strain isolated from sewage sludge. Bioresour.Technol. 99 (17), 79667970.

Yang, Y., Tada, C., Miah, M.S., Tsukahara, K., Yagishita, T., Sawayama, S., 2004.

Influence of bed materials on methanogenic characteristics and immobilized

microbes in anaerobic digester. Mater. Sci. Eng., C. 24 (3), 413419.

Yang, Y., Tsukahara, K., Sawayama, S., 2008. Biodegradation and methane

production from glycerol-containing synthetic wastes with fixed-bed

bioreactor under mesophilic and thermophilic anaerobic conditions. Process

Biochem. 43 (4), 362367.

Zhang, A., Cui, L., Pan, G., Li, L., Hussain, Q., Zhang, X., Zheng, J., Crowley, D., 2010.

Effect of biochar amendment on yield andmethane andnitrous oxide emissionsfrom a rice paddy from Tai Lake plain, China. Agric. Ecosyst. Environ. 139 (4),

469475.

http://refhub.elsevier.com/S0960-8524(13)01610-6/h0005http://refhub.elsevier.com/S0960-8524(13)01610-6/h0005http://refhub.elsevier.com/S0960-8524(13)01610-6/h0005http://refhub.elsevier.com/S0960-8524(13)01610-6/h0010http://refhub.elsevier.com/S0960-8524(13)01610-6/h0010http://refhub.elsevier.com/S0960-8524(13)01610-6/h0010http://refhub.elsevier.com/S0960-8524(13)01610-6/h0015http://refhub.elsevier.com/S0960-8524(13)01610-6/h0015http://refhub.elsevier.com/S0960-8524(13)01610-6/h0015http://refhub.elsevier.com/S0960-8524(13)01610-6/h0020http://refhub.elsevier.com/S0960-8524(13)01610-6/h0020http://refhub.elsevier.com/S0960-8524(13)01610-6/h0020http://refhub.elsevier.com/S0960-8524(13)01610-6/h0020http://refhub.elsevier.com/S0960-8524(13)01610-6/h0025http://refhub.elsevier.com/S0960-8524(13)01610-6/h0025http://refhub.elsevier.com/S0960-8524(13)01610-6/h0030http://refhub.elsevier.com/S0960-8524(13)01610-6/h0030http://refhub.elsevier.com/S0960-8524(13)01610-6/h0030http://refhub.elsevier.com/S0960-8524(13)01610-6/h0035http://refhub.elsevier.com/S0960-8524(13)01610-6/h0035http://refhub.elsevier.com/S0960-8524(13)01610-6/h0035http://refhub.elsevier.com/S0960-8524(13)01610-6/h0035http://refhub.elsevier.com/S0960-8524(13)01610-6/h0040http://refhub.elsevier.com/S0960-8524(13)01610-6/h0040http://refhub.elsevier.com/S0960-8524(13)01610-6/h0040http://refhub.elsevier.com/S0960-8524(13)01610-6/h0045http://refhub.elsevier.com/S0960-8524(13)01610-6/h0045http://refhub.elsevier.com/S0960-8524(13)01610-6/h0050http://refhub.elsevier.com/S0960-8524(13)01610-6/h0050http://refhub.elsevier.com/S0960-8524(13)01610-6/h0050http://refhub.elsevier.com/S0960-8524(13)01610-6/h0050http://refhub.elsevier.com/S0960-8524(13)01610-6/h0060http://refhub.elsevier.com/S0960-8524(13)01610-6/h0060http://refhub.elsevier.com/S0960-8524(13)01610-6/h0060http://refhub.elsevier.com/S0960-8524(13)01610-6/h0160http://refhub.elsevier.com/S0960-8524(13)01610-6/h0160http://refhub.elsevier.com/S0960-8524(13)01610-6/h0160http://refhub.elsevier.com/S0960-8524(13)01610-6/h0055http://refhub.elsevier.com/S0960-8524(13)01610-6/h0055http://refhub.elsevier.com/S0960-8524(13)01610-6/h0055http://refhub.elsevier.com/S0960-8524(13)01610-6/h0055http://refhub.elsevier.com/S0960-8524(13)01610-6/h0065http://refhub.elsevier.com/S0960-8524(13)01610-6/h0065http://refhub.elsevier.com/S0960-8524(13)01610-6/h0065http://refhub.elsevier.com/S0960-8524(13)01610-6/h0065http://refhub.elsevier.com/S0960-8524(13)01610-6/h0065http://refhub.elsevier.com/S0960-8524(13)01610-6/h0075http://refhub.elsevier.com/S0960-8524(13)01610-6/h0075http://refhub.elsevier.com/S0960-8524(13)01610-6/h0075http://refhub.elsevier.com/S0960-8524(13)01610-6/h0075http://refhub.elsevier.com/S0960-8524(13)01610-6/h0075http://refhub.elsevier.com/S0960-8524(13)01610-6/h0080http://refhub.elsevier.com/S0960-8524(13)01610-6/h0080http://refhub.elsevier.com/S0960-8524(13)01610-6/h0085http://refhub.elsevier.com/S0960-8524(13)01610-6/h0085http://refhub.elsevier.com/S0960-8524(13)01610-6/h0085http://refhub.elsevier.com/S0960-8524(13)01610-6/h0090http://refhub.elsevier.com/S0960-8524(13)01610-6/h0090http://refhub.elsevier.com/S0960-8524(13)01610-6/h0090http://refhub.elsevier.com/S0960-8524(13)01610-6/h0090http://refhub.elsevier.com/S0960-8524(13)01610-6/h0090http://refhub.elsevier.com/S0960-8524(13)01610-6/h0095http://refhub.elsevier.com/S0960-8524(13)01610-6/h0095http://refhub.elsevier.com/S0960-8524(13)01610-6/h0095http://refhub.elsevier.com/S0960-8524(13)01610-6/h0095http://refhub.elsevier.com/S0960-8524(13)01610-6/h0095http://refhub.elsevier.com/S0960-8524(13)01610-6/h0100http://refhub.elsevier.com/S0960-8524(13)01610-6/h0100http://refhub.elsevier.com/S0960-8524(13)01610-6/h0100http://refhub.elsevier.com/S0960-8524(13)01610-6/h0105http://refhub.elsevier.com/S0960-8524(13)01610-6/h0105http://refhub.elsevier.com/S0960-8524(13)01610-6/h0105http://refhub.elsevier.com/S0960-8524(13)01610-6/h0105http://refhub.elsevier.com/S0960-8524(13)01610-6/h0110http://refhub.elsevier.com/S0960-8524(13)01610-6/h0110http://refhub.elsevier.com/S0960-8524(13)01610-6/h0110http://refhub.elsevier.com/S0960-8524(13)01610-6/h0115http://refhub.elsevier.com/S0960-8524(13)01610-6/h0115http://refhub.elsevier.com/S0960-8524(13)01610-6/h0115http://refhub.elsevier.com/S0960-8524(13)01610-6/h0115http://refhub.elsevier.com/S0960-8524(13)01610-6/h0115http://refhub.elsevier.com/S0960-8524(13)01610-6/h0120http://refhub.elsevier.com/S0960-8524(13)01610-6/h0120http://refhub.elsevier.com/S0960-8524(13)01610-6/h0120http://refhub.elsevier.com/S0960-8524(13)01610-6/h0120http://refhub.elsevier.com/S0960-8524(13)01610-6/h0125http://refhub.elsevier.com/S0960-8524(13)01610-6/h0125http://refhub.elsevier.com/S0960-8524(13)01610-6/h0130http://refhub.elsevier.com/S0960-8524(13)01610-6/h0130http://refhub.elsevier.com/S0960-8524(13)01610-6/h0135http://refhub.elsevier.com/S0960-8524(13)01610-6/h0135http://refhub.elsevier.com/S0960-8524(13)01610-6/h0135http://refhub.elsevier.com/S0960-8524(13)01610-6/h0140http://refhub.elsevier.com/S0960-8524(13)01610-6/h0140http://refhub.elsevier.com/S0960-8524(13)01610-6/h0140http://refhub.elsevier.com/S0960-8524(13)01610-6/h0140http://refhub.elsevier.com/S0960-8524(13)01610-6/h0140http://refhub.elsevier.com/S0960-8524(13)01610-6/h0140http://refhub.elsevier.com/S0960-8524(13)01610-6/h0145http://refhub.elsevier.com/S0960-8524(13)01610-6/h0145http://refhub.elsevier.com/S0960-8524(13)01610-6/h0145http://refhub.elsevier.com/S0960-8524(13)01610-6/h0150http://refhub.elsevier.com/S0960-8524(13)01610-6/h0150http://refhub.elsevier.com/S0960-8524(13)01610-6/h0150http://refhub.elsevier.com/S0960-8524(13)01610-6/h0150http://refhub.elsevier.com/S0960-8524(13)01610-6/h0155http://refhub.elsevier.com/S0960-8524(13)01610-6/h0155http://refhub.elsevier.com/S0960-8524(13)01610-6/h0155http://refhub.elsevier.com/S0960-8524(13)01610-6/h0155http://refhub.elsevier.com/S0960-8524(13)01610-6/h0155http://refhub.elsevier.com/S0960-8524(13)01610-6/h0155http://refhub.elsevier.com/S0960-8524(13)01610-6/h0155http://refhub.elsevier.com/S0960-8524(13)01610-6/h0155http://refhub.elsevier.com/S0960-8524(13)01610-6/h0150http://refhub.elsevier.com/S0960-8524(13)01610-6/h0150http://refhub.elsevier.com/S0960-8524(13)01610-6/h0150http://refhub.elsevier.com/S0960-8524(13)01610-6/h0150http://refhub.elsevier.com/S0960-8524(13)01610-6/h0145http://refhub.elsevier.com/S0960-8524(13)01610-6/h0145http://refhub.elsevier.com/S0960-8524(13)01610-6/h0145http://refhub.elsevier.com/S0960-8524(13)01610-6/h0140http://refhub.elsevier.com/S0960-8524(13)01610-6/h0140http://refhub.elsevier.com/S0960-8524(13)01610-6/h0140http://refhub.elsevier.com/S0960-8524(13)01610-6/h0140http://refhub.elsevier.com/S0960-8524(13)01610-6/h0135http://refhub.elsevier.com/S0960-8524(13)01610-6/h0135http://refhub.elsevier.com/S0960-8524(13)01610-6/h0135http://refhub.elsevier.com/S0960-8524(13)01610-6/h0130http://refhub.elsevier.com/S0960-8524(13)01610-6/h0130http://refhub.elsevier.com/S0960-8524(13)01610-6/h0125http://refhub.elsevier.com/S0960-8524(13)01610-6/h0125http://refhub.elsevier.com/S0960-8524(13)01610-6/h0120http://refhub.elsevier.com/S0960-8524(13)01610-6/h0120http://refhub.elsevier.com/S0960-8524(13)01610-6/h0120http://refhub.elsevier.com/S0960-8524(13)01610-6/h0115http://refhub.elsevier.com/S0960-8524(13)01610-6/h0115http://refhub.elsevier.com/S0960-8524(13)01610-6/h0115http://refhub.elsevier.com/S0960-8524(13)01610-6/h0110http://refhub.elsevier.com/S0960-8524(13)01610-6/h0110http://refhub.elsevier.com/S0960-8524(13)01610-6/h0105http://refhub.elsevier.com/S0960-8524(13)01610-6/h0105http://refhub.elsevier.com/S0960-8524(13)01610-6/h0105http://refhub.elsevier.com/S0960-8524(13)01610-6/h0105http://refhub.elsevier.com/S0960-8524(13)01610-6/h0100http://refhub.elsevier.com/S0960-8524(13)01610-6/h0100http://refhub.elsevier.com/S0960-8524(13)01610-6/h0100http://refhub.elsevier.com/S0960-8524(13)01610-6/h0095http://refhub.elsevier.com/S0960-8524(13)01610-6/h0095http://refhub.elsevier.com/S0960-8524(13)01610-6/h0095http://refhub.elsevier.com/S0960-8524(13)01610-6/h0095http://refhub.elsevier.com/S0960-8524(13)01610-6/h0090http://refhub.elsevier.com/S0960-8524(13)01610-6/h0090http://refhub.elsevier.com/S0960-8524(13)01610-6/h0090http://refhub.elsevier.com/S0960-8524(13)01610-6/h0085http://refhub.elsevier.com/S0960-8524(13)01610-6/h0085http://refhub.elsevier.com/S0960-8524(13)01610-6/h0085http://refhub.elsevier.com/S0960-8524(13)01610-6/h0080http://refhub.elsevier.com/S0960-8524(13)01610-6/h0080http://refhub.elsevier.com/S0960-8524(13)01610-6/h0075http://refhub.elsevier.com/S0960-8524(13)01610-6/h0075http://refhub.elsevier.com/S0960-8524(13)01610-6/h0075http://refhub.elsevier.com/S0960-8524(13)01610-6/h0075http://refhub.elsevier.com/S0960-8524(13)01610-6/h0065http://refhub.elsevier.com/S0960-8524(13)01610-6/h0065http://refhub.elsevier.com/S0960-8524(13)01610-6/h0065http://refhub.elsevier.com/S0960-8524(13)01610-6/h0065http://refhub.elsevier.com/S0960-8524(13)01610-6/h0055http://refhub.elsevier.com/S0960-8524(13)01610-6/h0055http://refhub.elsevier.com/S0960-8524(13)01610-6/h0055http://refhub.elsevier.com/S0960-8524(13)01610-6/h0055http://refhub.elsevier.com/S0960-8524(13)01610-6/h0160http://refhub.elsevier.com/S0960-8524(13)01610-6/h0160http://refhub.elsevier.com/S0960-8524(13)01610-6/h0060http://refhub.elsevier.com/S0960-8524(13)01610-6/h0060http://refhub.elsevier.com/S0960-8524(13)01610-6/h0050http://refhub.elsevier.com/S0960-8524(13)01610-6/h0050http://refhub.elsevier.com/S0960-8524(13)01610-6/h0050http://refhub.elsevier.com/S0960-8524(13)01610-6/h0050http://refhub.elsevier.com/S0960-8524(13)01610-6/h0045http://refhub.elsevier.com/S0960-8524(13)01610-6/h0045http://refhub.elsevier.com/S0960-8524(13)01610-6/h0040http://refhub.elsevier.com/S0960-8524(13)01610-6/h0040http://refhub.elsevier.com/S0960-8524(13)01610-6/h0040http://refhub.elsevier.com/S0960-8524(13)01610-6/h0035http://refhub.elsevier.com/S0960-8524(13)01610-6/h0035http://refhub.elsevier.com/S0960-8524(13)01610-6/h0035http://refhub.elsevier.com/S0960-8524(13)01610-6/h0030http://refhub.elsevier.com/S0960-8524(13)01610-6/h0030http://refhub.elsevier.com/S0960-8524(13)01610-6/h0030http://refhub.elsevier.com/S0960-8524(13)01610-6/h0025http://refhub.elsevier.com/S0960-8524(13)01610-6/h0025http://refhub.elsevier.com/S0960-8524(13)01610-6/h0020http://refhub.elsevier.com/S0960-8524(13)01610-6/h0020http://refhub.elsevier.com/S0960-8524(13)01610-6/h0020http://refhub.elsevier.com/S0960-8524(13)01610-6/h0015http://refhub.elsevier.com/S0960-8524(13)01610-6/h0015http://refhub.elsevier.com/S0960-8524(13)01610-6/h0015http://refhub.elsevier.com/S0960-8524(13)01610-6/h0010http://refhub.elsevier.com/S0960-8524(13)01610-6/h0010http://refhub.elsevier.com/S0960-8524(13)01610-6/h0010http://refhub.elsevier.com/S0960-8524(13)01610-6/h0005http://refhub.elsevier.com/S0960-8524(13)01610-6/h0005http://refhub.elsevier.com/S0960-8524(13)01610-6/h0005

enhancing methane production during the anaerobic digestion of crude

Documents