effects of light emitting diode (led) irradiation ...led light emitting diode m molar x m meter mg...

i

EFFECTS OF LIGHT EMITTING DIODE (LED)

IRRADIATION AT NIGHT ON ABSCISIC ACID

METABOLISM AND ANTHOCYANIN

SYNTHESIS IN GRAPES

January 2016

ABHICHARTBUT RODYOUNG

Graduate School of Horticulture

CHIBA UNIVERSITY

ii

(千葉大学学位申請論文)

EFFECTS OF LIGHT EMITTING DIODE (LED)

IRRADIATION AT NIGHT ON ABSCISIC ACID

METABOLISM AND ANTHOCYANIN

SYNTHESIS IN GRAPES

2016 年 1月

ABHICHARTBUT RODYOUNG

Graduate School of Horticulture

CHIBA UNIVERSITY

i

TABLE OF CONTENTS

Page

Table of contents i

List of Tables v

List of Figures vi

List of Abbreviations ix

Chapter 1 General introduction and literature review

1.1 General introduction 2

1.2 Literature review

1.2.1 Grape 5

1.2.2 Stage of grape fruit development 6

1.2.3 Grape skin color 8

1.2.4 Anthocyanin biosynthesis in grapes 8

1.2.5 Regulated genes of anthocyanin accumulation in grape berries 11

1.2.6 Factors affect anthocyanin biosynthesis in grapes

1.2.6.1 Plant hormone 13

1.2.6.2 Environmental Factors 16

1.2.6.3 Viticulture practices 19

1.2.7 Light 20

1.2.8 Light emitting diodes (LEDs) 24

1.2.9 Sugar induction of anthocyanin accumulation 26

ii

1.2.10 Interaction between sugar and ABA on anthocyanin

accumulation

27

Chapter 2 Effect of blue- and red-LED at night on endogenous abscisic

acid, anthocyanin and sugar syntheses in delayed-start cultured

grapes under double cropping cultivation system

2.1 Introduction

2.2 Materials and methods

2.2.1 Plant materials

2.2.2 Quantitative analysis of ABA

2.2.3 RNA extraction, cDNA synthesis, and

quantitative real-time RT-PCR analysis

2.2.4 Anthocyanin analysis

2.2.5 Sugar analysis

2.2.6 Statistical analysis

2.3 Results

2.3.1 Endogenous ABA concentration and the

expressions of VvNCED1 and VvCYP707A1 genes

2.3.2 Total anthocyanin concentrations and the

expressions of VvUFGT, VlMYBA1-2, and VlMYBA2

2.3.3 Sugar concentrations

2.3.4 Fruit qualities at harvesting (106 DAFB)

2.4 Discussion

29

31

32

36

39

39

40

42

44

46

48

52

iii

Chapter 3 Effect of blue- and red-LED at night on endogenous abscisic

acid, anthocyanin and sugar syntheses in early-heating cultured

grapes under double cropping cultivation system and the effect

of the irradiating position of blue and red LED to enhance

anthocyanin syntheses in grape

3.1 Introduction

3.2 Materials and methods



3.2.3 RNA extraction, cDNA synthesis, and

quantitative real-time RT-PCR analysis

3.2.4 Anthocyanin analysis



3.3 Results

3.3.1 Endogenous ABA concentration and the

expressions of VvNCED1 and VvCYP707A1

3.3.2 Total anthocyanin concentration and the

expressions of VvUFGT, VlMYBA1-2, and VlMYBA2


3.3.4 Fruit qualities at harvesting (97 DAFB in Exp. 1

and 99 DAFB in Exp. 2)

3.4 Discussion

55

57

59

59

59

60

60

62

64

67

69

75

iv

General discussion 79

Summary 83

Acknowledgements 84

References 85

v

LIST OF TABLES

Page

Table 2.1. Primers used for real-time RT-PCR. 38

Table 2.2. Effect of LED irradiation on berry length, berry width, berry

weight, soluble solid and tartaric acid concentration in early harvest at 106 DAFB.

49

Table 2.3. Effect of LED irradiation on skin color in L*, a*, b* and Hue angle

at 106 DAFB.

50


weight, soluble solid and tartaric acid concentration at harvest (97 DAFB). (Exp. 1)

70


at harvest (97 DAFB). (Exp. 1)

71


weight,, soluble solid and tartaric acid concentration at harvest (99 DAFB). (Exp. 2)

72



73

vi

LIST OF FIGURES

Page

Figure 1.1. Diagram of a typical double-sigmoid pattern of growth by a grape

berry, from anthesis to harvest.

7

Figure 1.2. Anthocyanin biosynthesis pathway and its branches. 10

Figure 1.3. Absorption spectrum of chlorophyll and antenna pigments. 20

Figure 1.4. The spectrum of solar radiation reaching from gamma rays to radio

waves with view on visible wavelengths and plant photoreceptors absorbing

specific wavelength. Cry, cryptochromes; Phy, phytochromes; Phot,

phototropins; UV, ultraviolet; UVR8, UV-B photoreceptor.

21

Figure 1.5. Red and far-red light mediated conversion of phytochromes. 22

Figure 1.6. COP1 acts as a repressor in light signaling pathway by interacting

directly with photoreceptors to mediate different light-regulated plant

developmental process in darkness (A) and in visible light (B).

24

Figure 2.1. Flow chart of Quatitative analysis of ABA. 33

Figure 2.2. Retention time and mass spectrum profile showing selected ions in

the ABA-containing fraction in standard and sample.

34

Figure 2.3. Retention time and mass spectrum profile showing selected ions in

the ABA-containing fraction in sample.

35

Figure 2.4. Flow chart of RNA preparation. 37

Figure 2.5. Change of temperature in greenhouse. 41

Figure 2.6. Endogenous ABA concentrations in red or blue LED-treated skin. 42

vii

Figure 2.7. Quantitative real time RT-PCR analysis of VlMYBA1-2 and

VlMYBA2 in red or blue LED-treated skin.

43

Figure 2.8. Changes of total anthocyanin concentration in red or blue LED-

treated skin.

44

Figure 2.9. Changes of quantitative real time RT-PCR analysis of VvUFGT ,

VlMYBA1-2 and VlMYBA2 in red or blue LED-treated skin.

45

Figure 2.10. Changes of total sugar in red or blue LED-treated skin. 46

Figure 2.11. Changes of glucose and fructose concentrations in red or blue

LED-treated skin.

47

Figure 2.12. Effect of LED irradiation on grapes harvested at 106 DAFB. 51

Figure 3.1. Changes in the temperature in the greenhouse under the early-

heating culture (Exp. 1) (a) and in the ordinary growing season (Exp. 2) (b).

LED irradiation (−) shows the average temperature during LED irradiation

61

Figure 3.2. Endogenous ABA concentrations and the expression of VvNCED1

and VvCYP707A1 under the early-heating culture (Exp. 1) (A) and in the

ordinary growing season (Exp. 2) (B). The experimental values are plotted in

comparison to the control (Ubiquitin) value. Data are the means ± SE of three

replications. Different letters indicate significant difference by Tukey-Kramer

test at P ≤ 0.05. Red or blue-LED cluster treatment: red (C), blue (C). Red or

blue-LED leaf treatment: red (L), blue (L).

63

Figure 3.3. Changes in the total anthocyanin concentrations under the early-

heating culture (Exp. 1) (A) and in the ordinary growing season (Exp. 2) (B).

Data are the mean ± SE of three replications. Different letters indicate

65

viii

significant difference by Tukey–Kramer test at P ≤ 0.05. Red or blue-LED

cluster treatment: red (C), blue (C). Red or blue-LED leaf treatment: red (L),

blue (L)

Figure 3.4. Changes in the expressions of VvUFGT, VlMYBA1-2, and

VlMYBA2 under the early-heating culture (Exp. 1) (A) and in the ordinary

growing season (Exp. 2) (B). Data are the mean ± SE of three replications.

Different letters indicate significant difference by Tukey–Kramer test at P ≤

0.05. Red or blue-LED cluster treatment: red (C), blue (C). Red or blue-LED

leaf treatment: red (L), blue (L)

66

Figure 3.5. Changes in total sugar, glucose, and fructose concentrations under

the early-heating culture (Exp. 1) (A) and in the ordinary growing season (Exp.

2) (B). Data are the mean ± SE of three replications. Different letters indicate

significant difference by Tukey–Kramer test at P ≤ 0.05. Red or blue-LED

cluster treatment: red (C), blue (C). Red or blue-LED leaf treatment: red (L),

blue (L)

68

Figure 3.6. Effect of LED irradiation on grapes harvested at 97 DAFB. (Exp. 1) 74

Figure 3.7. Effect of LED irradiation on grapes harvested at 99 DAFB. (Exp. 2) 74

ix

LIST OF ABBREVIATIONS

ºC degree Celsius

µg microgram

µL microliter

µmol kg-1

micromole per kilogram

µM micromolar

% percentage

ABA abscisic acid

cm centimetre

DAFB days after full bloom

DNA deoxyribonucleic acid

et al. exampli gratia (Latin), for example

FB full bloom

FW fresh weight

GA3 gibberellic acid

GC-MS-SIM gas chromatography-mass spectrometry-

selected ion monitoring

g gram

HPLC high performance liquid chromatography

L liter

LED light emitting diode

M molar

x

m meter

mg L-1

milligram per liter

Mg milligram

min minute

mL milliliter

mm millimeter

mM millimolar

m/s mass/charge ratio

nm nanometre

OD optical density

pH power of hydrogen ion

PPF the photosynthetic photon flux density

ppm part per million

RNA ribonucleic acid

rpm revolution per minute

RI a refractive index

RT-PCR reverse transcription-polymerase chain

reaction

sec second

UV ultraviolet

V volt

v volume

VvNCED1 9-cis-epoxycarotenoid dioxygenase

xi

VvCYP707A1 ABA 8'-hydroxylase

VvUFGT UDP-glucose-flavonoid 3-O-

glucosyltranferase

v/v volume by volume

w/v weight by volume

s second

SE standard error

Chapter 1: General introduction and literature review

1

CHAPTER 1

GENERAL INTRODUCTION AND LITERATURE REVIEW


2

1.1 GENERAL INTRODUCTION

Grape skin color which is one of the most important fruit qualities is mainly

determined by anthocyanin synthesis during the maturation process. The

accumulation of anthocyanin during grape berry development requires a complicated

interaction between developmental and environmental factor. Abscisic acid (ABA)

has been considered as plant hormone that regulates berry development in

grapes. Its concentration increases significantly at veraison and then declines to low levels

at ripening stage. In addition, ABA application to grape berries can induce the

expression of anthocyanin biosynthetic genes. In plant, ABA plays important roles in

environmental stress such as low temperature and drought stress. The ABA accumulation

is regulated by the balance of biosynthesis and catabolism (Kushiro et al., 2004). The

9-cis-epoxycarotenoid dioxigenase (NCED) is a key enzyme in ABA biosynthesis,

and ABA is catabolized by 8'-hydrocylase (CYP707A) (Kondo et al., 2012). However,

effect of ABA on the grape berry ripening is less well understood.

Anthocyanins which belong to flavonoids are secondary plant metabolites that

accumulate in grape berries. They play important roles in resistance to UV light and

in attraction of animal pollinators. They have been also studied for their beneficial

effects on human health including antioxidant activity, prevention of coronary heart

disease, anticancer activity, and others. The biosynthesis pathway of anthocyanins in

grapes has been investigated. Boss et al. (1996a, b) showed that the expression of

flavonoid 3-O-glucosyltransferase (UFGT) which was detected only in the berry skins

of red cultivars is critical for anthocyanin biosynthesis. There are three regulatory

proteins that activate the structural genes in the anthocyanin pathway including MYB,


3

bHLH, and WD40 (Koes et al., 2005). In Vitis × Vitis labrusca grapes, some MYB-related

transcriptional factor genes have been isolated and shown to regulate anthocyanin

biosynthesis genes including VlMYBA1-2, VlMYBA1-3 and VlMYBA2 (Azuma et al.,

2011, 2008; Kobayashi et al., 2002). Temperature and light are important

environmental factors that affect anthocyanin synthesis in grapes. It has been reported

low temperature at night between 10 and 20°C developed the strongest coloration of

‘Tokay’ grapes (Kliewer and Torres, 1972), whereas high temperature such as 30 ºC

decreased the expressions of anthocyanin biosynthesis-related gene and anthocyanin

accumulation (Mori et al., 2005a; Yamane et al., 2006). Several studies showed that

exposure of grape clusters to light significantly increased the accumulation of

flavonoid and the expression of their biosynthesis genes, whereas they was reduced

by shading treatment (Fujita et al., 2006; Jeong et al., 2004; Matus et al., 2009).

In Japan, double-cropping system has been developed to enhance grape

production since 1960. In general, the first harvest is in late June or early July, and the

second one is in December or January. In this cultivation technique, supplementary

light treatment, temperature control, breaking of dormancy, pruning, and CO2

application are important factors to improve berry quality. Light emitting diodes

(LEDs) are used as a supplement light in a plant factory. They can reduce the

production cost, long durability, and low heat generation (Kwon and Lim, 2011).

It has been reported that LED treatment to grape at night increased the expression of

anthocyanin biosynthesis-related genes (Azuma et al., 2012a; Kondo et al., 2014).

However, there is little information on the effect of LED irradiation on ABA

concentrations, anthocyanin production, their related gene expressions, and sugar

synthesis in grape berries in greenhouse. The objective of this study is as follows:

http://en.wikipedia.org/wiki/Vitis_labrusca


4

1) To clarify the effect of red- and blue- LED irradiation at night to vines on

anthocyanin accumulation in greenhouse in the double-cropping system

which the proportion of blue and red light in sunshine differs with season.

2) To clarify the effect of the irradiating position (leaf or cluster) of red or blue

LED on anthocyanin synthesis in grape berries.


5

1.2 LITERATURE REVIEW

1.2.1 Grape

Grapes have a large fruit crop production with approximately 77.1 million

metric tons in the world in 2013 (FAOSTAT, 2013). About 80% of the total crop is

used in wine production, and approximately 13% is consumed as table grapes. Most

grapes are grown in China, Italy, USA, and France (Karlsson, 2013). There are two

major types of grapes including European grapes with the species Vitis vinifera L.,

and North American grapes with two main species V. labrusca and V. rotundifolia.

Almost 95% of Vitis vinifera such as ‘Cabernet Sauvigon’ and ‘Chardonnay’ are

cultivated for wine. Both V. labrusca and V. rotundifolia species of North American

grapes can be consumed as table or processed grapes as juice or wine. The most

important variety is ‘Concord’ with large purple berries. The important aspects of

table grapes are large, tasty and, having an attractive color. The anthocyanins are

primary substances for grape coloration. Their amount in red grapes varies with the

species, variety, maturity, seasonal conditions, production area, and yield of fruit

(Mazza and Miniati, 1993).

In 2013, the total grape production in Japan was almost 190,000 metric tons

(FAOSTAT, 2013), and most vineyards in Japan product are table grapes. ‘Kyoho’,

which is a cross variety between Vitis vinifera and Vitis labrusca, is one of the main

cultivar in Japan. ‘Kyoho’ produces large sized berries, strong sweetness, and good

flavor. ‘Kyoho’ harvested in late August has a dark purple or almost black color skin

that is easily separated from the fruit. Fruit qualities including bunch appearance, skin

http://en.wikipedia.org/wiki/Hybrid_grapes

http://en.wikipedia.org/wiki/Vitis_vinifera

http://en.wikipedia.org/wiki/Vitis_labrusca


6

color, and sugar contents are quite important for the market of table grapes in ‘Kyoho’

in Japan (Morinaga, 2001).

1.2.2 Stage of grape fruit development

Grapes are classified into non-climacteric fruits whose respiration rates do not

show large peaks during maturation and ripening (Giovannoni, 2001). To date, the

method that control ripening of non-climacteric fruits has not been well understood.

The hormonal control of non-climacteric fruits such as grapes and strawberries

appears to be complicated, whereas in climacteric fruits, ripening pathways is

primarily regulated by ethylene (Gazzarrini and McCourt, 2001; Pech et al., 2008;

Yokotani et al., 2009). However, it has been found that grapes and strawberries

exhibit an increase in ethylene development at ripening (Chervin et al., 2004; Iannetta

et al., 2006). Iannetta et al. (2006) has reported that there is a small rise in respiration

in strawberries at ripening. On the other hand, ABA has been implicated in the control

of grape ripening (Jia et al., 2011; Wheeler et al., 2009). Endogenous ABA

concentrations coincide with the accumulation of sugars and anthocyanin during the

onset of ripening (Geny et al., 2006; Wheeler et al., 2009).

Grape exhibits a double sigmoid pattern, and there are three stages of berry

development (Figure.1.1 ) (Keller, 2015). The first stage is the cell division which

begins 5−10 days before anthesis and continues for approximately 25 days (Coombe,

2001; Harris et al., 1968). At this stage, the berry expands in volume and accumulates

organic acids including tartaric and malic acids, and tannins. The hydroxycinnamic

acid in the flesh and skin is accumulated at this time. Endogenous ABA

concentrations in the berry is high during early development and then declines as the


7

berry expands (Davies and Böttcher, 2009). The cell division phase is followed by lag

phase or phase II which pauses in berry growth. Berry turgor pressure also declines

during lag phase (Matthews and Shackel, 2005). The length of this period about one

to six weeks depends on the cultivar. After the lag phase, about 60 day after anthesis,

phase III the ripening process begins. At the beginning of this phase, viticulturists call

the onset of ripening as veraison when the transition from green to red skin in berries

of red grape varieties occurs. Endogenous ABA concentrations increase rapidly after

veraison, then decrase to low levels at ripeness (Davies et al., 1997; Owen et al.,

2009). During this phase, the berry expands and several changes occur. The ripening

process involves a coordinated shift in fruit development which leads to berry

softening, malic acid reduction, and accumulation of sugars and anthocyanins. The

accumulations of sugars and anthocyanin are dependent on the different factors such

as environmental factors and viticulture practices.

Figure 1.1. Diagram of a typical double-sigmoid pattern of growth by a grape berry,

from anthesis to harvest. (Coombe, 2001.)


8

1.2.3 Grape skin color

Color is an important factor for the red grape cultivars since consumers

generally prefer well pigmented grapes. Grape skin color is mainly determined by the

content of anthocyanins which belong to flavonoids compound family (Baranac et al.,

1997). Anthocyanins are secondary plant metabolites which accumulate in fruit or

skin, and its synthesis occurs during the maturation process. In the red cultivars,

anthocyanins was synthesized and accumulated in their berry skin (Shiraishi and

Watanabe, 1994) whereas the white cultivars regularly do not produce any

anthocyanins in their fruits (P. Boss et al., 1996). In addition, the accumulation of

anthocyanins in red cultivars is often influenced by many factors such as

phytohormone and environment.

Anthocyanins are important in biological roles such as protection against UV

light, resistance against pathogens and attraction of predators for pollination (Chalker-

Scott, 1999; Schaefer et al., 2004; Takahama, 2004). Moreover, the beneficial effects

of anthocyanins on human health including antioxidant activity, antimicrobial activity,

anticancer, and prevention of coronary heart diseases have been suggested (Ross and

Kasum, 2002). For these reasons, anthocyanin accumulation in grape is one aspect of

currently active researches.

1.2.4 Anthocyanin biosynthesis in grapes

Anthocyanin that is predominant pigments in the red or purple colors in grape

berries commences at veraison, and sugar accumulation begins and continues

throughout berry ripening (Boss et al., 1996). Anthocyanin is glycoside of

polyhydroxy and polymethoxy derivatives of 2-phenylbenzopyrylium


9

(anthocyanidins). Among pelargonidin, cyanidin, delphinidin, peonidin, petunidin,

and malvidin which are the common anthocyanidins found in grapes, and malvidin is

usually the predominant anthocyanidin in most red vines (Mazza and Francis, 1995).

The proportion and amount of each anthocyanidin varies among cultivar and

viticulture.

In Figure 1.2, anthocyanin in grape berries is synthesized via flavonoid

pathway which can be divided into two sections. One is the upstream flavonoid

pathway which large gene encoded the enzymes that act earlier in the flavonoid

pathway. The other is downstream anthocyanin pathway in which the enzymes that

are encoded by one single active gene. (Sparvoli et al., 1994). Phenylalanine as a

direct precursor for the synthesis of anthocyanidins is converted to anthocyanine by a

series of enzyme-catalyzed reaction. Firstly, phenylalanine transformed to trans-

cinnamic acid by phenylalanine ammonia lyase (PAL). Then trans-cinnamic acid

changes into 4-coumaroyl-CoA by cinnamate 4-hydroxylase (C4H) and 4-coumarate-

CoA ligase (4CL). One molecular of 4-coumaroyl-CoA including three molecules of

malonyl-CoA is catalyzed by chalcone synthase (CHS) from naringenin chalcone

rapidly isomerized to naringenin by chalcone isomerase (CHI). Narigenin is

hydroxylated at the 3-position by flavanone 3-hydroxylase (F3H) and converts to

dihydroflavonols which is reduced to leucoanthocyanidin by dihydroflavonol 4-

reductase (DFR). Then leucoanthocyanins as substrate for the synthesis of

corresponding colored anthosyanidins are catalyzed by anthocyanidin synthase (ANS).

Finally, the hydroxyl group at C3 of anthocyanidins is glycosylated by the action of

UDPG-flavonoid-3-O-glucosyltransferase (UFGT) and anthocyanins are finally stored

in the vacuole (Xie et al., 2011).


10

Figure 1.2. Anthocyanin biosynthesis pathway and its branches. (Xie et al., 2011)

Do

wnst

ream

anth

ocyanin

Acetic acid

3 × malonyl-CoA

A

The Krebs

cycle

p

athw

ay

Cinnamic acid

Phenylalanin

p-coumaric acid

4-coumaroyl-CoA

Naringenin chalcone

Narigenin

Dihydroflavonols

Leucoanthocyanidins

Anthocyanidins

Anthocyanins

PAL

C4H

4CL

CHS

CHI

F3H

DFR

ANS

UFGT

Lignin C3H

Proanthocyanidins

ANR

FLS

LAR

Flavonols Upst

ream

fla

vo

no

id p

athw

ay


11

1.2.5 Anthocyanin accumulation and related genes in grape berries

Anthocyanin, the secondary metabolite of the flavonoid pathway, is

synthesized under the regulation of multiple regulatory genes at the transcriptional

level (Koes et al., 1994; Springob et al., 2003).

In flavonoid upstream pathway, the structural genes of the anthocyanin

biosynthesis were regulated by a transcription complex composed of three regulatory

proteins belonging to MYB transcriptional factors, MYC transcriptional factors

encoding basic helix-loop-helix proteins (bHLH), and WD40-like proteins playing

important roles in the regulation of other flavonoid products such as flavonols and

proanthocyanidins (Koes et al., 2005). In Arabidopsis thaliana with low

proanthocyanidin levels or low levels of both anthocyanins and proanthocyanidins,

three regulatory genes regulate the expression of the structural genes, which are

involved in the flavonoid synthesis, such as CHI, CHS, F3H, and DFR (Abrahams et

al., 2002; Gonzalez et al., 2008; He et al., 2008; Ramsay et al., 2003).

In grapes, MYB transcriptional factors have been involved in the control of

different branch of the phenylpropanoid pathway, such as anthocyanins, flavonols,

proanthocyanidins, and lignins. On the contrary, several transcriptional factors of

MYC family and the WD40-like proteins have been found in grapes, but there is no

detailed information on the anthocyanin synthesis (Czemmel et al., 2009; Stracke et

al., 2007).

For the specific downstream branches in anthocyanin synthesis pathway,

anthocyanin formation through glycosylation and subsequent modification of


12

methylation and acylation was regulated by some MYB related transcription factors.

Three MYB related transcriptional factors including VlMYBA1-1, VlMYBA1-2, and

VlMYBA2 in the Vitis labrusca grapes were identified as particularly regulating

anthocyanin accumulation, and those greatly facilitated the investigation of the

regulation of anthocyanin biosynthesis in Vitis vinifera grapes (Cutanda-Perez et al.,

2009; Kobayashi et al., 2002; Koshita et al., 2008).

Azuma et al. (2012b) showed that the three MYB related genes (VlMYBA1-3,

VlMYBA1-2, and VlMYBA2) in the Vitis × labrascana grapes responded to

temperature and light differently, although the products of those genes had the ability

to regulate anthocyanin biosynthesis pathway genes. They reported that VlMYBA1-3

was strongly and significantly affected by both temperature and light conditions,

whereas VlMYBA1-2 as well as VlMYBA2 was affected primarily by light and

temperature, respectively.

In red Vitis vinifera grapes, VvMYBA regulator genes including VvMYBA1,

VvMYBA2, and VvMYBA3 from grapes have been isolated (Kobayashi et al., 2005).

Only, VvMYBA1 is expressed in berry skin after veraison and regulates anthocyanin

biosynthesis during ripening by control of the expression of UFGT, critical

anthocyanin biosynthesis genes, and it is not expressed in the young leaves and stem

epidermis of grapes normally colored (Jeong et al., 2006).


13

1.2.6 Factors affect anthocyanin biosynthesis in grapes

1.2.6.1 Plant hormone

Abscisic acid (ABA)

Abscisic acid (ABA) is a phytohormone that plays important roles involved in

many phases of the plant’s life cycle, including seed development and dormancy.

ABA responds to various environmental stress such as salt, low temperature, and

drought stress (Kondo et al., 2012; Seo and Koshiba, 2002; Yoshikawa et al., 2007;

Zeevaart and Creelman, 1988). When plants encounter environment stress, ABA

levels increase as a signal transduction substance of secondary metabolism against

stresses (Cutler et al., 2010). ABA biosynthesis involves the oxidative cleavage of

carotenoids, and 9-cis-epoxycarotenoids (NCED) is known as the key enzyme in the

biosynthesis pathway of ABA (Nambara and Marion-Poll, 2005; Setha et al., 2004).

On the other hand, the expression of NCED gene is always not consistent with ABA

levels, indicating that the mechanism of ABA accumulation is complicated. The

endogenous ABA level is modulated by the specific balance between biosynthesis and

catabolism of NCEDs and ABA 8'-hydroxylase (CYP707As) transcripts.

ABA is degraded through the irreversible pathway by CYP707As (Sun et al., 2010;

Zhou et al., 2004).

In non-climacteric fruits such as strawberry and grape, ABA is associated with

fruit ripening (Jia et al., 2011; Wheeler et al., 2009). Endogenous ABA concentration

increases sharply during the onset of the ripening when berries begin to accumulate


14

sugars and anthocyanin (Geny et al., 2006; Wheeler et al., 2009), suggesting a

possible role in the onset of ripening.

It has been reported that ABA application to grape could increase the

anthocyanin content in grape skin and enhanced the coloration of grapes (Kataoka et

al., 1982). On the usage of ABA as a culture solution in grape cell suspension culture,

Hiratsuka et al. (2001) reported that ABA can highly promote anthocyanin

accumulation and the expression of chalcone isomerase (CHI), an essential enzyme in

the flavonoid pathway for anthocyanin biosynthesis. Furthermore, ABA application

not only increased the anthocyanin accumulation in grape skin but also the expression

of chalcone synthase (CHS), CHI, dihydroflavonol 4-reductase (DFR), and UDP-

glucose-flavonoid-3-O-glucosyl-transferase (UFGT) genes in the anthocyanin

biosynthesis pathway, and the expression of VvmybA1, regulatory factors (Ban et al.,

2003; Jeong et al., 2004). On the other hand, ABA application to grape increased

coloration rather than enhancement of sugar accumulation. (Cantín et al., 2007; Mori

et al., 2005a; Peppi and Fidelibus, 2008)

Ethylene

Ethylene acts as a plant hormone that controls many aspects of fruit ripening.

It seems to play a role in regulation of some genes expressed during non-climacteric

fruit ripening (Delgado et al., 2002; El-Kereamy et al., 2003; Tira-Umphon et al.,

2007). Application of the ethylene-releasing compound, 2-chloroethylphosphonic acid

(2-CEPA) to grape berries in some cases can promote the accumulation of

anthocyanins and/or sugar levels in grape skin (Delgado et al., 2002; El-Kereamy et

al., 2003; Tira-Umphon et al., 2007). In addition, 2-CEPA treatment to grape berries


15

stimulated the expression of CHS, flavonoid-3-hydroxylase (F3H), anthocyanidid

synthase (ANS) and UFGT except DFR (El-Kereamy et al., 2003). Moreover, the

treatment of berries with 1-methylcyclopropene (1-MCP), an ethylene inhibitor,

inhibited grape ripening (Chervin et al., 2004). Besides, Iannetta et al. (2006) reported

that strawberries underwent a small rise in respiration at ripening. These results

indicate that ethylene may play a role in grape berry ripening.

Jasmonic acid (JA) and Salicylic acid

Usually, plant produces Jasmonic acid (JA), methyl jasmonate (MeJA), and

salicylic acid in the response to many biotic and abiotic stresses. In apple and grape,

jasmonate has been found to affect color development, possibly through interaction

with ethylene biosynthesis (Fan et al., 1998; Rudell et al., 2005). It was reported that

JA application to grape cell suspension cultures which were irradiated with light

enhances anthocyanin production (Zhang et al., 2002). Moreover, MeJA application

in combination with carbohydrates in grape cell suspension cultures stimulated the

expressions of CHS and UFGT and triggered anthocyanin accumulation (Belhadj et

al., 2008).

In grape berries, salicylic acid can induce the expression of phenylalanine

ammonia-lyase (PAL) which is an important gene for phenylpropanoid metabolism.

Thus, salicylic acid may indirectly enhance anthocyanin biosynthesis (Wen et al.,

2005).


16

Auxin

Auxin is a plant growth hormone that stimulates differential growth in

response to gravity or light. It was reported that the applications of 2,4-

dichlorophenoxyacetic acid (2,4-D) or 1-naphthaleneacetic acid (1-NAA), a synthetic

auxin, to grape berries inhibited the accumulation of anthocyanin and the expression

of anthocyanin biosynthetic genes and suppressed VvMYBA1, a regulatory gene of

anthocyanin biosynthesis (Ban et al., 2003; Jeong et al., 2004).

1.2.6.2 Environmental Factors

Anthocyanin biosynthesis is generally influenced by many environmental

factors, such as sunlight exposure, UV irradiation, temperature, and water. These

environmental factors can significantly modify the content and the composition of

anthocyanins in grape berry by affecting the expressions of the structural and

regulatory genes (Mazza and Francis, 1995).

Light and temperature

Light is an important factor controls anthocyanin biosynthesis (Chalker-Scott,

1999). Many studies have shown that the anthocyanin biosynthesis in fruit skin can be

increased by light exposure and decreased by shading (Azuma et al., 2012a; Takos et

al., 2006). Light treatment induced higher expression of flavonoid biosynthetic genes

in grape berry skin such as CHS, CHI, F3H, flavonoid 3,5-hydroxylase (F3'5'H), DFR,

O-methyltransferase (OMT) as well as UFGT (Azuma et al., 2012b). Shading

treatment reduced the mRNA accumulation of VvMYBA1, a regulatory gene, and the

expression of several structural genes in anthocyanin biosynthesis, such as CHS, CHI,


17

F3H, and UFGT (Jeong et al., 2004), but upregulated the expression level of MYB4,

which is the repressor of UFGT (Azuma et al., 2012b).

In addition to light quantity (intensity) as well as light duration (photoperiod),

light quality (spectral distribution) including UV light and blue light affects the

anthocyanin biosynthesis in fruits by promoting the expression of related anthocyanin

biosynthesis enzymes (Li et al., 2013; M et al., 2012; Ubi et al., 2006). However,

excessive sunlight caused sunburn in grape berries to reduce anthocyanin

accumulation (Chorti et al., 2010).

Apart from light exposure, temperature is another important environmental

factor that influences anthocyanin biosynthesis (Tarara et al., 2008). Usually, low

temperatures promote the anthocyanin biosynthesis. For example, in ‘Tokay’ grapes,

the strongest fruit color development was found under day temperatures between 15

and 25°C and night temperatures between 10 and 20°C (Kliewer and Torres, 1972).

Furthermore, a lower temperature (15°C) around the berry clusters affected color

development more strongly than higher cluster temperatures in ‘Delaware’ and

‘Kyoho’ grpaes (Tomana et al., 1979). On the other hand, many studies have been

shown that high temperatures (30–35ºC) decreased anthocyanin concentration in the

skin of apple and grape berries (Azuma et al., 2012b; Lin-Wang et al., 2011; Mori et

al., 2007). In grape berries, high night temperatures about 30ºC inhibit the gene

expression of CHS, F3H, DFR, ANS, and UFGT at the early stages of ripening and

dramatically reduce the activity of UFGT, resulting in poor anthocyanin accumulation

(Mori et al., 2005b; Yamane et al., 2006). Also, changes in quantitative and/or

qualitative anthocyanin profile of grape berries, apples, and bilberries have been


18

reported in different temperature treatments (Azuma et al., 2012b; Uleberg et al.,

2012; Xie et al., 2012). Moreover, the combination of low temperature and light

treatment has been known to induce anthocyanin biosynthesis in the skin of apple,

pear, and grape (Azuma et al., 2012b; Steyn et al., 2009)

It has been reported that MYB genes that is related to flavonoid biosynthesis in

fruits react to environmental factors such as light or temperature in a different manner

(Azuma et al., 2012; Czemmel et al., 2009; Takos et al., 2006). In grape berry skins,

the expression of MYB related transcription factor genes in anthocyanin biosynthesis

such as VlMYBA1-3, VlMYBA2, VlMYBA1-2 varied in light or temperature treatment.

The expression of VlMYBA1-3 was strongly affected by both temperature and light

treatment, whereas the expression of VlMYBA2 as well as VlMYBA1-2 was affected

mainly by light and temperature, respectively. However, some other examined MYB

related flavonoid biosynthesis genes such as MYB5a and MYB5b did not react to light

or temperature treatment. Interestingly, the highest ABA contents were detected with

the low temperature (15 °C) in light or dark treatment, indicating that ABA might

have a role in temperature that controls flavonoid synthesis (Azuma et al., 2012b).

Water

Besides light and temperature, water status is important environmental factor

affects anthocyanin biosynthesis. Under water deficit conditions during grape

maturation, anthocyanin synthesis was highly stimulated. Moreover, the related

anthocyanin biosynthetic genes such as CHS, F3H, F3'5'H, OMT, and UFGT could

also be stimulated in grape berries under water deficit conditions. Drought conditions

enhance the production of the hydroxylated and methoxylated anthocyanins


19

(Castellarin et al., 2007b). Apart from anthocyanin accumulation, water deficit limited

the expression of the structural genes involved in the synthesis of proanthocyanidins

and other flavonols and their accumulation (Castellarin et al., 2007a).

1.2.6.3 Viticulture practices

The composition and concentration of anthocyanin in grape is complicated and

varies as an outcome of the many viticultural factors including cultivar, climate,

seasonal effects, canopy management, fertilizer, and irrigation (Mazza and Francis,

1995).

Thinning technique can improve yield and fruit composition at harvest.

Cluster thinning in order to reduce the bunch numbers can advance fruit maturation,

increase weight of bunch and berry, enhance the anthocyanin accumulation, and

improve fruit quality (Petrie and Clingeleffer, 2006). On the contrary, cluster thinning

at veraison had a little effect on maturation and the weight of grape skins; however it

resulted in a lower total acidity in berry skin (Peña Neira et al., 2007). Girdling

technique before veraison can improve coloration by enhancing sugar in berries

(Koshita et al., 2011; Yamane and Shibayama, 2007, 2006). In contrast, shading of

the leaves or defoliation reduces it (Kliewer, 1970). Moreover, excesses of nitrogen

fertilizer found to decrease the anthocyanin accumulation of fruit as well as other

phenolic compounds (Stefanelli et al., 2010). Root restriction can improve berry

quality in grape and increase the anthocyanin levels in berry skin at harvest (Wang et

al., 2012).


20

1.2.7 Light

Plants do not absorb all spectrum of solar radiation; they selectively absorb

the proper wavelengths according to their requirements. The most important part of

the light wavelengths is visible light laid in the range between 400 and 700 nm

which is known as photosynthetically active radiation (PAR). Chlorophylls

(chlorophyll a and b) and photosynthetic pigments, for example the carotenoids

β-carotene, zeaxanthin, lycopene, and lutein play an important role in the

photosynthesis. (Figure 1.3).

Figure 1.3. Absorption spectrum of chlorophyll and antenna pigments. (Singh et al., 2014.)

Plant pigments including chlorophylls and carotenoids begin absorption

in 380–400 nm (ultraviolet A/visible light), and peak absorption by chlorophylls

occurs in 400–520 nm range containing violet, blue, and green wavelengths which has

a strong influence on vegetative growth and photosynthesis. In 520–610 nm

containing green, yellow, and orange bands, this range is less absorbed by the plant


21

pigments. A large amount of absorption occurs at 610−720 nm including red

wavelength. This wavelength strongly affects the vegetative growth, photosynthesis,

flowering, and budding (Singh et al., 2014).

Photoreceptors

Higher plants accurately perceive solar radiation from UV-B to far-red

wavelengths by photoreceptors including phytochrome absorbing red/far-red light

as well as cryptochromes, and phototropins sensing UV-A/blue light, and UV-B

photoreceptor UV RESISTENCE LOCUS8 (UVR8) (Casal, 2013; Favory et al.,

2009; Möglich et al., 2010; Rizzini et al., 2011).

Figure 1.4. The spectrum of solar radiation reaching from gamma rays to radio waves

with view on visible wavelengths and plant photoreceptors absorbing specific

wavelength. CRY, cryptochromes; PHY, phytochromes; PHOT, phototropins; UV,

ultraviolet; UVR8, UV-B photoreceptor. (Zoratti et al., 2014.)


22

Phytochromes with in two forms such as Pr that responds to red light and Pfr

that responds to far-red light regulate flowering in plants. These two pigments (Pr

and Pfr) convert back and forward. Under red light (660 nm), Pr is converted into Pfr

which is the active form triggering flowering, in contrast Pfr into Pr with far-red light

(Figure 1.5) (Downs and Thomas, 1982; Evans, 1976; Shinomura et al., 2000; Smith,

1982). Phytochromes move to the nucleus that was activated by light. Two different

forms of phytochrome function as a detection of circadian rhythms and seasonal

changes in light conditions (Casal, 2013; Reed, 1999).

Figure 1.5. Red and far-red light mediated conversion of phytochromes. (Singh et al., 2014)

Cryptochromes are photoreceptors for blue, green, and UV-A light. They are

involved in sensing circadian rhythms and control of various developmental processes

including secondary metabolic biosynthesis, such as flavonoids (Giliberto et al., 2005;

Lopez et al., 2012). Phototropins also absorb blue and UV-A light. In Fragaria ×

ananassa fruits, Kadomura-Ishikawa et al. (2013) has shown that blue light increased

anthocyanin accumulation through FaPHOT2, a phototropin2 and the expression of

FaCHS after four days of treatment.


23

Recently, an important piece of the puzzle in the mechanism which light

controls anthocyanin synthesis in fruits has been reported at post-translational level.

MdMYB1 protein accumulates in light, but is degraded in the dark through an

ubiquitin-dependent pathway. The ubiquitin E3 ligase CONSTITUTIVE

PHOTOMORPHOGENIC1 (COP1), a suppressor of phytochromes, functions as a

negative regulator of light signaling directly at the downstream of the photoreceptors

in controlling different light-regulated plant development processes by adjustment of

its subcellular localization (Lau and Deng, 2012). Li et al. (2012) showed that in apple,

the MdMYB1 protein which is a positive regulator of light-induced anthocyanin

synthesis could interact directly with MdCOP1 protein acting as a molecular switch of

light-induced plant processes.

In the dark, COP1 is localized in the nucleus, where it interacts with the subset

of specific key positive regulators including MYB and ELANGATED

HYPOCOTYL5 (HY5), a transcription factor promoting photomorphogensis, which

is a direct target of COP1 (Lee et al., 2007) in Figure 1.6 A.

In light, COP1 can interact with activated photoreceptors including

phytochromes and cryptochromes leading to the inhibition of COP function by

dissociation of COP1 from the complex and exportation from the nucleus. After

COP1 protein is removed from nucleus by activated photoreceptors, HY5 is stabilized

and links to activation of the MYBs and key structural flavonoid biosynthesis genes as

well as the accumulation of flavonoids in response to light in Arabidopsis and apple

(Hardtke et al., 2000; Maier et al., 2013; Peng et al., 2013; Shin et al., 2013; Stracke

et al., 2010) in Figure 1.6 B.


24

Figure 1.6. COP1 acts as a repressor in light signaling pathway by interacting directly

with photoreceptors to mediate different light-regulated plant developmental process

in darkness (A) and in visible light (B). (Lau and Deng, 2012; Zoratti et al., 2014.)

1.2.8 Light emitting diodes (LEDs)

As mention above, plants do not absorb all wavelengths of solar radiation. The

wavelengths in 400–520 nm containing blue wavelengths and in 610–720 nm

containing red wavelengths are mostly important for plant growth. LEDs can easily

generate the red and blue wavelengths that are consistent with the maximum

absorption of chlorophyll for the photosynthesis.

Nowadays, LEDs have been used effectively as a light source for growing

plants in a plant factory. They can replace fluorescent lights or high-pressure sodium

lamps (Ono and Watanabe, 2010; Watanabe, 2011). LEDs allow reduction of the

production cost, low electricity consumption, long durability, and low heat generation


25

(Kwon and Lim, 2011). Red wavelength is required for the development of the

photosynthesis, whereas blue wavelength is important for the synthesis of chlorophyll,

chloroplast development, stomatal opening, photomorphogenesis as well as

biosynthesis of secondary metabolites such as flavonoids (Akoyunoglou and Anni,

1984; Giliberto et al., 2005; Sæbø et al., 1995; Senger, 1982).

In grape, blue or red LED irradiation treatment enhanced the expression of

anthocyanin biosynthesis-related genes including MYB transcription factor genes,

resulting in anthocyanin accumulation. Moreover, the effect of blue LED treatment

was stronger than red LED treatment (Azuma et al., 2012a; Kondo et al., 2014). It has

been reported that the expression of FaPHOT2, a phototropin2, corresponded with

increasing in anthocyanin content in strawberry (Fragaria × ananassa, cv. Sachinoka).

Consequently, light sensing may have a role in sensing blue light, and mediating

anthocyanin biosynthesis in fruits (Kadomura-Ishikawa et al., 2013). Phytochromes, a

red light receptors, activate signal pathways leading to seed germination, seed

production, shade avoidance, and flowering (Quail et al., 1995; Stutte, 2009), whereas

Cryptochromes, a blue-ultraviolet light receptors, including cyp1 and cyp2 control the

inhibition of hypocotyl elongation, stimulation of cotyledon opening, and floral

development (Ahmad and Cashmore, 1993; Guo et al., 1998; Lin et al., 1998, 1996).

Moreover, it has been shown that cry1 can stimulate anthocyanin accumulation

(Ahmad et al., 1995; Chatterjee et al., 2006). It was reported that the elongation effect

of the main stem in leaf lettuce was promoted by a red LED but suppressed by blue

LED treatment (Hirai et al., 2006; Shimokawa et al., 2014).


26

However, the growth that is influenced by the red or blue LED treatment

might have depend on plant species (Goins et al., 2001; Li et al., 2012; Sims and

Pearcy, 1992).

1.2.9 Sugar induction of anthocyanin accumulation

Sugars not only act as energy sources but also act as signaling molecules

involved in the growth and development of higher plants (Finkelstein and Gibson,

2002; Smeekens, 2000). It was reported that in Arabidopsis, anthocyanin synthesis in

cotyledons or leaves increased when seedlings were grown in a sugar-containing

medium (Mita et al., 1997; Ohto et al., 2001). Moreover, a similar phenomenon was

observed in grape cells (Larronde et al., 1998) and radish hypocotyls (Hara et al.,

2003). Solfanelli et al. (2006) reported that in Arabidopsis, exogenous sucrose

treatment increased the expression of enzymes acting at the downstream of CHS,

including CHS, CHI, F3H, F3′H, FLS, DFR, leucoanthocyanidin dioxygenase

(LDOX), and UFGT. In grape berry skin, sucrose triggers the expression of

anthocyanin biosynthesis genes (Boss et al., 1996). It was also reported that sugars

enhanced anthocyanin accumulation and induced the expression of F3H in grape

berries (Zheng et al., 2009). In addition, light is required for sugar to induce the

anthocyanin accumulation (Jeong et al., 2010).


27

1.2.10 Interaction between sugar and ABA on anthocyanin accumulation

It has been reported that ABA treatment can induce anthocyanin accumulation

in maize kernels and grape (Kim et al., 2006; Lee et al., 1997; Mori et al., 2005a). In

Arabidopsis seedlings, ABA showed a synergistic effect with sucrose on anthocyanin

accumulation, resulting in a significant increase in the transcript levels of biosynthesis

genes including CHS, DFR, LDOX, UFGT, and cinnamate 4-hydroxylase (C4H)

(Loreti et al., 2008). However, the expression of the DFR gene in the ABA-deficient

mutant and in the ABA-insensitive abi1-1 mutant was no effect on anthocyanin

accumulation, regardless of the presence of sugar. It has been suggested that ABA is

not strictly required for sucrose-induced anthocyanin biosynthesis (Loreti et al., 2008).

Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,

anthocyanin and sugar syntheses in delayed-start cultured grapes

28

CHAPTER 2

EFFECT OF BLUE- AND RED-LED IRRADIATION AT NIGHT

ON ENDOGENOUS ABSCISIC ACID (ABA), ANTHOCYANIN

AND SUGAR SYNTHESES IN DELAYED-START CULTURED

GRAPES UNDER DOUBLE CROPPING CULTIVATION SYSTEM



29

2.1 INTRODUCTION

Most vineyards in Japan product table grapes, and there are various cropping

techniques to cultivate grapevines such as early-heating culture or delayed-start

culture in greenhouses besides open-field culture. The grapes under early-heating

culture are harvested in late June or early July, and the grapes in the delayed-start

culture are harvested in December or January, when grapes are high prices. However,

generally the coloration or sugar concentrations in early-heating or delayed-start

grapes are inferior to those in grapes cultured in the open filed, because the duration

of sunshine or the amount of solar radiation are not always enough for the growing

period. In these cultivation techniques, long-day treatment by supplement light,

temperature control, breaking of dormancy, pruning, and enhanced CO2 application

are important to produce good qualities. Light emitting diodes (LEDs) have been used

as a supplement light for growing plants in a plant factory. Recently, Kondo et al.

(2014) showed that blue LED irradiation at night was effective in increasing

anthocyanin and sugar concentrations in grape berries that were harvested at the same

time as grapes cultured in the open field. Furthermore, anthocyanin synthesis in

grapes can be promoted by exogenous abscisic acid (ABA) treatment (Ovadia et al.,

2013), but Kondo et al. (2014) found that another factor besides ABA might

significantly influence anthocyanin formation in grape berries. There is little

information on the effect of LED irradiation on anthocyanin and sugar syntheses in

grape berries in the delayed-start culture system, in which the percentage of blue light

in sunshine gradually decreases and that of red light in the sunshine gradually

increases (Kamuro et al., 2003).



30

In the present study, the author examined the effects of red and blue LED

irradiation at night on endogenous ABA, anthocyanin synthesis, their related gene

expressions, and sugar synthesis in grape berries in delayed-start cultured grapes

under double cropping cultivation system.



31

2.2 MATERIALS AND METHODS


Twelve 8-year-old ‘Kyoho’ grapevines [Vitis labrusca×V. vinifera] grafted

onto ‘Teleki-Kober 5BB’ rootstocks [V. berlandieri×V.riparia hybrids] and

underwent a delayed start under a double-cropping cultivation system, were planted in

a 45-L plastic pot and grown in a greenhouse covered with polyvinyl film (90%

transmittancy) at Chiba University located at 35° N Lat, 140° E Long, and at an

altitude of 37 m. The width of each vine was 165 ± 6.5 standard error (SE) cm and the

vine height was 135 ± 10 cm. Each vine has six clusters with 35 berries. To produce

seedless fruit, each cluster was treated with a 25 mg L-1

solution of gibberellic acid

(GA3) at full bloom (FB) and again 10 days after FB. Each plastic pot was watered 20

L per day. Three test groups of four vines each were irradiated with a red LED (peak

wavelength 660 nm) for three hours before sunrise and three hours after sunset, from

full bloom to 106 days after full bloom (DAFB). Vines in the second group were

irradiated with a blue LED (peak wavelength 450 nm) on the same schedule. The

third group consisted of untreated controls. The photosynthetic photon flux density

(PPF) of the red and blue LEDs was adjusted to 50 µmol m-2

s-1

at a distance of 10 cm

from the light. The PPF measured at each cluster was 19-12 µmol m-2

s-1

.

Sixty berries from each test group (15 berries from each cluster of one

representative vine per group) were sampled immediately after dawn at 61, 76, 91,

and 106 DAFB for the analysis of endogenous ABA, the 9-cis-

epoxycarotenoiddioxygenase (VvNCED1), ABA 8'-hydroxylase (VvCYP707A1),

UDP-glucose-flavonoid 3-O-glucosyltransferase (VvUFGT), VlMYBA1-2, and



32

VlMYBA2 genes, and anthocyanin and sugar concentrations. Ten berries from each

test group were sampled to analyze fruit qualities including length, width, weight, and

soluble solid and acid contents and thirty berries from each test group were sampled

to analyze skin color in L*, a*, b* and hue angle at harvesting (106 DAFB). After the

skin of the berries was peeled, the skins were immediately frozen in liquid nitrogen

and stored at −80°C until analysis.


Endogenous ABA in the frozen skin samples was analyzed according to a

previous report (Kondo et al., 2014) (Fig. 2.1). The frozen skin samples [1 g fresh

weight (FW)] were homogenized in 20 mL cold 80 % (v/v) methanol with 0.2 µg

ABA-d6 as an internal standard. After homogenation and filtration of the

sample, the solution was subjected to a preparative high performance liquid

chromatograph (HPLC; model PU-980 Gulliver series; Japan Spectroscopic, Tokyo,

Japan; flow rate, 1.5 mL min−1

; detection at 254 nm) equipped with a Mightysil

RP-18 octadecylsilyl (ODS) column (Kanto Chemical, Tokyo, Japan; 4.6 mm

i.d. × 25 cm) eluted with a gradient of 4.8–9.6 M acetonitrile containing

20 mM acetic acid, over a period of 30 min, then held at 9.6 M acetonitrile for 5 min.

Fractions containing ABA were collected, dried in vacuo, and methylated using

ethereal diazomethane for 10 min. The methyl ester of ABA was analyzed by gas

chromatography-mass spectrometry-selected ion monitoring (GC-MS-SIM; model

QP5000; Shimadzu, Kyoto, Japan). The column temperature was a step gradient of

60°C for 2 min, then 60–270°C at 10°C min−1

, and 270°C for 35 min. The ions were

measured as ABA-d0 methyl ester/ABA-d6 methyl ester at m/z 190, 260, 194. The



33

ABA concentration was calculated from the ratio of peak areas for m/z 190 (d0)/194

(d6). To identify ABA methyl ester in the samples, its fragment ion pattern was

compared with chemical standards in the total ion monitoring (TIM) mode (Figure 2.2

and Figure 2.3).

Samples 1 gram were homogenized in 20 mL cold 80% (v/v) methanol with 0.2 µg

ABA-d6 as an internal standard

The homogenate was filtered

Washed with 20 mL cold 80% (v/v) methanol

Concentrated to an aqueous solution in vacuo

The aqueous phase was adjusted to pH 2.5 with 0.1 M phosphoric acid

Extracted three times with 20 mL 100% (v/v) ethyl acetate

Concentrated to dryness

Redissolved in 1 mL 4.8 M acetonitrile

The solution was subjected to HPLC

Fractions containing ABA was collected

Dried in vacuo

Methylated using ethereal diazomethane for 10 min

The methyl ester of ABA was analyzed by GC-MS-SIM

Figure 2.1. Flowchart of Quatitative analysis of ABA.



34

Rela

tive

abu

ndance

(m/z)

d6-ABA

d0-ABA

d0-ABA

ABA standard

190 (d0-ABA)

260 (d0-ABA)

194 (d6-ABA)

Time (min)

Retention time profile showing selected ions in the ABA-containing fraction in standard

Mass spectrum of d6-ABA and d0-ABA in standard

Figure 2.2. Retention time and mass spectrum profile showing selected ions in the

ABA-containing fraction in standard and sample.



35

Sample

d0-ABA

d6-ABA

Retention time profile showing selected ions in the ABA-containing fraction in sample

Mass spectrum of d6-ABA and d0-ABA in sample

Rela

tive

abu

ndance

d6-ABA

d0-ABA

d0-ABA

Time (min)

Figure 2.3. Retention time and mass spectrum profile showing selected ions in the

ABA-containing fraction in sample.



36

2.2.3 RNA extraction, cDNA synthesis, and quantitative real-time RT-PCR analysis

Total RNA was extracted from the skin (1 g FW; three replications of 20 berries) as

described by Kondo et al. 2012) (Figure 2.4). A 2-µg aliquot of total RNA was treated

with 5 U of DNaseI (Takara Bio, Inc., Otsu, Japan) and used for first-strand cDNA

synthesis. For reverse transcription-polymerase chain reaction (RT-PCR), cDNA was

synthesized in a 20 µL reaction volume using ReverTraAce (Toyobo Co., Ltd., Osaka,

Japan) following the manufacturer’s instructions. RNA extraction and cDNA

synthesis were performed three times on each sampling date. Quantitative real-time

PCR was performed using a KAPA SYBR FAST Master Mix (Kapa

Biosystems,Boston, MA, USA) with Applied Biosystems StepOnePlus

(LifeTechnologies Co., Tokyo, Japan) following the instruction manual. Gene-

specific primers for each gene (Table 2.1) were used for RT-PCR. Primers for the

VvNCED1 and VvCYP707A1 genes were constructed according to previous report

(Kondo et al., 2014). The relative expression level of each gene was determined by a

relative standard curvemethod. The expression level was normalized to that of the

VvUbiquitin gene (Fujita et al., 2007).



37

Samples 1 gram were ground to a fine powder in liquid nitrogen using a mortar and pestle.

The powder was added to pre-warmed (65ºC) extraction buffer at 20 mL g-1

Incubated in a 65ºC water bath for 10 min

Extracted twice with equal volumes chloroform:isoamyl alcohol (24:1)

centrifuged at 9,000 rpm for 10 min at 4ºC

The aqueous layer was transferred to a new tube

centrifuged at 9,000 rpm for 10 min at 4ºC

Added 0.1 v 3 M NaOAc and 0.6 v isopropanal

Mixed and stored at −80ºC for 30 min

Centrifuged at 3,500 rpm for 30 min at 4ºC to collected nucleic acid pallets

The pallet was dissolved in 1 mL TE and transferred to a microcentrifuge tube

Added 0.3 v of 10 M LiCl to selectively precipitate the RNA

Stored overnight at 4ºC

Centrifuged at 20,000 rpm for 30 min at 4ºC to pellet RNA

Washed with cold 70% EtOH, air dired, and dissolved in 30 µL MilliQ

Total RNA extraction

Figure 2.4. Flowchart of RNA preparation.



38

Table 2.1. Primers used for real-time RT-PCR.

Gene Forward/reverse primer (5'-3') Reference

VvNCED1 (F) GGTGGTGAGCCTCTGTTCCT Sun et al. (2010)

(R) CTGTAAATTCGTGGCGTTCACT

VvCYP707A1 (F) GAAACATTCACCACAGTCCAGA Sun et al. (2010)

(R) AGCAAAAGGGCCATACTGAATA

VlMYBA1-2 (F) TGGTCACCACTTGAAAAAGA Azuma et al. (2012a,b)

(R) GAATGTGTTAGGGGTTTATT

VlMYBA2 (F) GCTGAGCATGCTCAAATGGAT Azuma et al. (2012a,b)

(R) TCCCACCATATGATGTCACCC

VvUFGT (F) GGGATGGTAATGGCTGTGG Jeong et al. (2004)

(R) ACATGGGTGGAGAGTGAGTT

VvUbiquitin (F) TCTGAGGCTTCGTGGTGGTA Fujita et al. (2007)

(R) AGGCGTGCATAACATTTGCG



39

2.2.4 Anthocyanin

The Anthocyanin analysis was performed as described by Kondo et al. (2014).

The total anthocyanin concentrations were expressed as malvidin-3-O-glucoside

equivalents. The frozen skins samples (0.5 g FW; three replications of 20 berries)

were diluted with 2% (v/v) formic acid of 5 mL for 24 hours at 4ºC in the dark. After

filtration, Anthocyanin was analyzed by HPLC mass spectrometer (LC-MS; model

LCMS-2010 EV; Shimadzu) with a Mightysil RP-18 ODS column following

the method described by Wang et al. (2012) with a slight modification. Solvent

A was 2% formic acid and solvent B was composed of 2% formic acid and

acetonitrile. The starting conditions were 94% A and 6% B, then a linear gradient to

0% A and 100% B for 40 min, then a return to the initial conditions within 5 min. A

column at 40ºC with a flow rate of 1 mL min−1

and an ultraviolet/visible light

(UV/VIS) detector at 525 nm were used.


The sugar analysis was performed as described by Kondo et al. (2014).

The frozen skins samples (1 g FW; three replications of 20 berries) in 10 mL

80% (v/v) ethanol were heated at 60ºC for 10 min and homogenized after cooling.

The homogenate was filtered, evaporated, and analyzed by HPLC (model L-6200;

Hitachi, Tokyo, Japan) with a Shodex ODP2 HP-4E column [Showa Denko, Tokyo,

Japan; 4.6 mm i.d. × 25 cm]. A column at 30ºC with a flow rate of 1 mL min−1

at 75%

(v/v) acetonitrile and a refractive index (RI) detector were used.



40


Data are shown as means ± SE of three replications. The SAS analysis of

variance procedure (version 8.2, SAS Institute, Cary, NC, USA) was used to

determine the treatment effects, and the mean separation was analyzed by Tukey-

Kramer test at P ≤ 0.05.

.



41

2.3 Results

The average temperatures from full bloom to harvest (106 DAFB) during

LED irradiation in delayed-start cultured grapes are shown in Figure 2.5. The average

temperature in the greenhouse was similar to that in the open field until 61 DAFB

(veraison). Although the temperatures in the open field gradually decreased after 61

DAFB, those in greenhouse were kept about 15ºC until 106 DAFB (havest).

Figure 2.5. Change of temperature in greenhouse.



42

2.3.1 Endogenous ABA concentration and the expressions of VvNCED1 and

VvCYP707A1

Endogenous ABA concentrations in blue- and red-LED-treated skin at 61, 91,

and 106 DAFB were higher than those in the untreated control. However, endogenous

ABA in blue and red LED-treated skin was not significantly different (Figure 2.6).

The expressions of VvNCED1 in the blue- and red-LED-treated skin at 61 and 106

DAFB were higher than those in the untreated control. However, the expressions of

VvNCED1 in blue and red LED-treated skin were not significantly different. The

expressions of VvCYP707A1 showed changes similar to those in the expressions of

VvNCED1 at each date (Figure 2.7).

Figure 2.6. Endogenous ABA concentrations in red or blue LED-treated skin.

Different letters indicate significant difference by Tukey–Kramer test at P ≤ 0.05.

ns, not significant.



43

Figure 2.7. Quantitative real time RT-PCR analysis of VlMYBA1-2 and VlMYBA2 in

red or blue LED-treated skin. Different letters indicate significant difference by

Tukey–Kramer test at P ≤ 0.05. ns, not significant.



44

2.3.2 Total anthocyanin concentration and the expressions of VvUFGT,

VlMYBA1-2, and VlMYBA2

Total anthocyanin concentrations in blue- and red-LED-treated skin were

significantly higher than those in the untreated control at each measurement data

(Figure. 2.8). The expressions of VvUFGT in the blue- and red-LED-treated skin were

significantly higher than those in the untreated control, and at 91 and 106 DAFB those

in the blue-LED-treated skin were higher than those in red-LED-treated skin. The

expression of VlMYBA1-2 in red- and blue-LED-treated skin were higher than those in

the untreated control at 61 DAFB, but those in the untreated control were highest at

91 and 106 DAFB. The expressions of VlMYBA2 in blue- and red- treated skin at 61

and 76 DAFB were higher than those in the untreated control (Figure. 2.9).

Figure 2.8. Changes of total anthocyanin concentration in red or blue LED-treated

skin. Different letters indicate significant difference by Tukey–Kramer test at P ≤ 0.05.

ns, not significant.



45

Figure 2.9. Changes of quantitative real time RT-PCR analysis of VvUFGT ,

VlMYBA1-2, and VlMYBA2 in red or blue LED-treated skin. Different letters indicate

significant difference by Tukey–Kramer test at P ≤ 0.05. ns, not significant.



46


Total sugar, glucose, and fructose concentrations in blue- and red-LED-

treated skin at each date were significantly higher than those in the untreated control.

However, total sugar, glucose, and fructose concentrations in blue and red LED-

treated skin at 61, 76, and harvesting (106 DAFB) were not significantly different

(Figure 2.10 and 2.11).

Figure 2.10. Changes of total sugar in red or blue LED-treated skin. Different letters

indicate significant difference by Tukey–Kramer test at P ≤ 0.05. ns, not significant.



47

Figure 2.11. Changes of glucose and fructose concentrations in red or blue LED-

treated skin. Different letters indicate significant difference by Tukey–Kramer test at

P ≤ 0.05. ns, not significant.



48

2.3.4 Fruit qualities at harvest (106 DAFB)

The sugar concentrations in blue- and red-LED-treated skin were found to be

higher than those in the untreated control at (106 DAFB). Furthermore, acid content

in blue- and red-LED-treated skin was lower than that in the untreated control. There

was no significant difference in berry weight between LED- treated skin and the

untreated control. Length in the untreated control was higher than blue- and red-LED-

treated skin however there was no significant difference in wide among treatments

(Table 2.2). Skin color in L* and a* in blue- and red-LED-treated skin was higher

than that in the untreated control. On the other hand, skin color in b* in the untreated

control was higher than that in LED treatment. There was no significant difference in

hue angle between LED-treated skin and the untreated control (Table 2.3). Effect of

LED irradiation on grapes harvested at 106 DAFB was shown in Figure 2.12.

Chapter 2: Effect of blue- and red-LED at night on endogenous ABA, anthocyanin and sugar syntheses in delayed-start cultured

grapes

49

Table 2.2. Effect of LED irradiation on berry length, width, weight, and soluble solids and tartaric acid concentration

in early harvest at 106 DAFB.

Treatment

Berry length

(mm)

Berry width

(mm)

Berry weight

(g)

Soluble solids

(°Brix)

Tartaric acid

(g/100mL)

Red LED 29.14±0.26 a 24.02±0.19 a 10.54±0.22 a 16.62±0.10 b 0.74±0.01 a

Blue LED 28.48±0.31 a 23.80±0.19 a 9.96±0.22 b 17.68±0.13 a 0.76.±0.07 a

Untreated control 30.79±0.29 b 24.10±0.22 a 10.7±0.28 a 12.42±0.20 c 1.23±0.05 b

There are significant differences between different alphabet (significant level is 5 %) by Tukey's Multiple comparison

statistics. Data are the mean ± SE (n=10). ns, not significant.

Chapter 2: Effect of blue- and red-LED at night on endogenous ABA, anthocyanin and sugar syntheses in delayed-start cultured grapes

Chapter 2: Effect of blue- and red-LED at night on endogenous ABA, anthocyanin and sugar syntheses in delayed-start cultured

grapes

50

Table 2.3. Effect of LED Irradiation on skin color in L*, a*, b* and Hue angle at 106 DAFB.

Treatment

L*

a*

b*

Hue angle

Red LED 29.07±0.20 a 2.39±0.17 a 1.11±0.17 a 23.69±4.05 a

Blue LED 28.99±0.38 a 1.90±0.15 a 0.94±0.19 a 19.80±5.47 a

Untreated control 32.81±0.31 b 0.17±0.28 b 3.36±0.27 b 3.65±13.50 a

\

There are significant differences between different alphabet (significant level is 5 %) by Tukey's

Multiple comparison statistics. Data are the mean ± SE (n=30). ns, not significant.

Chapter 2: Effect of blue- and red-LED at night on endogenous ABA, anthocyanin and sugar syntheses in delayed-start cultured grapes



51

Figure 2.12. Effect of LED irradiation on grapes harvested at 106 DAFB.



52

2.4 Discussion

The result of the current study showed that endogenous ABA concentrations

in blue- and red-LED-treated skin in delayed-start cultured grapes under double

cropping cultivation system were not significantly different. However, Kondo et al.

(2014) showed that endogenous ABA increased in red-LED-treated grape berries

that were harvested at the same time as grapes cultured in the open field. This

result suggests that natural changes over the course of the growing season in the

proportions of blue and red light present in sunlight might influence endogenous ABA

concentrations. In the result of the current study, endogenous ABA and the

expressions of VvNCED1, an upstream enzyme for ABA synthesis, in blue- and red-

LED-treated skin were significantly higher than in the untreated control. Therefore,

LED-treated skin may be effective for increasing endogenous ABA through the

expressions of VvNCED1 in grape berries. Sun et al. (2010) showed that the specific

balance between the biosynthesis and catabolism of NCEDs and CYP707As regulates

the endogenous ABA concentration. Therefore, the high expressions of VvNCED1

and VvCYP707A1 at veraison may influence the increase in endogenous ABA

concentrations in grapes.

In the present study, blue- and red-LED irradiat ions at night significantly

increased anthocyanin concentration. The expressions of VvUFGT gene in blue- and

red-LED-treated skin were generally similar to the total anthocyanin concentrations.

However, the expressions of VlMYBA1-2 and VlMYBA2 were not necessarily

correlated with the blue and red irradiation. Azuma et al. (2011) concluded that



53

the final anthocyanin concentrations in grape skin cannot be determined solely by the

expression of MYB-related genes. The result of this study suggests that the

expressions of VlMYBA1-2 and VlMYBA2 at veraison (61 DAFB) may be

significantly associated with anthocyanin production.

The results of this study showed that sugar concentrations in the skin

increased by the blue- and red-LED irradiations. The compensation point in grape is

3.7−37 µmol m-2

s-1

, although this varies with temperature (Shiraishi et al., 1997). The

action of enzymes on the sugar metabolism in grape berries differs according to

growing conditions (Xie et al., 2009). It has been reported that the sucrose phosphate

synthase genes in rice (Oryza sativa L. cv. Nipponbare) were controlled by light

(Yonekura et al., 2013). Therefore, an increase in sugar in blue- or red-LED-treated

skin at night may depend on the promotion of the photosynthesis rate in leaves or the

activation of the enzymes in the sugar metabolism. The results of this study also

suggest complex interactions among endogenous ABA, anthocyanin synthesis, and

sugar accumulation.

Chapter 3: Effect of blue- and red-LED at night on endogenous ABA, anthocyanin and

sugar syntheses in early-heating cultured and effect of the irradiating position

54

CHAPTER 3

EFFECT OF BLUE- AND RED-LED IRRADIATION AT NIGHT

ON ENDOGENOUS ABSCISIC ACID (ABA), ANTHOCYANIN

AND SUGAR SYNTHESES IN EARLY-HEATING CULTURED

GRAPES UNDER DOUBLE CROPPING CULTIVATION SYSTEM

AND THE EFFECT OF THE IRRADIATING POSITION OF

BLUE- AND RED- LED TO ENHANCE ANTHOCYANIN SYNTHESES IN

GRAPE

Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and


55

3.1 INTRODUCTION

In Japan, the ratio of blue light in sunshine gradually increases toward the

summer solstice (June) but decreases toward the winter solstice (December), whereas

that of red light changes oppositely (Kamuro et al. 2003). The spectral composition of

solar radiation including red and blue light that changes with the season may

influence flowering and pigmentation in plants (Kamuro et al., 2003). Anthocyanins,

which are the predominant pigment in grapes, accumulate at the beginning of

maturation. It has been found that abscisic acid (ABA) can regulate berry

development in grapes. For instance, in grape skins, endogenous ABA concentrations

increased at veraison (the onset of berry maturation) when berries began to

accumulate sugars and anthocyanin (Wheeler et al., 2009). Furthermore, ABA

application stimulated berry maturation processes such as anthocyanin biosynthesis

with the increase of the expression of UDP-glucose:flavonoid 3-O-glucosyltransferase

(UFGT), which is the key gene in the anthocyanin pathway (Roberto et al., 2012). In

addition, grape berries which were incubated with sugar significantly accumulated

anthocyanin, and the addition of sugar elevated the expression of flavanone 3-

hydroxylase (F3H), which is pivotal at the bifurcation of the anthocyanins and

flavonols branches (Zheng et al., 2009). In contrast, leaf-shading reduced sugar

accumulation in the berry (Morrison and Noble, 1990). The positive effects of light

emitting diode (LED) irradiation on anthocyanin accumulation have been reported in

strawberries (Fragaria × ananassa Duch.) (Xu et al., 2014), leaf baby lettuce

(Lactuca sativa L.) (Samuolienė et al., 2012) and grapes (Kondo et al., 2014). These

findings suggest that interactions exist among light, ABA, sugar, and anthocyanin.



56

The author examined the effects of red- or blue-LED irradiation at night on

anthocyanin synthesis in grape berries in an early-heating culture system, in which the

percentage of red light in sunshine gradually decreases and that of blue light in

sunshine gradually increases, and in the ordinary growing season, in which the

percentage of red light in sunlight gradually increases and that of blue light in

sunshine gradually decreases (Kamuro et al., 2003). The author also examined the

effect of the irradiating position (leaf or cluster) of the red or blue LED. At the same

time, endogenous ABA, the expression of anthocyanin and ABA biosynthesis-related

genes, and sugar synthesis in grape berries were also analyzed.



57

3.2 MATERIALS AND METHODS


‘Kyoho’ grapevines [Vitis labrusca × V. vinifera] grafted onto ‘Teleki-Kober

5BB’ rootstocks [V. berlandieri × V. ripariahybrids] were planted in a 45 L plastic

pot and grown in a greenhouse covered with polyvinyl film (90% transmittancy)

at Chiba University, located at 35º N Lat, 140º E Long, and at an altitude of 37 m.

The width of each vine was 175 ± 6.3 standard error (SE) cm and the vine height was

138 ± 10 (SE) cm. Each vine had six clusters with 35 berries. To produce seedless

fruit, each cluster was treated with a 25 mg L−1

solution of gibberellic acid (GA3) at

full bloom (FB) and again 10 days after FB. Each plastic pot was watered 20 L per

day. A lighting system consisting of a red LED (Shibasaki, Inc., Saitama, Japan; peak

wavelength 660 nm) and a blue LED (Shibasaki; peak wavelength 450 nm) with a

length of 147 cm and a width of 4 cm was placed to irradiate the vines. The

photosynthetic photon flux density (PPF) of the red and blue LEDs was adjusted to 50

µmol m−2

s−1

(the compensation point in grapes : 3.7−37 µmol m−2

s−1

(Shiraishi et al.,

1997)) at a distance of 10 cm from the light using a photosynthetic active radiation

meter (Apogee Instruments, Inc., Logan, UT, USA).

Experiment 1 (Exp. 1) was conducted under an early-heating culture in 2013.

Three test groups of four 8-year-old vines each were created. Vines in the first group

were irradiated with a red LED for 3 h before sunrise and 3 h after sunset from bud

brake to harvest (97 days after full bloom (DAFB)). Vines in the second group were

irradiated with a blue LED on the same schedule. The third group consisted of the

untreated control.



58

In Experiment 2 (Exp. 2), vines were cultured in the ordinary growing season

in 2014. Each vine had six clusters with 35 berries. Five test groups of two 9-year-old

vines each were created in order to investigate the effect of the irradiating position of

the LED, such as on the leaf or the cluster only. Each group was irradiated with a red

or blue LED for 3 h before sunrise and 3 h after sunset from 25 to 99 DAFB. In the

first group, vine clusters only were irradiated with a red LED. In the second group,

vine clusters only were irradiated with a blue LED. In the third group, vine leaves

only were irradiated with a red LED. In the fourth group, vine leaves only were

irradiated with a blue LED. The fifth group consisted of the untreated controls. In

each treatment, four LEDs were placed around the cluster only or above the leaves

only. Black polyvinyl was used to eliminate unnecessary LED light when clusters or

leaves were irradiated with LED. In both Exp. 1 and Exp. 2, berries from each test

group were sampled for the analysis of endogenous ABA, the expressions of the 9-

cis-epoxycarotenoid dioxygenase (VvNCED1), ABA 8'-hydroxylase (VvCYP707A1),

UDP-glucose-flavonoid-3-O-glucosyltransferase (VvUFGT), VlMYBA1-2, and

VlMYBA2 genes, and anthocyanin and sugar concentrations. In Exp. 1, three berries

from each cluster (72 berries in total) of one vine per group were randomly sampled

at 55, 65, 75, 85, and 97 DAFB; in Exp. 2, five berries from each cluster (60 berries in

total) of one vine per group were randomly sampled immediately after dawn at 25, 53,

67, and 99 DAFB. Eight berries from each test group were sampled to analyze fruit

qualities including berry length, width, weight, and soluble solid and acid contents

and twenty four berries from each test group were sampled to analyze skin color in

L*, a*, b*, and hue angle at harvesting (97 DAFB in Exp. 1 and 99 DAFB in Exp. 2).



59

After the skin of the berries was peeled, the skins were immediately frozen in liquid

nitrogen and stored at −80 ºC until analysis.


Endogenous ABA in the frozen skin samples was analyzed according to

the procedure described in chapter 2.

3.2.3 RNA extraction, cDNA synthesis, and quantitative real-time RT-PCR analysis

Total RNA was extracted from the skin (1 g FW; three replications of 20

berries) as described in chapter 2. Gene-specific primers for each gene were used for

RT-PCR. Primers for the VvNCED1 and VvCYP707A1 genes were constructed

according to previous report (Kondo et al., 2014). The relative expression level of

each gene was determined by a relative standard curvemethod. The expression level

was normalized to that of the VvUbiquitin gene (Fujita et al., 2007).

3.2.4 Anthocyanin

The Anthocyanin analysis from the skin (1 g FW; three replications of 20

berries) was performed as described in chapter 2. The total anthocyanin

concentrations were expressed as malvidin-3-O-glucoside equivalents. The frozen

skin samples (0.5 g FW; three replications of 20 berries) were diluted with 2% (v/v)

formic acid of 5 mL for 24 hours at 4ºC in the dark. After filtration, anthocyanin was

analyzed by liquid chromatography mass spectrometer (LC-MS; model LCMS-2010

EV; Shimadzu) with a Mightysil RP-18 ODS column.



60


The sugar analysis from the skin (1 g FW; three replications of 20 berries)

was performed as described in chapter 2.


Data are shown as mean ± SE of three replications. The SAS analysis of

variance procedure (Version 8.02; SAS Institute, Cary, NC, USA) was used to

determine the treatment effects, and the mean separation was analyzed by Tukey–

Kramer test at P ≤ 0.05.



61

3.3 Results

The average temperature from full bloom to harvest during LED irradiation

under the early-heating culture (Exp. 1) was between 11 and 25°C, and that in the

ordinary growing season (Exp. 2) was between 16 and 27°C (Figure 3.1).

Figure 3.1. Changes in the temperature in the greenhouse under the early-heating

culture (Exp. 1) (A) and in the ordinary growing season (Exp. 2) (B). LED irradiation

(−) shows the average temperature during LED irradiation.



62

3.3.1 Endogenous ABA concentration and the expressions of VvNCED1 and

VvCYP707A1

The endogenous ABA concentrations in the skin differed in Exp. 1 and Exp. 2

(Figure 3.2). In Exp. 1, the endogenous ABA concentrations in blue-LED-treated skin

at 65 DAFB and 75 DAFB were significantly higher than those in red-LED-treated

skin. In each treatment, the endogenous ABA concentrations were highest at 65

DAFB. In Exp. 2, the endogenous ABA concentrations in the red-LED cluster

treatment increased toward 67 DAFB, and those in the red-LED cluster treatment at

53 DAFB were significantly higher than the others. There were no significant

differences between the LED leaf treatments and the untreated control in terms of the

ABA concentration in the skin. In Exp. 1, the expressions of VvNCED1 in the red-

and blue-LED cluster treatments at 97 DAFB were higher than those in the untreated

control. In Exp. 2, the expressions of VvNCED1 at 53 and 99 DAFB in the red- and

blue-LED cluster treatments were significantly higher than those in the untreated

control. However, the VvNCED1 expressions in the LED leaf treatments were not

different from those in the untreated control. In Exp. 1, the expressions of

VvCYP707A1 showed changes similar to those in the expressions of VvNCED1 at

each date. In Exp. 2, the expressions of VvCYP707A1 at 53 DAFB in the red- and

blue-LED cluster treatments were significantly higher than those in the untreated

control, and those in the red- and blue-LED cluster treatments at 67 DAFB were

significantly higher than those in the other treatments.



63

Figure 3.2. Endogenous ABA concentrations and the expressions of VvNCED1 and

VvCYP707A1 under the early-heating culture (Exp. 1) (A) and in the ordinary

growing season (Exp. 2) (B). The experimental values are plotted in comparison to

the control (Ubiquitin) value. Data are the means ± SE of three replications. Different

letters indicate significant difference by Tukey-Kramer test at P ≤ 0.05. ns, not

significant. Red- or blue-LED cluster treatment: red (C), blue (C). Red- or blue-LED

leaf treatment: red (L), blue (L).



64

3.3.2 Total anthocyanin concentration and the expressions of VvUFGT,

VlMYBA1-2, and VlMYBA2

In Exp. 1, the total anthocyanin concentrations in blue- and red-LED-treated

skin after veraison (55 DAFB) were significantly higher than those in the untreated

control. In Exp. 2, the total anthocyanin concentrations in the blue- and red-LED

cluster treatments after veraison (53 DAFB) were significantly higher than those in

the untreated control and LED leaf treatments. Anthocyanin concentrations in the

blue-LED cluster treatment at 67 DAFB were higher than those in the red-LED

cluster treatment (Figure 3.3). In Exp. 1, the expressions of VvUFGT, VlMYBA1-2,

and VlMYBA2 in red- and blue-LED-treated skin were significantly higher than those

in the untreated control at 75 DAFB and 97 DAFB, but there was no significant

difference between treatments at 55 DAFB. In Exp. 2, the expressions of VvUFGT

were generally similar to the total anthocyanin concentrations. That is, the expressions

of VvUFGT in the blue- and red-LED cluster treatments at veraison (53 DAFB) were

significantly higher than those in the untreated control, and at 67 DAFB those in the

blue-LED cluster treatment were higher than those in the other treatments. The

expressions of VlMYBA1-2 and VlMYBA2 at 67 DAFB in the red- and blue-LED

cluster treatments were significantly higher than those in the untreated control. In

general, there were no significant differences in the expressions of VvUFGT,

VlMYBA1-2, and VlMYBA2 between the LED leaf treatments and the untreated

control (Figure 3.4).



65

Figure 3.3. Changes in the total anthocyanin concentrations under the early-heating

culture (Exp. 1) (A) and in the ordinary growing season (Exp. 2) (B). Data are the

mean ± SE of three replications. Different letters indicate significant difference by

Tukey–Kramer test at P ≤ 0.05. Red- or blue-LED cluster treatment: red (C), blue (C).

Red- or blue-LED leaf treatment: red (L), blue (L)



66

Figure 3.4. Changes in the expressions of VvUFGT, VlMYBA1-2, and VlMYBA2

under the early-heating culture (Exp. 1) (A) and in the ordinary growing season

(Exp. 2) (B). Data are the mean ± SE of three replications. Different letters indicate

significant difference by Tukey-Kramer test at P ≤ 0.05. ns, not significant. Red- or blue-

LED cluster treatment: red (C), blue (C). Red- or blue-LED leaf treatment: red (L), blue (L)



67


In Exp. 1, the total sugar concentrations at 55 DAFB in blue-LED-treated

skin were significantly higher than those in the other treatments, and the glucose and

fructose concentrations in blue-LED-treated skin were also significantly higher than

those in the other treatments (Fig. 3.5). At 97 DAFB, the total sugar, glucose and

fructose concentrations in red-LED-treated skin were the highest, followed by the

blue-LED-treated skin and the untreated control. In Exp. 2, the total sugar, glucose

and fructose concentrations at 99 DAFB were highest in the blue-LED cluster

treatment, followed by the red-LED cluster treatment. The sugar concentrations in the

grapes in which only the leaves were irradiated by a red or blue LED were not

significantly different from those of the untreated control.



68

Figure 3.5. Changes in total sugar, glucose, and fructose concentrations under the

early-heating culture (Exp. 1) (A) and in the ordinary growing season (Exp. 2) (B).

Data are the mean ± SE of three replications. Different letters indicate significant

difference by Tukey–Kramer test at P ≤ 0.05. Red- or blue-LED cluster treatment: red

(C), blue (C). Red- or blue-LED leaf treatment: red (L), blue (L).



69

3.3.4 Fruit qualities at harvesting (97 DAFB in Exp. 1 and 99 DAFB in Exp. 2)

In Exp. 1, the sugar concentrations in the flesh of red- or blue-LED-treated

grapes were found to be higher than those in the untreated control at 97 DAFB. There

were no significant differences in tartaric acid concentration, length and berry weight

between blue- or red-LED-treated skin and the untreated control (Table 3.1). Skin

color in L*, a*, b* and hue angle was no significant differences between blue- or red-

LED-treated skin and the untreated control (Table 3.2).

In Exp. 2, the sugar concentrations in the grape flesh of red- or blue-LED

cluster treatment were higher than those evident in the other treatments; furthermore,

tartaric acid in the grape flesh of red- or blue-LED cluster treatment were lower than

those evident in the other treatments at 99 DAFB. There were no significant

differences in berry length and weight between blue- or red-LED treatment and the

untreated control (Table 3.3). Skin color in L*, b*, and hue angle of red or blue-LED

cluster treatment was lower than that in the other treatments (Table 3.4). Effect of

LED irradiation on grapes in Exp.1 and Exp. 2 was shown in Figures 3.6 and 3.7

respectively.

Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and sugar syntheses in early-heating cultured and

effect of the irradiating position

70

Table 3.1. Effect of LED Irradiation on berry length, width, weight, and soluble solids and tartaric acid

concentration at harvest (97 DAFB). (Exp. 1)

Treatment Berry length

(mm)

Berry width

(mm)

Berry weight

(g)

Soluble solids

(°Brix)

Tartaric acid

(g/100mL)

Red LED 30.1±0.49 a 24.2±0.34 a 10.8±0.62 a 16.00±0.26 a 0.465±0.01 a

Blue LED 29.6±0.40 a 24.1±0.26 a 9.94±0.45 a 16.05±0.34 a 0.407±0.02 a

Untreated control 32.4±0.65 a 24.6±0.26 a 11.2±0.67 a 13.95±0.31 b 0.466±0.01 a

There are significant differences between different alphabet (significant level is 5 %) by Tukey's Multiple

comparison statistics. Data are the mean ± SE (n=8).

Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and sugar syntheses in early-heating cultured and effect

of the irradiating position



71

Table 3.2. Effect of LED Irradiation on skin color in L*, a*, b*, and Hue angle at

harvest (97 DAFB). (Exp. 1)

Treatment L* a* b* Hue angle

Red LED 31.06±0.10 a 2.69±0.17 a -0.97±0.09 a 338.2±2.5 a

Blue LED 31.14±0.11 a 2.11±0.19 a -0.93±0.06 a 331.3±3.6 a

Untreated control 31.15±0.20 a 2.23±0.25 a -0.75±0.14 a 336.0±3.4 a

There are significant differences between different alphabet (significant level is 5 %)

by Tukey's Multiple comparison statistics. Data are the mean ± SE (n=24).





72

Table 3.3. Effect of LED irradiation on berry length, width, and weight, and soluble solids and tartaric acid concentration


Treatment Berry length

(mm)

Berry width

(mm)

Berry weight

(g)

Soluble solids

(0Brix)

Tartaric acid

(g/100mL)

Red (C) 30.68±0.30 a 24.48±0.15 a 10.53±0.28 a 20.85±0.03 a 0.428±0.007 b

Blue LED (C) 29.45±0.61 a 24.38±0.22 a 9.84±0.72 a 19.97±0.57 a 0.410±0.019 b

Red LED (L) 30.86±0.59 a 25.27±0.33 a 10.91±0.32 a 18.87±0.02 b 0.523±0.010 a

Blue LED (L) 30.68±0.34 a 25.24±0.18 a 10.68±0.31 a 18.42±0.08 b 0.501±0.009 a

Untreated control 30.70±0.48 a 25.27±0.20 a 10.87±0.35 a 17.80±0.28 b 0.520±0.012 a


statistics. Data are the mean ± SE (n=8).





73

Table 3.4. Effect of LED Irradiation on skin color in L*, a*, b* and Hue angle at harvest (99 DAFB). (Exp. 2)

Treatment

L*

a*

b*

Hue angle

Red (C) 28.99±0.15 b 5.26±0.16 a 0.44±0.05 a 4.37±0.53 a

Blue (C) 29.62±0.42 b 5.29±0.24 a 1.02±0.19 a 10.58±2.43 ab

Red LED (L) 32.54±0.30 a 6.32±0.24 a 2.48±0.23 b 22.45±2.49 c

Blue LED (L) 32.93±0.32 a 5.19±0.42 a 2.71±0.23 b 24.70±4.83 c

Untreated control 32.51±0.30 a 5.56±0.31 a 2.69±0.24 b 27.21±3.40 c


statistics. Data are the mean ± SE (n=24).





74

Figure 3.6. Effect of LED irradiation on grapes harvested at 97 DAFB. (Exp. 1)

Figure 3.7. Effect of LED irradiation on grapes harvested at 99 DAFB. (Exp. 2)

Chapter 3: Effect of blue and red-Led at night on endogenous ABA,anthocyanin and


75

3.4 Discussion

In the early-heating culture, endogenous ABA concentrations in blue-LED-

treated skin were higher than those in red-LED-treated skin. In contrast, in the

ordinary growing season, the ABA concentrations were higher in the red-LED cluster

treatment than in the blue-LED cluster treatment, a finding that was consistent with

our previous report (Kondo et al. 2014). This result suggests that endogenous ABA in

grapes might be influenced by the proportions of blue and red light in sunshine that

differ with the season (Kamuro et al. 2003) in addition to the LED irradiation

administered at night. Previous studies showed that ABA in the leaves may be

transported to the clusters via the phloem vessels (Antolín et al., 2003; Shiozaki et al.,

1999). However, in this study, endogenous ABA and the expressions of VvNCED1, an

upstream enzyme for ABA synthesis, in the red-LED treatment administered to the

cluster were significantly higher than in the LED treatment administered to the leaves.

Therefore, LED treatment of the cluster may be effective for increasing endogenous

ABA through the expressions of VvNCED1 in grape berries.

It is possible that ABA regulates the maturation involving anthocyanin

biosynthesis in non-climateric fruit such as the bilberry (Vaccinium myrtillus L.),

blueberries (V. corymbosum), sweet cherries (Prunus avium L.), and grapes

(Karppinen et al., 2013; Ren et al., 2010; Wheeler et al., 2009; Zifkin et al., 2012).

In grapes, endogenous ABA concentrations increase sharply at veraison when the

berries accumulate anthocyanin, and then gradually decrease toward harvest (Wheeler

et al., 2009). In this study, the expressions of VvNCED1 and VvCYP707A1 were high



76

at veraison (55 DAFB in Exp. 1 and 53 DAFB in Exp. 2), and the endogenous ABA

concentration was high at 65 DAFB in Exp. 1 and at 67 DAFB in Exp. 2.

The endogenous ABA concentration is modulated by the specific balance between the

biosynthesis and catabolism of NCEDs and CYP707As (Sun et al., 2010; Zhou et al.,

2004). Therefore, the high expressions of VvNCED1 and VvCYP707A1 at veraison

may be associated with the increase in endogenous ABA concentrations in grapes.

ABA application enhanced anthocyanin accumulation in grapes (Peppi et al., 2006).

However, the endogenous ABA concentrations after veraison and the anthocyanin

concentrations during maturation in the skin did not always coincide in Exp. 2.

It has been reported that sugar can induce anthocyanin synthesis in the absence of

ABA application in grape berries (Dai et al., 2014). Thus, anthocyanin synthesis in

grape skin might be affected by another factor in addition to endogenous ABA.

It has been shown that a low temperature increased anthocyanin accumulation

with the expression of anthocyanin-biosynthesis-related genes including CHS, CHI,

F3H, F3′5′H, DFR, OMT, and UFGT as well as VlMYBA2, which is a transcription

factor gene in grapes (Azuma et al., 2012a, b). In turnip seedlings (Brassica rapa),

cabbages (Brassica oleracea), and Chinese bayberries (Myrica rubra Sieb.),

anthocyanin was induced by irradiating blue light (Mancinelli et al., 1975; Shi et al.,

2014; Siegelman and Hendricks, 1957; Wang et al., 2012). In strawberries, it has been

demonstrated that blue light induces anthocyanin accumulation through a FaPHOT2

of phototropin 2 (Kadomura-Ishikawa et al., 2013). In this study, the anthocyanin

concentrations in the blue-LED treatment were the highest in both seasons. Moreover,

the anthocyanin concentrations were higher in grape berries under the early-heating

culture, which involved a lower temperature than the ordinary growing season.



77

The results of this study agree with those of the previous reports in showing that low

temperature and blue light affect anthocyanin accumulation. In this study, the

expressions of VvUFGT, VlMYBA1-2, and VlMYBA2 increased in red- and blue-LED-

treated skin, though the expressions of these genes were not necessarily correlated

with anthocyanin concentrations. For instance, anthocyanin concentrations in blue-

LED-treated skin were significantly higher than those in red-LED-treated skin at 67 DAFB

in Exp. 2, but the expressions of VlMYBA1-2 and VlMYBA2 genes were not

significantly different in blue- and red-LED-treated skins. It has been concluded that

final anthocyanin concentrations in grape skin cannot be determined solely by the

expression levels of MYB-related genes (Azuma et al., 2011). In this study, blue LED

irradiation promoted anthocyanin accumulation regardless of the growing season. It

has been shown that a wavelength of around 400 nm is effective at inducing

anthocyanin formation in fruits (Proctor, 1974). Blue LED irradiation may therefore

be effective at inducing anthocyanin production in grapes across differing seasons.

The results of this study showed that sugar concentrations in grape berries

were increased in blue- and red-LED-treated skin at night. Hexose accumulation

commences with enzyme activation at veraison and continues throughout maturation

(Davies and Robinson, 1996; Xie et al., 2009). Yonekura et al. (2013) reported that

the sucrose phosphate synthase genes in rice (Oryza sativa L. cv. Nipponbare) were

controlled by light. These results suggest that blue- and red-LED treatments may

activate the enzymes in the sugar metabolism in berries because the sugar

concentrations were not significantly different between the LED leaf treatment and

the untreated control.



78

In summary, blue-LED irradiation at night increased anthocyanin

accumulation and enhanced the expressions of the VvUFGT, VlMYBA1-2, and

VlMYBA2 regardless of the growing season. Blue- and red-LED irradiation of the

cluster increased the sugar concentrations in the berry skin.

General discussion

79

GENERAL DISSUSSION

Grape skin color is an important factor for fruit qualities because consumers

prefer well pigmented grapes. The skin color is mainly determined by anthocyanin

synthesis which requires a complicated interaction between development and

environmental factor such as plant hormone, temperature, and light. In this study, the

effects of red- and blue-LED irradiation at night to vines on anthocyanin

accumulation were investigated in the double-cropping cultivation system including

an early-heating culture system, in which the percentage of red light in sunshine

gradually decreases and that of blue light in sunshine gradually increases and delayed-

start culture system, in which the percentage of blue light in sunshine is the lowest

decrease and that of red light in sunshine is the highest increase. The author also

investigated the effects of red- and blue-LED irradiation at night to vines on

anthocyanin accumulation in the ordinary growing season, in which the percentage of

red light in sunlight gradually increases and that of blue light in sunshine gradually

decreases and examined the effect of the irradiating position (leaf or cluster) of the red

or blue LED. At the same time, endogenous ABA, the expression of anthocyanin and

ABA biosynthesis-related genes, and sugar synthesis in grape were also analyzed.

In this study, results of ABA concentrations showed that in the early-heating

culture, endogenous ABA concentrations in blue-LED-treated skin were higher than

those in red-LED-treated skin. In contrast, in the ordinary growing season, the ABA

concentrations were higher in the red-LED cluster treatment than in the blue-LED

cluster treatment and in delayed-start cultured grapes, endogenous ABA

General discussion

80

concentrations in blue- and red-LED-treated skin were not significantly different. This

result suggests that endogenous ABA in grapes might be influenced by the

proportions of blue and red light in sunshine that differ with the season (Kamuro et al.

2003) in addition to the LED irradiation administered at night.

The expressions of VvNCED1, an upstream enzyme for ABA synthesis, in

blue- and red-LED-treated skin were higher than those in the untreated control in

delayed-start culture system, and those in the red-LED treatment administered to the

cluster were significantly higher than in the LED treatment administered to the leaves.

Therefore, LED treatment of the cluster may be effective for increasing endogenous

ABA through the expressions of VvNCED1 in grape berries.

It has been reported that ABA application enhanced anthocyanin

accumulation in grapes (Peppi et al., 2006). The results of this study in the ordinary

growing season found that the endogenous ABA concentrations after veraison were

higher in the red-LED cluster treatment than the others, whereas the anthocyanin

concentrations during maturation in the skin were high in blue-LED cluster treatment.

Moreover, it has been reported that sugar can induce anthocyanin synthesis in the

absence of ABA application in grape berries (Dai et al., 2014).Thus, anthocyanin

synthesis in grape skin might be affected by another factor in addition to endogenous

ABA.

It has been reported that a low temperature increased anthocyanin

accumulation with the expression of anthocyanin-biosynthesis-related genes including

UFGT as well as VlMYBA2 in grapes (Azuma et al., 2012a, b). The results of this

study showed that the anthocyanin concentrations were higher in grape berries under

the early-heating culture, which involved a lower temperature than the ordinary

General discussion

81

growing season. Thus, the results of this study agree with those of the previous

reports in showing that low temperature and blue light affect anthocyanin

accumulation.

The expressions of VvUFGT in the blue- and red-LED-treated skin were

higher than those in the untreated control, and those were similar to the total

anthocyanin concentrations in three different growing seasons. However, the

expressions of VlMYBA1-2, and VlMYBA2 were not necessarily correlated with

anthocyanin concentrations. For instance, anthocyanin concentrations in blue-LED-

treated skin were significantly higher than those in red-LED-treated skin at 67 DAFB

but the expressions of VlMYBA1-2 and VlMYBA2 were not significantly different in

blue- and red-LED-treated skins in the ordinary growing season. It has been

concluded that final anthocyanin concentrations in grape skin cannot be determined

solely by the expression levels of MYB-related genes (Azuma et al., 2011).

In three different growing seasons, blue LED irradiation promoted

anthocyanin accumulation regardless of the growing season. A wavelength of around

400 nm is effective at inducing anthocyanin formation in fruits (Proctor, 1974). Then,

blue LED irradiation may be effective at inducing anthocyanin production in grapes

across differing seasons.

The results of this study showed that sugar concentrations in grape berries

were increased in blue- and red-LED-treated skin at night in three different growing

seasons. The action of enzymes on the sugar metabolism in grape berries differs

according to growing conditions (Xie et al., 2009). The sucrose phosphate synthase

genes in rice (Oryza sativa L. cv. Nipponbare) were controlled by light (Yonekura et

General discussion

82

al., 2013). These results suggest that blue-and red-LED treatments may activate the

enzymes in the sugar metabolism in grape berries.

These results suggest that blue-LED irradiation at night may be effective in

increasing anthocyanin accumulation and enhanced the expressions of the VvUFGT,

VlMYBA1-2, and VlMYBA2 regardless of the growing season. Blue- and red-LED

irradiation to grape skin increased the sugar concentrations in the grape berries.

Summary

83

SUMMARY

The effects of red- and blue-light irradiation at night on abscisic acid (ABA)

synthesis and anthocyanin and sugar concentrations were examined in grape vines,

which were grown in three different seasons. The ABA concentrations in light

emitting diode (LED) treatment were higher than those in the untreated control. In

grapes cultivated with early heating, the ABA concentrations were highest in blue-

LED-treated skin; however, those in grapes cultivated in the ordinary growing season

were highest in red-LED-treated skin. In delayed-start cultured grapes, the ABA

concentrations increased in skin treated with blue and red LED. The expressions of 9-

cis-epoxycarotenoid dioxygenase (VvNCED1) and ABA 8′-hydroxylase

(VvCYP707A1) were high in each treatment at veraison regardless of the growing

season. In three seasons, anthocyanin concentrations were highest under the blue-LED

treatment, followed by the red-LED treatment. The expressions of VlMYBA1-2,

VlMYBA2, and VvUFGT coincided with anthocyanin concentrations. Sugar

concentrations were increased by the blue- or red-LED treatment dependent on the

growing season. The results suggest that blue- or red-LED irradiation at night may

influence the ABA and anthocyanin metabolism including VvNCED1, VlMYBA1-2,

and VlMYBA2 and sugar synthesis in grape berries, although the degree of the effects

differs with the growing season.

Acknowledgments

84

ACKNOWLEDGEMENTS

It would not have been possible to complete this thesis without the support

and assistance from my advisor, Professor Satoru Kondo who has the attitude and the

substance of a genius: he continually and convincingly conveyed a spirit of adventure

in regard to research and scholarship. I would like to express the deepest appreciation

to him.

I would like to deeply thank my committee members, Professor Eiji Goto,

Professor Yukari Egashira and Professor Hitoshi Ohara, for their valuable advice,

comments and suggestions for the completeness of this thesis.

I would like to thank to Ministry of Education, Culture, Sport, Science and

Technology of Japan (MONBUKAGAKUSHO) for supporting a scholarship

throughout my study in Japan. I also express my warm gratitude and cordial thanks

Associate Professor Sirichai Kanlayanarat and Associate Professor Varit Srilaong at

King Mongkut’s University of Technology Thonburi, Thailand, for giving me the

opportunity to further study in Japan.

I thank profusely all members of Professor Kondo’s Laboratory for their

helpful corporations and friendship during my research.

Finally, I am very grateful to my family for their encouragement throughout

my research period.

References

85

REFERENCES

References

86

Abrahams, S., Tanner, G.J., Larkin, P.J., Ashton, A.R., 2002. Identification and

biochemical characterization of mutants in the proanthocyanidin pathway in

Arabidopsis. Plant Physiol. 130: 561–576. DOI:10.1104/pp.006189.

Ahmad, M., Cashmore, A.R., 1993. HY4 gene of A. thaliana encodes a protein with

characteristics of a blue-light photoreceptor. Nature 366: 162–166.

DOI:10.1038/366162a0.

Ahmad, M., Lin, C., Cashmore, A.R., 1995. Mutations throughout an Arabidopsis

blue-light photoreceptor impair blue-light-responsive anthocyanin

accumulation and inhibition of hypocotyl elongation. Plant J. Cell Mol. Biol.

8: 653–658.

Akoyunoglou, G., Anni, H., 1984. Blue light Effect on chloroplast development in

higher plants. pp. 397–406. In: Senger, P.D.H. (Ed.), blue light effects in

biological systems, proceedings in life sciences. Springer, Berlin Heidelberg.

Antolín, M.C., Baigorri, H., Luis, I.D., Aguirrezábal, F., Geny, L., Broquedis, M.,

Sánchez-Díaz, M., 2003. ABA during reproductive development in non-

irrigated grapevines (Vitis vinifera L. cv. Tempranillo). Aust. J. Grape Wine

Res. 9: 169–176. DOI:10.1111/j.1755-0238.2003.tb00266.x.

Azuma, A., Kobayashi, S., Mitani, N., Shiraishi, M., Yamada, M., Ueno, T., Kono, A.,

Yakushiji, H., Koshita, Y., 2008. Genomic and genetic analysis of myb-related

genes that regulate anthocyanin biosynthesis in grape berry skin. Theor. Appl.

Genet. 117: 1009–1019. DOI:10.1007/s00122-008-0840-1.

Azuma, A., Udo, Y., Sato, A., Mitani, N., Kono, A., Ban, Y., Yakushiji, H., Koshita,

Y., Kobayashi, S., 2011. Haplotype composition at the color locus is a major

genetic determinant of skin color variation in Vitis × labruscana grapes. TAG

References

87

Theor. Appl. Genet. Theor. Angew. Genet. 122: 1427–1438:

DOI:10.1007/s00122-011-1542-7.

Azuma, A., Ito, A., Moriguchi, T., Yakushiji, H., Kobayashi, S., 2012a. Light

emitting diode irradiation at night accelerates anthocyanin accumulation in

grape skin. Acta Hortic. 956: 341–347.

Azuma, A., Yakushiji, H., Koshita, Y., Kobayashi, S., 2012b. Flavonoid biosynthesis-

related genes in grape skin are differentially regulated by temperature and

light conditions. Planta 236: 1067–1080. DOI:10.1007/s00425-012-1650-x.

Ban, T., Ishimaru, M., Kobayashi, S., Shiozaki, S., Goto-Yamamoto, N., Horiuchi, S.,

2003. Abscisic acid and 2,4-dichlorophenoxyacetic acid affect the expression

of anthocyanin biosynthetic pathway genes in ‘Kyoho’ grape berries. J. Hortic.

Sci. Biotechnol. 78: 586–589.

Baranac, J.M., Petranović, N.A., Dimitrić-Marković, J.M., 1997. Spectrophotometric

study of anthocyan copigmentation reactions. 2. malvin and the

nonglycosidized flavone quercetin. J. Agric. Food Chem. 45: 1694–1697.

DOI:10.1021/jf9606114.

Belhadj, A., Telef, N., Saigne, C., Cluzet, S., Barrieu, F., Hamdi, S., Mérillon, J.-M.,

2008. Effect of methyl jasmonate in combination with carbohydrates on gene

expression of PR proteins, stilbene and anthocyanin accumulation in grapevine

cell cultures. Plant Physiol. Biochem. PPB Société Fr. Physiol. Végétale 46:

493–499. DOI:10.1016/j.plaphy.2007.12.001.

Boss, P., Davies, C., Robinson, S., 1996. Expression of anthocyanin biosynthesis

pathway genes in red and white grapes. Plant Mol. Biol. 32: 565–569.

DOI:10.1007/BF00019111.

References

88

Boss, P. k., Davies, C., Robinson, S.P., 1996. Anthocyanin composition and

anthocyanin pathway gene expression in grapevine sports differing in berry

skin colour. Aust. J. Grape Wine Res. 2: 163–170. DOI:10.1111/j.1755-

0238.1996.tb00104.x.

Cantín, C.M., Fidelibus, M.W., Crisosto, C.H., 2007. Application of abscisic acid

(ABA) at veraison advanced red color development and maintained

postharvest quality of ‘Crimson Seedless’ grapes. Postharvest Biol. Technol.

46: 237–241. DOI:10.1016/j.postharvbio.2007.05.017.

Casal, J.J., 2013. Photoreceptor signaling networks in plant responses to shade. Annu.

Rev. Plant Biol. 64: 403–427. DOI:10.1146/annurev-arplant-050312-120221.

Castellarin, S.D., Matthews, M.A., Di Gaspero, G., Gambetta, G.A., 2007a. Water

deficits accelerate ripening and induce changes in gene expression regulating

flavonoid biosynthesis in grape berries. Planta 227: 101–112:.DOI:10.1007/s00425-

007-0598-8.

Castellarin, S.D., Pfeiffer, A., Sivilotti, P., Degan, M., Peterlunger, E., Di Gaspero, G.,

2007b. Transcriptional regulation of anthocyanin biosynthesis in ripening

fruits of grapevine under seasonal water deficit. Plant Cell Environ. 30: 1381–

1399. DOI:10.1111/j.1365-3040.2007.01716.x.

Chalker-Scott, L., 1999. Environmental significance of anthocyanins in plant stress

responses. Photochem. Photobiol. 70: 1–9. DOI:10.1111/j.1751-1097.1999.tb01944.x.

Chatterjee, M., Sharma, P., Khurana, J.P., 2006. Cryptochrome 1 from Brassica napus

is up-regulated by blue light and controls hypocotyl/stem growth and

anthocyanin accumulation. Plant Physiol. 141: 61–74. DOI:10.1104/pp.105.076323.

References

89

Chervin, C., El-Kereamy, A., Roustan, J.-P., Latché, A., Lamon, J., Bouzayen, M., 2004.

Ethylene seems required for the berry development and ripening in grape, a non-

climacteric fruit. Plant Sci. 167: 1301–1305. DOI:10.1016/j.plantsci.2004.06.026.

Chorti, E., Guidoni, S., Ferrandino, A., Novello, V., 2010. Effect of different cluster

sunlight exposure levels on ripening and anthocyanin accumulation in

‘Nebbiolo’ grapes. Am. J. Enol. Vitic. 61: 23–30.

Coombe, B.G., 2001. Ripening berries: a critical issue. Aust. Vitic. 5: 28–34.

Cutanda-Perez, M.-C., Ageorges, A., Gomez, C., Vialet, S., Terrier, N., Romieu, C.,

Torregrosa, L., 2009. Ectopic expression of VlmybA1 in grapevine activates a

narrow set of genes involved in anthocyanin synthesis and transport. Plant Mol.

Biol. 69: 633–648. DOI:10.1007/s11103-008-9446-x.

Cutler, S.R., Rodriguez, P.L., Finkelstein, R.R., Abrams, S.R., 2010. Abscisic acid:

emergence of a core signaling network. Annu. Rev. Plant Biol. 61: 651–679.

Czemmel, S., Stracke, R., Weisshaar, B., Cordon, N., Harris, N.N., Walker, A.R.,

Robinson, S.P., Bogs, J., 2009. The grapevine R2R3-MYB transcription factor

VvMYBF1 regulates flavonol synthesis in developing grape berries. Plant

Physiol. 151: 1513–1530. DOI:10.1104/pp.109.142059.

Dai, Z.W., Meddar, M., Renaud, C., Merlin, I., Hilbert, G., Delrot, S., Gomès, E.,

2014. Long-term in vitro culture of grape berries and its application to assess

the effects of sugar supply on anthocyanin accumulation. J. Exp. Bot. 65:

4665–4677. DOI:10.1093/jxb/ert489.

Davies, C., Boss, P.K., Robinson, S.P., 1997. Treatment of grape berries, a

nonclimacteric fruit with a synthetic auxin, retards ripening and alters the

expression of developmentally regulated genes. Plant Physiol. 115: 1155–1161.

References

90

Davies, C., Böttcher, C., 2009. Hormonal control of grape berry ripening. pp. 229–

261. In: Roubelakis-Angelakis, P.D.K.A. (Ed.), grapevine molecular

physiology & biotechnology. Springer Netherlands.

Davies, C., Robinson, S.P., 1996. Sugar Accumulation in grape berries (cloning of

two putative vacuolar invertase cDNAs and their expression in grapevine

tissues). Plant Physiol. 111: 275–283. DOI:10.1104/pp.111.1.275.

Delgado, R., Gallegos, J.I., Martín, P., González, M.R., 2002. Influence of ABA and

ethephon treatments on fruit composition of ‘Tempranillo’ grapevines. pp.

321–326. In: XXVI International Horticultural Congress: Viticulture-Living

with Limitations 640.

Downs, R.J., Thomas, J.F., 1982. Phytochrome regulation of flowering in the long-

day plant, Hyoscyamus niger. Plant Physiol. 70: 898–900.

El-Kereamy, A., Chervin, C., Roustan, J.-P., Cheynier, V., Souquet, J.-M., Moutounet,

M., Raynal, J., Ford, C., Latché, A., Pech, J.-C., Bouzayen, M., 2003.

Exogenous ethylene stimulates the long-term expression of genes related to

anthocyanin biosynthesis in grape berries. Physiol. Plant. 119: 175–182.

DOI:10.1034/j.1399-3054.2003.00165.x.

Evans, L., 1976. Inflorescence initiation in lolium temulentum L. XIV. the role of

phytochrome in long day induction. Funct. Plant Biol. 3: 207–217.

Fan, X., Mattheis, J.P., Fellman, J.K., 1998. A role for jasmonates in climacteric fruit

ripening. Planta 204: 444–449. DOI:10.1007/s004250050278.

Faostat, 2013. Grape production quantity in 2013 [WWW Document]. URL

http://faostat3.fao.org/download/Q/QC/E (accessed 3.10.15).

References

91

Favory, J.-J., Stec, A., Gruber, H., Rizzini, L., Oravecz, A., Funk, M., Albert, A.,

Cloix, C., Jenkins, G.I., Oakeley, E.J., Seidlitz, H.K., Nagy, F., Ulm, R., 2009.

Interaction of COP1 and UVR8 regulates UV-B-induced photomorphogenesis

and stress acclimation in Arabidopsis. EMBO J. 28: 591–601.

DOI:10.1038/emboj.2009.4.

Finkelstein, R.R., Gibson, S.I., 2002. ABA and sugar interactions regulating

development: cross-talk or voices in a crowd? Curr. Opin. Plant Biol. 5: 26–32.

Fugita, A., Goto-Yamamoto, N., Aramaki, I., Hashizume, K., 2006. Organ-specific

transcription of putative flavonol synthase genes of grapevine and effects of

plant hormones and shading on flavonol biosynthesis in grape berry skins.

Biosci. Biotechnol. Biochem. 70, 632–638: DOI:10.1271/bbb.70.632.

Fujita, A., Soma, N., Goto-Yamamoto, N., Mizuno, A., Kiso, K., Hashizume, K.,

2007. Effect of shading on proanthocyanidin biosynthesis in the grape berry. J.

Jpn. Soc. Hortic. Sci. 76, 112–119: DOI:10.2503/jjshs.76.112.

Gazzarrini, S., McCourt, P., 2001. Genetic interactions between ABA, ethylene and

sugar signaling pathways. Curr. Opin. Plant Biol. 4: 387–391.

Geny, L., Saucier, C., gagné, S., Deytieux, C., Esteve, K., 2006. Influence of abscisic

acid in triggering ‘véraison’ in grape berry skins of Vitis vinifera L. cv.

cabernet-Sauvignon. J. Int. Sci. Vigne Vin Int. J. Vine Wine Sci. 40: 7–14.

Giliberto, L., Perrotta, G., Pallara, P., Weller, J.L., Fraser, P.D., Bramley, P.M., Fiore,

A., Tavazza, M., Giuliano, G., 2005. Manipulation of the blue light

photoreceptor cryptochrome 2 in tomato affects vegetative development,

flowering time, and fruit antioxidant content. Plant Physiol. 137: 199–208.

DOI:10.1104/pp.104.051987.

References

92

Giovannoni, J., 2001. Molecular biology of fruit maturation and ripening. Annu. Rev. Plant

Physiol. Plant Mol. Biol. 52: 725–749. DOI:10.1146/annurev.arplant.52.1.725.

Goins, G.D., Ruffe, L.M., Cranston, N.A., Yorio, N.C., Wheeler, R.M., Sager, J.C.,

2001. Salad crop production under different wavelengths of red light-emitting

diodes (LEDs) (SAE Technical Paper No. 2001-01-2422). SAE International,

Warrendale, PA.

Gonzalez, A., Zhao, M., Leavitt, J.M., Lloyd, A.M., 2008. Regulation of the

anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional

complex in Arabidopsis seedlings. Plant J. 53: 814–827. DOI:10.1111/j.1365-

313X.2007.03373.x.

Guo, H., Yang, H., Mockler, T.C., Lin, C., 1998. Regulation of flowering time by

Arabidopsis photoreceptors. Science 279: 1360–1363.

Hara, M., Oki, K., Hoshino, K., Kuboi, T., 2003. Enhancement of anthocyanin

biosynthesis by sugar in radish (Raphanus sativus) hypocotyl. Plant Sci. 164:

259–265. DOI:10.1016/S0168-9452(02)00408-9.

Hardtke, C.S., Gohda, K., Osterlund, M.T., Oyama, T., Okada, K., Deng, X.W., 2000.

HY5 stability and activity in Arabidopsis is regulated by phosphorylation in its

COP1 binding domain. EMBO J. 19: 4997–5006. DOI:10.1093/emboj/19.18.4997

Harris, J.M., Kriedemann, P.E., Possingham, J.V., 1968. Anatomical aspects of grape

berry development. Vitis 7: 106–119.

He, F., Pan, Q.-H., Shi, Y., Duan, C.-Q., 2008. Biosynthesis and genetic regulation of

proanthocyanidins in plants. Molecules 13: 2674–2703.

DOI:10.3390/molecules13102674.

References

93

Hirai, T., Amaki, W., Watanabe, H., 2006. Effects of monochromatic light irradiation

by LED on the internodal stem elongation of seedlings in eggplant, leaf lettuce

and sunflower. Shokubutsu Kankyo Kogaku 18: 160–166.

DOI:10.2525/shita.18.160.

Hiratsuka, S., Onodera, H., Kawai, Y., Kubo, T., Itoh, H., Wada, R., 2001. ABA and

sugar effects on anthocyanin formation in grape berry cultured in vitro. Sci.

Hortic. 90: 121–130. DOI:10.1016/S0304-4238(00)00264-8.

Iannetta, P.P., Laarhoven, L.-J., Medina‐Escobar, N., James, E.K., McManus, M.T.,

Davies, H.V., Harren, F.J., 2006. Ethylene and carbon dioxide production by

developing strawberries show a correlative pattern that is indicative of

ripening climacteric fruit. Physiol. Plant. 127: 247–259.

Jeong, S.-T., Goto-Yamamoto, N., Hashizume, K., Kobayashi, S., Esaka, M., 2006.

Expression of VvmybA1 gene and anthocyanin accumulation in various grape

organs. Am. J. Enol. Vitic. 57: 507–510.

Jeong, S.T., Goto-Yamamoto, N., Kobayashi, S., Esaka, M., 2004. Effects of plant

hormones and shading on the accumulation of anthocyanins and the

expression of anthocyanin biosynthetic genes in grape berry skins. Plant Sci.

167: 247–252. DOI:10.1016/j.plantsci.2004.03.021.

Jeong, S.-W., Das, P.K., Jeoung, S.C., Song, J.-Y., Lee, H.K., Kim, Y.-K., Kim, W.J.,

Park, Y.I., Yoo, S.-D., Choi, S.-B., Choi, G., Park, Y.-I., 2010. Ethylene

suppression of sugar-induced anthocyanin pigmentation in Arabidopsis. Plant

Physiol. 154: 1514–1531. DOI:10.1104/pp.110.161869.

References

94

Jia, H.-F., Chai, Y.-M., Li, C.-L., Lu, D., Luo, J.-J., Qin, L., Shen, Y.-Y., 2011.

Abscisic acid plays an important role in the regulation of strawberry fruit

ripening. Plant Physiol. 157: 188–199. DOI:10.1104/pp.111.177311.

Kadomura-Ishikawa, Y., Miyawaki, K., Noji, S., Takahashi, A., 2013. Phototropin 2

is involved in blue light-induced anthocyanin accumulation in Fragaria ×

ananassa fruits. J. Plant Res. 126: 847–857. DOI:10.1007/s10265-013-0582-2.

Kamuro, Y., Tohyama, T., Okabe, K., 2003. New functional photo selective sheets.

Regul. Plant Growth Dev. 38: 132–138.

Karlsson, P., 2013. The world’s grape production 2000-2012. BKWine Mag. URL

http://www.bkwine.com/features/winemaking-viticulture/global-grape-

production-2000-2012/ (accessed 3.10.15).

Karppinen, K., Hirvelä, E., Nevala, T., Sipari, N., Suokas, M., Jaakola, L., 2013.

Changes in the abscisic acid levels and related gene expression during fruit

development and ripening in bilberry (Vaccinium myrtillus L.).

Phytochemistry 95: 127–134. DOI:10.1016/j.phytochem.2013.06.023.

Kataoka, I., Sugiura, A., Utsunomiya, N., Tomana, T., 1982. Effect of abscisic acid

and defoliation on anthocyanin accumulation in Kyoho grapes (Vitis vinifera L.

× Vitis labruscana Bailey). Vitis.

Keller, M., 2015. The Science of grapevines: anatomy and physiology. Academic

Press.

Kim, J.-S., Lee, B.-H., Kim, S.-H., Oh, K.-H., Cho, K.Y., 2006. Responses to

environmental and chemical signals for anthocyanin biosynthesis in non-

chlorophyllous corn (Zea mays L.) leaf. J. Plant Biol. 49: 16–25.

DOI:10.1007/BF03030784.

References

95

Kliewer, W.M., 1970. Effect of time and severity of defoliation on growth and

composition of ‘Thompson Seedless’ Grapes. Am. J. Enol. Vitic. 21: 37–47.

Kliewer, W.M., Torres, R.E., 1972. Effect of controlled day and night temperatures

on grape coloration. Am. J. Enol. Vitic. 23: 71–77.

Kobayashi, S., Goto-Yamamoto, N., Hirochika, H., 2005. Association of VvmybA1

gene expression with anthocyanin production in grape (Vitis vinifera) skin-

color Mutants. J. Jpn. Soc. Hortic. Sci. 74: 196–203.

DOI:10.2503/jjshs.74.196.

Kobayashi, S., Ishimaru, M., Hiraoka, K., Honda, C., 2002. Myb-related genes of the

Kyoho grape ( Vitis labruscana) regulate anthocyanin biosynthesis. Planta

215: 924–933. DOI:10.1007/s00425-002-0830-5.

Koes, R.E., Quattrocchio, F., Mol, J.N.M., 1994. The flavonoid biosynthetic pathway

in plants: Function and evolution. BioEssays 16: 123–132.

DOI:10.1002/bies.950160209.

Koes, R., Verweij, W., Quattrocchio, F., 2005. Flavonoids: a colorful model for the

regulation and evolution of biochemical pathways. Trends Plant Sci. 10: 236–

242. DOI:10.1016/j.tplants.2005.03.002.

Kondo, S., Sugaya, S., Sugawa, S., Ninomiya, M., Kittikorn, M., Okawa, K., Ohara,

H., Ueno, K., Todoroki, Y., Mizutani, M., Hirai, N., 2012. Dehydration

tolerance in apple seedlings is affected by an inhibitor of ABA 8’-hydroxylase

CYP707A. J. Plant Physiol. 169: 234–241. DOI:10.1016/j.jplph.2011.09.007.

Kondo, S., Tomiyama, H., Rodyoung, A., Okawa, K., Ohara, H., Sugaya, S., Terahara,

N., Hirai, N., 2014. Abscisic acid metabolism and anthocyanin synthesis in

References

96

grape skin are affected by light emitting diode (LED) irradiation at night. J.

Plant Physiol. 171: 823–829. DOI:10.1016/j.jplph.2014.01.001.

Koshita, Y., Kobayashi, S., Ishimaru, M., Funamoto, Y., Shiraishi, M., Azuma, A.,

Yakushiji, H., Nakayama, M., 2008. An anthocyanin regulator from grapes,

VlmybA1-2, produces reddish-purple plants. J. Jpn. Soc. Hortic. Sci. 77: 33–37.

Koshita, Y., Yamane, T., Yakushiji, H., Azuma, A., Mitani, N., 2011. Regulation of

skin color in ‘Aki Queen’ grapes: Interactive effects of temperature, girdling,

and leaf shading treatments on coloration and total soluble solids. Sci. Hortic.

129: 98–101. DOI:10.1016/j.scienta.2011.03.014.

Kushiro, T., Okamoto, M., Nakabayashi, K., Yamagishi, K., Kitamura, S., Asami, T.,

Hirai, N., Koshiba, T., Kamiya, Y., Nambara, E., 2004. The Arabidopsis

cytochrome P450 CYP707A encodes ABA 8’-hydroxylases: key enzymes in

ABA catabolism. EMBO J. 23: 1647–1656. DOI:10.1038/sj.emboj.7600121.

Kwon, S., Lim, J., 2011. Improvement of energy efficiency in plant factories through

the Measurement of plant bioelectrical potential, in: Tan, H. (Ed.), informatics

in control, automation and robotics, lecture notes in electrical engineering.

Springer Berlin Heidelberg, pp. 641–648.

Larronde, F., Krisa, S., Decendit, A., Chèze, C., Deffieux, G., Mérillon, J.M., 1998.

Regulation of polyphenol production in Vitis vinifera cell suspension cultures

by sugars. Plant Cell Rep. 17: 946–950. DOI:10.1007/s002990050515.

Lau, O.S., Deng, X.W., 2012. The photomorphogenic repressors COP1 and DET1: 20

years later. Trends Plant Sci. 17: 584–593. DOI:10.1016/j.tplants.2012.05.004.

References

97

Lee, B.M., Smith, J.D., Cobb, B.G., Magill, C.W., Bai, D.G., Paek, N.C., 1997.

Regulatory roles of abscisic acid for anthocyanin synthesis in maize kernels

[Zea mays]. Maydica Italy.

Lee, J., He, K., Stolc, V., Lee, H., Figueroa, P., Gao, Y., Tongprasit, W., Zhao, H.,

Lee, I., Deng, X.W., 2007. Analysis of transcription factor HY5 genomic

binding sites revealed its hierarchical role in light regulation of development.

Plant Cell 19: 731–749. DOI:10.1105/tpc.106.047688.

Li, H., Tang, C., Xu, Z., Liu, X., Han, X., 2012. Effects of different light sources on

the growth of non-heading chinese cabbage (Brassica campestris L.). J. Agric.

Sci. 4: p262. DOI:10.5539/jas.v4n4p262.

Li, Y.-Y., Mao, K., Zhao, C., Zhao, X.-Y., Zhang, H.-L., Shu, H.-R., Hao, Y.-J., 2012.

MdCOP1 ubiquitin E3 ligases interact with MdMYB1 to regulate light-induced

anthocyanin biosynthesis and red fruit coloration in apple. Plant Physiol. 160:

1011–1022. DOI:10.1104/pp.112.199703.

Li, Y.-Y., Mao, K., Zhao, C., Zhao, X.-Y., Zhang, R.-F., Zhang, H.-L., Shu, H.-R.,

Hao, Y.-J., 2013. Molecular cloning and functional analysis of a blue light

receptor gene MdCRY2 from apple (Malus domestica). Plant Cell Rep. 32:

555–566. DOI:10.1007/s00299-013-1387-4.

Lin, C., Ahmad, M., Cashmore, A.R., 1996. Arabidopsis cryptochrome 1 is a soluble

protein mediating blue light-dependent regulation of plant growth and

development. Plant J. Cell Mol. Biol. 10: 893–902.

Lin, C., Yang, H., Guo, H., Mockler, T., Chen, J., Cashmore, A.R., 1998.

Enhancement of blue-light sensitivity of Arabidopsis seedlings by a blue light

receptor cryptochrome 2. Proc. Natl. Acad. Sci. U. S. A. 95: 2686–2690.

References

98

Lin-Wang, K., Micheletti, D., Palmer, J., Volz, R., Lozano, L., Espley, R., Hellens,

R.P., Chagnè, D., Rowan, D.D., Troggio, M., Iglesias, I., Allan, A.C., 2011.

High temperature reduces apple fruit colour via modulation of the anthocyanin

regulatory complex: Temperature and the anthocyanin regulatory complex.

Plant Cell Environ. 34: 1176–1190. DOI:10.1111/j.1365-3040.2011.02316.x.

Lopez, L., Carbone, F., Bianco, L., Giuliano, G., Facella, P., Perrotta, G., 2012.

Tomato plants overexpressing cryptochrome 2 reveal altered expression of

energy and stress-related gene products in response to diurnal cues. Plant Cell

Environ. 35: 994–1012. DOI:10.1111/j.1365-3040.2011.02467.x.

Loreti, E., Povero, G., Novi, G., Solfanelli, C., Alpi, A., Perata, P., 2008. Gibberellins,

jasmonate and abscisic acid modulate the sucrose-induced expression of

anthocyanin biosynthetic genes in Arabidopsis. New Phytol. 179: 1004–1016.

DOI:10.1111/j.1469-8137.2008.02511.x.

Maier, A., Schrader, A., Kokkelink, L., Falke, C., Welter, B., Iniesto, E., Rubio, V.,

Uhrig, J.F., Hülskamp, M., Hoecker, U., 2013. Light and the E3 ubiquitin

ligase COP1/SPA control the protein stability of the MYB transcription factors

PAP1 and PAP2 involved in anthocyanin accumulation in Arabidopsis. Plant J.

Cell Mol. Biol. 74: 638–651. DOI:10.1111/tpj.12153.

Mancinelli, A.L., Yang, C.-P.H., Lindquist, P., Anderson, O.R., Rabino, I., 1975.

Photocontrol of anthocyanin synthesis. Plant Physiol: 55, 251–257.

Matthews, M.A., Shackel, K.A., 2005. Growth and water transport in fleshy fruit.

Vasc. Transp. Plants: 181–197.

Matus, J.T., Loyola, R., Vega, A., Peña-Neira, A., Bordeu, E., Arce-Johnson, P.,

Alcalde, J.A., 2009. Post-veraison sunlight exposure induces MYB-mediated

References

99

transcriptional regulation of anthocyanin and flavonol synthesis in berry skins

of Vitis vinifera. J. Exp. Bot. ern336. DOI:10.1093/jxb/ern336.

Mazza, G., Francis, F.J., 1995. Anthocyanins in grapes and grape products. Crit. Rev.

Food Sci. Nutr. 35: 341–371. DOI:10.1080/10408399509527704.

Mazza, G., Miniati, E., 1993. Anthocyanins in fruits, vegetables, and grains.

Mita, S., Hirano, H., Nakamura, K., 1997. Negative regulation in the expression of a

sugar-inducible gene in Arabidopsis thaliana. A recessive mutation causing

enhanced expression of a gene for beta-amylase. Plant Physiol: 114, 575–582.

Möglich, A., Yang, X., Ayers, R.A., Moffat, K., 2010. Structure and function of plant

photoreceptors. Annu. Rev. Plant Biol. 61: 21–47. DOI:10.1146/annurev-

arplant-042809-112259.

M, O., P, G.-M., Nh, B., Mh, G., P, J., Ja, L., E, V., A, W., P, H., 2012. Development

of colour and firmness in strawberry crops is UV light sensitive, but colour is

not a good predictor of several quality parameters. J Sci Food Agric: 1597–604.

Mori, K., Goto-Yamamoto, N., Kitayama, M., Hashizume, K., 2007. Loss of

anthocyanins in red-wine grape under high temperature. J. Exp. Bot. 58:

1935–1945. DOI:10.1093/jxb/erm055.

Mori, K., Saito, H., Goto-Yamamoto, N., Kitayama, M., Kobayashi, S., Sugaya, S.,

Gemma, H., Hashizume, K., 2005a. Effects of abscisic acid treatment and

night temperatures on anthocyanin composition in Pinot noir grapes. Vitis-

geilweilerhof- 44: 161.

Mori, K., Sugaya, S., Gemma, H., 2005b. Decreased anthocyanin biosynthesis in

grape berries grown under elevated night temperature condition. Sci. Hortic.

105: 319–330. DOI:10.1016/j.scienta.2005.01.032.

References

100

Morinaga, K., 2001. Grape production in the Asia-Pacific region (country report),

Grape production in Japan. Food and Agriculture Organization of the United

Nation, Bangkok, THAILAND.

Morrison, J.C., Noble, A.C., 1990. The effects of leaf and cluster shading on the

composition of cabernet sauvignon grapes and on fruit and wine sensory

properties. Am. J. Enol. Vitic. 41: 193–200.

Nambara, E., Marion-Poll, A., 2005. Abscisic acid biosynthesis and catabolism. Annu.

Rev. Plant Biol. 56: 165–185. DOI:10.1146/annurev.arplant.56.032604.144046.

Ohto, M., Onai, K., Furukawa, Y., Aoki, E., Araki, T., Nakamura, K., 2001. Effects of

sugar on vegetative development and floral transition in Arabidopsis. Plant

Physiol. 127: 252–261. DOI:10.1104/pp.127.1.252.

Ono, Watanabe, 2010. Design and construction of a pilot-scale plant-factory with

multiple lighting sources. american society of agricultural and biological

engineers. DOI:10.13031/2013.29727.

Ovadia, R., Oren-Shamir, M., Kaplunov, T., Zutahy, Y., Lichter, A., Lurie, S., 2013.

Effects of plant growth regulators and high temperature on colour

development in ‘Crimson Seedless’ grapes. J. Hortic. Sci. Biotechnol. 88:

387–392.

Owen, S.J., Lafond, M.D., Bowen, P., Bogdanoff, C., Usher, K., Abrams, S.R., 2009.

Profiles of abscisic acid and its catabolites in developing merlot grape (Vitis

vinifera) berries. Am. J. Enol. Vitic. 60: 277–284.

Pech, J.C., Bouzayen, M., Latché, A., 2008. Climacteric fruit ripening: Ethylene-

dependent and independent regulation of ripening pathways in melon fruit.

Plant Sci., Ethylene Biology 175: 114–120. DOI:10.1016/j.plantsci.2008.01.003.

References

101

Peña Neira, A.I., Cáceres, A., Pastenes, C., 2007. Low molecular weight phenolic and

anthocyanin composition of grape skins from cv. syrah (Vitis vinifera L.) in

the maipo valley (Chile): Effect of clusters thinning and vineyard yield.

Peng, T., Saito, T., Honda, C., Ban, Y., Kondo, S., Liu, J.-H., Hatsuyama, Y.,

Moriguchi, T., 2013. Screening of UV-B-induced genes from apple peels by

SSH: possible involvement of MdCOP1-mediated signaling cascade genes in

anthocyanin accumulation. Physiol. Plant. 148: 432–444. DOI:10.1111/ppl.12002.

Peppi, M.C., Fidelibus, M.W., 2008. Effects of forchlorfenuron and abscisic acid on

the quality of ‘Flame Seedless’ Grapes. HortScience 43: 173–176.

Peppi, M.C., Fidelibus, M.W., Dokoozlian, N., 2006. Abscisic acid application timing

and concentration affect firmness, pigmentation, and color of ‘Flame Seedless’

grapes. HortScience 41: 1440–1445.

Petrie, P.R., Clingeleffer, P.R., 2006. Crop thinning (hand versus mechanical), grape

maturity and anthocyanin concentration: outcomes from irrigated Cabernet

Sauvignon (Vitis vinifera L.) in a warm climate. Aust. J. Grape Wine Res. 12:

21–29. DOI:10.1111/j.1755-0238.2006.tb00040.x.

Proctor, J.T.A., 1974. Color stimulation in attached apples with supplementary light.

Can. J. Plant Sci. 54: 499–503. DOI:10.4141/cjps74-084.

Quail, P.H., Boylan, M.T., Parks, B.M., Short, T.W., Xu, Y., Wagner, D., 1995.

Phytochromes: photosensory perception and signal transduction. Science 268:

675–680.

Ramsay, N.A., Walker, A.R., Mooney, M., Gray, J.C., 2003. Two basic-helix-loop-

helix genes (MYC-146 and GL3) from Arabidopsis can activate anthocyanin

References

102

biosynthesis in a white-flowered Matthiola incana mutant. Plant Mol. Biol. 52:

679–688. DOI:10.1023/A:1024852021124.

Reed, J.W., 1999. Phytochromes are Pr-ipatetic kinases. Curr. Opin. Plant Biol. 2:

393–397. DOI:10.1016/S1369-5266(99)00011-4.

Ren, J., Sun, L., Wu, J., Zhao, S., Wang, C., Wang, Y., Ji, K., Leng, P., 2010. Cloning

and expression analysis of cDNAs for ABA 8’-hydroxylase during sweet

cherry fruit maturation and under stress conditions. J. Plant Physiol. 167:

1486–1493. DOI:10.1016/j.jplph.2010.05.027.

Rizzini, L., Favory, J.-J., Cloix, C., Faggionato, D., O’Hara, A., Kaiserli, E.,

Baumeister, R., Schäfer, E., Nagy, F., Jenkins, G.I., Ulm, R., 2011. Perception

of UV-B by the Arabidopsis UVR8 protein. Science 332: 103–106.

DOI:10.1126/science.1200660.

Roberto, S.R., de Assis, A.M., Yamamoto, L.Y., Miotto, L.C.V., Sato, A.J., Koyama,

R., Genta, W., 2012. Application timing and concentration of abscisic acid

improve color of ‘Benitaka’ table grape. Sci. Hortic. 142: 44–48.

DOI:10.1016/j.scienta.2012.04.028.

Ross, J.A., Kasum, C.M., 2002. Dietary flavonoids: Bioavailability, metabolic effects, and

safety. Annu. Rev. Nutr. 22: 19–34. DOI:10.1146/annurev.nutr.22.111401.144957.

Rudell, D.R., Fellman, J.K., Mattheis, J.P., 2005. Preharvest application of methyl

jasmonate to ‘Fuji’ apples enhances red coloration and affects fruit size,

splitting, and bitter pit incidence. HortScience 40: 1760–1762.

Sæbø, A., Krekling, T., Appelgren, M., 1995. Light quality affects photosynthesis and

leaf anatomy of birch plantlets in vitro. Plant Cell Tissue Organ Cult. 41: 177–

185. DOI:10.1007/BF00051588.

References

103

Samuolienė, G., Sirtautas, R., Brazaitytė, A., Duchovskis, P., 2012. LED lighting and

seasonality effects antioxidant properties of baby leaf lettuce. Food Chem.

134: 1494–1499. DOI:10.1016/j.foodchem.2012.03.061.

Schaefer, H.M., Schaefer, V., Levey, D.J., 2004. How plant–animal interactions

signal new insights in communication. Trends Ecol. Evol. 19: 577–584.

DOI:10.1016/j.tree.2004.08.003.

Senger, H., 1982. The effect of blue light on plants and microorganisms. Photochem.

Photobiol. 35: 911–920. DOI:10.1111/j.1751-1097.1982.tb02668.x.

Seo, M., Koshiba, T., 2002. Complex regulation of ABA biosynthesis in plants.

Trends Plant Sci. 7: 41–48. DOI:10.1016/S1360-1385(01)02187-2.

Setha, S., Kondo, S., Hirai, N., Ohigashi, H., 2004. Xanthoxin, abscisic acid and its

metabolite levels associated with apple fruit development. Plant Sci. 166: 493–

499. DOI:10.1016/j.plantsci.2003.10.020.

Shi, L., Cao, S., Chen, W., Yang, Z., 2014. Blue light induced anthocyanin

accumulation and expression of associated genes in Chinese bayberry fruit.

Sci. Hortic. 179: 98–102. DOI:10.1016/j.scienta.2014.09.022.

Shimokawa, A., Tonooka, Y., Matsumoto, M., Ara, H., Suzuki, H., Yamauchi, N.,

Shigyo, M., 2014. Effect of alternating red and blue light irradiation generated

by light emitting diodes on the growth of leaf lettuce. bioRxiv 003103.

DOI:10.1101/003103.

Shin, D.H., Choi, M., Kim, K., Bang, G., Cho, M., Choi, S.-B., Choi, G., Park, Y.-I.,

2013. HY5 regulates anthocyanin biosynthesis by inducing the transcriptional

activation of the MYB75/PAP1 transcription factor in Arabidopsis. FEBS Lett.

587: 1543–1547. DOI:10.1016/j.febslet.2013.03.037.

References

104

Shinomura, T., Uchida, K., Furuya, M., 2000. Elementary processes of

photoperception by phytochrome A for high-irradiance response of hypocotyl

elongation in Arabidopsis. Plant Physiol. 122: 147–156.

Shiozaki, S., Kamata, Y., Ogata, T., Horiuchi, S., Kawase, K., 1999. Localization of

abscisic acid in grape berry by immunohistochemical techniques. J. Jpn. Soc.

Hortic. Sci. 68: 1–9. DOI:10.2503/jjshs.68.1.

Shiraishi, S., Hsiung, T.C., Shiraishi, M., Kitazaki, M., 1997. Effect of light intensity

on the photosynthetic rate of Vitis. Sci. Bull. Fac. Agric.-Kyushu Univ. Jpn.

Shiraishi, S., Watanabe, Y., 1994. Anthocyanin pigments in the grape skin of cultivars

(Vitis spp.). Sci Bull Fac Agr Kyushu Univ 48: 255–262.

Siegelman, H.W., Hendricks, S.B., 1957. Photocontrol of anthocyanin formation in

turnip and red cabbage seedlings. 1. Plant Physiol. 32: 393–398.

Sims, D.A., Pearcy, R.W., 1992. Response of leaf anatomy and photosynthetic

capacity in alocasia macrorrhiza (Araceae) to a transfer from low to high light.

Am. J. Bot. 79: 449–455. DOI:10.2307/2445158.

Singh, D., Basu, C., Meinhardt-Wollweber, M., Roth, B., 2014. LEDs for energy

efficient greenhouse lighting. ArXiv14063016 Phys. Q-Bio.

Smeekens, S., 2000. Sugar-induced signal transduction in plants. Annu. Rev. Plant

Physiol. Plant Mol. Biol. 51: 49–81. DOI:10.1146/annurev.arplant.51.1.49.

Smith, H., 1982. Light quality, photoperception, and plant strategy. Annu. Rev. Plant

Physiol. 33: 481–518. DOI:10.1146/annurev.pp.33.060182.002405.

Solfanelli, C., Poggi, A., Loreti, E., Alpi, A., Perata, P., 2006. Sucrose-specific

induction of the anthocyanin biosynthetic pathway in Arabidopsis. Plant

Physiol. 140: 637–646. DOI:10.1104/pp.105.072579.

References

105

Sparvoli, F., Martin, C., Scienza, A., Gavazzi, G., Tonelli, C., 1994. Cloning and

molecular analysis of structural genes involved in flavonoid and stilbene

biosynthesis in grape (Vitis vinifera L.). Plant Mol. Biol. 24, 743–755.

Springob, K., Nakajima, J., Yamazaki, M., Saito, K., 2003. Recent advances in the

biosynthesis and accumulation of anthocyanins. Nat. Prod. Rep. 20: 288–303.

DOI:10.1039/B109542K.

Stefanelli, D., Goodwin, I., Jones, R., 2010. Minimal nitrogen and water use in

horticulture: Effects on quality and content of selected nutrients. Food Res.

Int., Climate Change and Food Science 43: 1833–1843.

DOI:10.1016/j.foodres.2010.04.022.

Steyn, W.J., Wand, S.J.E., Jacobs, G., Rosecrance, R.C., Roberts, S.C., 2009.

Evidence for a photoprotective function of low-temperature-induced

anthocyanin accumulation in apple and pear peel. Physiol. Plant. 136: 461–

472. DOI:10.1111/j.1399-3054.2009.01246.x.

Stracke, R., Favory, J.-J., Gruber, H., Bartelniewoehner, L., Bartels, S., Binkert, M.,

Funk, M., Weisshaar, B., Ulm, R., 2010. The Arabidopsis bZIP transcription

factor HY5 regulates expression of the PFG1/MYB12 gene in response to

light and ultraviolet-B radiation. Plant Cell Environ. 33: 88–103.

DOI:10.1111/j.1365-3040.2009.02061.x.

Stracke, R., Ishihara, H., Huep, G., Barsch, A., Mehrtens, F., Niehaus, K., Weisshaar,

B., 2007. Differential regulation of closely related R2R3-MYB transcription

factors controls flavonol accumulation in different parts of the Arabidopsis

thaliana seedling. Plant J. 50: 660–677. DOI:10.1111/j.1365-313X.2007.03078.x.

References

106

Stutte, G.W., 2009. Light-emitting diodes for manipulating the phytochrome

apparatus. HortScience 44: 231–234.

Sun, L., Zhang, M., Ren, J., Qi, J., Zhang, G., Leng, P., 2010. Reciprocity between

abscisic acid and ethylene at the onset of berry ripening and after harvest.

BMC Plant Biol. 10: 257. DOI:10.1186/1471-2229-10-257.

Takahama, U., 2004. Oxidation of vacuolar and apoplastic phenolic substrates by

peroxidase: Physiological significance of the oxidation reactions. Phytochem.

Rev. 3: 207–219. DOI:10.1023/B:PHYT.0000047805.08470.e3.

Takos, A.M., Jaffé, F.W., Jacob, S.R., Bogs, J., Robinson, S.P., Walker, A.R., 2006.

Light-induced expression of a MYB gene regulates anthocyanin biosynthesis

in red apples. Plant Physiol. 142: 1216–1232. DOI:10.1104/pp.106.088104.

Tarara, J.M., Lee, J., Spayd, S.E., Scagel, C.F., 2008. Berry temperature and solar

radiation alter acylation, proportion, and concentration of anthocyanin in

Merlot grapes. Am. J. Enol. Vitic. 59: 235–247.

Tira-Umphon, A., Roustan, J.-P., Chervin, C., 2007. The stimulation by ethylene of

the UDP glucose-flavonoid 3-O-glucosyltransferase (UFGT) in grape tissues

is independent from the MYBA transcription factors. Vitis-geilveilerho- 46:

210.

Tomana, T., Utsunomiya, N., Kataoka, I., 1979. The Effect of environmental

temperatures on fruit ripening on the tree. J. Jpn. Soc. Hortic. Sci. 48: 261–266.

DOI:10.2503/jjshs.48.261.

Ubi, B.E., Honda, C., Bessho, H., Kondo, S., Wada, M., Kobayashi, S., Moriguchi, T.,

2006. Expression analysis of anthocyanin biosynthetic genes in apple skin:

References

107

Effect of UV-B and temperature. Plant Sci. 170: 571–578.

DOI:10.1016/j.plantsci.2005.10.009.

Uleberg, E., Rohloff, J., Jaakola, L., Trôst, K., Junttila, O., Häggman, H., Martinussen, I.,

2012. Effects of temperature and photoperiod on yield and chemical composition

of northern and southern clones of bilberry (Vaccinium myrtillus L.). J. Agric.

Food Chem. 60: 10406–10414. DOI:10.1021/jf302924m.

Wang, B., He, J., Duan, C., Yu, X., Zhu, L., Xie, Z., Zhang, C., Xu, W., Wang, S.,

2012. Root restriction affects anthocyanin accumulation and composition in

berry skin of ‘Kyoho’ grape (Vitis vinifera L. × Vitis labrusca L.) during

ripening. Sci. Hortic. 137: 20–28. DOI:10.1016/j.scienta.2011.10.006.

Watanabe, H., 2011. Light-controlled plant cultivation system in Japan - development

of a vegetable factory using LEDs as a light source for plants. Acta Hortic.

Wen, P.-F., Chen, J.-Y., Kong, W.-F., Pan, Q.-H., Wan, S.-B., Huang, W.-D., 2005.

Salicylic acid induced the expression of phenylalanine ammonia-lyase gene in

grape berry. Plant Sci. 169: 928–934. DOI:10.1016/j.plantsci.2005.06.011.

Wheeler, S., Loveys, B., Ford, C., Davies, C., 2009. The relationship between the

expression of abscisic acid biosynthesis genes, accumulation of abscisic acid

and the promotion of Vitis vinifera L. berry ripening by abscisic acid. Aust. J.

Grape Wine Res. 15: 195–204. DOI:10.1111/j.1755-0238.2008.00045.x.

Xie, R., Zheng, L., He, S., Zheng, Y., Yi, S., Deng, L., 2011. Anthocyanin

biosynthesis in fruit tree crops: Genes and their regulation. Afr. J. Biotechnol.

10: 19890–19897. DOI:10.5897/ajbx11.028.

Xie, X.-B., Li, S., Zhang, R.-F., Zhao, J., Chen, Y.-C., Zhao, Q., Yao, Y.-X., You, C.-

X., Zhang, X.-S., Hao, Y.-J., 2012. The bHLH transcription factor MdbHLH3

References

108

promotes anthocyanin accumulation and fruit colouration in response to low

temperature in apples: MdbHLH3 regulates apple fruit colouration. Plant Cell

Environ. 35: 1884–1897. DOI:10.1111/j.1365-3040.2012.02523.x.

Xie, Z., Li, B., Forney, C.F., Xu, W., Wang, S., 2009. Changes in sugar content and

relative enzyme activity in grape berry in response to root restriction. Sci.

Hortic. 123: 39–45. DOI:10.1016/j.scienta.2009.07.017.

Xu, F., Cao, S., Shi, L., Chen, W., Su, X., Yang, Z., 2014. Blue light irradiation

affects anthocyanin content and enzyme activities involved in postharvest

strawberry fruit. J. Agric. Food Chem. 62: 4778–4783.

DOI:10.1021/jf501120u.

Yamane, T., Jeong, S.T., Goto-Yamamoto, N., Koshita, Y., Kobayashi, S., 2006.

Effects of temperature on anthocyanin biosynthesis in grape berry skins. Am. J.

Enol. Vitic. 57, 54–59.

Yamane, T., Shibayama, K., 2007. Effects of treatment date, width of girdling, and

berry number of girdled shoot on the coloration of grape berries (Vitis sp.).

Hortic. Res. Jpn.

Yamane, T., Shibayama, K., 2006. Effects of trunk girdling and crop load levels on

fruit quality and root elongation in ‘Aki Queen’ grapevines. J. Jpn. Soc. Hortic.

Sci. Jpn.

Yokotani, N., Nakano, R., Imanishi, S., Nagata, M., Inaba, A., Kubo, Y., 2009.

Ripening-associated ethylene biosynthesis in tomato fruit is autocatalytically

and developmentally regulated. J. Exp. Bot. 60: 3433–3442.

DOI:10.1093/jxb/erp185.

References

109

Yonekura, M., Aoki, N., Hirose, T., Onai, K., Ishiura, M., Okamura, M., Ohsugi, R.,

Ohto, C., 2013. The promoter activities of sucrose phosphate synthase genes

in rice, OsSPS1 and OsSPS11, are controlled by light and circadian clock, but

not by sucrose. Front. Plant Sci. 4. DOI:10.3389/fpls.2013.00031.

Yoshikawa, H., Honda, C., Kondo, S., 2007. Effect of low-temperature stress on

abscisic acid, jasmonates, and polyamines in apples. Plant Growth Regul. 52:

199–206. DOI:10.1007/s10725-007-9190-2.

Zeevaart, J.A.D., Creelman, R.A., 1988. Metabolism and physiology of abscisic acid.

Annu. Rev. Plant Physiol. Plant Mol. Biol. 39: 439–473.

DOI:10.1146/annurev.pp.39.060188.002255.

Zhang, W., Curtin, C., Kikuchi, M., Franco, C., 2002. Integration of jasmonic acid

and light irradiation for enhancement of anthocyanin biosynthesis in Vitis

vinifera suspension cultures. Plant Sci. 162: 459–468. DOI:10.1016/S0168-

9452(01)00586-6.

Zheng, Y., Tian, L., Liu, H., Pan, Q., Zhan, J., Huang, W., 2009. Sugars induce

anthocyanin accumulation and flavanone 3-hydroxylase expression in grape

berries. Plant Growth Regul. 58: 251–260. DOI:10.1007/s10725-009-9373-0.

Zhou, R., Cutler, A.J., Ambrose, S.J., Galka, M.M., Nelson, K.M., Squires, T.M.,

Loewen, M.K., Jadhav, A.S., Ross, A.R.S., Taylor, D.C., Abrams, S.R., 2004.

A new abscisic acid catabolic pathway. Plant Physiol. 134: 361–369.

DOI:10.1104/pp.103.030734.

Zifkin, M., Jin, A., Ozga, J.A., Zaharia, L.I., Schernthaner, J.P., Gesell, A., Abrams,

S.R., Kennedy, J.A., Constabel, C.P., 2012. Gene expression and metabolite

profiling of developing highbush blueberry fruit indicates transcriptional

References

110

regulation of flavonoid metabolism and activation of abscisic acid metabolism.

Plant Physiol. 158: 200–224. DOI:10.1104/pp.111.180950.

Zoratti, L., Karppinen, K., Escobar, A.L., Häggman, H., Jaakola, L., 2014. Light-

controlled flavonoid biosynthesis in fruits. Front. Plant Sci. 5.

effects of light emitting diode (led) irradiation ...led light emitting diode m molar x m meter mg...

Documents