effects of aldosterone on cx43 gap junction expression in

Circulation Journal Vol.73, August 2009

Circ J 2009; 73: 1504 – 1512

he renin–angiotensin–aldosterone system (RAAS) affects the structural and functional properties of cardiac cells under a variety of pathological condi-

tions. The well-established main action of aldosterone, which is mediated by the mineralocorticoid receptor (MR), is acceleration of electrolyte transport in epithelial cells, particularly in the kidney, but also in the salivary gland and colon, where it increases Na+ reabsorption and K+ excretion.1 The MR is also localized in non-epithelial cells, including cardiac myocytes.2–5 Recent experimental and clinical studies have focused mainly on the role of aldosterone in the structural and functional derangements found in diseased hearts, in particular, progressive fibrosis and hypertrophy.6–8 Cardiac aldosterone production is increased in association with myocardial infarction or heart failure.9–12 Two large-scale clinical trials in patients with severe heart failure (RALES,13 EPHESUS14) have revealed that pharmacologi-cal blockade of MR, in addition to standard therapy, reduces

the occurrence of sudden cardiac death, suggesting a proar-rhythmic effect of aldosterone. Arrhythmia provoked by aldosterone has been demonstrated in dogs after myocar-dial infarction.15

The available information on the cellular and molecular mechanisms for the potential proarrhythmic action of aldoste-rone is still limited, and much remains to be clarified. Aldo-sterone affects Na+ transport in the cardiac cell membrane through upregulation of the Na+/K+ ATPase α1 subunit.16 Short-term exposure of cardiac myocytes to aldosterone has been shown to increase Na+ influx via the Na+–K+–Cl– cotransport and the Na+/K+ pump.17 Aldosterone increases the L-type Ca2+ current in adult rat ventricular myocytes, and increases the fast Na+ current in adult mouse ventricu-lar myocytes.18–20 More recently, aldosterone was shown to increase L-type and T-type Ca2+ currents in rat ventricular myocytes following the stimulation of gene expression.21 In cultured neonatal rat ventricular myocytes, Muto et al reported that exposure to aldosterone at a low concentra-tion (10–8 mol/L) resulted in an increase of hyperpolariza-tion-activated current in association with upregulation of mRNA and protein for HCN2 and HCN4, whereas expo-sure to aldosterone at a higher concentration (10–6 mol/L) resulted in opposite effects.22 Ouvrand-Pascaud et al reported that transgenic mice with cardiac-specific MR overexpres-sion display prolonged ventricular repolarization and lethal arrhythmia in association with a decreased transient outward K+ current and increased L-type Ca2+ current.23

The principal gap junction protein expressed in mamma-lian heart ventricles is connexin (Cx) 43. Cx40 is abundant in atrial tissue and in the atrioventricular conduction system,

(Received November 14, 2008; revised manuscript received March 11, 2009; accepted March 17, 2009; released online June 16, 2009)Division of Cardiology, Department of Medicine and Clinical Science, Yamaguchi University Graduate School of Medicine, Ube, Depart-ments of *Bioinformation Analysis and **Cardiovascular Research, Research Institute of Environmental Medicine, Nagoya University, Nagoya, JapanMailing address: Tomoko Ohkusa, MD, Division of Cardiology, Department of Medicine and Clinical Science, Yamaguchi University Graduate School of Medicine, 1-1-1 Minami-kogushi, Ube 755-8505, Japan. E-mail: [email protected] rights are reserved to the Japanese Circulation Society. For permis-sions, please e-mail: [email protected]

Effects of Aldosterone on Cx43 Gap Junction Expression in Neonatal Rat Cultured Cardiomyocytes

Shinsuke Suzuki, MD; Tomoko Ohkusa, MD; Takashi Sato, MD; Masaaki Yoshida, MD; Kenji Yasui, MD*; Keiko Miwa, BSc**; Jong-Kook Lee, MD**; Masafumi Yano, MD;

Itsuo Kodama, MD**; Masunori Matsuzaki, MD

Background: The renin–angiotensin–aldosterone system affects cellular morphology and function in the heart under a variety of pathologic conditions. In the present study the effects of aldosterone on the expression of con-nexin (Cx) 43 gap junctions in cardiomyocytes were investigated.Methods and Results: Cultured rat ventricular myocytes were exposed to aldosterone for 24 h. The protein and mRNA expression of Cx43 was estimated. Propagation of excitation was visualized by a multiple electrode array system. Treatment of the myocytes with 10–8 mol/L aldosterone resulted in a significant upregulation of Cx43 (by ~1.5-fold in protein and by ~1.2-fold in mRNA). The immunoreactive signal of Cx43 was also increased. Con-duction velocity (CV) was increased by ~24%. Treatment of the myocytes with aldosterone at higher concentra-tions (10–6–10–4 mol/L) caused a significant downregulation of Cx43 protein (by ~0.3-fold) without affecting Cx43 mRNA levels, and decreased the CV by ~23%. The Cx43 upregulation and CV acceleration at 10–8 mol/L aldosterone were prevented by pretreatment with eplerenone, but unaffected by mifepristone. Pretreatment of the myocytes with eplerenone or mifepristone did not prevent the Cx43 downregulation by aldosterone at 10–6– 10–4 mol/L.Conclusions: Aldosterone may be involved in arrhythmogenic gap junction remodeling through its dual effects on the expression of Cx43. (Circ J 2009; 73: 1504 – 1512)

Key Words: Aldosterone; Connexin43; Gap junction; Mineralocorticoid receptor; Mitogen-activated protein kinases (MAPKs)

T

ORIGINAL ARTICLE Molecular Cardiology

1505Effects of Aldosterone on Cx43 of Cardiomyocytes


and Cx45 is observed in the sinoatrial and atrioventricular nodes.24–26 Remodeling of gap junctions in the heart is an important feature of the structural substrates for conduction disturbance and arrhythmogenesis under various pathologi-cal conditions including myocardial ischemia, infarction and hypertrophy.25–27

In a previous study using neonatal rat cultured ventricu-lar myocytes, we showed that rapid electrical stimulation causes upregulation of Cx43 and a concomitant increase in conduction velocity (CV), mainly through an autocrine effect of angiotensin II (Ang II) that activates extracellular signal-regulated protein kinases (ERKs) and p38 mitogen-activated protein kinases (MAPKs).28 Aldosterone, which is downstream of the RAAS, could also have a direct action on the Cx43 expression of ventricular myocytes. The present study was designed to test this hypothesis.

MethodsAll animals were handled according to the guideline of the Animal Care Committee of Yamaguchi University. This investigation complied with the “Guide for the Care and Use of Laboratory Animals” published by the National Institutes of Health (NIH Publication No. 85-23, revised 1996).

Cell CulturePrimary cultures of 1- to 2-day-old neonatal rat ventricular myocytes were prepared as reported previously.28,29 Myocytes that were dissociated enzymatically were seeded on culture trays at a concentration of 3×105 cells/cm2, and then incubated in Leibovitz L-15 Medium (Worthington Biochemical Co, Lakewood, NJ, USA) supplemented with 5% fetal bovine serum at 37°C. The cell suspension was replated to reduce the fibroblast content. Cells were grown in a random orientation (isotropic growth) to make a conflu-ent layer, and by day 5 exhibited synchronized spontaneous beating with a regular frequency. The relative population of myocytes over non-myocytes in the respective culture, which was estimated by immunolabeling against with an anti-actin antibody, was >97%. Cultured myocytes on day 5 were transferred to serum-free medium, and exposed to aldoste-rone (10–8–10–4 mol/L, Sigma, St Louis, MO, USA) for 24 h. To determine the expression of phosphorylated or non-phosphorylated Cx43, the cultured myocytes on day 5 were treated with either protein kinase A (PKA) inhibitor (H-8 (N-[2-(methylamino) ethyl]-5-isoquinolinesulfonamide dihy-drochloride; Biaffin GmbH & Co KG, Kassel, Germany)30 or protein kinase C (PKC) inhibitor (Chelerythrine; Calbiochem, Tokyo, Japan)31 during exposure to 10–8 mol/L aldosterone. In experiments to elucidate the signaling cascade, the cul-tured myocytes on day 5 were pretreated for 1 h with a MR antagonist, eplerenone (10–6 mol/L and 10–5 mol/L; Pfizer

Japan, Tokyo),32 a glucocorticoid receptor (GR) antagonist, mifepristone (10–6 mol/L and and 10–5 mol/L; Sigma)33 or Ang II type 1 receptor antagonist, losartan (10–7 mol/L; Merck, Rahway, NJ, USA)28 before the addition of aldoste-rone.34

Electrophoresis and ImmunoblottingCollected cells were lysed and the cellular extracts elec-trophoresed on SDS-polyacrylamide gels as previously described.28 Rabbit polyclonal anti-Cx43 antibody (1:1,000, Zymed, South San Francisco, CA, USA), rabbit polyclonal anti-Cx40 antibody (1:1,000; Alpha Diagnostic, San Antonio, TX, USA), monoclonal anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (1:5,000; Clone GAPDH-71.7; Sigma), rabbit anti-ERK1/2 antibody, rabbit anti-c-Jun NH2-terminal kinase (JNK)1 antibody, rabbit anti-p38 anti-body (1:1,000; Santa Cruz, CA, USA), rabbit anti-active® MAPK pAb, rabbit anti-active® JNK pAb, and rabbit anti-active® p38 pAb (1:2,000; Promega, WI, USA) were used as the primary antibodies. The amount of protein recognized by the antibodies was quantified by means of an ECL™ immu-noblotting detection system (Amersham, Buckinghamshire, UK).

Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)Total RNA was extracted from cultured myocytes using an RNAqueous Kit (Ambion, Austin, TX), and a real-time RT-PCR assay (Perkin-Elmer ABI Prism 7700) was per-formed to quantify the mRNA expression of Cx43.28,35 GAPDH mRNA was used as an internal control. The sequences of the PCR primers and sequence-specific probes are shown in Table.

ImmunohistochemistryFor immunodetection of gap junctions, a polyclonal rabbit anti-Cx43 antibody (Zymed) was used. After permeabiliza-tion (0.1% Triton X-100), quenching and blocking (10% goat serum), samples were incubated with the antibody (1:100 diluted in phosphate-buffered saline) overnight at room temperature. Primary antibody-bound Cx43 was visu-alized by FITC-conjugated anti-rabbit IgG, and examined under a confocal microscope (LSM500, Zeiss, Germany). Samples processed without the primary antibody served as negative controls. The proportion of the Cx43 immunoreac-tive signal was defined as the number of high-signal-inten-sity (>90 % of the maximum level) pixels divided by the total number of pixels occupied by the myocytes.36 Ten individual measurements in different fields were averaged to yield a single value for each culture slide.

Extracellular Potential Mapping of PropagationThe conduction properties of the cultured ventricular myo-

Table. Primers for RT-PCR

Target Primer Sequence (5’–3’) Position

GAPDH Sense CTTCACCACCATGGAGAAGGC 327–347 Probe CCTGGCCAAGGTCATCCATGACAACTTT 501–528 Antisense CTCATGACCACAGTCCATGCC 544–564 Cx43 Sense AATCCTCGTGCCGCAATTA 1084–1103 Probe ACAAGCAAGCTAGCGAGCAAAACTGGG 1106–1132 Antisense CTACAGGGCAGAGCAAAATCA 1137–1157

RT-PCR, reverse transcription-polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Cx43, connexin43.

1506 SUZUKI S et al.


Figure 1. Quantitative analysis of the Cx43 and 40 levels in cardiomyocytes exposed to 10–8 mol/L aldosterone. (A) Cx43 and Cx40 protein levels estimated by western blotting analysis. The Cx43 and Cx40 protein amounts were normalized to GAPDH (mean ± SE; n=6 in each group). (B) Cx43 mRNA levels estimated by real-time reverse transcription-polymerase chain reaction. The Cx43 mRNA amount was normalized to GAPDH (mean ± SE; n=8 in each group). (C) Confocal images of Cx43 immunolabeling in cultured cardiomyocytes. Representative immunofluorescence images of Cx43 before (0 h) and 24 h after exposure to 10–8 mol/L aldosterone. (D) Proportion of the total cell area occupied by the Cx43 immu-noreactive signal (mean ± SE; n=5 in each group). (E) Effects of the PKA or PKC inhibitor on phosphorylated and non-phosphorylated Cx43 by exposure to 10–8 mol/L aldosterone. Phosphorylated Cx43: upper 2 bands; non-phosphorylated Cx43: lower band; *P<0.05, **P<0.01 vs 0 h. All data normalized to the value of 0 h, which was set at 1. Cx, connexin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PKA, protein kinase A; PKC, protein kinase C.



cytes were examined by extracellular potential mapping using a specifically designed multielectrode array system (MED-P545A and MED64, Panasonic, Tokyo, Japan).28,37,38 The 64-planar microelectrodes, each 50×50 μm, were arranged in an 8×8 pattern with an inter-electrode distance of 450 μm to cover 3,150×3,150 μm beneath the cultured myocytes. All 64 unipolar signals were recorded simultane-ously with a common reference from 4 distant electrodes, and amplified with high gain (60 dB) and at a low frequency (1.0–100 Hz) filter setting. Constant stimuli at 3.0 Hz were applied via 4 lateral electrodes of the recording array to elicit 1-way propagation of excitation in the observation area. Biphasic pulses of 0.1 ms duration were used for the stimula-tion with an intensity of 100–200 μA (twice the diastolic threshold). Activation time at each recording site was identi-fied by a sharp negative deflection. The CV was measured by plotting the activation time against distance from the stimula-tion site along a midline from right to left.

Statistical AnalysisAll data are presented as the mean ± standard error. Statis-tical analysis was performed using analysis of variance followed by multiple comparisons using Fisher’s protected least-significant difference and unpaired Student’s t-test. Differences were taken to be significant at P<0.05.

ResultsAldosterone Regulates Cx43 Expression in a Dose-Dependent MannerAfter immunoblotting (Figure 1A), the Cx43 antibody rec-ognized 3 bands migrating between 40 and 43 kDa (phos-phorylated Cx43: upper 2 bands, non-phosphorylated Cx43:

lower band). The amount of Cx43 protein normalized to control (GAPDH) was increased significantly after treatment for 24 h with 10–8 mol/L aldosterone (by 1.52±0.10, n=6, P< 0.01 vs 0 h). The amount of Cx43 mRNA normalized to control was also increased by treatment with 10–8 mol/L aldosterone (by 1.23±0.08, n=8, P<0.05 vs 0 h) (Figure 1B). Figure 1C shows confocal images of Cx43 immunolabel-ing. Cx43-containing gap junctions was visualized as aggregates of bright punctate fluorescent domains around the cell perimeter at the site of abutment with neighboring cells. The exposure to 10–8 mol/L aldosterone resulted in a homogeneous increase of the Cx43 immunoreactive signals without affecting their distribution pattern. Quantitative analysis revealed a significant increase in the Cx43-positive area by 10–8mol/L aldosterone (by 1.61±0.13 at 24 h, n=5, P<0.01 vs 0 h) (Figure 1D). As for phosphorylation of Cx43, 10–8 mol/L aldosterone increased both phosphorylated and non-phosphorylated Cx43 expression. Both the PKA and PKC inhibitors attenuated the 10–8 mol/L aldosterone-induced upregulation of phosphorylated and non-phosphor-ylated Cx43 (Figure 1E).

On the other hand, 10–6 and 10–4 mol/L aldosterone, which are the concentrations reported to induce myocyte apopto-sis,39 significantly decreased the amount of Cx43 protein (0.31±0.06 and 0.25±0.03 at 24 h, respectively, n=5 each, P< 0.01 vs 0 h) (Figure 2A). Interestingly, 10–6 and 10–4 mol/L aldosterone did not affect the expression of Cx43 mRNA (0.82±0.09 and 1.15±0.03 at 24 h, respectively, n=5 each) (Figure 2B).

For Cx40, the amount of protein normalized to control (GAPDH) revealed no significant difference after treatment for 24 h with 10–8–10–4 mol/L aldosterone (Figures 1A,2C).

Figure 2. Quantitative analysis of Cx43 and 40 levels in cardiomyocytes exposed to 10–6 and 10–4 mol/L aldosterone. (A) Cx43 protein levels estimated by western blotting analysis. The Cx43 protein amount was normalized to GAPDH (mean ± SE; n=5 in each group). (B) Cx43 mRNA levels estimated by real-time reverse transcription-polymerase chain reaction. The Cx43 mRNA amount was normalized to GAPDH (mean ± SE; n=5 in each group). (C) Cx40 protein levels estimated by western blotting analysis. The Cx40 protein amount was normalized to GAPDH (mean ± SE; n=5 in each group).**P<0.01 vs 0 h. All data normalized to the value of 0 h, which was set at 1. Cx, connexin; GAPDH, glyceralde-hyde-3-phosphate dehydrogenase; NS, not significant.



Pharmacological Evidence for MR Involvement in Aldosterone-Dependent Upregulation of Cx43Most biological actions of aldosterone are mediated by its binding to intracellular MR, which, once activated, modu-late gene expression.4 To study the role of MR in aldoste-rone-induced alterations in Cx43 expression, we investigated the effects of an MR blocker, eplerenone, added to the culture

medium. The 10–8 mol/L aldosterone-induced increase in Cx43 protein expression (1.52±0.10 at 24 h, n=6) was sig-nificantly blocked by 10–6 M eplerenone (1.01±0.20 at 24 h, n=4, P<0.01), as shown in Figure 3. Because aldosterone may also bind to the GR,40 we investigated the action of aldosterone in ventricular myocytes co-incubated with mife-pristone, a GR antagonist. As shown in Figure 3, 10–6 mol/L

Figure 3. Quantitative analysis of Cx43 protein levels in cardiomyocytes exposed to 10–8 mol/L aldosterone in the presence or absence of blockers: mineralocorticoid blocker, eplerenone; glucocorticoid blocker, mifepris-tone; angiotensin II type 1 blocker, losartan. The Cx43 protein amount was normalized to GAPDH (mean ± SE; n=4–6 in each group). *P<0.05, **P<0.01 vs 0 h. All data normalized to the value of a 0 h, which was set at 1. Cx, connexin; GAPDH, glyceraldehyde-3-phos-phate dehydrogenase; NS, not significant.

Figure 4. Changes in 3 MAPKs and their phosphorylated forms in response to aldosterone (western blotting analysis). (A) Total ERK and p-ERK. (B) Total JNK and p-JNK. (C) Total p-38 MAPKs and p-p38. Values were normalized to their baseline (mean ± SE; n=5). *P<0.05 vs baseline. MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regu-lated protein kinase; p-ERK, phospho-ERK; JNK, c-Jun NH2-terminal kinase; p-JNK, phospho-JNK; p-p38, phopho-p-38 MAPKs.



mifepristone did not block the 10–8 mol/L aldosterone-induced upregulation of Cx43. Losartan also did not affect the alterations in Cx43 expression caused by exposure to 10–8 mol/L aldosterone (Figure 3). Eplerenone, mifepristone, and losartan did not block the 10–4 mol/L aldosterone-depen-dent downregulation of Cx43 (data not shown). These results indicate that aldosterone-induced upregulation of Cx43 expression is mediated by the MR.

Effects of Aldosterone on ERK, JNK, and p38 MAPK Signaling PathwaysWe next examined the effects of aldosterone on 3 major MAPK signaling pathways. Although the total level of ERK was unaffected, phosphorylated ERK (p-ERK) showed a significant increase in response to 10–8 mol/L aldosterone, with a peak at 15 min (by 1.8±0.4-fold, P<0.05) (Figure 4A). For JNK, the total level was also unchanged, but phos-

Figure 5. Multielectrode extracellular potential mapping during propagation of excitation. (A) Representative electro-grams recorded from the 64 terminals. Arrows = stimulus artifacts. ST, stimulation point. Isochrone maps of activation time in a culture dish before (B, control) and after 10–8 mol/L (C) or 10–6 mol/L (D) aldosterone exposure for 24 h in the absence of eplerenone. (E) Isochrone map of activation time in another culture dish after 10–8 mol/L aldosterone exposure for 24 h in the presence of 10–6 mol/L eplerenone. *Stimulation points.

Figure 6. Effects of aldosterone on conduc-tion velocity. Conduction velocity from right to left was measured along the midline in the observation area before and 24 h after treatment with aldosterone with and without eplerenone or mifepristone. Values are mean ± standard error (n=5–7 in each group). *P<0.05, **P<0.01 vs baseline (0 h) value prior to aldosterone treat-ment. NS, not significant.



phorylated JNK (p-JNK) showed a significant increase in response to 10–8 mol/L aldosterone, with a peak at 30 min (by 3.1±1.2-fold, P<0.05) (Figure 4B). For p-38 MAPKs (p-38), although phosphorylated p-38 (p-p38) at 15 min after exposure tended to be increased (by 1.3±0.2-fold, P=0.09), the total p-38 and p-p38 levels showed no significant changes in response to 10–8 mol/L aldosterone. These results suggest that MAPK, and especially ERK and JNK signaling pathways, are activated by 10–8 mol/L aldosterone.

Aldosterone Modulates Electrophysiological Characteristics in Ventricular MyocytesWe investigated the functional manifestation of aldoste-rone-induced alterations in Cx43 expression by multi-elec-trode extracellular potential mapping. The measurements were made before and after treatment with 10–8–10–4 mol/L aldosterone. A clear local electrogram composed of a posi-tive deflection followed by negative deflection was recorded from most (>90%) of the 64 electrodes (Figure 5A). Iso-chrone maps of the activation time showed an almost uniform propagation of excitation from right to left both before (control, Figure 5B) and after exposure to 10–8 mol/L and 10–6 mol/L aldosterone for 24 h (Figures 5C,D). The acti-vation times after treatment with 10–8 mol/L aldosterone at the respective recording sites were much shorter than those of the control, indicating 10–8 mol/L aldosterone-induced acceleration of propagation. Such changes in propagation following exposure to 10–8 mol/L aldosterone were prevented by pretreatment with 10–6 mol/L eplerenone (Figure 5E). Figure 6 shows the pooled data for CV. In the absence of eplerenone, the CV was increased by 10–8 mol/L aldoste-rone; the value after 24 h treatment with 10–8 mol/L aldoste-rone (25.6±0.5 cm/s, n=7) was significantly higher than the control (0 h) (20.7±1.2 cm/s, n=5). In the presence of eplere-none, 10–8 mol/L aldosterone did not affect CV; the value at 24 h (22.7±0.7 cm/s, n=7) was not significantly different from the control (0 h). Moreover, 10–6 mol/L mifepristone did not prevent the 10–8 mol/L aldosterone-induced increase in CV (24.1±1.3 cm/s, n=6). The 10–6 and 10–4 mol/L aldo-sterone significantly decreased the CV (18.0±0.8 cm/s and 15.5±0.5 cm/s, respectively, n=5 each, P<0.05) compared with the control (0 h) (Figure 6). Eplerenone and mifepris-tone did not prevent the 10–6 and 10–4 mol/L aldosterone-induced decrease in CV (data not shown).

DiscussionIn the present study, we have shown that aldosterone may be involved in arrhythmogenic gap junction remodeling through its dual effects on the expression of Cx43: upreg-ulation at low concentrations, which is mediated at least in part by MR stimulation, and downregulation at higher concentrations. Indeed, 10–8 mol/L aldosterone specifically upregulated Cx43 expression through MR regulation, and at least in part by PKC-MAPKs, and accelerated the propa-gation of excitation in ventricular myocytes. This conclusion is supported by the finding that incubation of cells with 10–8 mol/L aldosterone for 24 h increased Cx43 expression (mRNA and protein), and this increase was prevented by the MR antagonist, eplerenone. Treatment of the myocytes with aldosterone at 10–6–10–4 mol/L downregulated Cx43 with a decrease in CV, which was not prevented by the MR antagonist. These results are potentially of interest, consid-ering the role of the MR in cardiac derangements, including sudden arrhythmic death under pathological conditions.

Regulation of Cardiac Gap Junction Cx43 by AldosteroneAldosterone, as with other steroid hormones, initiates its effects by binding to intracellular receptors, which are then able to control the transcription of a number of genes. For instance, aldosterone is reported to regulate the Ca2+ channel, Ito, If, and Na+–K+ ATPase through its genomic effects.16,18–20,22 To our knowledge, this is the first time that an aldosterone-induced functional expression of Cx43 has been reported. It has been shown that a MR–hormone complex can activate transcription of a target gene by binding an upstream transcription regulatory element.41 Indeed, in the rat cardiac Cx43 gene the promoter region preceding the first exon contains a half-site for hormone response ele-ments (HRE), which might bind the MR, with a consensus 15-nucleotide sequence of AGAACAnnnTGTTCT.42 In the present study, the expression of Cx43 (mRNA and protein) was upregulated by 10–8 mol/L aldosterone exposure for 24 h, and the upregulation of Cx43 might be caused by its genomic effect through the MR.

On the other hand, it is also reported that the growth response induced by aldosterone is not only dependent on the MR, but is also associated with the activation of ERK, JNK, and PKC-α.43 It has been reported that cardiac Cx43 expression is regulated by the MAPK family, including ERK, JNK, and p38 MAPKs.28,44,45 In this study, we also investigated the effect of aldosterone-induced activated MAPK signaling pathways, and our results showed that aldosterone activates the ERK and JNK signaling pathways. In addition, the PKC inhibitor attenuated the 10–8 mol/L aldosterone-induced upregulation of Cx43 expression. These results indicate that the PKC-MAPKs pathway, at least in part, contributed to the upregulation of Cx43 expression in our system.

Interestingly, in this study 10–6–10–4 mol/L aldosterone, which decreased the expression of Cx43 protein, resulted in a decrease in CV, but neither a MR blocker nor a GR blocker prevented the decrease in Cx43 expression caused by 10–6– 10–4 mol/L aldosterone. This concurs with recent observa-tions by Muto et al that in cultured ventricular myocytes a high concentration of aldosterone (10–6 mol/L), unlike at a low concentration (10–8 mol/L), causes a decrease in If and downregulation of HCN2 and HCN4.22 Mano et al reported that >10–6 mol/L aldosterone directly induced myocyte apoptosis through calcineurin-dependent pathways.39 Thus, an extremely high concentration of aldosterone (10–6– 10–4 mol/L) might cause myocyte damage, in part through an apoptotic pathway.

In various types of epithelial cells and vascular smooth muscle cells, expression of 11β-hydroxysteroid dehydro-genase type 2 (11β-HSD2) converts endogenous glucocor-ticoids into their receptor-inactive 11-keto-analogs, thereby conferring aldosterone selectivity on the MR. However, cardiac expression of 11β-HSD2 is extremely low,46 such that cardiomyocyte MRs are normally occupied by endog-enous glucocorticoids that are present at higher levels than aldosterone under physiological conditions. However, in pathophysiological states with high concentrations of aldo-sterone, it has been reported that mineralocorticoids can access the cardiac MR and affect cardiac protein metabo-lism.10 In the present study, we found that Cx43 expression was modulated by 10–8–10–4 mol/L aldosterone. Such a high concentration of aldosterone may be relevant in the context of cardiac hypertrophy, because intracardiac aldosterone levels of 1.6×10–8 mol/L have been reported in the rat myo-



cardium.3 Moreover, it is reported that the level of aldoste-rone in plasma is approximately 10–7 mol/L in patients with heart failure, and that the level of aldosterone in the myocar-dium is approximately 17-fold higher than that in plasma.3,47

Aldosterone and Arrhythmogenesis: Pathophysiological ImplicationsThe electrophysiological alterations observed during the development of hypertrophy or heart failure, crucial for arrhythmogenesis, have been extensively reviewed by Tomaselli and Marban.48 Indeed, aldosterone-induced upreg-ulation of depolarizing INa and ICa, as well as downregula-tion of K+ currents, may all participate in a synergistic manner to prolong the duration of action potentials.48 Aldo-sterone-induced upregulation (at low concentrations) and downregulation (at high concentrations) of If is also reported.22 In addition to this ion channel remodeling, our results indicate that aldosterone-dependent alterations in Cx43 expression, and the subsequent changes in the con-duction properties of cardiomyocytes, may also be involved in its potentially proarrhythmic action. Recently, Bian and Tung reported that a structurally heterogeneous form of alteration in CV affects the vulnerability to reentry during rapid pacing.49 Therefore, effective prevention of aldoste-rone activation during the development of gap junction remodeling might be, at least in part, an important thera-peutic strategy for the treatment of arrhythmias.

Study LimitationsThe first is the lack of measurement of action potential upstroke velocities in the mapping system. INa is known to influence cell-to-cell propagation, and Boixel et al recently reported that aldosterone upregulates cardiac INa.20 There-fore, we could not exclude the effects of upregulated INa on the increase in CV, and further studies are needed to clarify this point. The second limitation is the lack of a functional index of coupling. An important surrogate for cell-to-cell coupling is tissue resistance or effective space constant. In our experiments using neonatal cardiomyocytes, the space constant measurement cannot to be made. In light of this limitation, CV is presented as a viable surrogate for cou-pling.28

ConclusionsThe present study reveals that aldosterone affects the expression of gap junction Cx43 through its dual effects on Cx43 expression. Treatment of myocytes by aldosterone at 10–8 mol/L resulted in upregulation of Cx43 in association with an increase in CV, and this effect was prevented by eplerenone, a MR antagonist. Treatment of the myocytes with aldosterone at 10–6–10–4 mol/L caused downregulation of Cx43 with a decrease in CV, which was not prevented by the MR antagonist. Aldosterone might be involved in arrhythmogenic gap junction remodeling in diseased hearts through its concentration-dependent dual effects on Cx43 expression.

AcknowledgmentsWe thank Dr Bertram Pitt for his informative comments. We also thank Pfizer Japan Inc, Tokyo, for their gift of eplerenone and Merck (Rahway, NJ, USA) for their gift of losartan.

This study was supported by in part by a Grant-in-Aid for Scientific Research (C) in Japan (C17590738 and C19590818) from Japan Society for the Promotion of Science (JSPS), Japan.

DisclosuresNone.

References 1. Bonvalet JP. Regulation of sodium transport by steroid hormones.

Kidney Int 1998; 65: S49 – S56. 2. Knox JR, Lockett MF. Similarity between a substrate produced by

the heart in vitro and the 18-monoacetyl derivative of D-aldosterone. J Endocrinol 1969; 43: 315 – 316.

3. Silvestre JS, Robert V, Heymes C, Aupetit-Faisant B, Mouas C, Moalic JM, et al. Myocardial production of aldosterone and corticos-terone in the rat: Physiological regulation. J Biol Chem 1998; 273: 4883 – 4891.

4. Funder JW. Glucocorticoid and mineralocorticoid receptors: Biology and clinical relevance. Annu Rev Med 1997; 48: 231 – 240.

5. Slight SH, Ganjam VK, Gomez-Sanchez CE, Zhou MY, Weber KT. High affinity NAD+-dependent 11β-hydroxysteroid dehydrogenase in the human heart. J Mol Cell Cardiol 1996; 28: 781 – 787.

6. Brilla CG, Pick R, Tan LB, Janicki JS, Weber KT. Remodeling of the rat right and left ventricles in experimental hypertension. Circ Res 1990; 67: 1355 – 1364.

7. Robert V, Nguyen VT, Cheav SL, Mouas C, Swynghedauw B, Delcayre C. Increased cardiac types I and III collagen mRNAs in aldosterone-salt hypertension. Hypertension 1994; 24: 30 – 36.

8. Campbell SE, Janicki JS, Mastubara BB, Weber KT. Myocardial fibrosis in the rat with mineralocorticoid excess: Prevention of scaring by amiloride. Am J Hypertens 1993; 6: 487 – 495.

9. Duprez DA, Bauwens FR, De Buyzere ML, De Backer TL, Kaufman JM, Van Hoecke J, et al. Influence of arterial blood pressure and aldosterone on left ventricular hypertrophy in moderate essential hypertension. Am J Cardiol 1993; 71: 17A – 20A.

10. Qin W, Rudolph AE, Bond BR, Rocha R, Blomme EA, Goellner JJ, et al. Transgenic model of aldosterone-driven cardiac hypertrophy and heart failure. Circ Res 2003; 93: 69 – 76.

11. Silvestre JS, Heymes C, Oubénaïssa A, Robert V, Aupetit-Faisant B, Carayon A, et al. Activation of cardiac aldosterone production in rat myocardial infarction: Effect of angiotensin II receptor blockade and role in cardiac fibrosis. Circulation 1999; 99: 2694 – 2701.

12. Mizuno Y, Yoshimura M, Yasue H, Sakamoto T, Ogawa H, Kugiyama K, et al. Aldosterone production is activated in failing ventricle in humans. Circulation 2001; 103: 72 – 77.

13. Pitt B, Zannad F, Remme WJ, Cody R, Castaigne A, Perez A, et al. The effect of spironolactone on morbidity and mortality in patients with severe heart failure: Randomized Aldactone Evaluation Study Investigators. N Engl J Med 1999; 341: 709 – 717.

14. Pitt B, Remme W, Zannad F, Neaton J, Martinez F, Roniker B, et al. Eplerenone Post-Acute Myocardial Infarction Heart Failure Efficacy and Survival Study Investigators: Eplerenone, a selective aldosterone blocker, in patients with left ventricular dysfunction after myocardial infarction. N Engl J Med 2003; 348: 1309 – 1321.

15. Arora RB, Somari P. Ectopic arrhythmia provoking action of aldo-sterone. Life Sci 1962; 5: 215 – 218.

16. Ikeda U, Hyman R, Smith TW, Medford RM. Aldosterone-mediated regulation of Na+, K+-ATPase gene expression in adult and neonatal rat cardiocytes. J Biol Chem 1991; 266: 12058 – 12066.

17. Mihailidou AS, Buhagiar KA, Rasmussen HH. Na+ influx and Na+-K+ pump activation during short-term exposure of cardiac myocytes to aldosterone. Am J Physiol 1998; 274: C175 – C181.

18. Perrier R, Richard S, Sainte-Marie Y, Rossier BC, Jaisser F, Hummler E, et al. A direct relationship between plasma aldosterone and cardiac L-type Ca2+ current in mice. J Physiol 2005; 569: 153 – 162.

19. Sayers G, Lefer AM, Nadzam GR. Aldosterone and cardiac function. Endocrinology 1966; 78: 211 – 213.

20. Boixel C, Gavillet B, Rouqier JS, Abriel H. Aldosterone increases voltage-gated sodium current in ventricular myocytes. Am J Physiol 2006; 290: H2257 – H2266.

21. Lalevée N, Rebsamen MC, Barrère-Lemaire S, Perrier E, Nargeot J, Bénitah JP, et al. Aldosterone increases T-type calcium channel expression and in vitro beating frequency in neonatal rat cardiomyo-cytes. Cardiovasc Res 2005; 67: 216 – 224.

22. Muto T, Ueda N, Opthof T, Ohkusa T, Nagata K, Suzuki S, et al. Aldosterone modulates If current through gene expression in cultured neonatal rat ventricular myocytes. Am J Physiol Heart Circ Physiol 2007; 293: H2710 – H2718.

23. Ouvrard-Pascaud A, Sainte-Marie Y, Bénitah JP, Perrier R, Soukaseum C, Cat AN, et al. Conditional mineralocorticoid receptor expression in the heart leads to life-threatening arrhythmias. Circula-tion 2005; 111: 3025 – 3033.



24. Danik SB, Liu F, Zhang J, Suk HJ, Morley GE, Fishman GI, et al. Modulation of cardiac gap junction expression and arrhythmic sus-ceptibility. Circ Res 2004; 95: 1035 – 1041.

25. Jongsma HJ, Wilders R. Gap junctions in cardiovascular disease. Circ Res 2000; 86: 1193 – 1197.

26. Saffitz JE, Laing JG, Yamada KA. Connexin expression and turnover: Implications for cardiac excitability. Circ Res 2000; 86: 723 – 728.

27. Severs NJ, Coppen SR, Dupont E, Yeh HI, Ko YS, Matsushita T. Gap junction alterations in human cardiac disease. Cardiovasc Res 2004; 62: 368 – 377.

28. Inoue N, Ohkusa T, Nao T, Lee JK, Matsumoto T, Hisamatsu Y, et al. Rapid electrical stimulation of contraction modulates gap junction protein in neonatal rat cultured cardiomyocytes: Involvement of mitogen-activated protein kinases and effects of angiotensin II-recep-tor antagonist. J Am Coll Cardiol 2004; 44: 914 – 922.

29. Yamamoto M, Yoshimura M, Nakayama M, Abe K, Sumida H, Sugiyama S, et al. Aldosterone, but not angiotensin II, reduces angio-tensin converting enzyme 2 gene expression levels in cultured neona-tal rat cardiomyocytes. Circ J 2008; 72: 1346 – 1350.

30. Salameh A, Frenzel C, Boldt A, Rassler B, Glawe I, Schulte J, et al. Subchronic alpha- and beta-adrenergic regulation of cardiac gap junction protein expression. FASEB J 2006; 20: 365 – 367.

31. Doble BW, Ping P, Kardami E. The epsilon subtype of protein kinase C is required for cardiomyocyte connexin-43 phosphorylation. Circ Res 2000; 86: 293 – 301.

32. Yamamuro M, Yoshimura M, Nakayama M, Abe K, Shono M, Suzuki S, et al. Direct effects of aldosterone on cardiomyocytes in the pres-ence of normal and elevated extracellular sodium. Endocrinology 2006; 147: 1314 – 1321.

33. Gaeggeler HP, Gonzalez-Rodriguez E, Jaeger NF, Loffing-Cueni D, Norregaard R, Loffing J, et al. Mineralocorticoid versus glucocorti-coid receptor occupancy mediating aldosterone-stimulated sodium transport in a novel renal cell line. J Am Soc Nephrol 2005; 16: 878 – 891.

34. Sugiyama T, Yoshimoto T, Tsuchiya K, Gochou N, Hirono Y, Tateno T, et al. Aldosterone induces angiotensin converting enzyme gene expression via a JAK2-dependent pathway in rat endothelial cells. Endocrinology 2005; 146: 3900 – 3906.

35. Niwa N, Yasui K, Opthof T, Takemura H, Shimizu A, Horiba M, et al. CaV3.2 subunit underlies the functional T-type Ca2+ channel in

murine hearts during the embryonic period. Am J Physiol 2004; 286: H2257 – H2263.

36. Zhuang J, Yamada KA, Saffitz JE, Kleber AG. Pulsatile stretch remodels cell-to-cell communication in cultured myocytes. Circ Res 2000; 87: 316 – 322.

37. Oka H, Shimono K, Ogawa R, Sugihara H, Taketani M. A new planar multielectrode array for extracellular recording: Application to hip-pocampal acute slice. J Neurosci Methods 1999; 93: 61 – 67.

38. Shimono K, Brucher F, Granger R, Lynch G, Taketani M. Origins and distribution of cholinergically induced beta rhythms in hippocampal slices. J Neurosci 2000; 20: 8462 – 8473.

39. Mano A, Tatsumi T, Shiraishi J, Keira N, Nomura T, Takeda M, et al. Aldosterone directly induces myocyte apoptosis through calcineurin-dependent pathways. Circulation 2004; 110: 317 – 323.

40. Farman N, Rafestin-Oblin ME. Multiple aspects of mineralocorticoid selectivity. Am J Physiol 2001; 280: F181 – F192.

41. Funder JW. Mineralocorticoids, glucocorticoids, receptors and response elements. Science 1993; 259: 1132 – 1133.

42. Wei Y, Dahl G, Werner R. The connexin43 gene is responsive to oestrogen. Proc R Soc Lond B 1994; 255: 125 – 132.

43. Okoshi MP, Yan X, Okoshi K, Nakayama M, Schuldt AJ, O’Connell TD, et al. Aldosterone directly stimulates cardiac myocyte hypertro-phy. J Card Fail 2004; 10: 511 – 518.

44. Polontchouk L, Ebelt B, Jackels M, Dhein S. Chronic effects of endo-thelin 1 and angiotensin II on gap junctions and intercellular commu-nication in cardiac cells. FASEB J 2002; 16: 87 – 89.

45. Funder JW. The nongenomic actions of aldosterone. Endocr Rev 2005; 26: 313 – 321.

46. Sheppard KE, Autelitano DJ. 11β-Hydroxysteroid dehydrogenase 1 transforms 11-dehydrocorticosterone into transcriptionally active glu-cocorticoid in neonatal rat heart. Endocrinology 2002; 143: 198 – 204.

47. Rousseau MF, Gurné O, Duprez D, Van Mieghem W, Robert A, Ahn S, et al. Beneficial neurohormonal profile of spironolactone in severe congestive heart failure: Results from the RALES neurohormonal substudy. J Am Coll Cardiol 2002; 40: 1596 – 1601.

48. Tomaselli GF, Marban E. Electrophysiological remodeling in hyper-trophy and heart failure. Cardiovasc Res 1999; 42: 270 – 283.

49. Bian W, Tung L. Structure-related initiation of reentry by rapid pacing in monolayers of cardiac cells. Circ Res 2006; 98: 29 – 38.

effects of aldosterone on cx43 gap junction expression in

Documents