ÊÊÊÊ 6 - mavo nvrc scientific program thursday, july 10, 2008 8:00–9:00 a.m. registration and...

Proceedings of the 2nd AnnuAl nAtionAl Viticulture reseArch conference

July 9–11, 2008

University of California, Davis

2008 NVRC SCIENTIFIC PROGRAM

Wednesday, July 9, 2008 8:00–9:00 a.m. Registration and Information Desk Open 8:00 Posters on display in Rumsey Rancheria Grand Lobby, Mondavi Center 9:00 Introductions and Acknowledgements Deborah A. Golino, UCCE Specialist, Department of Plant Pathology, UC Davis;

Director, Foundation Plant Services M. Andrew (Andy) Walker, Professor, Department of Viticulture and Enology, UC Davis Dean Neal VanAlfen, College of Agricultural and Environmental Sciences, UC Davis SESSION 1: MODERATED BY ANDY WALKER 9:20 Grapevine Fanleaf Virus, Tomato Ringspot Virus and Grapevine Rupestris Stem-

pitting-Associated Virus in Chardonnay with a Severe Vein-clearing Disease Wenping Qiu, Missouri State University 9:40 Occurrence of Two Distinct Molecular Variants of Grapevine Leafroll-Associated Virus-1 in the Pacific Northwest Vineyards Olufemi Alabi, Washington State University 10:00 Survey for the Three Major Leafroll Disease-Associated Viruses in Finger Lakes Vineyards in New York Marc Fuchs, Cornell University 10:20–10:45 Break SESSION 2: MODERATED BY MARC FUCHS 10:50 The Occurrence Of Grapevine Fanleaf Virus In Washington State Vineyards Tefera Mekuria, IAREC, Washington State University 11:10 Identifying Sources of Inoculum for Eutypa Dieback Infections in Vineyards Kendra Baumgartner, USDA-ARS, Department of Plant Pathology, UC Davis 11:30 Grapevine Nursery Practices and Petri Disease Doug Gubler, Department of Plant Pathology, UC Davis END OF MORNING SESSIONS 12:00–1:15 p.m. Lunch at Buehler Alumni & Visitors Center AGR Room (across the street from Mondavi Center Studio Theater)

SESSION 3: MODERATED BY DOUG GUBLER 1:20 Virus Effects on Vine Growth and Fruit Components of Three California ‘Heritage’ Clones of Cabernet Sauvignon Deborah Golino, Foundation Plant Services, UC Davis 1:40 Virus Effects on Vine Growth and Fruit Components of Cabernet Sauvignon on Six Rootstocks Sue Sim, Foundation Plant Services, UC Davis 2:00 An Update On Research On Grapevine Necrotic Union On 110R Rootstock Mysore Sudarshana, USDA-ARS, Department of Plant Pathology, UC Davis 2:20 Characterization of a New Ampelovirus Associated with Grapevine Leafroll Disease Adib Rowhani, Foundation Plant Services and Department of Plant Pathology, UC Davis 2:40 Real-time RT-PCR (TaqMan®) assays and Low Density Array Detection of Viruses Associated with Rugose Wood Complex of Grapevine Fatima Osman, Department of Plant Pathology, UC Davis 3:00–3:25 Break SESSION 4: MODERATED BY MARK BATTANY 3:30 Effectiveness of Preharvest Applications of Fungicides on Preharvest Bunch Rot and Postharvest Sour Rot of ‘Redglobe’ Grapes Jennifer Hashim-Buckey, University of California Cooperative Extension 3:50 Examining the Effects of Cold Therapy on Pierce’s Disease-Infected Grapevines and on the Viability of Xylella fastidiosa Cells in vitro Melody Meyer, Department of Plant Pathology, UC Davis 4:10 Effects of Long-Term Floor Management on the Bacteria and Nematode Communities in a Salinas Valley Vineyard Shane Parker, Department of Plant Pathology, UC Davis 4:30 Preharvest Fungicides to Control Postharvest Decay of Table Grapes in California’s San Joaquin Valley Joseph Smilanick, USDA-ARS, Parlier, CA END OF AFTERNOON SESSIONS


Thursday, July 10, 2008 8:00–9:00 a.m. Registration and Information Desk Open 8:00 Posters on display in Rumsey Rancheria Grand Lobby, Mondavi Center SESSION 1: MODERATED BY RHONDA SMITH 9:00 Identification of Critical Output Parameter for Grape based on Mathematical Principles Chandrasekhar Putcha, California State University, Fullerton 9:20 The Effect of Crop Load and Extended Ripening on Vine Balance and Wine Quality in Cabernet Sauvignon Carrie McDonnell, J.Lohr Vineyards and Wines, University of Adelaide 9:40 Utility of the American Viticultural Areas of Texas Information System (AVATXIS)

as a Tool in the Characterization of Texas Wine Regions Elvis Takow, Texas A&M University 10:00–10:35 Break SESSION 2: MODERATED BY ED HELLMAN 10:40 Impact of Soil Properties on Nutrient Availability and Fruit and Wine Characteristics in a Paso Robles Vineyard Jean-Jacques Lambert, Department of Viticulture and Enology, UC Davis 11:00 Understanding Extended Berry Maturation: Implications of Fruit Sugar Content on Aroma Precursors and Green Aromas in Red Wine Grapes Martin Mendez-Costabel, E&J Gallo 11:20 Comparison of Greenhouse Grown, Containerized Grapevine Stomatal Conductance Measurements using Two Differing Porometers Thayne Montague, Texas Tech University / Texas A&M University 11:40 Genetic and Phenotypic Resistance to Pierce’s Disease in Vitis arizonica/candicans Selections from Monterrey, Mexico Joshua Rubin, Department of Viticulture and Enology, UC Davis END OF MORNING SESSIONS 12:00–1:15 p.m. Lunch at Buehler Alumni & Visitors Center AGR Room (across the street from Mondavi Center Studio Theater)

2:00–3:00 Student Paper and Poster Judges Meeting – Mondavi Center Studio Theatre 3:00–4:00 NVRC Business Meeting— Mondavi Center Studio Theater

POSTER SESSION AND WINE RECEPTION

4:00–6:00 Jackson Hall lobby – Mondavi Center Authors of posters present

BBQ DINNER AND SOCIAL

7:00–11:00 Putah Creek Lodge (Map in Registration Packet) Announcement of Student Contest Winners


Friday, July 11, 2008 8:00–9:00 a.m. Registration and Information Desk Open 8:00 Posters on display in Rumsey Rancheria Grand Lobby, Mondavi Center SESSION 1: MODERATED BY PETER COUSINS 9:00 Transcriptomic and Metabolomic Analyses of Cabernet Sauvignon Grape Berry Development Grant Cramer, University of Nevada, Reno 9:20 Mapping the Dagger Nematode, Xiphinema index, Resistance Gene Chin-Feng Hwang, Department of Viticulture and Enology, UC Davis 9:40 Characterization and Identification of PD Resistance Mechanisms: Analyses of Xylem Anatomical Structures and Molecular Interactions of Host/Xylella fastidiosa Hong Lin, USDA-ARS, Parlier, CA 10:00–10:25 Break SESSION 2: MODERATED BY ANNE FENNEL 10:30 Systems Biology of the Grapevine Jerome Grimplet, South Dakota State University 10:50 Vitis Shoots Show Reversible Change in Leaf Shape along the Shoot Axis Peter Cousins, USDA-ARS, Geneva, NY 11:20 Hunt For Resistance Genes To Combat Pierce’s Disease In Grapevine Andy Walker, Department of Viticulture and Enology, UC Davis 11:40 Breeding Salinity Tolerant Grape Rootstocks Kevin Fort, Department of Viticulture and Enology, UC Davis 12:00–1:15 p.m. Lunch at Buehler Alumni & Visitors Center AGR Room (across the street from Mondavi Center Studio Theater)

i

July 9, 10 & 11, 2008Studio Theater

Robert and Margrit Mondavi Center for the Performing ArtsUniversity of California, DavisWebsite: http://ucanr.org/nvrc

Welcome to the Second Annual National Viticulture Research Conference

The National Viticulture Research Conference (NVRC) arose out of a desire to establish a national-level forum focused solely on viticulture research. The purpose of the conference is to provide public and private researchers, post-docs, scientific staff and students an opportunity to present their technical work during an intensive three-day program. The Proceedings contains the abstracts from their oral and poster presentations.

Talks for the scientific program will be generally grouped as follows:

Wednesday, July 9, 2008: Viticultural Pests and Diseases

Thursday, July 10, 2008: Cultural Practices and Grapevine Physiology

Friday, July 11, 2008: Grapevine Improvement and Evaluation

The poster session will be held on Thursday, July 10, 2008 at the Mondavi Center, UC Davis, from 4-6 pm. A wine tasting hosted by the Davis Enology and Viticulture Organization (D.E.V.O.) and appetizers are included. Later that night a BBQ dinner will be held at the Putah Creek Lodge, UC Davis, to allow attendees to have a chance to become acquainted, socialize and relax together.

The Organizing Committee looks forward to recognizing excellence in student scholarship. A committee of viticulture researchers will evaluate student oral and poster presentations and award prizes for three oral presentations and three poster presentations. In each of the two competition categories, the 1st place winners will receive $250, 2nd place winners will receive $150, and 3rd place winners will receive $50. All winners will receive free registration for the 2009 National Viticulture Research Conference. Student competition results will be announced and the recipients recognized at the conference dinner program on Thursday July 10, 2008.

Thank you for you interest and participation in the National Viticulture Research Conference. We wish you an enjoyable and educational experience!

ii

UC Davis is one of the nation’s top public research universities and is part of the world’s pre-eminent public university system. The campus is close to the state capital and San Francisco Bay Area. Information and maps are available on the NVRC web site at http://ucanr.org/nvrc. For additional information or questions about the conference, please contact:

NVRC Organizing CommitteeFoundation Plant ServicesUniversity of CaliforniaOne Shields AvenueDavis, CA 95616-8600

Phone: (530) 752-3590E-mail: [email protected]://ucanr.org/nvrc

2008 NVRC ORgaNiziNg COmmittee

COmmittee CO-ChaiRs:M. Andrew Walker, UC Davis Viticulture & Enology DepartmentDeborah A. Golino, UC Davis Plant Pathology Department and Director, Foundation

Plant Services, UC Davis

COmmittee membeRs:Kendra Baumgartner, USDA-ARS Plant Pathology, UC DavisPeter Cousins, USDA-ARS, Cornell University, Geneva, New YorkDoug Gubler, UC Davis Plant Pathology DepartmentClare M. Hasler, Executive Director, Robert Mondavi Institute for Wine & Food

Science, UC DavisEd Hellman, Texas A&M UniversityRhonda Smith, UC Cooperative Extension, Sonoma CountyKeith Streigler, University of Missouri - ColumbiaJames A. Wolpert, UC Davis Viticulture & Enology DepartmentFrank Zalom, UC Davis Entomology Department

iii

aCkNOwledgemeNts

The NVRC Organizing Committee is indebted to the many individuals and organizations that have contributed to the success of this conference. We are grateful to the researchers who have taken their time to share their knowledge with the rest of us, and to the staff of Foundation Plant Services at UC Davis for providing support. We would especially like to thank the following for their contributions:

Paraiso Vineyards, for providing financial support for the student oral and poster presentation competition. They donated the cash prizes awarded for the most outstanding student work.

Our appreciation to E&J Gallo Winery, and to J. Lohr Vineyards and Wines for their generous donation of wines for the poster reception and dinner.

We greatly appreciate the support of Dean Neal Van Alfen and the College of Agricultural and Environmental Sciences, UC Davis in helping make this conference a reality.

Proceedings of the 2nd Annual National Viticulture Research Conference • July 9–11, 2008 • University of California, Davis

1

Molecular Characterization of Californian Isolates of Grapevine Leafroll-Associated Viruses 7 (GLraV-7) and Development of

Detection Methods

Maher Alrwahnih, Fatima Osman and Adib Rowhani*

Department of Plant Pathology, University of California, Davis 95616. *Email address: [email protected].

Grapevine leafroll-associated viruses 7 (GLRaV-7) was first found in unidentified symptomless white-berried cultivar from Albania (Choueiri et al., 1996). The virus was partially characterized by Turturo et al. (2000), but the genomic sequence information was never released to the public. To date, knowledge of the GLRaV-7 genome sequence is restricted to a small portion of the heat shock protein homologue (HSP70h) gene. GLRaV-7 has a wide geographic distribution and has been reported in several countries including Armenia, Greece, Hungary, Egypt, Italy (Turturo et al., 2000, Avgelis and Boscia 2001) Turkey (Akbaş et al., 2007) and Palestine (Alkowni et al., 1997). GLRaV-7 was recently detected in symptomatic and asymptomatic grapevines collected from many Californian vineyards, including selections of Chardonnay, Merlot, Pinot Noir, and Sauvignon Blanc cultivars (Morales and Monis 2007). The GLRaV-7 Californian isolates show high variability (81 to 98%) when compared with the GLRaV-7 Italian isolates. In addition, all GLRaV-7 Californian isolates reported in that study showed low or no reactivity to GLRaV-7 specific antibodies (BIOREBA AG, Reinach, Switzerland).

Serological techniques have been developed to detect GLRaV-7 in grapevines (Choueiri et al., 1996 and Rigotti et al. 2006). Available GLRaV-7 antibodies produce high background signals and are characterized by low sensitivity, thus making them unsuitable for the routine detection of the virus. Up to date, the molecular detection of the virus is based on a set of RT-PCR primers designed in the replicase gene (RdRp) by Turturo et al. (2000) using the sequence of the GLRaV-7 Albanian isolate. The RdRp gene is considered of the most variable parts of any viral genome, hence explaining the limitation of these primers to detect all GLRaV-7 isolates. The primary objective of this study is to obtain more molecular data from the most conserved regions of the viral genome, mainly the coat protein (CP) and HSP70h in order to develop more sensitive detection tools (RT-PCR and TaqMan PCR) and accordingly investigate the spread of GLRaV-7 in California.

Materials and MethodsA total of nine isolates (6 from California, 2 from Afghanistan and 1 from Russia) were collected from USDA Clonal Clonal Germplasm Repository. All isolates were tested by ELISA using the two commercial kits available for the detection of GLRaV-7 (BIOREBA AG, Reinach, Switzerland and Agritest, Valenzano, Italy). Total nucleic acid (TNA) was isolated from cambial tissue of GLRaV-7 infected grapevines. This TNA was used as a template to synthesize complementary DNA (cDNA) with a random hexaprimer. Several sets of primers spanning the full CP and HSP70h genes were designed based on the sequence available from the Albanian isolate (Martelli G.P. personal communication). PCR was done using Phusion High Fidelity DNA polymerase (Finnzymes, Espoo Finland) per manufacturer’s instructions. Taq DNA polymerase was used to add (A) to the ends of synthesized cDNA (Zhang & Rowhani, 2000). The double stranded DNA was ligated into a pGM-T easy vector (Promega, Madison-USA) and the plasmids were transformed into Escherichia coli electro-competent cells. Specific PCR primers targeting the CP and HSP70h genes were designed after aligning the sequences obtained from the GenBank and the GLRaV-7 Albanian isolate. RT-PCR protocol was performed as described by Rowhani et al. (2000).

Two real-time RT-PCR (TaqMan®) assays were developed for the specific detection of GLRaV-7. To increase the reliability, we targeted the more conserved regions on the genome of the viruses in this study for designing specific primers and TaqMan® probes. A number of different isolates from diverse geographical


2

regions were selected for this experiment. The sequences from the conserved regions were piled up and primers and TaqMan® probes were designed from regions showing 100% consensus in both the CP and hHSP70 genes to ensure the detection of the majority of the virus isolates. Improving the RNA extraction technique and testing the quality of the RNA using the internal control, the 18S ribosomal RNA, in TaqMan® assay will validate the quality of the extracted RNA and increase the reliability of the assay.

ResultsAll of the GLRaV-7 isolates identified by RT-PCR in our viral collection tested negative by both commercial ELISA kits. Three to four clones form CP and HSP70 genes of each isolate wers sequenced and alinged with the previously available sequences (the GLRaV-7 Albanian isolate and two GLRaV-7 sequences in the gene bank, Accesion no. Y158999 and EF093187). Percent identities among nucleotide sequences ranged between 85-96 % in CP and 89-94% in HSP70. Evaluating the two TaqMan assays is currently in progress. The evaluation will be against virus isolates from different geographical regions and comparing their specificity and sensitivity.

References Akbaş B. Kunter B and Ilhan D. 2007. Occurrence and Distribution of Grapevine Leafroll associated Viruses

1, 2, 3 and 7 in Turkey. Journal of Phytopathology. Volume 155, 122-124.Alkowni R., M.A. Castellano, M. Digiaro, G. Bottalico and G.P. Martelli, 1997. A survey of grapevine virus

diseases in Palestine. In: Extended Abstracts 12th Meeting ICVG, September 29–October 2, 1997, Lisbon, Portugal, 111–112.

Avgelis A. and Boscia D. 2001. Grapevine leafroll associated closterovirus 7 in Greece. Phytopathol. Mediterr. 40, 289-292.

Choueiri E., D. Boscia, M. Digiaro, M.A. Castellano and G.P. Martelli, 1996. Some properties of a hitherto undescribed filamentous virus of the grapevine. Vitis 35, 91–93.

Morales R. Z. and Monis J. 2007. First Detection of Grapevine leafroll associated virus-7 in California Vineyards., Plant Disease. 91, 465.

Rowhani, A., Biardi, L., Johnson, R., Saldarelli, P., Zhang, Y.P., Chin, J. and Green, M. 2000. Simplified sample preparation method and one-tube RT-PCR for grapevine viruses. In: Proceedings of XIII International Council for the Study of Viruses and Virus-Like Diseases of the Grapevine, Adelaide 2000, pp. 82.

Rigotti S. Bittterlin W. and Gugerli P. 2006. Production of monoclonal antibodies to grapevine leafroll associated virus7 (GLRaV-7). Extended Abstracts 13th Meeting ICVG, Stellenbosch, South Africa, 200-201. 200-201.

Turturo C. Rott M.E. Minafra A. Saldarelli P. Jelkmann W. And Martelli G.P. 2000. Partial molecular characterization and RT-PCR detection of grapevine leafroll associated virus 7. Extended Abstracts 13th Meeting ICVG, Adelaide, Australia, 17-18.

Zhang Y.P., Rowhani A. 2000. A strategy for rapid cDNA cloning from double-stranded RNA templates isolated from plants infected with RNA viruses by using Taq DNA polymerase. Journal of Virological Methods 84: 59-63.


3

Effects of Abscisic Acid on Phenolic Composition of Cabernet Sauvignon and Merlot Wine Grapes

Mauri Anderson1, Matthew Fidelibus1, Oren Kaye2, Steve Kupina2, and Andrew Waterhouse1**Corresponding Author

1Department of Viticulture and Enology, University of California, Davis 2Constellation Wines US, Madera, California

The objectives of this study were to examine the effect abscisic acid (ABA) applications had on berry and wine phenolic development and color. Treatments varied both in timing and concentration of ABA and were applied to two cultivars. Abscisic acid was applied at two concentrations (200 and 400 mg l -1) and at two phenologically based events (veraison and four weeks post veraison) to Cabernet Sauvignon and Merlot in Madera County during the 2007 growing season. Effects of the treatments on dermal phenolic content were evaluated at two week intervals throughout the ripening period until harvest.

Increases in several phenolic compounds were seen in both cultivars following ABA applications. These responses were influenced both by timing and concentration. Veraison application of ABA to Cabernet Sauvignon fruit at both 200 and 400 mg l -1 resulted in significant increases of several phenolic components including flavon-3-ols and flavones, as well as color density, hue and visible color at harvest, when compared to control fruit. These effects were first seen as early as two weeks following treatment and exhibited a positive dose-response. Similar, but reduced, compositional changes were seen following the post veraison application. Application of ABA to Merlot showed mixed results. Wine produced from ABA treated grapes showed increases in color and certain phenolic components.


4

A Practical Method for Counting Berries based on Image Analysis

Mark BattanyUC Cooperative Extension; 2156 Sierra Way, Suite C; San Luis Obispo, CA 93401

The most accurate crop estimates in machine-pruned vineyards are based on measurements of average berry weights during the season, rather than cluster weights as is commonly done in hand-pruned vineyards (Pool et al., 1996). As machine pruning becomes more popular, methods for crop estimation methods will need to improve, in particular methods for counting berries.Currently the only feasible way to count berries is to do so manually. Manual counting may be practical if the number of clusters to be counted is not large, but if a significant amount of counting needs to be done, the manual method quickly becomes extremely tedious, inefficient, and very often inaccurate.

This work demonstrates a novel method of using a common flatbed scanner to take an image of a sample of loose grape berries, and subsequently counting the imaged berries with a software program. The advantage of this method is that it offers a much quicker and more reliable count of large numbers of berries; this should make it particularly attractive for both researchers and vineyard managers who require significant amounts of berry counts to be made.

Materials and MethodsAll scanning was done with a Canon scanner, model “Canoscan LiDe 90”, set to scan in grayscale mode with a 200 dpi resolution, with the output saved as JPEG images. A separate glass berry tray was made by gluing ½” aluminum angle stock around the edges of an 8 ½” x 12” rectangular piece of 1/8” thick window glass, forming a flat, clear-bottomed tray with raised edges. The loose berries were then placed onto this glass tray, and the tray placed directly onto the platen (clear surface) of the scanner. The underside of the berry tray which was directly beneath the aluminum edges was covered with a ¾” wide strip of black electrical tape, to prevent any light-colored aluminum from showing up in the scanned image. The top of the scanning tray was covered with dark-colored cardstock during scanning, in the same way as the normal scanner lid is used.

Eight clusters containing small pea-sized berries were removed from a local Pinot Noir vineyard on June 2, 2008. A sample of 250 random berries was removed from these clusters and used for testing.

To determine the accuracy of the counting method, all 250 berries were placed onto the glass berry tray and scanned. The glass tray was then lifted off of the scanner and shaken to move all berries, and then replaced and the image was scanned again. This process was repeated a total of five times, producing the initial grayscale images (Fig. 1).

The grayscale images were then opened with the ImageJ® image analysis program, and converted to binary black/white images. The binary images were then processed with the “Watershed” command, which divided any berries which were adjoining in the image (Fig. 2). Lastly, using the “Analyze Particles” function, the software counted the individual berries; a threshold particle size was set, to avoid errors due to counting of any small bits of debris in the image.

To test the ability of the method to measure berry size (cross sectional area), five groups of 20 berries were selected. The length and width of each berry was measured manually using hand calipers, and the cross sectional area of each berry was then calculated assuming an oval cross section. Each group of 20 berries was then placed in a single line on the scanning tray and processed following the method described earlier, the only difference being that when the “Analyze Particles” function was used, that an option which listed the area for each measured particle was also enabled.

Results and DiscussionThe method proved to be completely accurate in counting the 250 berries; each analysis produced the same count of 250. This accuracy of counting immature berries matched the same accuracy seen in earlier tests with dried beans and fresh peas, before actual berries were available.


5

The correlation between the measured berry cross-sectional area and the area based on the image analysis was less accurate, with an r^2 value of 0.67, and a slight tendency for underestimation. This low correlation is likely due to the edges of the berries being out of focus in the images, because they are relatively farther away from the platen surface. This limits the use of the method for estimating absolute cross-sectional areas accurately for spherical objects such as berries, but it does not appear to be a limitation for counting particles.

Overall, the method is much faster than manual hand counting for large numbers of berries. A significant advantage of this method over other potential counting devices is that it is very inexpensive to implement; a new scanner can be purchased for less than $100, and the image analysis software is available at no cost from the NIH website (http://rsb.info.nih.gov/ij/). The simple glass berry tray was built for less than $10 in materials. A person proficient with the method can comfortably and accurately count a sample of loose berries in much less time than is required for manual counting.

ReferencesPool, R. M., R. M. Dunst, et al. Predicting and controlling crop of machine and minimal pruned

grapevines. In: Proc. 2nd N.J. Shaulis Grape Symposium, Fredonia, NY. pp 31-45 (1993).

Figure 1. One of the raw scanned images; a black background is used with the scanner so that the green immature berries stand out distinctly. If scanning of mature, dark-colored berries is to be done, then the background should be changed to the standard white color.

Figure 2. The raw image converted to a binary black/white image in the ImageJ® program. Any small specks of debris are ignored in the count by setting a minimum threshold size of particle to be considered in the count.

y = 0.8134x + 5.7299R2 = 0.67

30

35

40

45

50

55

60

65

70

30 35 40 45 50 55 60 65 70

Cross-sectional area per berry, determined from caliper measurements (mm^2)

Cross-sectional area per berry,

determined from ImageJ output

(mm^2)

Figure 3. Correlation between the manually measured berry cross sectional area and the area estimated from image analysis.


6

Identifying Sources of Inoculum for Eutypa Dieback Infections in Vineyards

Kendra Baumgartner*1, Sarah E. Bergemann2, Phillip Fujiyoshi3, Philippe E. Rolshausen4, and W. Douglas Gubler5

1USDA-ARS, 363 Hutchison Hall, University of California, One Shields Avenue, Davis, CA 95616, USA, email: [email protected]

2Middle Tennessee State University, Biology Department, PO Box 60, Murfreesboro, TN 37132, USA3USDA-ARS, 363 Hutchison Hall, University of California, One Shields Avenue, Davis, CA 95616, USA

4Department of Plant Science, University of Connecticut, Storrs, CT, 06269, USA5Department of Plant Pathology, University of California, One Shields Avenue, Davis, CA 95616, USA

The means of spread of Eutypa dieback from vine-to-vine within vineyards is likely due to dispersal of sexual spores (ascospores) of the causal fungus, Eutypa lata, based on evidence of distributions of vegetative compatibility groups, reproductive structures (perithecia), and symptoms (2, 6). Asexual spores (conidia) are produced in nature, but are not infectious. Ascospores are released from perithecia following rain and are wind-dispersed. They infect grapevine vascular tissue by colonizing susceptible wounds (e.g., pruning wounds, freeze-damaged tissue).

Although it seems clear that ascospores initiate infections of vines, the origin of ascospores that initiate the first infections in a healthy vineyard is not clear. Possible sources include distant vineyards (8), forest trees (10), or apricot orchards (3). To evaluate the relatedness of E. lata populations from vineyards, forests, and apricot orchards, we isolated and characterized nine E. lata-specific microsatellite markers. As numerous Eutypa species infect grapevines, forest trees, and apricots, we also evaluated our markers for E. armeniacae, E. laevata, E. leptoplaca, and E. petrakii var. petrakii. These closely related species are not distinguishable from E. lata in culture, and it is, therefore, critical to ensure that markers will not inadvertently amplify isolates of different species.

Materials and MethodsGenomic DNA was extracted from an isolate of E. lata from Switzerland [isolate 208.87; Centraalbureau voor Schimmelcultures (CBS), Utrecht, The Netherlands], purified (GENECLEAN III Kit, MP Biomedicals, Solon, OH), digested with TaqαI (New England BioLabs, Ipswich, MA), and enriched for both a trinucleotide, CAC10, and a tetranucleotide mixture (AAAC6, AAAG6, AAAT8, AGAT8; Integrated DNA Technologies, Coralville, IL). Digested DNA was ligated to linker oligonucleotides 20B (5’-GCG GTT CCC GGT CGA GTT GG-3’) and 22B (5’-pCGC CAA CTC GAC CGG GAA CCG C-3’) (5), and the resulting linker-ligated DNA was used as template for pre-enrichment using the polymerase chain reaction (PCR) (GeneAmp PCR System 9700, Applied Biosystems, Foster City, CA) (4). Linker-ligated restriction fragments enriched with microsatellites were captured onto Streptavidin Dynabeads M-280 (Dynal Biotech, Oslo, Norway). Captured DNA fragments were eluted from the Dynabeads, amplified by PCR, purified, then rehybridized with the biotinylated oligonucleotides in a repeated (serial) enrichment reaction. PCR products from the second enrichment were purified, cloned (TOPO TA 2.1 Cloning Kit, Invitrogen, Carlsbad, CA), and screened for positive inserts. Ninety-six positive colonies were amplified from fragments enriched for CAC10 and 96 for the tetranucleotide mixture, and sequenced (BigDye Terminator version 3.1 Cycle Sequencing Kit, ABI 3100, Applied Biosystems). Sequences were screened for microsatellite repeats and 24 primer pairs were designed (Primer3 v.0.4.0; 11).

The 24 primer pairs were first used to screen for allelic variation with genomic DNA from a small subset of haploid isolates of E. lata: two from California (isolates CS2 and CS16, (9) and one from Italy (isolate MD1, Instituto di Pathologia Vegetale, Milan, Italy). PCR was performed in multiplex or simplex reactions, using a ‘touchdown’ protocol (1). PCR fragment sizes were analyzed with the ABI 3100 (Applied Biosystems) and sized with the ROX-500 size standard after excluding the 250 bp standard (GeneScan v. 3.7, Applied Biosystems).


7

Of the 24 primer pairs, nine gave consistent PCR amplicons for all three isolates of E. lata. The nine primer pairs were then used to screen for polymorphisms on genomic DNA from a set of 48 isolates representing two populations (24 isolates per population), which were collected from 24 symptomatic grapevines in each of two northern California vineyards located 50 km apart. Genepop on the web (available at http://genepop.curtin.edu.au/) was used to calculate the number of alleles and to test for linkage disequilibrium (LD) within populations, using the Markov chain parameters. Genalex 6 (7) was used to estimate the haploid gene diversity. In addition, the nine primer pairs were tested on the following related taxa (CBS identification numbers in parentheses): E. armeniacae (622.84), E. laevata (291.87), E. leptoplaca (286.87), and E. petrakii var. petrakii (245.87).

Results and DiscussionAll nine primer pairs were found to be polymorphic. The loci examined revealed high allelic variation, having the total number of alleles ranging from two to 11 alleles per locus. Haploid gene diversity ranged from 0.33 to 0.83 per locus (mean for Population 1 = 0.53, Population 2 = 0.54). Genotypic diversity was high within the two populations, with each sample comprising a unique genotype, which is consistent with ascospore infection and not conidia infection. Significant pairwise linkage disequilibrium (LD) was detected in two loci (B11 and G09 across both populations; P = 0.046). The absence of LD at eight of the nine loci and our finding of high genotypic diversity suggests that recombination via outcrossing comprises a significant contribution to the population structure of E. lata. The nine primer combinations gave negative and/or consistent amplicons of the closely-related species, E. armeniaceae, E. laevata, E. leptoplaca, and E. petrakii var. petrakii. These nine polymorphic microsatellite loci, therefore, appear be a suitable tool for studies of fine-scale, spatial population structure and distribution, for estimating dispersal distances, and for identification of siblings. In addition, it should be possible to identify the possible sources of initial source infections from local and distant forests, vineyards, and apricot orchards.

ReferencesBergemann, S. E., Miller, S. L., and Garbelotto, M. 2005. Microsatellite loci from Russula brevipes, a

common ectomycorrhizal associate of several tree species in North America. Molecular Ecology Notes 5:472-474.

Cortesi, P., and Milgroom, M. G. 2001. Outcrossing and diversity of vegetative compatibility types in populations of Eutypa lata from grapevines. Journal of Plant Pathology 83:79-86.

DeScenzo, R. A., Engel, S. R., Gomez, G., Jackson, E. L., Munkvold, G. P., Weller, J., and Irelan, N. A. 1999. Genetic analysis of Eutypa strains from California supports the presence of two pathogenic species. Phytopathology 89:884-893.

Glenn, T. C., and Schable, N. A. 2005. Isolating microsatellite DNA loci. Methods in Enzymology 395:202-222.

Kretzer, A. M., Molina, R., and Spatafora, J. W. 2000. Microsatellite markers for the ectomycorrhizal basidiomycete Rhizopogon vinicolor. Mol Ecol 9:1190-1191.

Munkvold, G. P., Duthie, J. A., and Marois, J. J. 1993. Spatial patterns of grapevines with Eutypa dieback in vineyards with or without perithecia. Phytopathology 83:1440-1448.

Peakall, R., and Smouse, P. E. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6:288-295.

Peros, J.-P., and Berger, G. 2003. Genetic structure and aggressiveness in European and Australian populations of the grapevine dieback fungus, Eutypa lata. Eur J Pl Pathol 109:909-919.

Rolshausen, P. E., Greve, L. C., Labavitch, J. M., Mahoney, N. E., Molyneux, R. J., and Gubler, W. D. 2008. Pathogenesis of Eutypa lata in grapevine: Identification of virulence factors and biochemical characterization of cordon dieback. Phytopathology 98:222-229.

Rolshausen, P. E., Mahoney, N. E., Molyneux, R. J., and Gubler, W. D. 2006. A reassessment of the species concept in Eutypa lata, the causal agent of Eutypa dieback of grapevine. Phytopathology 96:369-377.

Rozen, S., and Skaletsky, H. J. 2000. Primer3 on the WWW for general users and for biologist programmers. Pages 365-386 in: Bioinformatics Methods and Protocols: Methods in Molecular Biology, S. Krawetz and S. Misener, eds. Humana Press, Totowa, NJ.


8

Use of Genetic Markers to Assess Pedigrees of Grape Cultivars and Breeding Program Selections

John Bautista1, Gerald S. Dangl2, Judy Yang1, Bruce Reisch3, and Ed Stover4

1 Laboratory Assistant, 4Curator & Research Leader, USDA, ARS National Clonal Germplasm Repository One Shields Ave., University of California, Davis, CA 95616, U.S.A.

2 Manager, Plant Identification Lab, Foundation Plant Services One Shields Ave., University of California, Davis, CA 95616, U.S.A.

3 Professor, Department of Horticultural Sciences, Cornell University New York State Agricultural Experiment Station, Geneva, New York 14456

In a grape breeding program, it is necessary to keep accurate records of pedigrees. Occasionally, breed-er’s record can contain mistakes. Using genetic markers, “DNA Fingerprinting”, it is possible to identify and confirm parent progeny relationships. In this project, Simple Sequence Repeat (SSR) markers are used to confirm or correct pedigrees for grape varieties from the Cornell breeding program. As expected, most (20 of 24) reported pedigrees were confirmed.

Keeping accurate records can allow plant breeders to continue breeding grapes with desired traits. Since 1906 Cornell University has named and released 56 grape cultivars. Many of these cultivars have been selected for cold-tolerance, often times fungal disease-resistance, and high fruit quality. Like all plant breeding programs, many previously selected cultivars are used again as parents to create a new variety. An example is Emerald Seedless, a selection made by Dr. Harold Olmo from a cross of Emperor and Sultana Moscato. Emerald Seedless was later used as a parent, crossed with Athens, to obtain the new variety Marquis (Figure 1).

Tests were performed on DNA extracted from dried young leaves using a DNeasy Plant Mini Kit (Quigen, Valencia, California, USA) following the manufacturer’s protocol. PCR amplifications were performed fol-lowing typical protocols (Dangl et al. 2005). Each sample was analyzed with a set of eight markers which included the international six SSR marker set (This et al., 2004). An additional seven loci were used for specific samples to confirm unexpected results (Table 1). Forward primers were labeled with one of three fluorescent dyes. Fragment amplifications were verified on 2% agarose gel. Samples are run in multiplex-es on a capillary electrophoresis on an ABI Prism 3100 Genetic Analyzer.

As expected, most (20 of 24) reported pedigrees were confirmed. Analysis of three pedigrees, Groups A, B, and C showed a heritable null allele in Ontario at VVMD25 (Table 1). Russian Seedless is a synonym for Black Kishmish (Dangl et al. 2001) and has been used, inappropriately, as a synonym for Black Mo-nukka. Russian Seedless was reported to be a parent of both Glenora and Suffolk Red (Groups A and D, Table 1). In both of the original publications (Einset, 1973; Pool et al., 1977), the Russian Seedless parent was described as “probably” being Black Monukka. This study shows only Black Kishmish, not Black Mo-nukka, produced SSR fingerprints consistent with parentage of Glenora and Suffolk Red.

Alden (Group C) is reported to be from a cross of Ontario and Gros Guillaume. As Gros Guillaume is not available, Ribier, a suspected synonym, was tested. The results confirm the pedigree and the synonymy. The tetraploid nature of the seedless table grape selection NY 88.0515.01 and its two reported parents is clearly illustrated by this analysis (Group E). Group F is an example pedigree for which one of the reported parents is no longer available; the associate grandparents were assessed to support the reported pedigrees.

We tested several accessions of Vignoles (Ravat 51), an important parent in the Cornell grape breeding program. They were found to be identical and the data were consistent with Vignoles being a parent of a particular selection (data not shown). However, this study shows neither of the reported parents of Vi-gnoles (Seibel 6905 x Pinot de Corton, a clone of Pinot noir) could be a parent of Vignoles (Group G). To the best of our knowledge, the two parents are correctly identified; therefore, it may be possible the tested Vignoles may not be Ravat’s actual selection 51.


9

This study shows SSR markers are a powerful tool for confirming and correcting pedigrees of grape breeding programs. This study also provides some specific, valuable information to future grape breeding efforts. In some cases scoring heritable null alleles was necessary to confirm pedigrees. We also demon-strated the use of “grand parents” to confirm a pedigree when one reported parent is no longer available for analysis.

Figure 1:

OLMO CROSS

EMPEROR X SULTANA MOSCATA

↓OLMO

SELECTIONEMERALD

SEEDLESSX ATHENS CORNELL

CROSS↓

MARQUISCORNELL

SELECTION

Intersection of UC Davis and Cornell breeding program, two generations.

Table 1:

Accession VVMD5a

V V M D 7 a

V V M D 2 7a

V V M D 3 1 V V M D 3 2 V V S 2 a V r Z A G 6 2a

V r Z A G 7 9a

V V M D 2 1

V V M D 2 8

V V M D 3 4 V V M D 6

V V M D 2 5

V V M D 3 6

V r Z A G 9 3

A Ontario 238:238 235:247 185:185 204:216 241:251 123:125 203:205 247:265 241:249 229:233 240:242 205:205 244:null 264:295 189:189Glenora 234:238 235:253 185:194 212:216 251:251 125:151 189:203 251:265 249:256 221:229 240:240 205:214 253:null 250:296 189:215Black Kishmish 234:234 249:253 181:194 196:212 251:251 151:155 189:203 247:251 249:256 221:249 240:240 214:214 249:253 244:250 189:215Black Monukkac 234:240 253:253 181:194 212:212 251:257 141:151 189:189 247:257 249:249 221:247 240:248 212:214 253:259 250:268 189:199

Conclusion: Markers consistent with O ntario x Black Kishmish as parents for Glenora, scoring null alle le from O ntario at VVMD25B Ontario 238:238 235:247 185:185 204:216 241:251 123:125 203:205 247:265 241:249 229:233 240:242 205:205 244:null 264:295 189:189

Himrod 234:238 239:247 185:194 212:216 251:251 125:151 189:205 259:265 241:249 221:229 240:248 205:214 253:null 268:295 189:199Thompson Seedless234:234 239:253 181:194 212:212 251:251 145:151 189:189 247:259 249:256 221:247 240:248 212:214 243:253 250:268 189:199

Conclusion: Markers consistent with O ntario x Thompson Seedless as parents for Himrod, scoring null alle le from O ntario at VVMD25C Ontario 238:238 235:247 185:185 204:216 241:251 123:125 203:205 247:265 241:249 229:233 240:242 205:205 244:null 264:295 189:189

Alden 238:238 235:249 185:185 204:216 241:273 123:135 187:203 239:265 249:249 233:247 240:248 205:214 259:null 254:264 189:215Ribier 226:238 249:255 185:185 210:216 253:273 133:135 187:205 239:251 249:249 247:247 240:248 194:214 243:259 254:264 189:215

D Fredonia 236:290 235:235 183:185 204:204 251:273 125:125 203:203 247:259 249:249 229:247 240:248 212:null 247:247 264:270 187:189Suffolk Red 234:236 235:253 181:185 204:212 251:273 125:155 189:203 247:259 249:256 229:249 240:240 214:null 247:249 244:270 187:189Black Kishmish 234:234 249:253 181:194 196:212 251:251 151:155 189:203 247:247 249:256 221:249 240:240 214:214 249:253 244:250 189:215Black Monukkac 234:240 253:253 181:194 212:212 251:257 141:151 189:189 247:257 249:249 221:247 240:248 212:214 253:259 250:268 189:199

E Niabell 236:236 241:247 179:185 204:212 241:249:273 123:133 203:205:207 237:247NY 88.0515.01 234:236:238 239:241 179:185:194 204:212 249:251:273 123:125:151 189:203 237:247:259:265Himrod 4X 234:238 239:247 185:194 212:216 251:251 125:151 189:205 259:265

Conclusion: Markers consistent with Niabell x Himrod 4X as parents for NY 88.0515.01, note that all members of this group are tetraploid F Seyval 226:252 237:243 189:189 212:220 251:273 133:133 181:189 259:261

Melody 238:252 235:243 185:189 204:220 241:273 133:137 189:203 247:261Ontariob 238:238 235:247 185:185 204:216 241:251 123:125 203:205 247:265Pinot noirb 228:238 239:243 185:189 216:216 241:273 137:151 189:195 239:245

Conclusion: Markers consistent with Seyval x GW5 as parents for Melody, using O ntario and Pinot Noir as parents of GW5G Pinot noirc 228:238 239:243 185:189 216:216 241:273 137:151 189:195 239:245 249:249 221:239 240:240 205:205 243:253 254:254 189:189

Vignoles 226:244 239:251 185:194 212:214 251:251 125:149 189:195 251:259 243:249 241:263 240:242 212:219 253:259 240:270 189:199Seibel 6905c 226:236 237:243 181:189 212:212 241:273 143:145 181:189 243:261 229:249 239:261 240:243 211:219 245:259 264:270 209:209

Conclusion: Markers exclude both Pinot noir and Seibel 6905 as parents for Vignoles, though these are the reported parentsaS ix int e r na t io na l r e f e r e nc e m a r k e r s. bGr a ndpa r e nt s use d inst e a d o f pa r e nt s. cC ult iv a r s e xc lude d a s pa r e nt s.

Conclusion: Black Monukka not Suffolk Red parent. Markers consistent with Fredonia x Black Kishmish as parents for Suffolk Red with null alle le at VVMD6

SSR marker analysis at loci designated in first row of table. Allele sizes (in base pairs) for grape releases and selections addressed in this study are arranged in parent/progeny groups, with the putative offspring in the middle. SSR alleles display typically Mendelian segregation, with alleles at each locus contributed by parents, permitting assessment of parent/progeny relationship..

Conclusion: Markers consistent with O ntario x Ribier as parents for Alden, scoring null alle le from O ntario at VVMD25, is Ribier synonym for Grosse Guillaume

ReferencesDangl, G.S., K. Woeste, M.K. Aradhya, A. Koehmstedt, C. Simon, D. Potter, C.A. Leslie and G.

McGranahan. 2005. Characterization of fourteen microsatellite markers for genetic analysis and cultivar identification of walnut. J. Amer. Soc. Hort. Sci. 130: 348-354.

Dangl, G.S., M.L. Mendum, B.H. Prins, M.A. Walker, C.P. Meredith, and C.J. Simon. 2001. Simple sequence repeat analysis of a clonally propagated species: a tool for managing a grape germplasm collection. Genome 44:432-438.

Einset, J. 1973. ‘Lakemont’, ‘Suffolk Red’ and ‘Cayuga White’, new grapes from New York. Fruit Varieties J. 27:12-15.

Pool, R.M., J.P. Watson, K.H. Kimball, and J. Einset. 1977. Canadice and Glenora seedless grapes named. N.Y. Food and Life Sci. Bul. 68. NYS Agric. Exp. Sta., Geneva, New York

This P., A. Jung, P. Boccacci, J. Borrego, R. Botta, L. Costantini, M. Crespan, G.S. Dangl, C. Eisenheld, F. Ferreira-Monteiro, S. Grando, J. Ibáñez, T. Lacombe, V. Laucou, M. Magalhães, C.P. Meredith, N. Milani, E. Peterlunger, F. Regner, L. Zulini, and E. Dettweiler. 2004. Development of a standard set of microsatellite reference alleles for identification of grape cultivars. Theor. Appl. Genet. 109: 1448-1458.


10

2008 Grape Bud Survival on Eight Winegrape Cultivars in Vermont

Lorraine P. Berkett*, Terence L. Bradshaw, Sarah L. Kingsley-Richards, and Morgan L. CromwellDepartment of Plant and Soil Science, University of Vermont, Burlington, VT 05405, USA

*email: [email protected]

Cold climate winegrape production is an emerging “new” crop in the diversification of agriculture in Vermont and northern New England offering significant value-added and agri-tourism economic opportunities. Before the availability of cold climate winegrape varieties, commercial grape production was not recommended in northern New England because of problems with winter survival of the vines. More than 75% of Vermont has an average minimum cold temperature below -290C and in the remainder of the state, the average minimum cold temperature is between -260C to -290C (Perry, 2003). In Burlington, VT, the lowest winter temperature can fall between -280C to –340C (NOAA, 2008). Vermont’s low winter temperatures are well below the temperature tolerated by many winegrape cultivars (Pool, 1999; Bordelon et al., 1997).

What is allowing the rapid development of Vermont’s winegrape industry? Cold climate winegrape cultivars developed by the University of Minnesota grape breeding program and Elmer Swenson, a private breeder, are now available commercially. These winegrape cultivars survive -340C to -370C winter temperatures (Univ. of MN, 2008) and are being planted in Vermont on newly created farms or as an alternative crop on existing farms, such as dairy farms. It is estimated that winegrape acreage has increased in Vermont from approximately 12 hectares in 2004, to 32 hectares in 2007, and it is projected that the total acreage planted to cold climate winegrapes will more than double again during the next two years and continue to increase (Vermont grape growers, pers. comm.). Presently, there are eight bonded wineries in the state and approximately 20 vineyards. In the region, Vermont grape growers have become the “early adopters,” the leaders and pioneers of the emerging cold climate grape industry to whom prospective growers from other states are contacting for information, insights, and advice.

A crucial decision for Vermont grape growers is selecting what winegrape cultivars to plant from the wide selection of cold climate winegrape cultivars that are now commercially available. Currently, research-generated, science-based information is non-existent on which cultivars will not only consistently survive Vermont’s winters, but which cultivars are least vulnerable to spring frosts, and which will consistently ripen within Vermont’s relatively short growing season. Accordingly, Vermont research is focused on this critical research need.

A research vineyard to evaluate cultivar performance was planted at the University of Vermont Horticultural Research Center, South Burlington, on April 26, 2007, with winegrape cultivars considered to be the most “promising” based on the experience and insights of current Vermont grape growers. A randomized complete block experimental design of six blocks with four-vine plots of each cultivar per block was used to plant the following eight winegrape cultivars: ‘Frontenac’, ‘LaCrescent’, ‘St. Croix’, ‘Marquette’, ‘Prairie Star’, ‘Corot Noir’, ‘Vignoles’, and ‘Traminette’. The vines were planted 1.8 m apart within each row and there are 3.0 m between rows. The vines will be trained to a high-wire cordon system. The soil is a well-drained Windsor loamy sand; drip irrigation was installed. This research vineyard is part of the multi-state research project: NE-1020 Multi-state Evaluation of Winegrape Cultivars and Clones. It represents the coldest winter and coolest growing season conditions of any of the NE-1020 sites in the East. Environmental conditions including ambient air temperature were monitored with an on-site Davis Vantage Pro Wireless Weather Station (Davis Instruments Corp., 3465 Diablo Ave., Hayward, California 94545 USA) and daily snow depth measurements were obtained from the local NOAA weather station (Burlington, VT) (NOAA, 2008). Bud survival was assessed on May 1, 2008, by determining the percentage of 10 basal nodes with live buds on one cane per vine (Bordelon et. al., 1997).


11

Figure 1 represents a preliminary summary of the percentage of live buds on the basal 10 nodes of each winegrape cultivar. ‘Traminette’, ‘Corot Noir’, and ‘Vignoles’ had, numerically, the lowest percentage of live buds. Of the MN/Swenson cultivars, it appeared that ‘LaCrescent’ and ‘Prairie Star’ had the highest survival rate. Further analysis will reveal if these differences are statistically significant. It should be noted that the coldest winter temperature at the site occurred on February 29, when the temperature reached -230C. At that time, there were approximately 25 cm of snow cover. In general, the winter was not unusually cold with varying depth of snow cover present for most of the winter. There were a few “thaws” when temperatures rose to 110C, 180C, and 130C in December, January, and February, respectively, which may have affected cold hardiness. This is a long-term research project and evaluation of bud survival will continue as the vines mature.

University of Vermont VineyardSouth Burlington

Avg. Percent Live Buds at Ten Basal Nodes May 1, 2008

0%10%20%30%40%50%60%70%80%90%

100%

.'Tram

inette'

.'Coro

t Noir

'

.'Vign

oles'

.'Fron

tenac

'

.'Marqu

ette'

.'St C

roix'

.'Prai

rie S

tar'

.'LaC

resce

nt'

Figure 1. Preliminary summary of the average percent of live buds at the ten basal nodes for each winegrape cultivar.

References:Bordelon, B. P., Ferree D. C. and T. J. Zabadal. 1997. Grape bud survival in the Midwest following the

winter of 1993-1994. Fruit Varieties Journal 51(1):53-59. NOAA, 2008. National Weather Service. http://www.weather.gov/climate/xmacis.php?wfo=btvPerry. L. 2003. Vermont Hardiness Map. University of Vermont Extension. http://www.uvm.edu/pss/ppp/

pubs/oh53.htmPool, B. 1999. Factors affecting vineyard site suitability in cold climates such as found in New York State.

In-depth Fruit School and 28th Annual New York Wine Industry Workshop. March 22-24. Geneva, NYUniversity of Minnesota. 2008. Cold Hardy Grapes. http://www.grapes.umn.edu/


12

Evaluation of Syrah Clonal Selections in the Salinas Valley

Larry BettigaUniversity of California Cooperative Extension, 1432 Abbott Street, Salinas, CA 93901, USA

Fax: 831-758-3018; e-mail [email protected]

Seven clonal selections of Syrah were evaluated for viticultural performance for four years (2004-2007). Syrah FPS 7 (reported to be 877); ENTAV selections 174, 383, 470, and 525; 99 (Tablas Creek A); and

Shiraz FPS 7 were field budded onto SO4 rootstock planted in 2001 at a vineyard site southwest of Soledad (Arroyo Seco appellation). Vines were planted at a row and vine spacing of 2.4 x 1.5 m, trained

as unilateral cordons and spur pruned on a vertical shoot positioned trellis.

Significant differences have been observed in the yield response, with a range of 1.75 kg/vine from high to low yielding selections. Syrah selections separated into four groups with 99 being the highest yielding, ENTAV 383 and 525 being similar, then ENTAV 174 and FPS 7, and the lowest yielding group was ENTAV 470 and Shiraz 7. Higher cluster weights were the factor most influencing crop yield. Either more berries per cluster or greater berry weight increased cluster weight.

Pruning weights had a range of 0.57 kg/vine from high to low weights. FPS 7 and ENTAV 470 had higher pruning weight and ENTAV 525 had the lowest, the remaining selections were intermediate between the high and low groups. Yield: pruning weight ratios were higher for the more productive selections. They ranged from 3.9 (99) to 1.7 (FPS 7). The lower yielding selections tended to have higher Brix.

Tasting panels were not able to significantly separate the wines made in 2005 and 2006, in 2007 there was a preference for wine made from Syrah 7 (877).


13

Microscopic Examination of Berry Shrivel

Bhaskar Bondada and Markus KellerWashington State University Tri-Cities, 2710 University Drive, Richland, WA 99354. WSU-IAREC, Prosser, WA 99350

Berry Shrivel, a ripening disorder causing poor sugar accumulation and increased acidity was examined using various techniques of microscopy to better understand the mechanistic basis for identifying its causal factors. We hypothesize that a disruption in the functionality of both phloem and xylem pathways assist the arrested development of the berries.

To test our hypothesis, healthy and afflicted berries of Semillon were examined using scanning electron microscopy and confocal laser scanning microscope. Prior to microscopic examination, chemical composition and nutritional status of the berries were analyzed. Brix values were 25, 17, and 13 for the healthy berries, berries that appeared healthy in the shriveled cluster, and shriveled berries, respectively. The berries afflicted with Berry Shrivel had had low concentrations of oxalic and citric acids and no succinic acid; however, in general, they were highly acidic when compared with healthy berries. The levels of P, K, Ca, and Mg were higher in the shriveled berries than in the healthy berries.

Most of the cells were viable in the healthy berries as opposed to predominantly dead cells in the berries with Berry Shrivel. The sieve tube members (STM) in the peduncles of healthy cluster were functional with unobstructed sieve plate. The STM in the peduncles of Berry Shrivel cluster was healthy; whether or not its sieve plates are plugged will be examined in future studies. The xylem pathways in canes of healthy clusters were functional with no pluggings in the vessels; however, the xylem of Berry Shrivel canes appeared to be plugged with tylosis. In future studies, structure and function of phloem pathway will be continued and such insight will be used to explore into possible causal factors of Berry Shrivel.


14

Modeling Climate and Climate Change Impacts on Wine Grape Yields in California

Kimberly Nicholas Cahill*, David B. Lobell, Christopher B. Field, Celine Bonfils, and Katharine Hayhoe

*Department of Global Ecology, Carnegie Institution, Stanford, CA 94305, USA and Interdisciplinary Program in Environment and Resources, Stanford University, Stanford, CA 94305, USA email: [email protected]

Improved assessment of wine grape yield responses to future climate are needed to understand potential damages from climate change and to prioritize adaptation strategies. We evaluated the effect of climate change on wine grapes in California using outputs from multiple climate models to evaluate climate uncertainty, multiple emissions scenarios to evaluate uncertainty in emission pathways, and multiple statistical yield models to evaluate yield response uncertainties.

Our model found higher yields associated with moderate nights in April and higher precipitation in June and the October proceeding harvest (R2

adj = 0.66). We found that wine grape yields in California are likely to experience a decline of 5% by the end of the century if future yield changes from climate do not exceed historical extremes, with 90% confidence intervals including both climate and crop uncertainties of +8 to -13%. If future yield changes do exceed historical extremes, yields are likely to decline by 10% (90% confidence intervals: +10 to -39%). The areas modeled to have high yields overlap with the currently planted areas, but shift towards the coast and the north with future warming. While wine grape yields are highly manipulated by viticulturists, a warming climate may limit management options by stressing the growing and ripening capacities of vines.


15

Segregation of necrotic spotting on leaves in a grape rootstock population

Peter Cousins*USDA ARS, Grape Genetics Research Unit, New York State Agricultural Experiment Station

630 W. North Street, Geneva, NY, 14456 email: [email protected]

Segregation of necrotic spotting on the leaves was observed in a grape rootstock breeding population developed for nematode and phylloxera resistance. Necrotic spotting on plant leaves is associated with responses to pathogen attack, response to chemicals (such as pesticides or plant growth regulators), and with physiological disorders and spontaneous lesion mimics. This population was not inoculated with fun-gal or bacterial leaf pathogens nor treated with plant growth regulators and the development of necrotic spotting. Segregation of necrotic leaf spotting to un-spotting individuals in the population was 1:1, which implies simple genetic control of the trait.

Materials and MethodsA grape rootstock population was developed by controlled pollination between the rootstock 106-8 Mgt and the USDA ARS rootstock selection 4-13B. 106-8 Mgt, a rootstock for phylloxera protection, is derived from a cross of Vitis riparia x (V. cordifolia x V. rupestris). 4-13B, the male parent of the population, is a Dog Ridge x V. rufotomentosa hybrid (David Ramming, personal communication) and is resistant to ag-gressive root-knot nematodes. The cross was made in 2001. Seeds were collected and stratified, then planted in 2002. Seeds were germinated at 29.3 °C and transferred into individual pots in a greenhouse upon germination. They were grown in 4:1 volume:volume Cornell peat-Lite mix:medium sand and fer-tigated with Miracle-Gro Excel brand 21-5-20 All Purpose water soluble fertilizer. Sulfur was applied for powdery mildew control. About 4 weeks after seeding, plants were inoculated with 1500 J2 stage Meloido-gyne arenaria root-knot nematodes. The seedlings were screened for interveinal necrotic spotting at the time of nematode resistance screening, about 11 weeks after seeding.

Results and DiscussionLeaves of 90 seedlings were examined. Spots were round and approximately 1-3 mm in diameter and were observed primarily in the interveinal regions of the leaves (Figure 1). Necrotic spots were observed on 43 seedlings, while 47 seedlings did not exhibit necrotic spots (Figure 2). The observed ratio is consis-tent with a 1:1 ratio (chi-square test).

What is the nature of the necrotic spotting observed to segregate in this population? Plant growth regula-tors were not applied in the cultivation of this population and the necrotic spotting observed is inconsistent with the grapevine phytotoxic response to sulfur applications for powdery mildew management, which manifests as interveinal bleaching (Pearson et al. 1988). The necrotic spotting, while distinctive and no-ticeable, apparently did not impact plant growth or nematode resistance and selections from the necrotic spotting and un-spotting groups were made as candidate rootstocks. Mitchell et al. (1994) reported dif-ferential responses to Septoria ampelina, a fungal pathogen of grapevine foliage that causes Septoria leaf spot, across cultivars from diverse genetic backgrounds, although the responses they reported reflected continuous variation rather than discrete classes as observed here and S. ampelina lesions on grape leaves typically are angular (McGrew and Pollack, 1988b). It could be that this population segregates for a necrotic spotting response to S. ampelina. Rupestris speckle is a physiological disorder with symp-toms that resemble Septoria leaf spot, including necrotic lesions (McGrew and Pollack, 1988a). Rupestis speckle particularly is reported from grape varieties and germplasm with V. rupestris ancestry. The female parent of this population is one quarter V. rupestris, while Dog Ridge, the paternal grandmother, is V. x champinii, a natural hybrid with the putative parental species V. rupestris and V. mustangensis. The incite-ment of rupestris speckle is undetermined; it could be spontaneous or it could be associated with some unknown agent. It may be that this population is demonstrating segregation for rupestris speckle.


16

Figure 1. Leaf top (upper) and bottom (lower) from an individual seedling showing interveinal necrotic spotting.

Figure 2. Leaves of typical un-spotted (upper) and necrotic spotted (lower) seedlings.

AcknowledgementsMany thanks to Mary Lauver and Debra Johnston for their outstanding care and experimental cultivation of the plants population, to David Ramming, USDA ARS Crop Diseases, Pests and Genetics Research Unit, Parlier, California, for providing access to 4-13B, and to M. Andrew Walker, Department of Viticulture and Enology, University of California, Davis, for providing access to the 106-8 Mgt.

References:Mitchell, J. K., Patterson, W. K., and Ford, R. H. 1994. Susceptibility of American, European, and

interspecific hybrid grape cultivars to the fungus Septoria ampelina. HortScience 29(1):31-32.McGrew, J. R. and Pollack, F. G. 1988a. Other minor foliage diseases, p. 31-32. In. Pearson, R. C. and

Goheen, A. C. (eds.). Compendium of Grape Diseases. Amer. Phytopath. Soc. Press, St. Paul, Minn.McGrew, J. R. and Pollack, F. G. 1988b. Septoria leaf spot, p. 31. In. Pearson, R. C. and Goheen, A. C.

(eds.). Compendium of Grape Diseases. Amer. Phytopath. Soc. Press, St. Paul, Minn.Pearson, R. C., Pool, R. M., and Jubb, Jr., G. L. 1988. Pesticide toxicity. p. 69-71. In. Pearson, R. C. and

Goheen, A. C. (eds.). Compendium of Grape Diseases. Amer. Phytopath. Soc. Press, St. Paul, Minn.


17

Vitis Shoots Show reversible Change in Leaf Shape along the Shoot Axis

Peter Cousins*1 and Bernard Prins2

1USDA ARS, Grape Genetics Research Unit, New York State Agricultural Experiment Station 630 W. North Street, Geneva, NY, 14456 email: [email protected]

2USDA ARS, National Clonal Germplasm Repository, University of California, Davis, California

Grapevine (Vitis) species typically bear entire leaves along the shoot axis once mature. A few species and selections are known to bear palmately compound leaves. Whether entire or compound, the shape of the leaf is essentially constant over the length of the shoot axis; the practices of ampelography and ampelometry, used to identify grapevine varieties, clones, and species, are based on leaf shape and rely on the relative stability of this character. Leaves on primary shoots may differ in shape from leaves on other shoots, demonstrating some plasticity in leaf shape among shoots. We examined primary shoots of grapevine species and species hybrids in the United States national grape collection at the USDA ARS National Clonal Germplasm Repository, Davis, California. Most accessions examined showed no substantial change in leaf shape along the shoot axis. However, some accessions exhibited compound leaves at the base of the shoot, followed by a zone of entire leaves, then a zone of compound leaves. Transition into the zone of entire leaves appears related to the unidirectional transition from leaf-opposed inflorescences to leaf-opposed tendrils. Genetic control of the reversible leaf shape change has not been determined, although the character is found only in specific selected populations. Leaf shape change along the shoot axis evokes shifts in leaf shape related to grapevine maturation and has implications for grapevine improvement and viticulture.

Most grapevine species have leaves that are entire or lobed and the shape of the leaf is more or less con-stant along the axis of the primary (inflorescence bearing) shoot. Several East Asian species, notably V. piasezkii, are distinguished by palmately compound leaves. Some vines show both compound and entire leaves on the same plant and even the same shoot. This phenomenon is poorly described in Vitis and the underlying mechanisms are unknown. The compound leaf trait is apparently dominant to entire leaves, but is not expressed in juvenile grapevines (data not shown). Boyden (2005) observed that treating seed-lings with a compound leafed parent with growth retardants and gibberellin blockers (following Srinivasan and Mullins 1981) could induce production of compound leaves in juvenile vines.

Materials and MethodsWe examined eleven varieties or accessions, representing grapevine species and species hybrids in the United States national grape collection at the USDA ARS National Clonal Germplasm Repository, Davis, California, observing the leaves on shoots that grew from overwintering buds and bore inflorescences (primary shoots). Each leaf was classified as entire, compound, or transitional. Leaves from single shoots are presented; the first leaf presented is the one opposite the most basal inflorescence on the shoot. The accessions we examined were DVIT 1489, 2032, 1252, 2031, 1535, 2876, 1566, and 1196, Roger’s Red (a Vitis californica hybrid), and the rootstocks 44-53 M and 157-11 C.

Results and conclusionsGrapevine varieties and accessions differ substantially in the stability of leaf shape over the shoot axis. On those shoots in which there is a transition from compound leaf shape to other leaf shapes, this transi-tion is often close to the distal inflorescence. Boss and Thomas (2002) demonstrated that a GAI mutation in grapevine results in the production of inflorescences indeterminately rather than exclusively at the base of the shoot. Is there a GA gradient responsible for leaf shape transition? Does GA signaling mark the end of the inflorescence zone and simultaneously trigger the transition towards entire leaves? This is consistent with reduced GA perception or activity being associated with both compound leaves (Boyden 2005) and in-florescence development in preference to tendrils (Boss and Thomas 2002, Srinivasan and Mullins 1981).


18

Acccesions of V. piasezkii and its hybrids showed the greatest variability in leaf shape. Accession DVIT 2032, a V. piasezkii accession, showed rapid reversible change in leaf shape from palmately compound to entire and back to palmately compound within three nodes:

Leaf 7 Leaf 8 Leaf 9 Leaf 10

Some palmately compound leafed accessions were apparently stable, showing no substantial change in leaf shape (DVIT 1489):

Leaf 4 Leaf 6 Leaf 10 Leaf 12 Leaf 16

Others showed unidirectional leaf shape change (DVIT 1566):

Leaf 4 Leaf 6 Leaf 9 Leaf 16 The compound leaf shape may be useful in viticulture. The quality of grapes used for wine is improved by light on the developing fruit. Application of pesticides into the cultivated grapevine canopy is facilitated by gaps in the canopy. Compound leaves resemble small entire leaves, but the viticultural effect may be a collection of connected small leaves rather than large entire leaves, presenting an advantage for fruit quality and management. Thorough genetic and physiological characterization of the leaf shape transition is required before this phenomenon can be applied in viticulture.

ReferencesBoss, P.K, and Thomas, M.R. 2002. Association of dwarfism and floral induction with a grape ‘green

revolution’ mutation. Nature 416:847-850.Boyden, Laurie Elizabeth, 2005. Allelism of Root-Knot Nematode Resistance and Genetics of Leaf Traits

in Grape Rootstocks. Dissertation.Cornell University, Ithaca, New York.Srinivasan, C. and M. G. Mullins. 1981. Induction of precocious flowering in grapevine seedlings by

growth regulators. Agronomie 1:1-5.


19

Genetic Control of Tendril Distribution in a Grapevine rootstock Hybrid Population

Peter Cousins*, Debra Johnston, Susan Switras-Meyer, and Carl MeyerUSDA ARS, Grape Genetics Research Unit, New York State Agricultural Experiment Station

630 W. North Street, Geneva, NY, 14456 email: [email protected]

Grapevine tendril distribution is a characteristic of varieties and species. We examined the tendril distribu-tion on a population of seedlings from a 161-49C x (V. labrusca x V. mustangensis) hybridization. 161-49C is a V. riparia x V. berlandieri hybrid that ordinarily bears tendrils in a discontinuous pattern. Although the V. labrusca x V. mustangensis parent frequently demonstrates more than two tendrils in sequence, it does show nodes without tendrils and as such cannot be described as strictly continuous in its tendril dis-tribution.

Grapevine tendrils and clusters (inflorescences) are found at the node opposite a leaf. Cultivars and spe-cies exhibit some variation in tendril distribution, the phyllotactic patterning of which nodes have tendrils (or clusters) and which do not. Most Vitis species and cultivars have two nodes with tendrils followed by a node without a tendril (Mullins et al., 1992; Gerrath et al., 1998). This pattern is called intermittent tendril distribution. However, in the North American species V. labrusca and some V. labrusca interspecific hy-brids, a tendril is found at every node (continuous tendril distribution). Some interspecific hybrid cultivars have an intermediate tendril distribution, with more than two nodes in a row bearing tendrils, but with oc-casional tendril-free nodes. Cousins et al. (2005) reported exploratory studies in the genetic control of phyllotactic patterning. Here we report in-depth analysis of a population segregating for tendril distribution patterns.

Materials and Methods161-49 (V. riparia x V. berlandieri) is a pistillate flowered rootstock cultivar that ordinarily bears two ten-drils per three nodes. Q126 is a staminate flowered V. labrusca x V. mustangensis hybrid in the collection of the National Clonal Germplasm Repository at Davis, California (accession number DVIT 1456); this repository holds part of the United States Department of Agriculture National Plant Germplasm System grape collection. Q126 bears more than two tendrils in three nodes, but is not fully continuous (skip nodes are found). 161-49 was crossed to Q126 in 2004. We collected the seeds from ripe fruit and moist strati-fied them for at least three months prior to germination. The seeds were sprouted on blotter paper in an incubator and the germinated seeds were transferred to individual 2.5 cm square pots. The seedlings were transplanted to individual 3 gallon pots and staked. Vines were grown in a greenhouse in Geneva, New York with supplemental light. Tendril distribution was screened at twelve successive nodes beginning at the first node with a tendril. 103 seedlings were screened successfully at twelve nodes.

Results and DiscussionThere were five classes of seedlings, respectively those with 8, 9, 10, 11, and 12 tendrils in 12 nodes (Figures 1). The mean number of tendrils per 12 nodes is 9.50 and the variance is 2.47.

Q126 does not bear tendrils at all nodes (although at more nodes than 161-49C), so it is perhaps surpris-ing that we found that nearly a quarter of the seedlings (20) bore 12 tendrils in 12 nodes. These seedlings apparently exceed the tendril density on their male parent. Nearly half of the seedlings bore 8 tendrils in 12 nodes, identical to 161-49C.


20

42

18

1211

20

0

5

10

15

20

25

30

35

40

45

8 9 10 11 12

Tendrils per 12 nodes

Number of seedlings

Figure 1: Tendrils found in the first 12 nodes of hybrid seedlings.

The distribution of tendrils patterning in this population suggests segregation of alleles of relatively few genes. It is tempting to assign seedlings with 8 and 9 tendrils into one class (total 60) and the remaining seedlings into another class (total 43), but experimental evidence to support such an assignment is com-pletely lacking. What is the importance of the transgressive segregation observed here? Does this reflect substantial environmental influence on the distribution of tendrils, quantitative inheritance, or epistatic rela-tionships between essentially qualitatively acting alleles? The evaluation of additional populations derived from crosses among plants in the several classes is needed in order to answer these questions.

Are twelve nodes sufficient to identify categories of tendril distribution? It may be that blurring between categories is reduced as more nodes are evaluated per plant, both over the length of shoots and over several seasons. To test the stability of tendril distribution it will be necessary to follow individual seedlings through early screening into multiple year vineyard evaluation. Could a seedling with an entirely intermit-tent tendril pattern (as evaluated at the 12 node stage) switch to an entirely continuous pattern at some later stage in life, such as upon sexual maturation? This is unknown. Future study of tendril distribution will include mating designs and vineyard studies that will allow us to address the questions of stability of tendril distribution in an individual seedling and assignment of seedlings to phenotypic classes.

AcknowledgementsMany thanks to M. Andrew Walker, Department of Viticulture and Enology, UC Davis, for providing access to 161-49C vines used in generating the hybrid population.

Literature CitedCousins, P. Switras-Meyer, S. Vidmar, J., Boyden, L., and Johnston, D. 2005. Segregation of tendril

distribution patterning in grapevine populations. Acta Hort. 689:541-544.Gerrath, J.M., Lacroix, C.R. and Posluszny, U. 1998. Phyllotaxis in the Vitaceae. p.89-107. In:R.V. Jean

and Denis Barabé (eds.), Symmetry in Plants. World Scientific, Singapore.Mullins, M.G., Bouquet, A. and Williams, L.E. 1992. Biology of the Grapevine. Cambridge University

Press, Cambridge.


21

Transcriptomic and Metabolomic Analyses of Cabernet Sauvignon Grape Berry Development

Laurent G. Deluc1, Jérôme Grimplet1, Matthew D. Wheatley1, Richard L. Tillett1, David R. Quilici1, Craig Osborne2, David A. Schooley1, Karen A. Schlauch1, John C. Cushman1, Grant R. Cramer*1

1Department of Biochemistry and Molecular Biology, University of Nevada, Reno, Nevada 89557-0014, USA.2Department of Animal Biotechnology, University of Nevada, Reno, NV 89557-0014

Grape berry development is a dynamic process that involves a complex series of molecular genetic and biochemical changes divided into three major phases. During initial berry growth (Phase I), berry size increases along a sigmoidal growth curve due to cell division and subsequent cell expansion, and organic acids (mainly malate and tartrate), tannins, and hydroxycinnamates accumulate to peak levels. The sec-ond major phase (Phase II) is defined as a lag phase in which cell expansion ceases and sugars begin to accumulate. Véraison (the onset of ripening) marks the beginning of the third major phase (Phase III) in which berries undergo a second period of sigmoidal growth due to additional mesocarp cell expansion, accumulation of anthocyanin pigments for berry color, accumulation of volatile compounds for aroma, softening, peak accumulation of sugars (mainly glucose and fructose), and a decline in organic acid ac-cumulation. In order to understand the transcriptional network responsible for controlling berry develop-ment, mRNA expression profiling was conducted on berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0 spanning seven stages of berry develop-ment from small pea size berries (E-L stages 31-33 as defined by the modified E-L system), through vé-raison (E-L stages 34-35), to mature berries (E-L stages 36 and 38). Selected metabolites were profiled in parallel with mRNA expression profiling to understand the effect of transcriptional regulatory processes on metabolite production affecting color, flavor, and aroma characters, which ultimately influence the or-ganoleptic properties of wine.

ResultsOver the course of berry development whole fruit tissues were found to express an average of 74.5% of probes represented on the Vitis microarray. Approximately 60% of these transcripts exhibited significant differential expression between at least two out of the seven stages of berry development with more than 28% of transcripts (4,151 Unigenes) showing pronounced (≥ 2 fold) differences in mRNA expression illus-trating the dynamic nature of the developmental process. Grouping 4,151 Unigenes having at least two-fold differential expression among two developmental phases revealed twenty well-correlated expression profile groups of interest. Expression profile patterns included those with declining or increasing mRNA expression over the course of berry development as well as transient peak or trough patterns across vari-ous developmental stages as defined by the modified E-L system. These detailed surveys revealed the expression patterns for genes that play key functional roles in phytohormone biosynthesis and response, calcium sequestration, transport and signaling, cell wall metabolism mediating expansion, ripening, and softening, phenylpropanoid and flavonoid metabolism, transport, and regulation, aroma biosynthesis, organic and amino acid metabolism, hexose sugar and triose phosphate metabolism and transport, and starch metabolism. In particular, mRNA expression patterns of transcription factor, abscisic acid (ABA) biosynthesis, and calcium signaling genes identified candidate factors likely to participate in the progres-sion of key developmental events such as véraision and potential candidate genes associated with such processes as auxin partitioning within berry cells, aroma compound production, and flavonoid pathway regulation and sequestration of flavonoid compounds. Finally, analysis of sugar metabolism gene expres-sion patterns suggested the existence of an alternative pathway for glucose and triose phosphate produc-tion that is invoked from véraison to mature berries.

ConclusionsThese results reveal the first high-resolution picture of the transcriptome dynamics that occur during sev-en stages of grape berry development. This work also establishes an extensive catalogue of gene expres-sion patterns for future investigations aimed at the dissection of the transcriptional regulatory hierarchies that govern berry development in a widely grown cultivar of wine grape. More importantly, this analysis identified a set of previously unknown genes potentially involved in critical steps associated with fruit de-velopment that can now be subjected to functional testing.


22

Functional Genomics of Bud Endodormancy Induction in Grapes (Vitis)

Anne Fennell1, Grant Cramer2, Julie Dickerson3, Karen Schlauch2, Jerome Grimplet1, Laurent Deluc2, Lingyong Mao3, Kathy Mathiason1, and Dong He1

1 South Dakota State University, Brookings, SD 57007, USA 2 University of Nevada-Reno, Reno, NV 89557

3 Iowa State University, Ames, IA 50011

Bud dormancy contributes to the ability of grapevines and other woody plants to survive freeze and de-hydration stresses encountered during over-wintering. In regions with prolonged periods of sub-zero tem-peratures, delayed dormancy induction or early dormancy release can increase susceptibility to freezing injury. In sub-tropical regions, chilling temperatures may be limiting and result in prolonged dormancy and/or uneven budbreak. In grapevines, an understanding of the mechanisms controlling dormancy induction, maintenance and release is especially important because of the diversity of grape production regions. We are using a genetic model system that exhibits differences in dormancy induction and release character-istics to identify mechanisms involved in regulating grape bud dormancy. This information will be used to further the understanding of molecular mechanisms that promote and maintain bud dormancy and con-tribute markers for breeding and mapping programs.


23

Breeding Salinity Tolerant Grape rootstocks

Kevin Fort and M. Andrew Walker*Department of Viticulture and Enology, University of California, Davis, California 95616 USA

Understanding the mechanism of salinity tolerance in any crop plant is a prerequisite to crop development with regards to this trait. However, analogous to agronomic breeding for yield, salt tolerance breeding in grapevines is hampered by the complex nature of the plant response to a soil solution containing a high concentration of salt (reviewed in M. Ashraf and P.J.C. Harris, eds., 2005, Abiotic Stresses, Haworth Press). Salt tolerance is generally regarded as a multigenic trait (T.J. Flowers, 2004, Journal of Experimental Botany 55:307-319) and may be exhibited in at least five distinct control points within a plant (R. Munns et al., 2002, Plant and Soil 247: 93-105). But the importance of understanding and improving salinity tolerance in crop plants overshadows the difficulties involved; in California, an estimated 4.5 million acres of agricultural land contains saline soil, including major grape-growing regions.

Hydroponic culture in a greenhouse is an ideal method for studying salinity stress, permitting precise control of the ionic environment to which the root system is exposed while concurrently minimizing atmospheric variation. Unfortunately, grapevines are ill-suited for most hydroponic systems, often exhibiting symptoms of anoxia within one month. Recently, a continuous-flow recirculating system using lightweight expanded clay aggregate has been tested with grapevines and found to be an effective method of growing grapevines hydroponically (M. Wheatley and G. Cramer, manuscript in progress). In 2007, we constructed an identical system in a greenhouse at UC Davis with the goal of breeding grape rootstocks tolerant to salt stress, and to develop molecular markers for the alleles that confer this tolerance. To date, no such markers have been defined in the scientific literature for grapevines.

Materials and MethodsIn 2007 we successfully assembled a continuous-drip hydroponic system in a UC Davis greenhouse currently capable of analyzing 144 grapevines, and expandable to approximately 400 positions. We completed a pilot study designed to optimize salt tolerance screens by using multiple NaCl concentrations, grafted and ungrafted plantlets and a suite of response variables. Our results, while informative, were limited by a high mortality rate, which resulted from the use of newly-rooted dormant cuttings rather than rooted cuttings with a year of root establishment in the field.

Our first of two hydroponics experiments is currently underway and corrections have been instituted to prevent the plant mortality experienced in 2007. This experiment is an improved version of the pilot study, testing the salinity tolerance of Riparia Gloire from two different sources, Ramsey and Thompson Seedless. The results of this study will establish actual root-to-shoot transport rates of NaCl in these selections in three 1-month intervals following establishment, rather than using more common indirect indices of tolerance (e.g., the petiolar Cl- content of a subjectively selected leaf at a subjectively selected time point). The first of these three harvests is beginning at the time of this writing. This data will provide important insight into the utility, or lack thereof, in developing molecular markers from existing F1 populations of Ramsey x Riparia and Ramsey x Thompson Seedless. Based on data from the pilot experiment, two potentially useful and quickly obtained growth indices will be evaluated against actual transport rates. The commonly used index of petiolar ion content will also be evaluated, as will capacitance at the interface of a petiole-embedded microelectrode, an index of plant water status.

The data obtained from this study should provide a solid foundation for all subsequent grapevine screens.


24

Hydroponic and soil-based salinity tolerance screening system.

Results and DiscussionUsing data derived from the preceding experiments, we will determine optimal conditions by which to assess salinity tolerance in grapevines in this hydroponic system. This information will be immediately applied to a screen of the most commonly-used rootstocks in California: 101-14, 3309C, 1103P, 110R, 420A, SO4, St. George, 5BB, Riparia Gloire, 5C, 140R, 44-53 and 039-16. Additionally, Ramsey and Thompson Seedless will be co-screened as salt-tolerant and salt-sensitive controls, respectively. This data should prove useful to the grape industry in California; additionally, such a data set will be of basic interest because of the known differences amongst these rootstocks with regard to vigor induction or devigoration to the shoot. Separating the effects of vigor from salt tolerance would be useful to grape growers if a salt-tolerant rootstock can be developed that does not excessively induce vigor, or if one already exists but has been inadequately described. Future breeding efforts which seek to independently manipulate these two traits must begin with this preliminary information.

The generation of idealized data from hydroponics in a greenhouse environment permits an evaluation of theoretically less robust data generated from a less expensive study system. We have therefore complet-ed the construction of four 4’x8’ trays which are irrigated automatically with a digital controller and three dositrons. We are currently performing a parallel, but expanded, salinity tolerance experiment which uses Riparia Gloire, Ramsey, Thompson Seedless and French Colombard. Each of these genotypes is being tested both on their own roots and with additional plants grafted with a common scion of Pinot Noir.

AcknowledgementsThe authors gratefully acknowledge research support from the California Grape Rootstock Improvement Commission, the CDFA Improvement Advisory Board, the California Table Grape Commission, and the Louis P. Martini Endowed Chair funds.


25

Survey for the Three Major Leafroll Disease-Associated Viruses in Finger Lakes Vineyards in New York

M. Fuchs†*, T. E. Martinson§, G. M. Loeb‡ and H. C. Hoch†

†Department of Plant Pathology and Plant-Microbe Biology, Cornell University New York State Agricultural Experiment Station, Geneva, NY 14456; *[email protected]

§Department of Horticultural Sciences, Cornell University New York State Agricultural Experiment Station, Geneva, NY 14456

‡Department of Entomology, Cornell University, New York State Agricultural Experiment Station, Geneva, NY 14456

Leafroll disease is one of the most important and widespread viral diseases of grapevines worldwide. It can affect Vitis vinifera, American grapes, French-American hybrids and rootstocks (Martelli, 1993). Leafroll causes significant yield losses (up to 30-50%) and delays fruit ripening. Reduced soluble solids and increased titratable acidity are also often reported. Berries of red-fruited cultivars may show pale coloring due to reduced skin anthocyanin pigments (Martelli, 1993). To date, ten different phloem-limited filamentous viruses identified as grapevine leafroll-associated viruses (GLRaVs) have been isolated and characterized from leafroll-infected grapevines (Abou Ghanem-Sabanadzovic et al. 2006; Martelli, 2006). All GLRaVs are readily transmitted by propagation and grafting. In addition, some of them (GLRaV-1, GL-RaV- 3, GLRaV-5 and GLRaV-9) are transmitted by several species of mealybugs and soft scale insects (Gugerli, 2003). Prevalent viruses in leafroll-affected V. vinifera are GLRaV-1, GLRaV-2 and GLRaV-3 (Zimmermann et al. 1990).

Leafroll disease has been reported in American grapes (Wilcox et al. 1998) and V. vinifera (Hu et al. 1990) in New York, especially GLRaV-2 and GLRaV-3. Also, the full-length genomic sequence of the lat-ter two viruses has been determined from New York isolates (Ling et al. 2004; Zhu et al., 1998). Admits these advances on disease occurrence and viral genome structure and expression, little is known on the incidence and prevalence of GLRaV-2 and GLRaV-3 in New York vineyards. Similarly, no information is available on the presence of GLRaV-1 in New York vineyards. Therefore, we examined the status of these three major leafroll-associated viruses in Finger Lakes vineyards in New York. The objectives of our study were to assess the incidence of GLRaV-1, GLRaV-2 and GLRaV-3, examine the relative distribution and abundance of mealybugs and soft scale insect vectors.

A total of 95 vineyard blocks, including 80 of V. vinifera and 15 of French-American hybrids, were sur-veyed in the Finger Lakes region. Vineyard blocks were randomly selected without prior knowledge of their sanitary status. A 5 x 5 quadrat sampling strategy with a stratified regular quadrat distribution was used to collect leaf samples from the lower vine canopy in late August through early October. Leaf sam-ples were collected from each quadrat, five quadrats per row, every five rows, for a maximum of 20 quad-rats per vineyard block. Composite samples of three leaves per vine and five vines per quadrat, making a total of 15 leaves per sample, were collected and further tested for viruses by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). GLRaV-1, GLRaV-2 and/or GLRaV-3 were detected in nearly two thirds (68%, 65 of 95) of the vineyard blocks surveyed (Table 1). Virus incidence was low in 7% (7 of 95) of the blocks tested, moderate in 21% (20 of 95), and high to extremely high in 40% (38 of 95) of them (Table 1). The three target viruses were found in 10% (113 of 1,124), 3% (36 of 1,124) and 15% (173 of 1,124) of the samples tested, respectively. Mixed infection occurred in 3.6% (40 of 1,124) of the samples, essentially with GLRaV-1 and GLRaV-3 (2.5%, 28 of 1,124).

The presence of the three target viruses was confirmed in a few samples by reverse transcription-poly-merase chain reaction (RT-PCR). DNA products of the expected size were obtained in total RNA from grapevine leaves infected with GLRaV-1 (401 bp), GLRaV-2 (515 bp) and GLRaV-3 (546 bp). No DNA amplicon was obtained in total RNA from leaves of healthy vines, except the 183 nucleotide-long product for the Vitis sp. Rbcl gene used as internal control, as expected. Virus isolates were further character-ized by sequencing DNA amplicons obtained by RT-PCR. Comparative sequence analysis indicated high nucleotide identities in the coat protein gene (86-99% for GLRaV-1 and 81-100% for GLRaV-2) and in the heat shock 70 homologue gene (90-99% for GLRaV-3) of New York isolates with other isolates from vari-ous geographic origin.


26

Two species of soft scales (Parthenolecanium corni and Neopulvinaria innumerabilis) and one species of mealybug (Pseudococcus maritimus) were tentatively identified in the majority of vineyards blocks sur-veyed (85%, 25 of 31). Their abundance in Finger Lakes vineyards is quite low (0.18 scale insects/min on the edge and 0.16 scale insects/min in the interior) for the most part. Groups of insects or individual in-stars were collected in vineyard blocks in which the occurrence of GLRaV-1 and GLRaV-3 was document-ed and assayed by RT-PCR to assess their viruliferous potential. Some of the P. corni and N. innumerabi-lis tested reacted positively to GLRaV-1. The viral nature of DNA products obtained from soft scales was confirmed by sequencing. These results provided direct evidence of the viruliferous status of soft scales in Finger Lakes vineyards.

Our research provided new insights into the incidence and distribution of GLRaV-1, GLRaV-2, and -3 in New York. The prevalence of the three major leafroll disease-associated viruses in Finger Lakes vine-yards results likely from a poor sanitary status of planting materials, stressing the need to reinstate a cer-tification program in New York. Our study also shed light on the distribution and abundance of mealybugs and soft scales, and potential spread of GLRaV-1 and GLRaV-3, suggesting the need for pest manage-ment strategies to be deployed for vectors of leafroll-associated viruses in Finger Lakes vineyards.

ReferencesAbou Ghanem-Sabanadzovic, N., Sabanadzovic, S., Uyemoto, J.K., and Rowhani, A. 2006. A putative

new ampelovirus associated with grapevine leafroll disease. In Proc. 15th ICVG Conference, Stellen-bosh, South Africa, April 3-7, http://www.icvg.ch/data/extabstr2006part1.pdf.

Gugerli P. 2003. Grapevine leafroll and related viruses. In Proc. 14th ICVG Conference, Locorotondo, Italy, Sept. 12-17, http://www.agr.uniba.it/ICVG2003.

Hu, J. S., Gonsalves, D. and Teliz, D. 1990. Characterization of closterovirus-like particles associated with grapevine leafroll disease. J. Phytopathol. 128:1-14.

Ling, K. S., Zhu, H. Y. and Gonsalves. 2004. Complete nucleotide sequence and genome organization of Grapevine leafroll-associatyed virus 3, type member of the genus Ampelovirus. J. Gen. Virol. 85:2099-2102.

Martelli, G. P. 1993. Graft-transmissible diseases of grapevines. Handbook for detection and diagnosis. FAO Publication Division, Rome, Italy.

Martelli, G.P. 2006. Grapevine virology highlights 2004-2005. In Proc. 15th ICVG Conference, Stellenbosh, South Africa, April 3-7, http://www.icvg.ch/data/exrabstr2006part1.pdf.

Wilcox, W., Jiang, Z. Y. and Gonsalves, D. 1998. Leafroll virus is common in cultivated American grape-vines in western New York. Plant Dis. 82:1062.

Zhu, H. Y., Ling, K. S., Goszczynski, D. E., McFerson, J. R. and Gonsalves, D. 1998. Nucleotide se-quence and genome organization of grapevine leafroll-associated virus-2 are similar to beet yellows virus, the closterovirus type member. J. Gen. Virol. 79:1289-1298.

Zimmermann, D., Bass, P., Legin, R. and Walter, B. 1990. Characterization and serological detection of four closterovirus-like particles associated with leafroll disease on grapevine. J. Phytopathol. 130:205-218.

Table 1. Incidence of GLRaV-1, GLRaV-2 and GLRaV-3 in Finger Lakes vineyard blocks. Vineyard blocks Virus incidence (%)a (category) No. infected % 0 (none) 30 321-10 (low) 7 711-20 (moderate) 20 2121-50 (high) 20 2151-90 (very high) 14 1591-100 (extremely high) 4 4 Total 95 100 aData represent the number of quadrats per vineyard block in which samples infected by GLRaV-1, GLRaV-2 and/or GLRaV-3 were detected by DAS-ELISA over the number of quadrats tested.


27

Characterization of a New Ampelovirus Associated with Grapevine Leafroll Disease

N. Abou Ghanem-Sabanadzovic1, S. Sabanadzovic1, D.A. Golino2 and A. Rowhani2*1Department of Entomology and Plant Pathology, Mississippi State University, Mississippi State, MS 39762, USA

2Department of Plant Pathology, University of California, Davis CA 95616, USA

Symptoms resembling leafroll disease were observed on a grapevine (Vitis vinifera) cv. Carnelian in a grape virus collection at UC Davis. The presence of leafroll infection was confirmed by grafting onto leafroll-specific indicator V. vinifera cv. Cabernet Franc. The source plant was tested negative for all known grapevine leafroll-associated viruses by ELISA and RT-PCR. Double stranded RNA (dsRNA) was isolated from diseased tissues using double phenol-chloroform extractions and CF-11 column chromatography. Presence of a clostero-like virus was first proved by the presence of multiple, high molecular weight dsRNA molecules extracted from cortical tissue of the diseased Carnelian cultivar. The putative full length genomic size of replication form was estimated to be 14kbp. Relatedness of this virus was further proven by a positive amplification with degenerate primers designed on conserved sequences of the HSP70-homologue.

The genome of the virus has partially been sequenced and up to date11,836 nt (approximately 85% of the genome) is available. The genome consisted of 6 open reading frames (ORFs) in the 5’->3’ direction with an organization similar to GLRaV-4, -5, -6 and -9. The genome organization included an incomplete ORF1 identified as viral replicase (1045 aminoacids) which shared limited homology with other ampeloviruses. The sequence continues with an ORF2 encoding for a small, hydrophobic protein of 46 aminoacids in size (p5) which shared similarity with corresponding proteins of GLRaV-4,-6 and –9 ranging from 69-73%. The 58 K polypeptide encoded by the ORF3 contained the conserved motifs of the HSP70 homologue and shared less than 70% of the identical amino acids with that encoded by GLRaV-4,-5,-6 and -9 genomes. The next ORF overlapped the HSP70 encoding cistron for 22 nt and extended for 1620 nt. It encoded for 539 amino acid long protein of an estimated molecular weight of c. 60K (p60). This ORF was apparently less conserved and sharing only 63-65% identity with corresponding products of other ampeloviruses involved in grapevine leafroll disease. The sequences continued with 804 nt long ORF encoding for a viral coat protein with a molecular weight of c. 29K. The last known coding region from the available sequence terminates with an ORF of 624 nt in length encoding for a putative p23 protein, a possible coat protein minor.

Our preliminary results have demonstrated that the virus from cv. Carnelian has conserved genomic arrangements characteristic of the members of the fam. Closteroviridae (Martelli et al., 2002). Phylogenetic analyses, independent of gene used for comparison, have shown close relationship between this virus and GLRaVs-4, -5, -6 and -9 as well as Pineapple mealybug wilt-associated virus 1 (PMWaV-1).

Based on our sequence data, the virus from cv. Carnelian appears to be the most distinct member of this sub-group of ampeloviruses and apparently seems to be a new member of the family Closteroviridae.

References Martelli G.P., Agranovsky A.A., Bar-Joseph M., Boscia D., Candresse T., Coutts R.H., Dolja V.V., Falk B.W., Gonsalves D., Jelkmann W., Karasev A.V., Minafra A., Namba S., Vetten H.J., Wisler G.C. and Yoshikawa N, 2002. The family Closteroviridae revised. Archives of Virology 147(10): 2039-2044.


28

Virus Effects on Vine Growth and Fruit Components of Cabernet Sauvignon on Six rootstocks

Deborah A. Golino,*1 James Wolpert2, Susan T. Sim1, Jason Benz2, Michael Anderson2, and Adib Rowhani1

1 Department of Plant Pathology, 2 Department of Viticulture and Enology University of California, Davis, California, 95616, U.S.A. email: [email protected]

A research block was planted to provide data on the effect(s) of grapevine leafroll (GLRV), corky bark as-sociated virus (GVB), and Rupestris stem pitting virus (RSP), in single and mixed infections, on the fruit and wine making quality of Cabernet Sauvignon grafted upon selected rootstocks.

Materials and MethodsVine growth and fruit components of Cabernet Sauvignon clone FPS 5 with and without viruses and graft-ed onto six rootstocks was evaluated. Rootstocks included: Couderc 3309, Kober 5BB, Paulsen 1103, Richter 110, Millardet et de Grasset 101-14, and Rupestris St. George. Rootstocks were selected as rep-resentative of commercial rootstocks for the region with the exception of Rupestris St. George which was selected for its known virus tolerance. The trial was established at the UC Oakville Station in Napa Valley with 1.5 x 2 meter (vine x row) spacing in rows oriented North-South. Budwood was field budded onto cer-tified rootstock in spring, 2002, in a randomized complete block design with 5 replications and 5 – 6 vines/ treatment/ replication. Vines were trained to a bilateral cordon on a vertical shoot positioned (VSP) trellis, and spur-pruned.

Virus-infected budwood was collected from the Davis Grapevine Virus Collection (Golino, 1992). Healthy budwood was collected from Foundation Plant Services. Virus treatments included: LR101- a single infec-tion of Grapevine leafroll virus type 3 (GLRV-3); LR109 - a mixed infection of Grapevine leafroll virus type 2 (GLRV-2), GLRV-3, and Grapevine fleck virus (GFkV); RSP115 - a single infection of Rupestris stem pit-ting associated virus (RSPaV), and LR102 - a mixed infection of Grapevine leafroll virus type 1 (GLRV-1), GLRV-2, Grapevine leafroll virus type 5 (GLRV-5) and Grapevine virus B (GVB). Thirty-one vines infected with virus accession LR102 were included in an edge row for observation purposes only, due to concerns that vines infected with this virus would not produce usable fruit.

Each plant was observed for symptoms and RT-PCR and/or ELISA tested to confirm virus infection. Vine yield components (cluster number, cluster weight, clusters per shoot, berries per cluster and berry weight), fruit composition (Brix, pH, titratable acidity) and vegetative growth parameters (pruning weight and shoot weight) were measured for two years when vines were three and four years old before they were fully mature. The vineyard was subsequently removed due to concern that the viruses may spread to neighboring vineyards (Golino et al, in press).

ResultsVirus infection: All vines were successfully inoculated with the virus treatment inoculated based on labora-tory testing and symptoms. No healthy controls were found to have virus with the exception of RSPaV. RSPaV was detected in 30% of the plants on 101-14, 5BB, and St. George, which we suspect came from the rootstock source. No RSPaV was detected in the healthy treatment plants of 1103P, 110R or 3309C.

Yield: Fruit yield was highly dependent on both virus and rootstock (Figure 1). Kober 5BB was most se-verely affected. The LR109 treatment yield was 12% of what was harvested on the healthy treatment (0.33, 2.71 kg/vine respectively). Some LR109-infected vines on Kober 5BB had no fruit at all. On the rootstock, 101-14, yield was significantly lower in the leafroll infected treatments, LR109 and LR101, but not the RSPaV treatment, as compared to healthy (1.16, 1.58, 2.02, 2.21 kg/vine, respectively). On 110R and 3309C there was a significant difference in yield between the RSP115 treatment and healthy, but


29

not the LR101 or LR109 treatments. This is the first time that RSPaV has been documented to cause an affect on yield. More years of data would be necessary to confirm this conclusion, to see if this pattern continued as the plants matured. On 1103P, there was no significant difference in yield between any virus treatment and healthy (2.40 ± 0.29 kg/vine average for all treatments) although the LR 109 treatment was lower than healthy. On St. George, as expected, there was also no significant difference in yield between any virus treatment and healthy (1.69 ± 0.19 kg/vine average for all treatments).

Fruit Components: Brix levels on all rootstocks were significantly lower when infected with LR 109 and LR101, but not RSP115 as compared to healthy (average 23.8, 25.1, 26.1, and 26.2° Brix, respectively)(Figure 2). Titratable acidity was significantly affected by viruses in all rootstocks except 101-14 (Figure 3).

Discussion Fruit sugar accumulation was significantly reduced by leafroll virus infection in vines on every rootstock by approximately 1 - 2° Brix. RSPaV had no affect on fruit sugar in any rootstock. Yield and vine growth was also significantly reduced by leafroll viruses in vines grafted onto Kober 5BB and 101-14 (Figure 4). Yield of vines on 110R and 3309C was affected by RSPaV but not the leafroll viruses; further investigation is needed to confirm these results. Fruit yield and vine growth was not significantly affected in vines grafted onto St. George and 1103P, indicating that these rootstocks were fairly tolerant to these viruses. Leaf symptoms in LR102- infected vines were different on different rootstocks, possibly indicating different vi-rus titer of and tolerance to different viruses, notably, GVB in certain rootstocks. The original goal of mak-ing wine from these vine to more clearly establish the effects of virus-infection on wine quality could not be completed due to concern about the rapid field spread of leafroll in this area (Golino et all, in press).

ReferencesGolino, D. A. 1992. The Davis Grapevine Virus Collection. American Journal of Enology and Viticulture

43(2):200-205. Golino, D.A., Weber, E., Sim, S. T., and Rowhani, A. Grapevine Leafroll Disease is Spreading in Napa

Valley. California Agriculture (submitted).

Figure 1. Yield, average of 2 years

0

0.5

1

1.5

2

2.5

3

3.5

101-14 1103P 110R 3309C 5BB StGeoCabernet Sauvignon - 5/ Rootstock

kg/v

ine LR109

LR101RSP115Healthy

Figure 3. Titratable Acidity, average of 2 years

66.26.46.66.8

77.27.47.67.8

8

101-14 1103P 110R 3309C 5BB StGeo

Cabernet Sauvignon - 5/ Rootstock

g/l LR109

LR101RSP115Healthy

Figure 4. Pruning weight, average of 2 years

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

101-14 1103P 110R 3309C 5BB StGeo

Rootstock

kg y

ield

: kg

prun

ing

wei

ght LR109

LR101RSP115Healthy

Figure 2. Sugar content, average of 2 years

23

23.5

24

24.5

25

25.5

26

26.5

27

101-14 1103P 110R 3309C 5BB StGeoCabernet Sauvignon - 5/ Rootstock

Bri

x

LR109LR101RSP115Healthy


30

Virus Effects on Vine Growth and Fruit Components of Three California ‘Heritage’ Clones of Cabernet Sauvignon

Deborah A. Golino*1, James Wolpert2, Susan T. Sim1, Jason Benz2, Michael Anderson2, and Adib Rowhani1

1 Department of Plant Pathology, 2 Department of Viticulture and Enology, University of California, Davis, California, 95616, U.S.A. email: [email protected]

Vine growth and fruit components of three California ‘Heritage’ Cabernet Sauvignon clones were com-pared with their original virus-infected parent selections. The heritage clones were field selections from highly regarded vineyards in Napa Valley which were known to have virus problems. They were each treated by meristem shoot tip culture (Golino et al, 2001) to eliminate virus. Clone FPS 29, the Niebaum-Coppola clone, was from old plantings near the Niebaum-Coppola winery which provided premium quality grapes. Clone FPS 30, the Disney Silverado clone, was from an old vineyard off Silverado trail believed to be planted with the See clone of Cabernet. Clone 31, the Mondavi clone, was collected from 50-year old vines in the To-Kalon vineyard.

Materials and MethodsWood for each Heritage clone came from the Foundation vineyard at Foundation Plant Services, UC Davis. For each new clone, wood from the original virus-infected source (VIS) was collected from the UC Davis Grapevine Virus Collection (Golino, 1992). All three original virus-infected parent selections were infected with Grapevine leafroll virus type 3 (GLRV-3), Grapevine virus B (GVB), and Grapevine fleck virus (GFkV). The three pairs of virus-infected parent selections with their healthy progeny clones totaled six different treatments and were: VIS 29 & FPS 29 (Niebaum-Coppola); VIS 30 & FPS 30 (Disney Sil-verado); and VIS 30 & FPS 31(Mondavi).

The trial was established at the UC Oakville Station in Napa Valley with 1.5 x 2 meter (vine x row) spac-ing in rows oriented North-South. Budwood was field budded onto certified 101-14 Mgt in spring, 2002, in a randomized complete block design with 5 replications and 12 vines/ treatment/ replication. Vines were trained to a bilateral cordon on a vertical shoot positioned (VSP) trellis, and spur-pruned. Each plant was observed for leafroll symptoms in the fall. Selected vines were virus tested to confirm infection and monitor possible spread. Vine yield components (cluster number, cluster weight, clusters per shoot, berries per cluster and berry weight), fruit composition (Brix, pH, titratable acidity) and vegeta-tive growth parameters (pruning weight and shoot weight) were measured for two years when vines were three and four years old before they were fully mature. Subsequently, the virus-infected selections were removed due to concern that leafroll disease might spread to adjacent clones and trials.

ResultsSymptom Observations and Vine Growth: Typical leafroll virus symptoms were observed in all original vi-rus-infected selections. In general, the virus-infected selections required more replanting and took longer to establish trunks and cordons than healthy clones. Vine growth, as indicated by pruning weight, was sig-nificantly reduced by virus infection in two clones (Figure 1). Notably, VIS 29 was severely stunted; it had 58% less pruning weight compared to FPS 29. Selection VIS 31 had 24% less pruning weight compared to FPS 31.

Yield: Yield was significantly reduced by virus infection in two clones; VIS 29 had a 45% yield reduction compared to FPS 29; VIS 31 had a 30% yield reduction compared to FPS 31. Also, yield between healthy clones was significantly different; yield of FPS 29 and FPS 30 was almost double that of FPS 31 (3.1, 3.0, 1.7 kg/vine respectively) (Figure 2). The number of clusters/vine was significantly reduced by virus infec-tion in one clone (28.8, 20.5 for FPS 29, VIS 29, respectively).


31

Fruit composition: Sugar content was significantly lower in all virus-infected selections by approximately 3 to 4 ° Brix (P< 0.0001). There was also a small but statistically significant difference in sugar content between healthy clones; FPS 29 had lower sugar content than FPS 30 and 31 (24.2, 24.8, 24.8° Brix, respectively) (Figure 3). Titratable acidity (TA) was significantly higher in virus-infected vines compared to healthy in one clone (7.7, 6.3 g/L for VIS 31, FPS 31 respectively) (Figure 4).

DiscussionThe effects of virus infection on each Heritage selection varied significantly. In the case of FPS 30/VIS 30 little effect was seen on yield in contrast to FPS 29/VIS 29 and FPS 31/VIS 31. This may be a result of clonal difference in virus response. However, all three Cabernet Sauvignon selections came from different field sources. Therefore, although they are infected with the same species of virus (GLRV-3, GVB, AND GFkV), there may be strain differences between those species affecting the severity of symptoms. Different strains of each species of GLRV would be expected by plant virologists to demonstrate variation in symptoms se-verity. This data provides some evidence for that hypothesis.

ReferencesGolino, D. A. 1992. The Davis Grapevine Virus Collection. American Journal of Enology and Viticulture

43(2):200-205. Golino, D.A., Sim, S.T.,. Bereczky, J. and Rowhani, A.. 2001. The Use of Shoot Tip Culture in Foundation

Plant Materials Service Programs. Combined Proceedings of the International Plant Propagators Society, Volume 50: 568-573.

Figure 2. Yield, mean of 2 years

0

0.5

1

1.5

2

2.5

3

3.5

VIS 29 & FPS 29 VIS 30 & FPS 30 VIS 31 & FPS 31Cabernet Sauvignon clone

kg/v

ine

Virus-infected parent Healthy tissue cultured progeny

Figure 3. Sugar content, mean of 2 years

19

20

21

22

23

24

25

VIS 29 & FPS 29 VIS 30 & FPS 30 VIS 31 & FPS 31

Cabernet Sauvignon clone

deg

rees

Bri

x


Figure 4. Titratable acidity, mean of 2 years

0

1

2

3

4

5

6

7

8

9


g/ L


Figure 1. Pruning weight, mean of 2 years

0.00

0.20

0.40

0.60

0.80

1.00

1.20

1.40


kg/v

ine



32

Systems Biology of the Grapevine

Jérôme Grimplet1, Julie A. Dickerson2, Kim J. Victor1, Grant R. Cramer3 and Anne Y. Fennell1*1 South Dakota State University, Horticulture, Forestry, Landscape and Parks Department, Brookings, SD, 57006, USA

2 Iowa State University, Virtual Reality Applications Center, Ames, IA, 50011, USA3 University of Nevada, Department of Biochemistry, MS 200, Reno, NV, 89557, USA

*[email protected]

During recent years, an increasing amount of genomics data has been released within the grapevine community, including a significant share from our laboratories (1, 2, 4, 5, 6). The next critical challenge is to annotate the recently released grapevine genome and adapt existing interpretive tools of model species to the specificities of the grapevine genome. Having grapevine specific tools will increase the power and speed of genomic and systems biology data analysis. Our goal is to develop and validate a database of the molecular networks occurring in the grapevine. This tool will allow the visualization of the changes of the transcriptome, proteome and metabolome within molecular networks (for example, metabolic or signal pathways), during a given experiment.

Material and methodsGene features were assigned to an EC number or an orthology number, which is used by the KEGG: Kyoto Encyclopedia of Genomes and Genes (www.genome.ad.jp/kegg) for regrouping orthologous genes. Assignment was made by blasting genes against various databases (GeneBank, UniProt, Swiss-Prot, KEGG, the Arabidopsis and the rice genomes) and manually curating the annotation. The initial approach for the construction of metabolic pathways was to download xml files from the KEGG website and to convert them into systems biology markup language format (SBML). Genes and mRNA were then placed onto respective pathways with the Cell Designer software (www.celldesigner.org). For processes not present in KEGG, pathways were built using biochemical literature.

Results and discussionThe gene sequences from the French-Italian Public Consortium for Grapevine Genome Characterization (6), EST data assembled at the Dana Farber Cancer Institute (http://compbio.dfci.harvard.edu) and non-vinifera sequences have been matched for determining unique sequences, leading to 39,423 unique potential genes and proteins. Amongst them, 7,265 genes have been assigned to 107 pathways, including: 86 metabolic pathways, 3 transporter pathways, 9 genetic information processing pathways, and 9 signal pathways focused mainly on phytohormone signaling.

A beta version of the molecular networks based on manual annotation of genome and EST sequences, existing Arabidopsis thaliana pathways and biochemical literature will be displayed online through the METNET database (http://metnet.vrac.iastate.edu/). This database allows expert users to curate the pathways through an internet portal. In addition, the pathways can be exported in xml format and subsequently used in Cytoscape (http://www.cytoscape.org/) for quantitative pathway analysis and identification of co-regulation networks of genes.

AcknowledgmentsThis research was support by grants from the National Science Foundation Plant Genome Program (DBI-0604755). The authors wish to thank Kathy Mathiason for invaluable technical support.


33

ReferencesCramer, G. R., Ergül, A., Grimplet, J., Tillett, R. L., Tattersall, E. A., Bohlman, M. C., Vincent, D.,

Sonderegger, J., Evans, J., Osborne, C., Quilici, D., Schlauch, K. A., Schooley, D. A., and J. C. Cushman. 2007. Water and salinity stress in grapevines: early and late changes in transcript and metabolite profiles. Funct Integr Genomics 7(2):111-34.

Deluc, L. G., Grimplet, J., Wheatley, M. D., Tillett, R. L., Quilici, D. R., Osborne, C., Schooley, D. A., Schlauch, K. A., Cushman, J. C., and G. R. Cramer. 2007. Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development. BMC Genomics. 8:429.

French-Italian Public Consortium for Grapevine Genome Characterization. 2007. The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449(7161):463-7.

Grimplet, J., Deluc, L. G., Tillett, R. L., Wheatley, M. D., Schlauch, K. A., Cramer, G. R., and J. C. Cushman. 2007. Tissue-specific mRNA expression profiling in grape berry tissues. BMC Genomics 8:187.

Tattersall, E. A., Grimplet, J., DeLuc, L., Wheatley, M. D., Vincent, D., Osborne, C., Ergül, A., Lomen, E., Blank, R. R., Schlauch, K. A., Cushman, J. C., and G. R. Cramer. 2007. Transcript abundance profiles reveal larger and more complex responses of grapevine to chilling compared to osmotic and salinity stress. Funct Integr Genomics 7(4):317-33.

Vincent, D., Ergül, A., Bohlman, M. C., Tattersall, E. A., Tillett, R. L., Wheatley, M. D., Woolsey, R., Quilici, D. R., Joets, J., Schlauch, K., Schooley, D. A., Cushman, J. C., and G. R. Cramer. 2007. Proteomic analysis reveals differences between Vitis vinifera L. cv. Chardonnay and cv. Cabernet Sauvignon and their responses to water deficit and salinity. J Exp Bot 58(7):1873-92.


34

Grapevine Nursery Practices and Effects on Petri Disease and Young Esca

W. D. Gubler and A. EskalenDepartment of Plant Pathology, University of California, Davis, CA 95616.

Petri disease and young esca are caused by the endophytic fungi Phaeomoniella. chlamydospora and Pheaoacremonium aleophilum (Tognonia minima). These fungi have evolved with grapevine for thousands of years and due to their relationship with grapevines, we probably will never be able to completely rid the vines from these pathogens. However, research has shown that we might be able to reduce the severity of infection in nursery plants by use of fungicide dips prior to starting the plant making process. Several fungicides were tested on naturally infested dormant propagation materials. Prior to grafting, the dormant cuttings of various rootstock varieties were obtained from naturally infected grapevines and soaked for half an hour in 50 l suspensions of either Aliette (200ml/100L), Kocide-2000 (500gr/100ga), Cabrio330gr/100ga, Captan-80 4lb/100ga, Elevate 4lb/100ga, Vangard 10 oz/100ga, Hot Water 50 °C/30min, Lime Sulfur 20%, Procure 8oz/100ga, Scala 20 oz/100ga, Rally 6 oz/100ga, Switch 15 oz/100ga, Thiram 8oz/100ga, Topsin-M 5lb/ 100ga, and tap water (untreated control). Treatments were applied with and without Pentrabark. Treated cuttings were then grafted (Freedom x Crimson and Couderc 3309 x Thompson seedless). One month after grafting, twenty-five grafted cuttings were visually evaluated for shoot length (cm), Root length (cm), extent of vascular discoloration (cm), and isolation of Phaeaomoniella. chlamydospora, Phaeoacremonium. aleophilum (%) and Cylindrocarpon spp.

Results in 2007 showed that some fungicide treatments gave excellent control of esca pathogens in nursery stock. Based on isolation of Pa. chlamydospora, Pm. aleophilum and Cylindrocarpon spp. from discolored vascular tissue of cuttings, the following treatments resulted in reduced infection: Cabrio, Vangard, Lime sulfur, Procure, Thiram, Switch, Rally and Topsin M. and hot water applications. While it was shown in these studies that fungicides can reduce the presence of the esca and black foot pathogens in nursery production, non of these pathogens were completely eliminated. However, it seems that a reduction in degree of pathogen invasion into the nursery material does make stronger plants.


35

Effectiveness of Preharvest Applications of Fungicides on Preharvest Bunch rot and Postharvest Sour rot of ‘redglobe’ Grapes

Hashim-Buckey, J.1, Mlikota Gabler, F.2, Mansour, M. F.2, Schrader, P.1, Pryor, M.1, Margosan, D. A.2, and Smilanick, J. L.2

1UC Cooperative Extension Kern County, 1031 South Mount Vernon Avenue Bakersfield, CA 93307 2USDA ARS, San Joaquin Valley Agricultural Sciences Center, 9611 S. Riverbend Ave., Parlier CA 93648

Postharvest sour rot of ‘Redglobe’ grapes, also called “non-Botrytis slip skin”, “breakdown disorder”, “soft tissue breakdown”, or “melting decay” has affected this cultivar worldwide. The disorder causes berries to discolor, split, lose internal structure, and decay from veraison to harvest (Cameron at al. 1997) and later in storage. Symptoms were caused by several yeasts and bacteria (Crisosto 2001, Morgan and Mi-chailides 2004, and Palou et al. 2005), some of which are resistant to SO2 fumigation (Palou et al. 2005). Symptoms develop more rapidly under warm conditions (in several days) than during cold storage (about one month). Organisms isolated differed among the investigators, but all are common microbes found in vineyards and they rarely infect other cultivars. We evaluated the effectiveness of preharvest applications of registered fungicides on preharvest bunch rot and postharvest sour rot of ‘Redglobe’ grapes.

Materials and Methods Experiments were conducted in a commercial vineyard near Delano. The canopy of this vineyard was not dense and the clusters were relatively exposed. It was approximately 20 years old, bilateral cordon trained, spur pruned, and drip irrigated. The vines were girdled and treated with gibberellic acid, so the berry size was large (10-12 g). Each replicate plot had 6 vines. Treatments were applied to 4 replicate plots in 2006 and to 5 replicate plots in 2007. Thiophanate methyl (Topsin M® 70 WP), iprodione (Rovral®), cyprodinil (Vangard® WG), pyraclostrobin+boscalid (Pristine®), pyrimethanil (Scala™ SC), fenhexamid (El-evate® 50 WDG), captan (Captan 50 WP), potassium bicarbonate (Kaligreen®), copper hydroxide (Kocide® DF), Bacillus subtilis (Serenade® MAX), and paraffinic oil (JMS Stylet Oil®)were applied at maximum ap-proved rates and water volume of 200 gallons per acre by an air-blast sprayer. All except the JMS Stylet oil contained Latron B1956 at 4 oz/100 gal. In 2006, one (2 wk before harvest) or two (prior to bunch closure and 2 wk before harvest) applications were done. Three boxes were filled from each plot. In 2007, two identical complete block design experiments evaluated the 5 spray regimes. Bunch rot before harvest was evaluated on August 7 and August 30, 2007. Clusters were classified as having bunch rot if two or more adjacent berries were infected and dripping. At harvest three boxes were prepared from each plot, and the grapes were harvested by hand and placed into clean boxes. The boxes were stored for 5 wk in 2006 and 11 wk in 2007 at 0oC in a commercial facility with weekly SO2 fumigation to minimize interfer-ence by B. cinerea. After storage, the prevalence of sour rot and other decay was recorded. An analysis of variance was applied to arcsin of the square root of the proportion of infected berries, followed by Tukeys HSD at P = 0.05 to separate means.

Results and DiscussionIn 2006, Pristine, JMS Stylet-Oil, and Vangard significantly reduced bunch rot, however, postharvest sour rot was high and the treatments could not be separated at P < 0.05 (Table 1). At a P value of 0.10, howev-er, JMS Stylet-Oil, Pristine, Vangard, or Scala reduced postharvest sour rot by about 50%. JMS Stylet-Oil left a shiny residue that was visible for about 3 wk after application. In 2007, 2 of 3 programs with Pristine, Vangard, or Scala significantly reduced preharvest bunch rot by about 50% (Table 2). Significant reduc-tions in postharvest sour rot were caused by two applications of Scala and one of Pristine.

One benefit of the fungicide programs was a reduction in summer bunch rot, from 49% among untreated clusters before harvest to as low as 22%. This is a substantial increase in yield, berry quality, and the speed of harvest, because harvesters would have less trimming to do. Control of postharvest sour rot was significant but the magnitude of reduction was not large, from 0.39% among untreated berries to 0.23% among those berries treated with the best fungicide regime. Rooney-Latham et al. (2007) reported Switch, Scala, and Pristine applications reduced postharvest sour rot, which corroborates our findings.


36

Table 1. ‘Redglobe’ 2006 trial. Influence of one early application of fungicides on the incidence of summer bunch rot and the percentage of perfect clusters assessed in the vineyard before harvest and ‘Redglobe’ postharvest sour rot (%) stored 35 days at 0oC with weekly SO2 fumigation before examination. Perfect clusters were those with a rating of zero, which indicated no infections were present.

Postharvest decay (%)** Perfect Late onlyx Early & latey Bunch rot (%)* clusters (%) application application Data combinedz

Control 0.767 a 37.5 2.15 a 2.12 a 2.14 aKocide 0.767 a 40.0 1.59 ab 1.43 abc 1.51 abc Elevate 0.717 a 38.3 1.21 ab 2.00 ab 1.61 abCaptan 0.700 a 39.2 1.57 ab 1.60 abc 1.59 abcSerenade 0.658 a 41.7 1.15 b 1.56 abc 1.35 bcKaligreen 0.650 ab 42.5 1.15 b 1.56 abc 1.35 bcScala 0.608 abc 48.3 1.12 b 0.73 c 0.93 cPristine 0.492 bcd 55.0 1.01 b 1.25 c 1.13 cJMS Stylet-Oil 0.475 cd 57.5 1.18 b 1.17 c 1.17 bcVangard 0.350 d 67.5 1.72 b 0.84 c 1.28 bc*Ratings: 0=No infection, 1=1-5% infection, 2=6-25%, 3=26-50%, 4=51-75%, 5=76-100%. Values are means of 4 plots with 30 clusters examined in each. **Early application prior to bunch closure; late application 14 days before harvest. Values are means of 4 replicates of 2 to 3 boxes containing 9 cluster bags. None are significant at P-value of 0.05. Values with unlike letters differ at P-values footnoted: xP-value of 0.227 yP-value of 0.065 zP-value of 0.108.

Table 2. ‘Redglobe’ 2007 trial. Vineyard experiment to evaluate fungicide regimes to control of preharvest vineyard bunch rot and postharvest sour rot. Three boxes with eight cluster bags were prepared from each replicate plot. The boxes were stored at 0.5oC with weekly sulfur dioxide fumigation and examined 11 weeks after harvest, when the number of infected berries was counted.

Fungicide applications Bunch rot (%)* Postharvest decay (%)** After flowering Bunch 2 wk before closure harvest Aug 7 Aug 30 Sour rot Total decay1. water water water 8.3 a 49.0 a 0.39 ab 0.75 a2. JMS stylet oil JMS stylet oil Serenade 6.3 ab 41.6 ab 0.41 a 0.75 a3. Pristine Vangard Pristine 1.0 c 27.6 bc 0.25 bc 0.50 b4. Vangard Pristine Vangard 2.6 bc 35.0 ab 0.26 bc 0.52 b5. Scala Pristine Scala 3.6 ab 22.0 c 0.23 c 0.54 ab*Each value is the mean of 300 clusters examined. Clusters were classified as having bunch rot if two or more adjacent berries were infected. ** Values are means of 30 boxes. Values with unlike letters are significantly different.

Literature citedCameron, I. J., Woods, W., and Wood, P. 1997. Berry Rot Disease in Redglobe Table Grapes. Abstract.

International Table & Raisin Grape Symposium, Cape Town, South Africa. Crisosto, C., 2001. Isolation and identification of the organisms that cause Redglobe table grape breakdown

in California. 2001 CTGC Progress Report. Michailides, T. J., Morgan, D. P., Pelts, D., and Peacock, B. 2000. Infection of California table grapes and

detection and significance of symptomless latent infection by Botrytis cinerea. Abstracts of the XII International Botrytis symposium, Reims, France, P48.

Palou, L., Crisosto, C., Driever, G., Basinal, L., and Garner, D. 2005. In vitro resistance of postharvest table grape pathogens to sulfur dioxide fumigation. Phytopathology 95:S79 (Abstr.)

Rooney-Latham, S., Janousek, C.N., and W. D. Gubler. 2007. The use of various pre-harvest practices for the management of “Sour Rot” and “Non-Botrytis Slip Skin” of Red Globe table grapes. Phytopathology 97: S101.


37

Mapping the Dagger Nematode, Xiphinema index, resistance Gene

Chin-Feng Hwang*, Kenong Xu, Rong Hu, Summaira Riaz and M. Andrew WalkerDepartment of Viticulture and Enology, University of California, Davis, CA 95616

Vitis vinifera is susceptible to a wide range of pests and diseases including grapevine fanleaf virus (GFLV) and its dagger nematode vector, Xiphinema index. This virus/nematode complex causes fanleaf degeneration, which is considered to be one of the most severe viral diseases of grape. The virus spreads through propagation with virus-infected stock and by the feeding of X. index, which moves GFLV by feeding on root tips. Chemical control of X. index in the vineyards has been inefficient and no longer been recommended because of the high cost, its ineffectiveness and the nematicides’ detrimental effects on the environment (Raski and Goheen 1988). Therefore, resistance to X. index has been an important objective in grape rootstock breeding programs. We have previously demonstrated that resistance to X. index derived from V. arizonica is controlled by a major QTL, XiR1, on chromosome 19 (Xu et al. 2008). Genetic studies that lead to the isolation and characterization of genes conferring resistance to X. index are expected to have immediate impact on our understanding of the resistance mechanisms and help control the viral vector X. index. In this report, we are presenting the development of high resolution genetic and physical maps in the XiR1 region.

Materials and MethodsThree mapping populations of 1,375 F1 genotypes were used to construct the high-resolution genetic map of the XiR1 QTL region. The first was the 9621 population derived from D8909-15 × F8909-17, in which the XiR1 QTL was initially identified. We have expanded the 9621 population to 943 F1 individuals. The second was population AT0023 consisting of 178 F1 individuals from a cross D8909-15 × V. vinifera B90-116. The third was population 05384 consisting of 253 F1 individuals obtained from a cross D8909-15 × V. vinifera Airen. The common female parent D8909-15 is the source of resistant to X. index, whereas all three male parents F8909-17, V. vinifera B90-116 and V. vinifera Airen are susceptible. D8909-15 was a selection derived from a cross V. rupestris A. de Serres × V. arizonica b42-26. The maternal grandparent V. rupestris A. de Serres is also susceptible to X. index while the paternal grandparent V. arizonica b42-26 is highly resistant to X. index.

Results and DiscussionThe XiR1 major QTL was previously mapped near marker VMC5a10 on chromosome 19, and the putative region of XiR1 was located within a 5.6 cM interval between two markers VNG3a10 and M4F3F (Xu et al. 2008). To physically locate XiR1, VMC5a10 – the co-segregating simple sequence repeat (SSR) marker, was used to screen two bacterial artificial chromosome (BAC) libraries: one constructed from a resistant source D8909-15 and the other from the susceptible cultivar Cabernet Sauvignon (developed by E&J Gallo Co.). A total of 21 BAC clones were identified and 9 markers tightly linked to XiR1 were developed from the BAC ends (Figure 1A). To fine-scale map the XiR1 region, the two flanking markers VMC3a10 and M4F3F were used to identify informative recombinant genotypes from the three mapping populations 9621, AT0023 and 05384. Genotypic data showed that the two markers segregated normally with an expected 1:1 ratio (χ2=1.34, P=0.10-0.25 for VMC3a10, and χ2=0.16, P=0.50-0.75 for M4F3F) in the three combined populations. Of 1,375 individuals analyzed, 99 were identified as recombinants within the interval. The 99 recombinants were further evaluated for X. index resistance and revealed 61 resistant and 38 susceptible. When the location of the newly developed markers and nematode assay results were combined, 10 key recombinants were identified in the XiR1 region. The XiR1 locus was delimited in an interval of 0.51 cM (7 recombinants) between the two closest flanking markers 1N2R3b and M4F3R (Figure 1B). In addition, sequence analysis of a BAC clone from the resistant source is in progress and will be presented.


38

ReferencesRaski DJ, Goheen AC (1988) Comparison of 1,3-dichloropropene and methyl-bromide for control of

Xiphinema index and grapevine fanleaf degeneration complex. Amer. J. Enol. Viticult. 39:334-336Xu K, Riaz S, Roncoroni N, Jin Y, Hu R, Zhou R, Walker MA (2008) Genetic and QTL analysis of

resistance to Xiphinema index in a grapevine cross Theor. Appl. Genet, 116: 305-311.

Figure 1: Physical maps of the XiR1 region and Schematic representation of genotypes for 10 key recombinant plants.

(A). High-resolution genetic map of XiR1 locus on chromosome 19. (B). The solid bars stand for the D8909-15 chromosomal segments originated from V. arizonica b42-26 resistant to X. index (“R” genome origin) and the open bars are for those from V. rupestris A. de Serres (“S” genome origin). The crossover break-points were shown by the junctions between the solid and open bars.

AcknowledgementsThe authors gratefully acknowledge research support from the California Grape Rootstock Improvement Commission, American Vineyard Foundation and the Louis P. Martini Endowed Chair funds.


39

Grapevine leafroll disease (GLD) is an economically important virus disease of grapevines worldwide (Martelli, 2002). At least nine (and possibly ten) Grapevine leafroll-associated viruses (GLRaVs), desig-nated as GLRaV-1 to -9 in the order of their discovery, have been reported in GLD-affected grapevines (Gugerli, 2003). Among them, GLRaV-1, -2, -3, -4, -5, and -9 have so far been documented in the Pacific Northwest (PNW) region vineyards (Martin et al., 2005; Naidu et al., 2006). These viruses have been found as single or mixed infections in grapevines showing GLD symptoms.

GLRaV-1 is one of the most important viruses infecting grapevines in many countries and known to cause reduction of yield (Habili et al., 1997). The virus is 17,647 nucleotides in length and contains ten open reading frames in two blocks, the replicase gene block and the quintuple gene block (Fazeli and Rezaian, 2000). Among the grapevine-infecting closteroviruses, GLRaV-1 is ‘unique’ in that the virus genome contains two minor copies of the coat protein (CP) called CP duplicate (CPd1 and CPd2, respectively). In-tra-species genetic diversity in GLRaV-1 has been documented by Little et al. (2001) and Kominek et al., 2005). As part of understanding the molecular diversity of GLRaVs, we have initiated studies on molecular variability of GLRaV-1 in PNW region vineyards.

Materials and MethodsA total of seven GLRaV-1 isolates from four wine grape cultivars (Chardonnay, Pinot Noir, Lemberger and Cabernet Savignon) and two ornamental grapes were used in this study. Samples were initially tested by ELISA using antibodies specific to GLRaV-1 from a commercial source (Bioreba AG, Reinach, Germany) To determine molecular variability, a 398 nucleotide (nt) fragment specific to CPd2 and a 633 nt fragment specific to the ORF 9, located towards the 3’ end of the virus genome, were amplified by one tube-one step reverse transcription-polymerase chain reaction (RT-PCR). Primers CPd2/F (5’- GTTACGGCCCTTT-GTTTATTATGG) & CPd2/R (5’- CGACCCCTTTATTGTTTGAGTATG) and LR1-9/F (5’- CGATGGCGT-CACTTATACCTAAG) & LR1-9/R (5’- CACACCAAATTGCTAGCGATAGC) were used to amplify sequenc-es specific to CPd2 and ORF 9, respectively. The amplicons were cloned into pCR2.1 vector (Invitrogen Corp, Carlsbad, CA). Three independent clones were sequenced for each isolate in both orientations and a consensus sequence obtained. Nucleotide sequences were edited and pair wise comparisons made us-ing Vector NTI Advance10 software (Invitrogen). Multiple sequence alignments and phylogenetic analyses were performed by the neighbor-joining method using molecular evolutionary genetics analysis (MEGA) software version 4.0 (Tamura et al., 2007). A consensus phylogram was generated using the same pro-gram and 1000 boot strap values. Corresponding sequences of other GLRaV-1 isolates available in the GenBank were included in these analyses.

Results and DiscussionsIn ELISA, all nine GLRaV-1 isolates showed positive reaction with antibodies available from a commercial source. DNA fragments of expected size for CPd2 and ORF 9 were amplified from all nine isolates. In pair wise comparisons, CPd2 sequences of the nine GLRaV-1 isolates showed nucleotide (nt) sequence iden-tities between 93 and 99% and amino acid (aa) sequence identities between 89 and 100%. A comparison of these sequences with corresponding sequences available in the GenBank showed nt and aa sequence

Occurrence of Two Distinct Molecular Variants of Grapevine Leafroll-Associated Virus-1 in the Pacific Northwest Vineyards

Gandhi Karthikeyan,1 Olufemi J. Alabi,1 Tefera Mekuria,1 Robert R. Martin2 and Rayapati A. Naidu1

1Department of Plant Pathology, Washington State University Irrigated Agriculture Research and Extension Center, Prosser, WA 99350

2USDA-ARS Horticultural Crops Research Laboratory, Corvallis, OR 97330


40

identities between 85% & 88% and 80% & 84%, respectively, with an Australian isolate (GenBank acces-sion no. AF195822), 80-84% nt and 74-82% aa identities with two isolates from Japan (GenBank acces-sion nos. AB222849 and AB222850) and 80-83% nt and 72-78% aa sequence identities with an isolate from China (GenBank accession no. EF583823).

In pair wise comparisons, the ORF 9 sequences of GLRaV-1 isolates showed nt sequence identities be-tween 83 and 100% and aa sequence identities between 85 to 100%. A comparison of these sequences with corresponding sequences of an Australian isolate (GenBank accession no. AF195822) showed nt and aa sequence identities between 80% and 89% and 80% and 88%, respectively. Phylogenetic analy-ses of ORF 9 revealed that all nine GLRaV-1 isolates segregated into two groups with 82-83% nt and 82-85% aa identity between the groups.

These results indicate the presence of two distinct molecular variants of GLRaV-1 in Washington State vineyards. Further studies are in progress to gain a comprehensive understanding of genetic diversity of GLRaV-1 in the region.

AcknowledgmentsThe authors would like to thank USDA-ARS Northwest Center for Small Fruits Research and USDA-CS-REES Viticulture Consortium-West and Washington State Wine Commission for funding this study.

References:Fazeli FC, Rezaian MA (2000) Nucleotide sequence and organization of ten open reading frames of the

grapevine leafroll-associated virus 1 genome and identification of three subgenomic RNAs. Journal of General Virology 81,605-615.

Gugerli, P. (2003). Grapevine leafroll and related viruses. Extended abstracts 14th Meeting ICVG, Locorotondo (Bari), Italia, 12–17 September, 2003, 25–31.

Habili N, Fazeli CF, Rezaian MA (1997) Identification of a cDNA clone specific to grapevine leafroll-associated virus 1, and occurrence of the virus in Australia. Plant Pathol. 46: 516–522

Komínek P, Glasa M, Bryxiová M (2005) Analysis of the molecular variability of Grapevine leafroll-associated virus 1 reveals the presence of two distinct virus groups and their mixed occurrence in grapevines. Virus Genes 31, 247-255.

Little, A., Fazeli, C.F. and Rezaian, M.A., 2001. Hypervariable genes in Grapevine leafroll associated virus 1. Virus Research 80: 109-116.

Martelli G.P., 2000. Major Graft-transmissible diseases of grapevines: Nature, diagnosis, and sanitation. American Journal of Enology and Viticulture, 51, 42-48.

Martin, R.R., Eastwell, K.C., Wagner, A., Lamprecht, S., and Tzanetakis, I.E., 2005. Survey for viruses of grapevine in Oregon and Washington. Plant Disease 89:763-766.

Naidu, R.A., Soule, M.J. and Jarugula, S. 2006. Single and mixed infections of Grapevine leafroll-associated viruses in Washington State vineyards. Phytopathology 96:S83.

Tamura K, Dudley J, Nei M, Kumar S 2007 MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596-1599.


41

Propagation Success of Grapevines Infected with Xylella fastidiosa

Michael Krawitzky*, Thayne Montague, and Ed HellmanTexas AgriLife Research and Extension Center, Lubbock, TX 79403-6603

Department of Plant and Soil Science, Texas Tech University, Lubbock, TX 79409-2122 *[email protected]

Pierce’s Disease (PD) of grapes, caused by the xylem limiting bacterium Xylella fastidiosa, is typically fa-tal to varieties of Vitis vinifera. Pierce’s Disease is commonly vectored by xylem-feeding insects, including the glassy-winged sharpshooter, but other vectors may also spread the disease. One recent report docu-mented the successful transmission of X. fastidiosa with pruning shears (Rayda, et al., 2007). In addition, Meyer et al. (2002) report graft transmission of X. fastidiosa may also be possible. Conventional wisdom assumes because PD is fatal to grapevines, cuttings taken from X. fastidiosa infected grapevines would not survive the asexual propagation process, and therefore would not be able to produce a marketable plant. However, it seems likely cuttings taken from X. fastidiosa infected vines would root, but the success and survival of cuttings taken from X. fastidiosa infected grapevines has not been reported. The objec-tive of this experiment was to investigate rooting success of asexually propagated cuttings taken from X. fastidiosa infected grapevines and determine if rooted cuttings can survive and produce viable plants for vineyard establishment.

Cuttings were taken January 2008 from dormant Vitis vinifera cv. Merlot and cv. Cabernet Sauvignon grapevines. Vineyards which provided propagation wood were located in the Hill Country and Gulf Coast regions of Eastern Texas where PD is problematic. Over several previous growing season grapevines were determined to be asymptomatic or symptomatic for PD symptoms (David Appel, personal commu-nication). Prior to our research, symptoms of PD were recorded on each grapevine in each vineyard and given a rating on a scale from 1-6 (1 being asymptomatic and 6 being highly symptomatic). Asymptomatic cuttings were taken only from grapevines with a 1 rating, while symptomatic cuttings were taken from grapevines with ratings ranging from 3 to 5 (grapevines with a rating of 6 died and had been replaced). Prior to taking cuttings, all pruning instruments were spayed till drip with 70% isopropyl alcohol (Ryada, et al., 2007). Spurs and cuttings taken from each grapevine were labeled. Cuttings were transported on ice in coolers to Texas Tech University in Lubbock, Texas. Upon arrival, cuttings were transplanted into clear plastic tubs (119 x 57 x 61 cm) filled with a standard greenhouse medium and allowed to root under green-house conditions. A data logger recorded greenhouse climate data and medium soil temperature. During rooting daily observations of bud break were made. At the conclusion of six weeks cuttings were uprooted and evaluated. Rooting percentage, the number of roots, root length, root rating (0 = dead, 5 = more than 30 roots), the number of shoots, shoot length, and stem diameter were recorded for each cutting.

Rooting differences were found between grape varieties, vineyards, and PD symptomatic or asymptomatic grapevines. Asymptomatic Merlot vines from the Gulf Coast vineyard rooted at 67%. While symptomatic Merlot fines from the same vineyard had a rooting percentage of 26%. Cabernet Sauvignon vines from the Gulf Coast vineyard had rooting percentages of 48 and 70% (symptomatic and asymptomatic grapevines, respectively). For the Hill Country vineyard, Merlot symptomatic vines had a rooting percentage of 89%, while asymptomatic Merlot grapevines had a rooting percentage of 96%. Symptomatic Cabernet Sauvi-gnon grapevines from the Hill Country rooted at a percentage of 93%, while asymptomatic Cabernet Sau-vignon vines from had a rooting percentage of 90%. Other rooting and shoot data followed similar trends.

Our data indicate PD symptomatic grapevines have the ability to be propagated asexually through cut-tings. Future work will test source vines and rooted cuttings with Quantitative-PCR and ELISA for the presence of X. fastidiosa. In addition, future research will be conducted to determine long term survivabil-ity and viability of cuttings taken from PD symptomatic grapevines.

ReferencesMeyer, M., L. Kocisis, and A. Walker. 2002. Transmission of Pierce’s Disease by chip-budding and bench-

grafting. Am. J. Enol. Vitic. 53:248A.Rayda K. Krell, Elizabeth A. Boyd, Justin E. Nay, Yong-Lak Park, and Thomas M. Perring. 2007.

Mechanical and insect transmission of Xylella fastidiosa to Vitis vinifera. Am. J. Enol. Vitic. 58:211-216.


42

Detection and Differentiation of Pathogenic Agrobacterium vitis and A. tumefaciens in Grapevine using Multiplex Bio-PCr

Lucita Kumagai and Anna-Liisa Fabritius*Agri-Analysis LLC, 45133 County Road 32B, Davis, CA 95618

*[email protected]

Crown gall caused by Agrobacterium vitis and A. tumefaciens occurs in grape growing areas worldwide. Infected vines can harbor both pathogenic and nonpathogenic strains and remain symptomless until the vines are injured (Burr and Katz 1983, 1984). Injury can cause galls which interfere with the function of the vascular system of the plant and reduce its vigor and productivity. To limit the spread of crown gall in vineyards, it is important to test propagation materials and ensure they are free from pathogenic Agrobac-terium prior to planting. Polymerase chain reaction (PCR) is quickly replacing many of the slower tradi-tional methods of diagnosing Agrobacterium; however, many existing primers have limitations due to the genetic diversity of the Agrobacterium spp. For example, some primers that can detect pathogenic A. tu-mefaciens fail to consistently detect pathogenic A. vitis. Other primers are limited to detecting only specif-ic opine types of A. vitis and A. tumefaciens. Furthermore, certain primers fail to distinguish between the virulent and avirulent strains and some give amplifications that are not reproducible or are non-specific.

The purpose of this study was to compare available Agrobacterium primer sets and identify a more re-liable PCR test that can detect pathogenic A. vitis and A. tumefaciens in grapevine and differentiate between the two species. The specificity and reproducibility of several primers in detecting pathogenic strains were tested using colony and Bio-PCR. Virulence specific universal primers were selected in this study to detect the virD2, virC and virF regions of the Ti plasmid. The primer sets virD2A/2C (Haas et al. 1995) and VCF3/VCR3 (Suzaki et al. 2004) were used to detect the virD2 and the virC genes, respective-ly. A combination of virFF1/virFR2 and virD2S4F/virD2S4R (Bini et al. in press) was used in a multiplex PCR to detect the virF and virD2 regions in the most common opine types of A. vitis which are nopaline, octopine and vitopine types (Burr et al. 1998, Ride et al. 2000). In order to identify A. vitis strains and dif-ferentiate them from the A. tumefaciens strains, PGF/PGR (Szegedi and Bottka, 2002), a polygalacturo-nase specific primer set was used. Twenty-two strains and 17 Bio-PCR preps were included in this study. The pathogenicity of the strains was confirmed on tomatoes, tobacco and carrot disks.

Materials and MethodsTwenty-two young, randomly selected rooted benchgrafts from various California nurseries and one older vine from Virginia were tested. Out of 22 samples, 6 were symptomatic and 16 were asymptomatic. Fif-teen bacterial strains isolated from the samples and seven reference strains from Dr. Burr were tested. Bacteria were extracted from vascular tissue of galls, crown, roots and canes that were suspended in sterile dH2O for 1 hour at room temperature. A dilution series of 100–10-3 were made from the extract and 100μl of each dilution was plated on RS agar plates (Moore et al. 2001). The plates were incubated at 27°C. After four days, suspect colonies were subcultured and purified on Potato dextrose agar containing 0.5% calcium carbonate (Moore et al. 2001). For the single colony PCR reactions, one loopful of a 24-48 h culture suspended in 1 ml of extraction buffer (Osman and Rowhani, 2006) was used as a template. Template for the Bio-PCR reactions was made by suspending four day old growth on RS plates in 2 mls of extraction buffer. For the PCR reaction, 2 μl of template was used in a 25 μl reaction for PCR amplifica-tion and combined with 1X PCR buffer (20mM Tris-Cl, pH 8.4, 50mM KCL), 1X sucrose red dye solution (2% sucrose, 0.1mM crysol red), 0.5 μM of both forward and reverse primers, 5 mM DTT, 1.5mM MgCl2, 0.2 mM dNTPs, 0.5U Taq polymerase. The amplification was started with an initial denaturation step at 94°C, 5 min; followed by 35 cycles of (94°C for 1 min, primer-specific annealing temperature for 1 min, 72°C for 1 min); with a final extension at 72°C for 5 min. An annealing temperature of 43°C was used for virD2A/2C, 56°C for VCF3/R3 and PGF/R, and 60°C for the opine primers. PCR products were separated on 1.8% agarose gel via electrophoresis, stained with ethidium bromide and observed under UV. Strains were inoculated on tomato, tobacco or carrot disks to confirm their pathogenicity.


43

Results and DiscussionBased on this study, the new primer set VCF3/VCR3 developed by Suzaki et al. proved to be the most re-liable in detecting the pathogenic strains of A. vitis and A. tumefaciens in grapevine. VCF3/VCR3 detect-ed all the pathogenic strains in this study, whereas, virFF1/virFR2 and virD2S4R/virD2S4F failed to detect two A. vitis strains. Since the virFF1/virFR2 and virD2S4R/virD2S4F primers were made specifically to detect the octopine, nopaline, and vitopine types of A. vitis, the two strains that were not detected may be of variant opine type pointing out the possible limitations of these primer sets. VirD2A/virD2C primers con-sistently detected pathogenic A. tumefaciens but not the pathogenic A. vitis strains. VirD2A/virD2C failed to detect one pathogenic A. vitis strain and produced weak signals with two other A. vitis strains even un-der a low annealing temperature of 43°C. Similar findings were reported by Bini et al. They later showed that there are two different nucleotide sequences of the virD2 in A. vitis which may contribute to the inconsistencies of this primer set in detecting pathogenic A. vitis strains (Bini et al., in press). PGF/PGR primers detected both pathogenic and non-pathogenic strains of A. vitis but did not detect A. tumefaciens strains as expected.

Although the previous work done with the VCF3/VCR3 primers involved only single colony PCR of Agro-bacterium strains isolated from infected apple saplings, we found that this primer set worked just as ef-ficiently in detecting pathogenic Agrobacterium strains in grapevine using Bio-PCR, thereby eliminating the tedious step of subculturing and isolation of bacterial colonies. We found 100% correlation between the Bio-PCR and the corresponding single colony PCR results with VCF3/VCR3 primers. Furthermore, we discovered that by combining the PGF/PGR primers with the VCF3/VCR3, we were able to detect both pathogenic A. vitis and A. tumefaciens and differentiate between the two species in one multiplex Bio-PCR reaction. All the pathogenic A. vitis strains produced two bands (466 bp and 414 bp) whereas, all pathogenic A. tumefaciens strains produced only one band of 414 bp size. The pathogenicity of all the VCF3/VCR3 positive strains and some negative strains was confirmed on tomato, tobacco or carrot disks resulting in 100% correlation with the PCR results. Based on this preliminary study, the PGF/PGR, VCF3/VCR3 multiplex Bio-PCR is a faster and more sensitive assay that can be a valuable tool for large-scale diagnosis of crown gall in grapevine.

AcknowledgementReference strains were kindly provided by Dr.Thomas Burr.

ReferencesBini, F., Kuczmog, A., Putnoky, P., Otten, L., Bazzi, C., Burr, T.J., Szegedi, E. 2007 (in press). Novel

pathogen-specific primers for the detection of Agrobacterium vitis and Agrobacterium tumefaciens. Vitis

Burr, T., Bazzi, C., Sule, S., Otten, L. 1998. Crown gall of grape: Biology of Agrobacterium vitis and the development of disease control strategies. Plant Dis. 82:1288-1297

Burr , T. and Katz, B.H. 1983. Isolation of Agrobacterium tumefaciens biovar 3 from grapevine galls and sap, and vineyard soil. Phytopathology 73:163-165.

Burr , T.and Katz, B.H. 1984. Grapevine cuttings as potential sites of survival and means of dissemination of Agrobacterium tumefaciens. Plant Dis. 68:976-978.

Haas, J.H., Moore, L.W., Ream, W., Manulis, S. 1995. Universal PCR primers for detection of phytopathogenic Agrobacterium strains. Appl. Anvironm. Microbiol. 61:2879-2884.

Moore, L.W., Bouzar, H., Burr, T 2001. Agrobacterium. Pages 17-35 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd Ed., Schaad, N.W., Jones. J.B., Chun, W. (eds.), American Phytopathological Press, St. Paul, Minnesota.

Osman, F. and Rowhani, A. 2006. J. Virol. Methods 133: 130-136.Suzaki, K., Yoshida, K., Sawada, H. 2004. Detection of tumorigenic Agrobacterium strains from infected

apple saplings by colony PCR with improved PCR primers. J. Gen Plant Pathol 70:342-347.Szegedi, E. and Bottka, S. 2002. Detection of Agrobacterium vitis by polymerase chain reaction in

grapevine bleeding sap after isolation on a semiselective medium. Vitis 41:37-42.


44

Impact of Soil Properties on Nutrient Availability and Fruit and Wine Characteristics in a Paso robles Vineyard

J.J. Lambert1, R.A. Dahlgren2, M. Battany3, A. McElrone1, J.A. Wolpert3

1Department of Viticulture and Enology, 2Department of Land, Air and Water Resources, UC Davis 3UC Cooperative Extension, UC Davis, One Shields Avenue, Davis CA 95616

Soil physical and chemical properties affect vine nutrition and fruit composition in a way that directly im-pacts wine properties. There is renewed interest in the effect of soil nutrients, as influenced by soil type and soil mineralogy, on fruit and wine characteristics (Tomasi 2006, Andres de Prado 2007, Mackenzie, 2005). This is a continuing study of own-rooted Cabernet Sauvignon vines grown on four distinct soil types in the same Paso Robles vineyard. The soils were classified as Palexeralfs, Haploxeralfs, Haploxe-rolls and Haploxererts. The soils covered contiguous vineyard patches planted with the same cultivar, on its own roots, and managed uniformly. Mesoclimatic conditions and slope aspect were similar. Berries from the four blocks exhibited different sensory attributes, as determined by a tasting panel. This con-firmed earlier observations from an informal tasting made on small lot wines. To determine the influence of the four contrasting soil types on vine growth and wine chemistry, soils were analyzed for physical and chemical differences. The four soils exhibited important morphological differences in color, coarse frag-ment content, texture, water holding capacity, and hydraulic conductivity. The soils also showed important differences in chemical characteristics and nutrient availability. Differences in cation exchange capacity and cationic balance in the soil solution can affect nutrient availability to the vines, and likely contributed to the observed differences in the plant and fruit characteristics.

Materials and MethodsEight soil pits were excavated for description and sampling in April 2007. The soils were described fol-lowing the National Cooperative Soil Survey field description manual. Bulk samples were collected for chemical and physical analyses. A grid with 20 x 20 cm squares was constructed and positioned in the pit, encompassing the 1.80 meters between vines along the row. A similar grid was positioned across the row. Root distribution was recorded for each of the 72 grid squares for 4 of the profiles, to a depth of 1.2 meters. Samples of the soil were taken from each square for laboratory analyses. The pH, CaCl2 pH and electrical conductivity of a 1:1 saturated paste were recorded for each sample. Granulometric analyses were also performed for selected grid cells in the profile. TDR probes were positioned at 30, 60 and 90 cm within the profile, associated with a canopy thermometer. Suction lysimeters were installed in the soil and the soil solution collected at regular intervals during the growing season. Leaves were collected for tissue analysis at bloom, veraison and harvest. Grapes were harvested when ripe and small lot wines were made for analysis; berry samples were collected and frozen for later analyses. Pruning weights were measured in the fall season.

Results and Discussion• Soil physical and chemical characteristics revealed pronounced differences between the four differ-

ent soil types. Soil heterogeneity was primarily attributed to great variability in the soil parent material, alluvium from the Estrella River containing sand, silt, clay and coarse fragments. A second source of heterogeneity was attributed to differences in soil age.

• Mollisols were found on the upper parts of the topography, on block 52. These soils had calcic hori-zons, with remnants of laminar lime concretions below a more clayey surface horizon.

• Blocks 56 and 57 contained two related soil types. Flat surface remnants in Block 56 contained Palexeralfs, with an abrupt textural change and thicker argillic horizons dominated on the flat terrace remnants. Less developed Haploxeralfs, (Alfisol type II) with coarser surface textures and a higher proportion of coarse fragments, were found in shallow swales. These were shallower to an impeding layer than type I Alfisols.

• In block 53, swales were occupied by Vertisols, clayey throughout, and with high shrink-swell potential. • The range of colors within profiles and between pedons was quite broad, reflecting variation in organic

matter, carbonates and iron oxide content. Reaction with HCl indicated the presence of carbonates in two of the profiles. One soil was strongly calcareous.


45

• The four soil profiles showed distinct pH, buffering capacity and electrical conductivity. pH values ranged from 6.0 to 8.6, with average values between 7.6 and 8.0. In some of the profiles, pH values were higher than expected for soils with a given classification, likely reflecting the influence of cultiva-tion practices. The soils were well buffered, as expected for soils in this pH range.

• Soil nutrient analysis revealed low amounts of available nitrogen. This was reflected in a low amount of yeast available nitrogen (YAN) in the grape juice at harvest. All profiles exhibited high potassium reserves in the topsoil, reflecting a good supply from fertilization, but were K deficient in the subsoil. Phosphorus values were low in the Mollisol, with its high calcium content, as was K availability in the same profile.

• Soil electrical conductivity values were moderate but could peak higher locally, indicating potential soil salinity problems; this was likely due to insufficient leaching of salts in some profiles. Factors contribut-ing to high salt concentration included insufficient rainfall or water application, the presence of soil lay-ers impeding drainage, and high initial amounts of salts in certain profiles. Cations in the soil solution indicated a high proportion of sodium with respect to calcium, magnesium and potassium (Figure 1).

• Root distribution generally showed high densities near the surface, as anticipated for a drip irrigated vineyard. However, each soil type had a specific root distribution (Figure 2). Roots were most evenly distributed in the Vertisol, which was clayey throughout. Compacted clay or weakly cemented lay-ers in type II Alfisols tended to restrict root exploration of deeper soil layers. The density of fine roots generally increased in the upper part of argillic horizons in Alfisols with a coarser surface texture. The Mollisols had a greater root density in the subsoil due to heavier textured surface horizons.

• Vine vigor, which was moderate overall, tended to increase in swales, where runoff or soil internal drainage concentrated water, as well as in more clayey soils, such as profiles 2 and 6. This was re-flected in pruning weight differences. However, cluster weights were similar.

This ongoing project is currently examining the relationships between plant tissue characteristics, berry juice and soil chemistry for the four vineyard sites.

AcknowledgmentsJ. Lohr Winery, Paso RoblesAnji Perry, Viticulturist, J. Lohr WineryKim Adams, Viticulturist, J. Lohr WIneryAmerican Vineyard Foundation

ReferencesAndres-de-Prado, R., M. Yste-Rojas, X. Sort, C. Andres-Lacueva, M. Torres and R.M. Lamuela-Raventos.

2007. Effect of soil type on wines produced from vitis vinifera L. Cv. Grenache in commercial vine-yards. J. Agric. Food Chem. 55, 779 - 786.

Mackenzie, D.E. and A.G. Christy, 2005. The role of soil chemistry in wine grape quality and sustainable soil management in vineyards. Water science and technology , 51, 1, 27-37.

Tomasi, D., P. Belvini, G. Pascarella, P. Sivilotti, and C. Giulivo. 2006. L’effetto del suolo sulla resa e sulla qualita dei vitigni Cabernet Sauvignon, Cabernet franc e Merlot. VigniVini 33:59-65.

Figure 2. Root counts vary considerably by soil type.

Figure 1. Cations and anions in the soil solution.


46

Characterization and Identification of PD resistance Mechanisms: Analyses of Xylem Anatomical Structures and Molecular Interactions

of Host/Xylella fastidiosa

Hong Lin*1, Harsha Doddapaneni1,2, Felix B. Fritschi3 and M. Andrew Walker2

1Crop Diseases, Pests and Genetics Research Unit, USDA/ARS, Parlier, CA 93648, USA2Department of Viticulture and Enology, University of California, Davis, CA, 95616, USA

3Division of Plant Sciences, University of Missouri, Columbia 65211, USA

The xylem-limited bacterium Xylella fastidiosa (Xf) causes Pierce’s disease (PD) with the symptoms pri-marily due to the result of xylem vessel blockage in susceptible grapevines. Grapevine genotypes differ in their susceptibility/tolerance to Pierce’s disease (PD). This may be related to the concentration and presence or absence of chemical compounds in the xylem sap and/or due to anatomical features of the xylem. Experimental as well as anecdotal information indicates that a considerable range in tolerance to PD exists among grapevine genotypes. It appears that a number of Vitis as well as Muscadinia species have evolved mechanisms that allow them to tolerate infection by Xf. However, while it is often thought that many wild genotypes evolved tolerance mechanisms, it is also possible that it is the induction of a deleterious response by V. vinifera genotypes that renders them more susceptible than tolerant geno-types which may not respond to a challenge by Xf. Therefore, understanding the mechanisms underlying differential sensitivity is critical for the development of PD resistant grapes. The rich diversity of grapevine genotypes tolerant to PD is currently being utilized to serve as a source for PD resistance for breeders. However, while PD resistant species have been identified (Mortensen et al., 1977; Krivanek and Walker, 2004; Fritschi et al., 2007), the molecular mechanisms of resistance have not been identified. Breeding of resistant genotypes is likely the most sustainable means of combating PD. In order to generate highly PD tolerant grape cultivars, knowledge of the kind and function of resistance mechanisms is paramount. Therefore, our research focuses on • Host-pathogen interactions using comparative analyses of Xf population dynamics among a group of

grapevine genotypes. • Examination of xylem anatomical factors using microscopic approaches.• Evaluation of the effects of xylem saps from resistant and susceptible grapevines on planktonic growth,

biofilm formation and virulence-related gene expression in Xf.• Microarray global gene expression analysis of PD resistant and susceptible grapes in response to Xf

infection.Fourteen Vitis genotypes (V. aestivalis, V. arizonica/candicans, V. arizonica/girdiana, V. candicans, V. champinii, V. girdiana, V. monticola, V. nesbittiana, V. rufotomentosa, V. shuttleworthii, V. simpsonii, V. smalliana, V. tiliifolia, V. vinifera), one M. rotundifolia cultivar (Cowart) and three hybrids; 8909-15 (V. rupestris A. de Serres x V. arizonica/girdiana b42-26), 9621-67 and 9621-94 (D8909-15 x F8909-17 (V. rupestris A. de Serres x V. arizonica/candicans b43-17), were evaluated in this study. Estimated Xf con-centrations in the stem tissue sampled 113 d post-inoculation varied greatly among the 18 genotypes in-vestigated. The concentration of Xf in stem tissue is well suited to measure the level of PD resistance and corresponds well to field resistance (Krivanek and Walker, 2005; Ruel and Walker, 2006; Fritschi et al., 2007). Therefore, screening grape genotypes under greenhouse conditions allows for rapid and efficient evaluation of numerous plants for PD resistance. For M. rotundifolia, V. girdiana, V. arizonica/candicans, V. candicans, V. shuttleworthii, V. nesbittiana, and V. arizonica/girdiana, the estimated Xf concentration in the stems did not exceed the positive threshold and was less than 2.1 x 106 cells g-1 tissue. In addition, 9621-67, a highly PD-resistant member of a genetic mapping population (Doucleff et al., 2004), had the lowest average Xf concentration among stem tissues. Vitis simpsonii also had very low Xf concentrations (<2.1 x 106 cells g-1 tissue). Average stem Xf concentrations in the remaining genotypes exceeded 5.0 x 106 cells g-1 tissue. PD symptoms are primarily the result of xylem vessel blockage in susceptible grape-vines (Goodwin et al., 1988a, 1988b). Stem internode and petiole tissues from infected and uninfected control plants of four grape genotypes differing in PD susceptibility (Vitis vinifera, V. rufotomentosa, V. smalliana, and V. arizonica/candicans) were examined using scanning electron microscopy (SEM). Tylo-ses, fibrillar networks and gum plugs were observed in lumens of tracheary elements in petioles and inter-nodes of both water-inoculated control plants and Xf–inoculated plants of all genotypes. Among infected plants, tylose formation in internodes was lowest in V. arizonica/candicans and did not differ among the other three genotypes. Infection with Xf strongly induced tylose formation in V. vinifera and V. smalliana


47

but not in V. arizonica/candicans. Limiting the spread of Xf infection by xylem conduit occlusions does not appear to be the mechanism conferring PD resistance or tolerance to V. arizonica/candicans, V. smal-liana, or V. rufotomentosa. In contrast, the strong induction of tyloses may be detrimental rather than ben-eficial for V. vinifera survival after Xf infection (Fritschi et al., 2008).

Because there is direct contact between xylem sap and Xf, altering xylem sap composition presents a promising venue to interfere with successful pathogen colonization of the host. A bioassay system was developed to investigate the effects of xylem sap from PD resistant and susceptible grape genotypes on Xf growth, biofilm formation and virulence-related gene expression in vitro. The results of the in vitro study showed that the susceptible xylem sap provided better support for bacterial growth and biofilm formation than resistant xylem sap. A study of pathogenicity and virulence-related gene expression using RT-PCR revealed that glucanase, protease, and a number of virulence genes were differentially expressed in re-sponse to the resistant and susceptible xylem sap treatments. These results suggest that differences in xylem cell wall properties and sap chemical composition between PD resistant and susceptible grapes may affect Xf pathogenesis.

Plants respond to pathogen attack through a variety of signaling pathways consisting of a large number of regulatory as well as effector genes. Comparison of the PD susceptible V. vinifera transcriptional respons-es to Xf infection with those from resistant (9621-67) and susceptible (9621-94) V. arizonica hybrids, sug-gests common as well as distinct responses. Transcript profiling has shown that grape plant response to Xf infection is different among species, tissues and between resistant and susceptible siblings, and the stages of infection. While broad spectrum and presumably non-specific plant responses were observed in V. vinifera species, including the induction of transcripts such as WRKY transcription factor 30, CBF like transcription factor, NDR-1 like protein, and phi-1 (an AvrPto-Pto, or AP responsive gene), a majority did not overlap with the response of the resistant genotype (Lin et al., 2007).

The goal of this study was to identify and characterize the physiological, anatomical, biochemical and molecular events in the grape/Xf interaction between resistant and susceptible genotypes and among dif-ferent tissue types. Our results have clearly shown differences in response of Vitis species to Xf infection. In general, tolerant/resistant genotypes tend to have lower Xf cell counts in the xylem, even at late stages of disease development, and have fewer tyloses than susceptible genotypes. In fact, an over-induction of responses of the susceptible genotypes such as V. vinifera may, at least in part, be the cause their sen-sitivity to PD. Results of the genome-wide transcriptional studies further support this differential response hypothesis and have helped identify a small group of putative genes involved in signal transduction and defense response pathways in response to Xf infection. Similarly, the xylem sap studies have shown that in vitro Xf response varies with the nature of xylem sap treatment and that such a response is linked to the differential expression of virulence genes.

ReferencesDoucleff, M., Y. Jin, F. Gao, S. Riaz, A.F. Krivanek, and M.A. Walker. 2004. A genetic linkage map of

grape, utilizing Vitis rupestris and Vitis arizonica. Theor. Appl. Genet. 109:1178-1187.Fritschi, F., H. Lin, and M. A. Walker. 2007. Xylella fastidiosa Population dynamics in grapevine genotypes

differing in susceptibility to Pierce’s disease. Am. J. Enol. Vitic. 58:326-332Fritschi, F., H. Lin, and Walker, M.A. 2008. Scanning electron microscopy reveals different plant-pathogen

interaction pattern in four Vitis genotypes infected with Xylella fastidiosa. Plant Dis. 92: 276-286Kirvanek, A.F., and M.A. Walker. 2005. Vitis resistance to Pierce’s Disease is characterized by differential

Xylella fastidiosa populations in stems and leaves. Phytopathology 95:44-52. Lin, H., H. Doddapaneni, Y. Takahashi and M. A. Walker. 2007. Comparative analysis of ESTs involved in

grape responses to Xylella fastidiosa infection. BMC Plant Biology. doi:10.1186/1471-2229-7-8.Goodwin, P.H., DeVay, J.E., and Meredith, C.P. 1988a. Roles of water stress and phytotoxins in the devel-

opment of Pierce’s disease of the grapevine. Physiol. Molec. Plant Pathol. 32:1-15.Goodwin, P.H., DeVay, J.E., and Meredith, C.P. 1988b. Physiological responses of Vitis vinifera cv. Char-

donnay to infection by the Pierce’s disease bacterium. Physiol. Molec. Plant Pathol. 32:17-32Mortensen, J.A., L.H. Stover, and C.F. Balerdi. 1977. Sources of resistance to Pierce’s Disease in Vitis. J.

Am. Soc. Hort. Sci. 102:695-697. Ruel, J. J., and Walker, M. A. 2006. Resistance to Pierce’s disease in Muscadinia rotundifolia and other

native grape species. Am. J. Enol. Vitic. 57:158-165.


48

Differential Gene Expression During Chilling requirement Fulfillment in Vitis riparia Buds

Kathy Mathiason, Dong He, Jérôme Grimplet, Anne FennellDept. of Horticulture, Forestry, Landscape, & Parks, South Dakota State University

NPB 201, Box 2140A, Brookings, SD 57007, USA

The native grape, Vitis riparia, is a woody perennial vine that cycles from active growth to dormancy to survive winter conditions. Once dormant, the overwintering buds require a certain amount of chilling (hours below 7°C) before they will break dormancy and begin to grow. Custom cDNA microarrays were utilized to examine differential gene expression during the acquisition of chilling. Buds exposed to 4°C were collected after 0, 500, 1000, 1500, and 2000 hours of chilling. Three-node cuttings collected concurrently with buds were exposed to growing conditions (25°C with constant lights) to monitor depth of dormancy. Complete (100%) bud break was achieved after 1500 hr of chilling; however, 2000 hr of chilling significantly increased rate of bud break.

Microarray data analysis (R package LIMMA) revealed 1469 array features that were significantly differentially expressed (p-value < 0.05) when 1000, 1500, and 2000 hr time points were compared to 500 hr of chilling. The majority were involved in metabolism, cell defense and stress response, and genetic information processing. The number of significantly expressed array features increased with accumulation of chilling. A core group of 130 features were down-regulated at all time points. The majority of up-regulation in gene express occurred at the end of the chilling period. Expression of candidate genes, as determined by real-time PCR, correlated with the microarray expression analysis. Transcriptomic profiles obtained from this study will contribute to the understanding of the molecular mechanisms involved in the grape plant’s fulfillment of chilling requirement and preparation for release from dormancy.


49

The Effect of Crop Load and Extended ripening on Vine Balance and Wine Quality in Cabernet Sauvignon

C. McDonnell*1, 2, Dr. Peter R. Dry1, Dr. Robert L.Wample3 and Dr. Susan Bastian1

1Discipline of Wine and Horticulture, School of Agriculture, Food and Wine, University of Adelaide, Waite Campus PMB 1, Glen Osmond, SA 5064 [email protected]

2 J. Lohr Vineyards and Wines, 6169 Airport Rd. Paso Robles, CA 93446 [email protected] of Viticulture and Enology, California State University, Fresno, Viticulture and Enology Research Center

2360 E. Barstow Ave, Fresno, CA 93740

Farming for desired flavors and economic sustainability is an ultimate goal of viticulturists. This should be achieved through best management practices for a vineyard site. For as long as grapes have been grown, it has been known that the best wines come from those vineyards where vegetative growth and crop yield are in balance (Dry et al. 2004). Vine balance was defined by Gladstones (1992) by stating, “balance is achieved when vegetative vigor and fruit load are in equilibrium and consistent with high fruit quality.”

Extended ripening has become a recent trend in harvest decision making in order to achieve optimum “flavor ripeness”; recognized as an important parameter for harvest decisions in wine grapes (Coombe 2001). Inadequate understanding of the later stages of ripening is limiting. Additionally, the practice of extended ripening causes yield loss from berry dehydration (Battany 2005, Grant 2005, Bisson 2001, Mc-Carthy 1997a, Hamilton and Coombe 1992, La Rosa and Nielson 1956, Coombe 1975). Other problems may include: increased pest and disease susceptibility, shortened post harvest period (Grant 2005) and negative consequences of high alcohol wines (Bisson 1999). Minimal research exists on this practice. Crop load adjustment is commonly required for growers and contributes to significant yield loss. The rela-tionship between crop load and wine quality has been and continues to be a prominent issue in viticulture research and farming (Keller et al. 2005, Chapman et al. 2004). Studies on crop load have been conflict-ing and warrant further research.

The aim of this study was to investigate the interaction of crop load and extended ripening on yield com-ponents, wine and fruit composition and to increase understanding of the synchronization of flavor ripe-ness with sugar ripeness through optimal vine balance.

In 2005, 2006 and 2007 a commercial vineyard of clone 8 Cabernet Sauvignon located in Paso Robles, CA was adjusted to four crop levels post fruit set. Each crop level was harvested at five target Brix levels from 22.5-28.5 Brix and fermented into wine. Yield components, wine and fruit composition, and wine sen-sory were measured and assessed on all replicated treatments.

Yield components were reduced from both crop load adjustment and extended ripening. Pruning weight increased in treatments thinned to lower crop levels in all three seasons, indicating changes in vegetative growth from the crop thinning. Average berry weight (Fig 1), cluster weight and berries per cluster were inversely related to crop load. Extended ripening increased wine color density (Fig 2). Additionally the low-est color density was consistently found in the lowest crop load treatments. Results from the descriptive analysis characterized the wines, showing opposing differences between treatments harvested early (22.5-24.0 Brix) verses those which underwent extended ripening and were harvested at the 27.0-28.5 Brix target. Acceptability scoring and commercial grading showed that in gen-eral, wines from higher Brix levels in all crop load treatments were preferred. Furthermore, the most ac-ceptable wines were from higher crop load and higher Brix treatments. These results suggest wine quality can be improved with extended ripening, although significant yield is lost. Additionally, lowest crop load does not always produce highest wine quality. Crop thinning may have detrimental effects on wine quality by disturbing the natural balance of the vine and increasing vegetative growth.


50

Figure 1: Effect of extended ripening on berry weight of four crop load treatments.

Figure 2: Effect of extended ripening on wine color density measured by spectrometer (420+520nm).

ReferencesBattany, M. 2005 Extended Ripening Project -Final Report. University of California Cooperative Extension,

San Luis Obispo and Santa Barbara Counties. Bisson, L.F. 1999. Stuck and Sluggish Fermentations. American Journal of Enology and Viticulture.

50:107-116.Chapman, D.M., Matthews, M.A., and Guinard J. (2004) Sensory Attributes of Cabernet Sauvignon Wines

Made from Vines with Different Crop Yields. American Journal of Enology and Viticulture 55:325-334.Coombe, B.G. (2001) Ripening berries - a critical issue. Australian Viticulture. Mar/Apr: 28-34.Coombe, B.G. (1975) Development and maturation of the grape berry. Australian Grapegrower and

Winemaker. 12:60-66. Dry, P.R., P.G. Iland, and R. Ristic. (2004) What is Vine Balance? Proceedings from the 12th Australian

Wine Industry Technical Conference. Melbourne, Victoria 68-74.Gladstones, J. Viticulture and Environment. Winetitles. Adelaide, South Australia. 1992.Grant S.G. (2005) Consequences of Extended Wine Grape Ripening. Repo, CAWG. Progressive

Viticulture, Turlock, CA.Hamilton, R.P. and Coombe B.G. (1992) Harvesting of winegrapes. In Coombe, B.G. and Dry P.R. (ed.).

Viticulture: Volume 2 Practices. Winetitles, Adelaide.Keller, M. Mills, L.J., Wample, R.L., and Spayd, S.E. (2005) Cluster Thinning Effects on Three Deficit-

Irrigated Vitis vinifera Cultivars. American Journal of Enology and Viticulture. 56:91-103.McCarthy, M.G. (1997a) Effect of timing of water deficit on fruit development and composition of Vitis

vinifera cv Shiraz. PhD Thesis University of Adelaide.

0.60

0.65

0.70

0.75

0.80

0.85

0.90

20 27 34 41 48 55 62 69 76 83

days past veraison

berr

y w

eigh

t (g)

20 cl40 cl60 clUN


51

Seasonal Patterns of Water-use Measured with a Dual Heat Pulse Sap Flow Technique on Mature

Grapevines Growing in a Weighing Lysimeter

Andrew J. McElrone*1,2, Tim M. Bleby3, Kyle Pearsall1,2 and Larry E. Williams2

1USDA-ARS, Davis, CA USA; 2Department of Viticulture and Enology, University of California,Davis, CA USA; 3School of Plant Biology, The University of Western Australia, Crawley, WA

Email: [email protected]

Competition between urban and agricultural entities for limited water resources is increasing in California. In any given year, this competition can be exacerbated by below average precipitation throughout the state. The ability to precisely determine the irrigation needed to maintain vineyard productivity and fruit quality while improving water-use efficiency will enable viticulturists to better conserve this natural resource. Despite previous attempts to determine grapevine water-use using sap flow sensors, the industry still lacks a reliable method that encompasses the full range of flow exhibited in mature grapevines. In 2007 and 2008, we validated/calibrated a dual sap flow technique that combines two heat pulse methods capable of measuring the full range of flow conditions (i.e. high, low & reverse flow) typical of daily grapevine water-use.

Field testing involved sensor installation on mature Thompson Seedless grapevines (~twenty year old) growing in a weighing lysimeter at the University of California Kearney Agricultural Center located in the San Joaquin Valley of California (36° 48' N, 119° 30' W). Water-use by the mature lysimeter vines can exceed 60 L day-1 during peak evaporative demands in mid-summer, therefore this site provides an ideal opportunity to calibrate the sensors against the large range of flows common to grapevines in this region. The sensors were able to resolve high flow rates (>100 cm hr-1) during midday periods of peak evaporative demand as well as low flows (<4cm hr-1) generated by nighttime transpiration, stem capacitance recharge, and/or root pressure. In both growing seasons, diurnal sap flow data was significantly correlated with water-use measured by the weighing lysimeter and predicted by climatic evaporative demand. The strong patterns from the field were verified in the lab with excised trunks and in the greenhouse on potted vines. The vines (diameter ~9.5cm) also exhibited variable radial flow within the trunk with the vast majority of flow occurring in the most recent annual rings for this diffuse porous species. Radial flow patterns were also verified using a dye-tracer technique. The small cross sectional area of actively conducting xylem supplies the water demands of a relatively large leaf area.

The performance of the dual method sensor on grapevines will be discussed relative to other sap flow techniques in terms of radial flow patterns, xylem anatomy, and power requirements. The potential use of these sensors for development of site specific crop coefficients and incorporation into real-time irrigation management will also be discussed.


52

The Occurrence of Grapevine Fanleaf Virus in Washington State Vineyards

Tefera Mekuria1, Robert R. Martin2 and Rayapati A. Naidu1

1Department of Plant Pathology, Washington State University, Irrigated Agriculture Research and Extension Center, Prosser, WA 99350

2USDA-ARS Horticultural Crops Research Laboratory, Corvallis, OR 97330

Grapevine degeneration in grapevines caused by Grapevine fanleaf virus (GFLV) has been documented in many viticultural regions worldwide (Andret-Link et al. 2004). It is one of the major economically important virus diseases affecting the longevity of grapevines and reducing the fruit yield and fruit quality. Infected grapevines show a range of foliar symptoms consisting of leaf deformation, yellow mosaic, vein banding, ring and line patterns and flecks. GFLV cause yield reductions as high as 80% depending on the cultivar and severity of infection (Martelli and Savino 1990). Plant-to-plant spread of GFLV is known to occur by dagger nematode (Xiphinema index) and hence the infected grapevines appear in patches in the field. Long distance spread of the virus, however, occurs by transfer of infected propagation material. GFLV (genus: Nepovirus, family Comoviridae) has a bipartite genome consisting of two single-stranded, positive sense RNAs called RNA-1 and RNA-2 (Pink et al., 1988). Genetic diversity of GFLV genome has been studied in different countries (Arani et al. 2001; Vigne et al., 2004; Pompe-Noak et al., 2007), thereby establishing quasi-species nature of the virus.

GFLV has been documented in grapevines in different viticultural regions of USA (Qiu et al., 2007; Arani et al., 2001; Milkus and Goodman, 1999). However, the status of GFLV in the Pacific Northwest vineyards, consisting of Idaho, Oregon, and Washington and accounting for the second largest grape-growing region in the USA, is currently not known.

Materials and MethodsDuring our reconnaissance studies in 2007, dormant wood cuttings were collected randomly from Chardonnay grapevines in two geographically separate vineyards in Eastern Washington State. A total of 26 samples from one Chardonnay block and 31 from another Chardonnay block were tested separately for GFLV by one tube-one step reverse transcription-polymerase chain reaction (RT-PCR) method using virus-specific primers. A forward primer (5’-ACCGGATTGACGTGGGTGAT, corresponding to nucleotides [nt] 2231-2250) and reverse primer (5’-CCAAAGTTGGTTTCCCAAGA, complementary to nt 2533-2552) of GFLV-F13 isolate (GenBank accession number: X16907) were used in RT-PCR assays for amplification of a 322 nucleotide fragment specific to the coat protein (CP) of GFLV (Rowhani et al., 1993). The amplicons were cloned into pCR2.1 vector (Invitrogen Corp, Carlsbad, CA). Three independent clones per amplicon were sequenced from both orientations and a consensus sequence derived for each amplicon using Vector NT1 Advance10 software (Invitrogen). Multiple alignments were performed using Clustal W (BioEdit version7.0.5.3, Ibis Therapeutics, Carlsbad, CA) and phylogenetic analysis was carried out using MEGA4 (Tamura et al., 2007). Corresponding sequences of GFLV isolates in Genebank (accession numbers: DQ922668, AY017338, DQ362921, X16907, U11768, X60775, AF304013, AF304014, AF304015) were included in these studies. A selected number of GFLV-positive samples were tested by enzyme-linked immunosorbent assay (ELISA) with GFLV-specific antibodies.

Results and DiscussionIn RT-PCR, a 322 nt DNA fragment specific to GFLV CP was amplified from two out of thirty one grapevines in one Chardonnay block and six of the twenty six grapevines in the second Chardonnay block. ELISA results further confirmed the presence of GFLV in samples that were positive in RT-PCR. Pair wise comparison of sequences derived from the eight grapevines showed 99-100% nucleotide sequence identity among themselves, indicating that GFLV isolates from the two vineyards may be


53

identical. A comparison of GFLV sequences obtained in this study with corresponding sequences in the GeneBank showed 87-92% identity at the nucleotide and amino acid sequence level. These results indicate that GFLV isolates from Washington State vineyards are distinct strains of the virus.

GFLV-positive samples from the first Chardonnay block tested positive for Grapevine leafroll-associated virus (GLRaV)-3 and those from the second Chardonnay block tested positive for GLRaV-1, GLRaV-3, and Grapevine virus A. These results indicate mixed infection of GFLV with other grapevine viruses. In addition, presence of GFLV as mixed infection with different viruses in the two Chardonnay blocks may suggest independent origin of planting material in these blocks. To our knowledge, this is the first report of GFLV in grapevines in the Pacific Northwest region of USA. Consequently, this study adds to existing knowledge on the distribution of GFLV in grapevines in the USA. Further investigations are being carried out on the distribution, symptoms, molecular variability and nematode vector transmission of GFLV.

AcknowledgmentsThe authors would like to thank Washington State Wine Commission, Washington State Department of Agriculture, USDA-ARS Northwest Center for Small Fruits Research and USDA-CSREES Viticulture Consortium-West for funding this study

ReferencesAndret-Link, P.,Laporte C., Valat L., Ritzenthaler C., Demangeat G., Vigne E., Laval V., Pfeiffer P., Stussi-

Garaud C., Fuchs M. 2004. Grapevine fanleaf virus: Still a major threat to the grapevine industry. J. Plant Pathol. 86(3), 183-195.

Arani, N. P., S. Daubert, and A. Rowhani. 2001. Quasispecies nature of the genome of Grapevine fanleaf virus. J Gen Virol. 82, 1791-1795.

Martelli G.P., Savino V.1990. Fanleaf degeneration. In: Pearson R.C and Goheen A. (eds.) Compendium of grape diseases, pp. 48-49. APS Pres, St Paul, MN, USA.

Milkus B.N., Goodman R.N. 1999. A survey of Missouri vineyards for the presence of five grape viruses. Am. J. Enol., Vitic. 50:133-134.

Pinck, L., M. Fuchs, M. Pinck, M. Ravelonandroi., B. Walter. 1988. A satellite rna in Grapevine fanleaf virus strain F13. J. Gen. Virol. 69, 233-239.

Pompe-Novak, M., Gutierrez-Aguirre I., Vojvoda J., Blas M., Tomazic I., Vigne E., Fuchs M., Ravnikar M., and Petrovic. 2007. Genetic variability within RNA2 of Grapevine fanleaf virus. Eur J. Plant Pathol. 117,:307-312.

Rowhani, A., C. Chay, D. A. Golino, and B. W. Falk. 1993. Development of a polymerase chain reaction technique for the detection of Grapevine fanleaf virus in grapevine tissue. Phytopath. 83,749-753.

Tamura K, Dudley J, Nei M & Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596-1599.

Vigne E., Bergdoll M., Guyader S., Fuchs M. 2004. Population structure and genetic diversity within Grapevine fanleaf virus isolates from a naturally infected vineyards: Evidence for mixed infection and recombinations. J Gen Virol 85, 2435-2445.

Qiu W., Avery, J. D., Lunden, S. 2007. Characterization of a severe virus-like disease in Chardonnay grapevines in Missouri. Online. Plant Health Progress doi:10.1094/PHP-2007-1119-01-BR.


54

Understanding Extended Berry Maturation: Implications of Fruit Sugar Content on Aroma Precursors

and Green Aromas in red Wine Grapes

Martin P. Mendez¹, Michael Cleary1 and Nick Dokoozlian1

1 E&J Gallo Winery, PO Box 1130, Modesto CA 95353 email: [email protected]

Optimum berry flavor development is essential for reaching desired wine style targets and maintaining quality and market share of California wines. A major objective is to achieve an absence of green aromas or flavors in the fruit prior to harvest. Delaying grape harvest beyond traditional maturity levels is believed to enhance aroma development and promote degradation of undesirable green or vegetal aromas in red wine cultivars (Tilbrook and Tyerman 2006). As a result, harvest decisions are no longer based solely on fruit sugar content (ex 24 Brix) but now commonly include berry sensory evaluations to assess the potential for both fruit and vegetal aromas in the resulting wines.

Methoxypyrazines are a potent odorant present in vegetables such as bell peppers and beans and have also been identified in Vitis vinifera grape varieties such as Cabernet Sauvignon, Merlot and Sauvignon Blanc among others (Allen et al. 1989; Roujou de Boube et al. 2000). Among the different types of methoxypyrazines that have been found in grapes, a study done by Allen et al. (1993) showed that IBMP (3-isobutyl-2-methoxypyrazine) contributes the most to green aromas present in Cabernet Sauvignon and Sauvignon blanc wines.

Many positive aroma compounds of grape berries are present in the free or volatile form, as well as bound to sugars in the odorless form of glycosides (Cordonnier and Bayonove, 1974). The relative importance of both fractions in grape berries has been studied for several different wine cultivars. Experiments done by Genoves et al (2005) and Gunata et al (1985) found the bound fraction in the berry (glycosides) to be about three times greater than the free form (volatiles).

The effects of extended maturation on both aroma precursors (glycosides) and methoxypyrazine in the fruit were studied in field-grown Cabernet Sauvignon grapevines in the Sonoma Valley of California. Clusters samples were taken on a weekly basis starting around 20-22Brix until commercial harvest during the 2006 and 2007 seasons, and analyzed for phenol-free glucose glycosides (Whiton and Zoecklein, 2002) and methoxypyrazines (modification of Chapman et al., 2004 to analyze grape homogenate). An additional fruit sample was collected weekly and subjected to berry sensory analysis using a trained panel. Each treatment (harvest date) was replicated six times using 5 vine plots arranged in a randomized complete block design.

The practice of extended maturation significantly increased aroma precursors and decreased green notes in both seasons (Figure 1). Methoxypyrazine fruit levels were below the berry sensory threshold (15 ppt, Roujou de Boubee - 2003) by the time that berries reached 23 Brix in 2007, but remained above this level until the fruit reached 25 Brix in 2006. Higher levels of aroma precursors were also reached at a lower Brix in 2007 compared to 2006. Berry sensory showed similar results, but greater differences between years, and higher correlation with the fruit chemistry data were observed for green notes compared to fruit flavors. This is explained by the volatile nature of the compound that contributes the most to green aromas (methoxypyrazine) and the predominance of the positive aroma compounds in the bound fraction (odorless - glycosides). Therefore, fruit sensorial evaluations might be more accurate assessing fruit vegetal characteristics than determining positive fruity aromas. These results show that fruit sugar content is not an accurate estimation of neither aromatic potential or degradation of vegetative notes, and suggest therefore that berry sugar loading is not directly related to the development of critical aroma compounds in the fruit.


55

Figure 1: Effects of extended maturation on vegetative notes (A), fruit aroma precursors (B) and berry sensory (C) of Cabernet Sauvignon grapes during two seasons.

ReferencesALLEN, M. S., M. J. LACEY, et al. (1989) Ocurrence of methoxypyrazine in grapes of Vitis vinifera cv.

Cabernet Sauvignon and Sauvignon Blanc. IV Symposium d’Enologie de Bordeaux. Paris: 25-30.ALLEN, M. S., M. J. LACEY, et al. (1993) Contribution of methoxypyrazines to the flavour of Cabernet

Sauvignon and Sauvignon Blanc grapes and wines. Seventh Australian Wine Industry Technical Conference: 113-116.

CORDONNIER, R.E., BAYONOVE, C.L. (1974) Mise en evidence dans le baie de raisin var. Muscat d’Alexandrie de monoterpenes lies revelables par une ou plusiers enzymes du fruit. C.R. Acad. Sci. Paris 278:3387-3390.

GENOVES, S, et al (2005) Assesment of the aromatic potencial of Palomino Fino grape must using glycosidases. American Journal for Enologie and Viticulture, 56:2 188-191.

GUNATA, Y.Z. et al (1985) The aroma of grapes – Extraction and determination of free and glycosidicaly bound fractions of some grape aroma components. Journal of Chromatography, 331 83-90.

ROUJOU DE BOUBEE, D., C. VAN LEEUWEN, et al. (2000) Organoleptic impact of 2-methoxy-3-isobutylpyrazine on red Bordeaux and Loire wines. Effect of environmental conditions on concentrations in grapes during ripening. Journal of Agricultural and Food Chemistry 48(10): 4830-4834.

ROUJOU DE BOUBEE, D. (2003) Research on 2-Methoxy-3-Isobutylpyrazine in grapes and wines. Bourdeax, School of Oenology.

TILBROOK J., TYERMAN S. (2006) Water, sugar and acid: how and where they come and go during berry ripening. In ''Finishing the job" - Optimal ripening of Cabernet sauvignon and Shiraz'. Mildura, VIC. (Eds D Oag, K DeGaris, S Partridge, C Dundon, M Francis, R Johnstone, R Hamilton) pp. 4-10. (ASVO)

WHITON, W. ZOECKLEIN, B.W. (2002) Evaluation of Glycosyl-Glucose analytical methods for various glycosides. American Journal of Enology and Viticulture, 53:4 315-317

Figure 1: Effects of extended maturation on vegetative notes (A), fruit aroma precursors (B) and berry sensory (C) of Cabernet Sauvignon grapes during two seasons.

REFERENCES

Met

hoxy

pyra

zine

(ppt

)

0

2 0

4 0

6 0

2 0 0 6

2 0 0 7

Glu

cose

gly

cosi

des

(ppb

)

4 0 0 0 0

5 0 0 0 0

6 0 0 0 0

7 0 0 0 0

8 0 0 0 0

2 0 0 62 0 0 7

A

B

S o l u b l e s o l i d s2 0 2 1 2 2 2 3 2 4 2 5 2 6 2 7 2 8

Frui

t fla

vor i

nten

sity

via

sen

sory

(0-5

)

0

1

2

3

4

Gre

en fl

avor

inte

nsity

via

sen

sory

(0-5

)

0

2

4

6

8

2 0 0 6

2 0 0 7

2 0 0 6

2 0 0 7

C

Met

hoxy

pyra

zine

(ppt

)

0

2 0

4 0

6 0

2 0 0 6

2 0 0 7

Glu

cose

gly

cosi

des

(ppb

)

4 0 0 0 0

5 0 0 0 0

6 0 0 0 0

7 0 0 0 0

8 0 0 0 0

2 0 0 62 0 0 7

A

B

S o l u b l e s o l i d s2 0 2 1 2 2 2 3 2 4 2 5 2 6 2 7 2 8

Frui

t fla

vor i

nten

sity

via

sen

sory

(0-5

)

0

1

2

3

4

Gre

en fl

avor

inte

nsity

via

sen

sory

(0-5

)

0

2

4

6

8

2 0 0 6

2 0 0 7

2 0 0 6

2 0 0 7

C

ALLEN, M. S., M. J. LACEY, et al. (1989) Ocurrence of methoxypyrazine in grapes of Vitis vinifera cv. Cabernet Sauvignon and Sauvignon Blanc. IV Symposium d'Enologie de Bordeaux. Paris: 25-30.

ALLEN, M. S., M. J. LACEY, et al. (1993) Contribution of methoxypyrazines to the flavour of Cabernet Sauvignon and Sauvignon Blanc grapes and wines. Seventh Australian Wine Industry Technical Conference: 113-116.

CORDONNIER, R.E., BAYONOVE, C.L. (1974) Mise en evidence dans le baie de raisin var. Muscat d’Alexandrie de monoterpenes lies revelables par une ou plusiers enzymes du fruit. C.R. Acad. Sci. Paris 278:3387-3390.

GENOVES, S, et al (2005) Assesment of the aromatic potencial of Palomino Fino grape must using glycosidases. American Journal for Enologie and Viticulture, 56:2 188-191.

GUNATA, Y.Z. et al (1985) The aroma of grapes – Extraction and determination of free and glycosidicaly bound fractions of some grape aroma components. Journal of Chromatography, 331 83-90.

ROUJOU DE BOUBEE, D., C. VAN LEEUWEN, et al. (2000) Organoleptic impact of 2-methoxy-3-isobutylpyrazine on red Bordeaux and Loire wines. Effect of environmental conditions on concentrations in grapes during ripening. Journal of Agricultural and Food Chemistry 48(10): 4830-4834.

ROUJOU DE BOUBEE, D. (2003) Research on 2-Methoxy-3-Isobutylpyrazine in grapes and wines. Bourdeax, School of Oenology.

TILBROOK J., TYERMAN S. (2006) Water, sugar and acid: how and where they come and go during berry ripening. In ''Finishing the job" - Optimal ripening of Cabernet sauvignon and Shiraz'. Mildura, VIC. (Eds D Oag, K DeGaris, S Partridge, C Dundon, M Francis, R Johnstone, R Hamilton) pp. 4-10. (ASVO). WHITON, W. ZOECKLEIN, B.W. (2002) Evaluation of Glycosyl-Glucose analytical methods for various

glycosides. American Journal of Enology and Viticulture, 53:4 315-317


56

Examining the Effects of Cold Therapy on Pierce’s Disease-infected Grapevines and on the Viability of Xylella fastidiosa Cells in vitro

Melody M. Meyer* and Dr. Bruce C. Kirkpatrick. Department of Plant Pathology, University of California, Davis, CA 95616

*[email protected]

The severity of winter temperatures limits the geographical distribution of Pierce’s Disease (PD) in North America. For example, PD does not occur in New York, the Pacific Northwest or at high altitudes in South Carolina, Texas and California where the winter temperatures on average drop below 0 degrees Celsius (Hopkins et al., 2002). Purcell (1977, 1980) demonstrated that relatively brief exposures to sub-freezing temperatures eliminated X. fastidiosa in cold treated Vitis vinifera grapevines. Purcell also found that a higher percentage of grapevines that were moderately susceptible to PD, such as ‘Cabernet Sauvignon’, were cured by cold therapy treatments compared to susceptible varieties such as ‘Pinot Noir’. More recently, Purcell’s group also showed that whole, X. fastidiosa infected potted vines exposed to low temperatures had a higher rate of recovery than PD-affected detached bud sticks exposed to the same cold temperatures (Feil, 2002). This implies that some factor(s) expressed in the intact plant, but not in detached bud sticks, helped eliminate X. fastidiosa from the plants. To better understand the cold therapy phenomenon, PD disease severity, curing rates and biochemical changes in Vitis vinifera “Pinot Noir” (PN) and “Cabernet Sauvignon” (CS) grapevines growing in 4 field locations and in 4 cold chambers were compared to the viability of X. fastidiosa cells cultured in vitro. The objective of this research is to elucidate the physiological/biochemical basis that mediates cold therapy and to identify the physiological/biochemical factor(s) that occur or are expressed in cold treated vines that eliminate X. fastidiosa. If such a factor(s) is/are found, it may be possible to induce their expression under non-freezing temperatures and potentially provide a novel approach for managing PD.

Materials and MethodsTo examine the cold therapy on Pierce’s Disease-infected grapevines, Pinot Noir (PN, susceptible to PD) and Cabernet Sauvignon (CS, moderately resistant to PD) grapevines grafted onto 101-14 rootstock were grown in five gallon pots. Treatment vines were inoculated with the Stag’s Leap (STL) strain of X. fastidiosa in the spring using the pinprick inoculation procedure (Hopkins, 1980; Hill and Purcell, 1995; Purcell and Saunders, 1999) whereas control vines were inoculated with water. All PD inoculated plants were tested with immunocapture-PCR (IC-PCR) in the late summer to confirm presence of X. fastidiosa. Twelve weeks after inoculation, the plants were rated for disease using a symptom severity index of 0 (healthy) to 5 (dead) (Guilhabert and Kirkpatirck, 2005). In the fall the grapevines were transported to each of the 4 field sites and 4 cold chambers. At the beginning of bud break in spring, the plants were picked up and planted in the field at UC Davis. The plants were rated for PD symptoms at the end of summer and tested for the presence of X. fastidiosa using IC-PCR. Temperature, evapotranspiration, and other weather data for each experimental condition were monitored using CIMIS weather data www.cimis.water.ca.gov and HOBO data loggers (Onset Computer Corporation, Bourne, MA).

To examine the viability of Xylella fastidiosa cells in vitro, I used various buffers and media at various pH values and osmolarities. The solutions used for these viability experiments included: water, extracted V. vinifera (‘Pinot Noir’ and ‘Cabernet Sauvignon’ varieties) xylem sap, PD3 medium, HEPES, sodium and potassium phosphate buffers. X. fastidiosa cells suspended in the various buffers and media were exposed to various temperatures between -5ºC and 28ºC. Potassium phosphate buffer at various pH values (5.0-6.8) was also used to determine the effects of pH on the survival of X. fastidiosa. Viable colony forming units were counted daily for one week to determine the effect of each temperature treatment.


57

Results and DiscussionResults for the field and chamber plots revealed that there were differences in pH, osmolarity and abscisic acid (ABA) from sap collected from CS and PN grapevines. The results of this study show that pH of xylem sap from both cold chamber and field cold treated vines is lower than culture media used to grow X. fastidiosa (pH of PD3 is 6.8). Osmolarity of PD3 media is 113 mmol/kg, whereas the osmolarity of xylem sap was25-45 mmol/kg.

Sugar and select ion concentration analyses of CS grapevines showed greater amounts of glucose and fructose in –5ºC cold chamber vines, whereas Ca+ levels were the greatest in the warmest treatments. Osmolarity was greatest in the coldest treatments and decreased with increasing temperature. Conversely, in PN grapevines, glucose and fructose levels were the lowest in the coldest treatments. Ca+ levels showed a similar trend with CS vines, with increased Ca+ levels in the warmer temperature treatments. Temperature appeared to have a less direct effect on osmolarity in Pinot Noir grapevines.

The media experiments indicate that X. fastidiosa can survive at 28ºC in most media except water. At 28˚C the survival rate was the highest in PD3 media followed by potassium phosphate at pH 6.8, sodium phosphate, and xylem sap. The survival rate was the lowest in water. X. fastidiosa in potassium phosphate buffers with pH values at 5.0, 5.4 and 5.8 died rapidly and were not included in the graphs below to increase the clarity of the graphs. The mortality rate was the lowest in PD3 medium in the 5˚C temperature treatment. The highest mortality was in deionized water, which had 0% survival within three days. At 2.2˚C, survival was greatest in PD3 medium and xylem sap collected from Cabernet Sauvignon grapevines growing in a warm climate (Yolo County, CA). The highest survival at 0˚C occurred with PD3 media and in xylem sap collected from grapevines growing in a cold climate (Placer County, CA). Survival was the lowest in deionized water and potassium phosphate at the pH of 6.2. X. fastidiosa can survive at -5ºC in all buffers at pH 6.8, media and xylem sap for at least 4 days. At -5˚C, survival of X. fastidiosa was the greatest in xylem sap collected from grapevines growing in a cold climate (Placer County, CA) and HEPES buffer. As with the 0˚C treatments, survival was the lowest in deionized water and potassium phosphate at the pH of 6.2. No cultivable X. fastidiosa was recovered from any of the media, buffers or xylem sap after 24 hours at -10˚C or at -20˚C.

ReferencesFeil, H., 2002. Effect of sub-freezing temperature on the survival of Xylella fastidiosa in vitro and in plants.

In Ph.D. dissertation, University of California, Berkeley.Guilhabert M.R and B.C. Kirkpatirck, 2005. Identification of Xylella fastidiosa antivirulence genes:

hemagglutinin adhesins contribute a biofilm maturation to X. fastidios and colonization and attenuate virulence. Molecular Plant Microbe Interact.18(8):856-68.

Hill, B.L. and Purcell, A.H. 1995. Multiplication and movement of Xylella fastidiosa within grapevine and four other plants. Phytopathology 85, 1368-1372.

Hopkins, D.L., 1980. Use of pin-prick inoculation technique to demonstratevariability in virulence of the Pierce’s Disease bacterium. Proceedings of the International Conference on Viruses of Grapevines. (ICVG). September 1980: 8-12.

Hopkins, D.L. and Purcell. 2002. Xylella fastidiosa: Cause of Pierce’s Disease of Grapevine and Other Emergent Diseases. Plant Disease 86(10): 1056-1065.

Purcell, A.H. 1977. Cold therapy of Pierce’s disease grapevines. Plant Dis. Reptr. 61:514-518.Purcell, A.H. 1980. Environmental therapy for Pierce’s disease of grapevines. Plant Disease 64:388-390. Purcell, A.H. and Saunders, S.R. 1999. Fate of Pierce’s disease strains of Xylella fastidiosa in common

riparian plants in California. Plant Disease 83, 825-830.


58

Comparison of Greenhouse Grown, Containerized Grapevine Stomatal Conductance Measurements Using Two Differing Porometers

Thayne Montague*, Edward Hellman, and Michael KrawitzkyTexas AgriLife Research and Extension Center, Lubbock, Texas, U.S.A. 79403-6603

Department of Plant and Soil Science, Texas Tech University, Lubbock, Texas, U.S.A. [email protected]

Measurement of leaf stomatal conductance is critical for numerous aspects of viticulture research. Sto-matal conductance regulates many plant processes (carbon dioxide assimilation, respiration, transpira-tion) and may be used to determine grapevine water use, water status, response to climatic factors, or response to chemical and insect injury. When making stomatal conductance measurements, a balance must be made between the number of measurements taken and the amount of time between measure-ments. Too few measurements limit statistical comparisons, while taking measurements over an extended period of time subjects stomata to varying climatic conditions (incoming radiation, wind speed, air tem-perature, humidity, etc.) which can confound data. Therefore, researchers desire to make the greatest number of conductance measurements in the shortest time period. To achieve this goal, it is often desir-able to use more than one porometer. However, concerns have arisen when comparing stomatal conduc-tance measurements taken with porometers manufactured by differing companies. Although no longer in production, the LI-1600 Steady State Porometer (LI-COR Inc, Lincoln, Nebraska) has long been used by plant physiologists when measuring stomatal conductance. Recently, other manufactures have introduced porometers which are user friendly, yet are able to provide precise and accurate measurements. The Decagon SC-1 Leaf Porometer (Decagon Devices, Inc., Pullman, Washington) was introduced in 2005 and is thought to be a reliable alternative to the LI-1600. The objective of this research was to compare stomatal conductance measurements collected from greenhouse grown, containerized grapevines col-lected with two differing porometers.

Dormant Vitis vinifera cv. Chardonnay vines bench grafted to Freedom rootstocks were obtained Spring 2007 and planted in 5 gallon containers using a standard greenhouse potting medium. Throughout the 2007 growing season vines were grown outside under full sun conditions and irrigated and fertilized as needed. On 23 October 2007 dormant vines were pruned back to 4 nodes and brought into a green-house. For 5 weeks containerized vines were irrigated daily and fertilized twice each week with 300 ppm N through a liquid fertilization system. Within each container new growth was trained to single stake. In mid-December, 18 vines were selected for uniformity and arranged on greenhouse benches in a random-ized complete block design with 6 blocks and 3 vines within each block. In an attempt to generate a range of stomatal conductance measurements, three irrigation treatments were randomly assigned to each vine within each block: 1 liter water each day, 0.5 liter water each day, and 0.25 liter water each day (high, medium, and low, respectively). Vines were irrigated each evening. Between 18 December 2007 and 2 January 2008 mid-day stomatal conductance was measured on each plant 7 different times (Fig. 1). Be-ginning near noon, a block of plants and an irrigation treatment within the block was randomly selected. A healthy, fully mature, full sun leaf was randomly selected and stomatal conductance was simultaneously measured on the leaf using the LI-1600 and the SC-1 Leaf Porometer. Conductance measurements were made near the terminal tip of the leaf within 2.5 cm of each other. Four leaves from each grapevine were measured. Following the last measurement, a vine from the remaining irrigation treatments within the block was selected and stomatal conductance was measured in a similar manner. After each grapevine within a block was measured another block of vines was randomly selected for measurement. This pro-tocol was followed until vines within each block were measured. Throughout the experiment greenhouse climate data (air temperature, relative humidity, and incoming shortwave radiation) were recorded using a datalogger (CR23x, Campbell Scientific Inc., Logan, Utah). Daily and overall mean conductance data were exposed to analysis of variance appropriate for a randomized complete block design. If significant differ-ences were found means were separated by Fisher’s least significance difference procedure (P ≤ 0.05).

Mean daily stomatal conductance measurements ranged from a high of 63 mmol m-2 s-1 (20 Dec. LI-1600 low irrigation) to a low of 19 mmol m-2 s-1 (1 Jan SC-1 low irrigation) (Fig. 1). Daily and overall mean sto-matal conductance data indicate differences between irrigation treatments and porometers. In general,


59

regardless of porometer, grapevines which received low or medium irrigation each day had greater mean stomatal conductance when compared to vines which received high irrigation. However, there was a sin-gle day (1 Jan.) when vines which received high irrigation had greater stomatal conductance when com-pared to vines which received medium or low irrigation. In addition to stomatal conductance differences due to irrigation, differences were found when stomatal conductance readings between porometers were compared (Fig. 1). Of days data was collected, on only a few occasions was stomatal conductance mea-sured with the SC-1 similar to stomatal conductance measured with the LI-1600 (18 Dec. high irrigation, 2 Jan. low irrigation). Also, it is evident that within irrigation treatments, daily mean stomatal conductance measured with the LI-1600 was greater when compared to conductance measured with the SC-1. With the exception of 21 Dec. (when all SC-1 means were greater when compared to all LI-1600 means) and 2 Jan. (low irrigation) means measured with the LI-1600 were greater than or equal to means measured with the SC-1 (Fig. 1).

Results indicate irrigation level and porometer manufacturer influenced stomatal conductance readings measured on greenhouse grown, containerized V. vinifera cv. Chardonnay grapevines. Low daily conduc-tance values were likely due to climatic influences such as low radiation levels and low air temperatures found in the greenhouse during winter months. In addition, low conductance means associated with high irrigation vines may be an indication of excess soil moisture stress. Other than the SC-1 generally giving lower conductance readings when compared to the LI-1600, conductance differences between porometers do not seem to follow specific trends (that is, SC-1 measurements tend to be lower than LI-1600 measure-ments at all conductance levels). Results suggest further research should be taken to investigate if con-ductance measurements taken with the LI-1600 and the SC-1 are compatible. Research over the course of the 2008 growing season will investigate the relationship of stomatal conductance readings between the LI-1600 and the SC-1 porometers in an experimental vineyard under ambient climatic conditions.

Figure one. Mid-day stomatal conductance means for containerized, greenhouse grown Vitis vinifera cv. Chardonnay grapevines grafted to Freedom rootstocks. Vines were subjected to three irrigation treatments: low (0.25 liter water each day), medium (0.5 liter water each day), and high (1 liter water each day). Mid-day stomatal conductance was measured with 2 porometers (LI-COR LI-1600 and Decagon SC-1). Each daily bar is the mean of 24 measurements. Different letters indicate daily differences between irrigation levels and porometer measured stomatal conductance (LSD, P ≤ 0.05).

were found when stomatal conductance readings between porometers were compared (Fig. 1). Of days data was collected, on only a few occasions was stomatal conductance measured with the SC-1 similar to stomatal conductance measured with the LI-1600 (18 Dec. high irrigation, 2 Jan. low irrigation). Also, it is evident that within irrigation treatments, daily mean stomatal conductance measured with the LI-1600 was greater when compared to conductance measured with the SC-1. With the exception of 21 Dec. (when all SC-1 means were greater when compared to all LI-1600 means) and 2 Jan. (low irrigation) means measured with the LI-1600 were greater than or equal to means measured with the SC-1 (Fig. 1). Results indicate irrigation level and porometer manufacturer influenced stomatal conductance readings measured on greenhouse grown, containerized V. vinifera cv. Chardonnay grapevines. Low daily conductance values were likely due to climatic influences such as low radiation levels and low air temperatures found in the greenhouse during winter months. In addition, low conductance means associated with high irrigation vines may be an indication of excess soil moisture stress. Other than the SC-1 generally giving lower conductance readings when compared to the LI-1600, conductance differences between porometers do not seem to follow specific trends (that is, SC-1 measurements tend to be lower than LI-1600 measurements at all conductance levels). Results suggest further research should be taken to investigate if conductance measurements taken with the LI-1600 and the SC-1 are compatible. Research over the course of the 2008 growing season will investigate the relationship of stomatal conductance readings between the LI-1600 and the SC-1 porometers in an experimental vineyard under ambient climatic conditions.

Measurement date

18 Dec 20 Dec 21 Dec 26 Dec 28 Dec 1 Jan 2 Jan Overall means

Stom

tal c

ondu

ctan

ce(m

mol

m-2

s-1

)

15

30

45

60

LI-COR highDecagon highLI-COR mediumDecagon mediumLI-COR lowDecagon low

aa

b

ccc

a

b

cd

d

e

a

bc

d d

e

aa

b c

d

e

aa

b

c c

d

ab

cd d

e

a

b bc

dd

a a

bc c

d

Figure one. Mid-day stomatal conductance means for containerized, greenhouse grown Vitis vinifera cv. Chardonnay grapevines grafted to Freedom rootstocks. Vines were subjected to three irrigation treatments: low (0.25 liter water each day), medium (0.5 liter water each day), and high (1 liter water each day). Mid-day stomatal conductance was measured with 2 porometers (LI-COR LI-1600 and Decagon SC-1). Each daily bar is the mean of 24 measurements. Different letters indicate daily differences between irrigation levels and porometer measured stomatal conductance (LSD, P ≤ 0.05).


60

Shoot Thinning and Leaf removal – Effects on Bunch rot and Yield Components of Zinfandel

Norton, M. VK. and D. RiversUC Cooperative Extension, 2145 Wardrobe, Merced CA 95341. [email protected]

AbstractIn 2006, early and late leaf removal, early and late shoot thinning and combinations of the above were imposed on drip irrigated Zinfandel in Merced County to re-evaluate their effects on bunch rot and yield components. High vine to vine variability made statistical significance difficult to obtain but the combination treatments appeared to reduce bunch rot appreciably. Yield components were not affected. In 2007, only leaf removal was re-evaluated and the practice was beneficial in reducing rot while not affecting yield components.

BackgroundDue to changing conditions and economics it is good to re-visit cultural and pest management practices periodically. In this trial we re-examined the practice of leaf pulling and shoot thinning to reduce summer bunch rot in Zinfandel. Zinfandel is prone to summer rot due to its often large berry size, soft berries and tight clusters. Since the rot is caused by a complex of organisms, bloom-time fungicide sprays can be of little value as a control measure. There are a variety of cultural practices that can contribute to rot control but they often entail high labor costs.

Materials and MethodsThis trial was conducted in a large Zinfandel block north of Merced CA. The block was moderately vigorous by San Joaquin Valley standards and is drip irrigated, with native cover crop in the middles. The row x vine spacing is 12’ x 7’ in an east-west orientation. The trellis is single curtain, bilateral cordon with three vertical foliage support wires. The vines are pruned to 14 two-node spurs and receive light canopy hedging mid-season. Due to phylloxera-root systems, the block receives close to full irrigations through the season. July 06 broke records for having more than ten consecutive days over 100°F.

The treatments are shown in Table 1. The early treatments were applied 16 June 2006 and late treatments applied 28 July. Leaves were removed from the fruiting zone, adjacent to a cluster and one node above and below on the north side of the canopy. Unnecessary and poorly positioned shoots were removed in the thinning treatment.

There were seven three-vine reps, in a RCB down the row. The center vine of each rep was harvested when a composite sample of the site reached 17° Brix which was ahead of commercial harvest for a white-Zin program. A cluster with rot on four or more berries was considered a rotten cluster and the rotten and sound clusters were counted and weighed separately.

In 2007 late leaf removal along with the grower standard were the only treatments with the leaf removal performed on 9 July. The method was identical to 2006. There were seven three-vine reps in a similar design using the same vines. Harvest samples were taken when a composite sample of the site showed 17.8° Brix.


61

Table 1. 2006 (2007*) Canopy Management Treatments.Early LR Leaf removal at fruit setLate LR * Leaf removal at veraison Early ST Shoot thinning at fruit set Late ST Shoot thinning at veraisonEarly LR+ST Leaf removal and shoot thinning at fruit setLate LR+ST Leaf removal and shoot thinning at veraisonGrower Standard* No leaf removal and no shoot thinning

Results and ConclusionsIn 2006 there was not difference in the yield components among treatments (Table 2). The combined treatments apparently reduced rot appreciably but high vine to vine variability made the results statistically weak. In 07 the early leaf removal treatment did not change the yield components but did statistically reduce rot levels (Table 3).

Table 2. Yield and yield components, Zinfandel Canopy Management Trial, 2006.

Total Yield Cluster wt Clusters Good Yield Rot Yield RotTreatment (lbs/vine) (lbs) per vine (lbs/vine) (lbs/vine) (%)Early LR 28.8 0.68 42 15.5 13.3 46Late LR 32.5 0.72 45 19.1 13.4 41Early ST 28.4 0.77 37 13.7 14.7 52Late ST 29.4 0.75 39 13.4 16.1 55Early LR+ST 28.4 0.67 42 18.8 9.6 34Late LR+ST 26.0 0.59 44 16.5 9.5 36GS 29.7 0.72 41 14.8 14.9 50

Table 3. Yield and yield components, Zinfandel Leaf Removal Trial, 2007.

Total Yield Cluster wt Clusters Good Yield Rot Yield RotTreatment (lbs/vine) (lbs) per vine (lbs/vine) (lbs/vine) (%)Late LR 35.0 0. 39 89 32.5 2.5 7.2GS 36.6 0.47 78 31.3 5.3 14.4

While cultural practices can reduce rot levels in San Joaquin Valley Zinfandel, the costs must be considered before implementing as a normal practice.


62

Establishment of Cover Crops to Enhance the Attraction of Beneficial Insects in a Drip-Irrigated Vineyard System

Mercy A. Olmstead, David James, Tessa R. GrasswitzWSU –IAREC, Prosser, WA 99350

Cover crops offer numerous potential benefits to grape growers, including reduced soil erosion, improved soil fertility, improved soil structure and health, increased traction for machinery, and attraction and retention of beneficial insect populations. Few studies on the establishment of cover crops in drip irrigated systems for the Pacific Northwest have been completed and there is much interest in sustainable vineyard floor management systems. This study was initiated to explore the establishment of various cover crop species for the specific purpose of enhancing biodiversity in the vineyard, hopefully leading to increased insect biodiversity and beneficial insects.

Two vineyards were seeded with four cover crop mixes/treatments in the fall of 2005 and 2006. These included resident vegetation, cereal rye, a dry land medic mix, and a flower mix. One vineyard was managed conventionally, while the other vineyard was managed organically. Establishment of the cereal rye and flower mix treatments was successful in both vineyards; however the medic mix had exceedingly poor performance, which led to the elimination of the medic mix in the second year.

There was no effect in either vineyard on vine shoot length, berry weight or number, or cluster numbers. Baseline data for soil nutrient content and vine nutrient status were also collected. Although low establishment rates of the flower mix was observed in both vineyards in both years, two years’ data indicates that beneficial insect populations have increased due to the availability of nectar sources throughout the growing season.


63

real-time rT-PCr (TaqMan®) Assays and Low Density Array Detection of Viruses Associated with rugose Wood Complex of Grapevine

Fatima Osman, Deborah Golino and Adib RowhaniDepartment of Plant Pathology, University of California, Davis, CA 95616, U.S.A

Real time TaqMan® RT-PCR assays and Low Density Arrays (LDA) have been developed to detect the viruses associated with Rugose wood complex of grapevines. These viruses included Rupestris stem pit-ting-associated virus (RSPaV) in the genus Foveavirus, Grapevine virus A (GVA), Grapevine virus B (GVB) and Grapevine virus D (GVD) in the genus Vitivirus. The coat protein (CP) gene of these viruses was found to be the most conserved gene, therefore, the primers and probes for TaqMan® RT-PCR assays were de-signed from the CP sequence pile up of various isolates of each virus. Comparisons were also made be-tween the conventional one step RT-PCR, real-time TaqMan® RT-PCR for the detection of these viruses using four fold serial dilutions of both purified RNA and crude extract. Results showed that real-time Taq-Man® RT-PCR was more sensitive and could detect viruses at 32 and 256 fold higher dilutions for purified RNA and crude extract, respectively, compared to RT-PCR. In addition, high throughput detection of these viruses using LDAs was compared to RT-PCR and real time TaqMan® RT-PCR. The efficiency of different RNA extraction methodologies and buffers were compared for use in low density array detection.

Rugose wood (RW) complex is a term used to describe a group of graft-transmissible diseases which are affecting grapevines (Vitis spp) worldwide (Martelli, 1993). RW is of great economic importance causing severe reduction of growth and yield of affected grapevine plants and accordingly having a great impact on the grape industry (Golino et al., 2000). The RW complex is classified into different diseases based on symptomatology on specific indicator hosts and can be divided into four components: Kober stem grooving (KSG), LN 33 stem grooving (LNSG), corky bark (CB) and rupestris stem pitting (RSP) (Martelli, 1993). Up-to-date three different phloem-restricted viruses belonging to two different genera have been identified to be associated with the etiology of RW including two viruses in the genus Vitivirus, Grapevine virus A (GVA) and Grapevine virus B (GVB), and one virus in the genus Foveavirus, Rupestris stem pit-ting-associated virus (RSPaV) (Meng et al., 1998; Zhang et al., 1998; Martelli et al., 1997). Furthermore, another vitivirus i.e. Grapevine virus D (GVD) (Abou Ghanem et al., 1997) was detected in a vine (V. vinefera) showing corky Rugose wood symptoms, but its role in the RW is unclear. Diagnostic tools for the detection of grapevine viruses have evolved through the years to include highly sophisticated and sensi-tive detection methodologies, starting from biological indexing using woody indicators and herbaceous hosts, Enzyme-Linked Immuno Sorbent Assay (ELISA), Polymerase Chain Reaction (PCR), real-time TaqMan® RT-PCR and Low density array (LDA) . Detection of RW is based on bioassays, ELISA, and RT-PCR. Bioassays are widely used, but they are time and labor intensive. The low concentration of RW-re-lated viruses and their uneven distribution in infected plants along with the seasonal titer variation, make detection by ELISA methods difficult and sometimes unreliable. Further investigations have shown the existence of large sequence variability among different isolates of RSPaV (Meng et al., 1998 and Lima et al., 2006) GVA (Murolo et al., 2008) and GVB (Shi et al., 2004). In addition, high concentrations of phe-nolic compounds and polysaccharides that exist in grapevine tissues inhibit the function of enzymes used in RT-PCR and thus prevent virus detection. Real-time PCR is increasingly being used for the detection and quantification of pathogens in plant tissue (Osman et al., 2007 and 2008). TaqMan® PCR is a sensi-tive method that substantially increases the reliability of virus detection in host plants. Primers and probes used in TaqMan® RT-PCR assays for the detection of viruses constituting the RW complex were designed from the CP regions that were proven to exhibit high degree of sequence conservation. Therefore the TaqMan® assays developed were able to detect more isolates than conventional RT-PCR. Two sample preparation methods were compared in standard and real-time TaqMan® RT-PCR assays using purified RNA and crude extract. TaqMan® Low-Density Arrays (LDA, Applied Biosystems, Foster City, CA, USA) has recently been introduced as a novel approach for pathogen detection. LDA is a modified method of real-time TaqMan® PCR that uses micro plates with 384 wells. Similar to real time RT-PCR, these arrays enable a more focused and sensitive approach for the detection of plant pathogens while offering higher


64

throughput compared to RT-PCR. In this study, the LDAs have been evaluated as a diagnostic tool for detecting grapevine viruses. The objective of this study was to design sensitive TaqMan® PCR and LDA assays for the detection of RSPaV, GVA, GVB and GVD with the capability to detect large sequence vari-ation within the viruses. The results presented here clearly show that TaqMan® RT-PCR and LDA are ro-bust and reliable methods for the detection of viruses constituting the RW complex of grapevine whether using purified RNA or crude extract as the starting template.

Results showed that more viruses were detected in tested samples when total RNA prepared by AB method was used (Table 1). This automated approach for nucleic acid extraction has also the advantages of allowing a rapid (<1 h), high throughput sample preparation and reduced possibilities of cross contami-nation between samples, therefore, suitable for processing large number of samples which usually re-quired in diagnostic laboratories. In addition, RNA extracted by the AB method was quite clean, contained negligible amount of inhibitors and had appropriate CT values when tested by the internal control of 18S rRNA TaqMan® assay (Osman et al., 2007). In contrast, GES is a crude method of preparing samples that includes inhibitors of RT-PCR enzymes. As a result, the amplification of low tittered viruses in the samples is inhibited. In this study, the comparison of the real-time TaqMan® RT-PCR assay to conven-tional RT-PCR showed that real-time TaqMan®RT-PCR detected viruses in grapevine samples that were previously tested negative by conventional RT-PCR (Table 2). The 4 fold serial dilution experiments of the viruses associated with RW revealed that TaqMan RT-PCR was 32 and 256 fold more sensitive than RT-PCR, respectively, when samples prepared by AB and GES methods were used (Fig.1). In addition the results showed that the TaqMan RT-PCR was 4 fold more sensitive in detecting samples prepared by AB method compared to GES method and 32 fold more sensitive when RT-PCR was used (Fig.1). Similar results were obtained for all four viruses used in this investigation. The reliability of TaqMan® RT-PCR as-says for routine diagnostics was improved by adding the 18S rRNA TaqMan® assay as an internal control. In summary, the TaqMan® RT-PCR assays described here were designed in order to advance routine virus diagnostics in grapevines. No validated routine molecular assay has previously been reported for high-throughput testing of grapevine diseases associated with the RW complex. The TaqMan® RT-PCR assays developed were found to be sensitive, specific and robust in that a range of isolates of RSPaV, GVA, GVB and GVD from geographically diverse regions were detected. Also, the testing process which starts from AB nucleic acid extraction to TaqMan® RT-PCR final results can be achieved in less than 3 hours. In addition, in this method, the results are evaluated quantitatively based on CT values, therefore, it eliminates the use of gel electrophoresis and gel documentation, saving time and labor, especially when large number of samples are involved. To further improve the diagnostic method, the very sensitive, high capacity LDA system was investigated for the simultaneous detection of RW viruses in infected grape-vines. In this study the LDA CT values were compared with results obtained from conventional RT-PCR and real-time TaqMan® RT-PCR. A comparison between conventional diagnostic methods and the Taq-Man® RT-PCR and LDA showed that the latter two diagnostic techniques were very sensitive in detecting viruses. The designed TaqMan® RT-PCR assays and LDA had a broad range which could detect virus isolates collected from wide geographical regions where many of them were undetectable by conventional RT-PCR (Table 2). Quantification of the viruses is also possible by TaqMan® RT-PCR in extracts of total plant RNA as well as crude extract in GES buffer (Osman et al, 2006). In summary, LDA analysis is a mo-lecular diagnostic method that is primarily based on the real time TaqMan® RT-PCR assays and this is the first report of its use in the detection of plant viruses. It is rapid, reliable, very sensitive, easy to perform and applicable to use for testing large number of samples. The results showed that the LDA technology is a promising and time-saving tool in detecting of plant pathogens and allowing simultaneous analyses of different pathogens in the same sample in a single reaction set up. LDA system produces comparable and often better results than those produced by TaqMan® RT-PCR.

ReferencesAbou-Ghanem, N., Saldarelli, P., Minafra, A., Buzkan, N., Castellano, M. A., Martelli, G.P., 1997. Proper-

ties of grapevine virus D, a novel putative Trichovirus. J. Plant Pathol. 78, 15-25.Golino, D., Sim, S., Rowhani, A., 2000. Identification of the latent viruses associated with young vine de-

cline in California. In: Proceedings of the 13th Meeting of ICVG, 2000. Adelaide, Australia, 85.


65

Lima, M. F., Alkowni, R., Uyemoto, J. K., Golino, D., Osman, F., Rowhani, A., 2006. Molecular analysis of a California strain of Rupestris stem pitting-associated virus isolated from declining Syrah grape-vines. Arch. Virology 151, 1889-94.

Martelli, G.P., 1993. Rugose wood complex. In G.P. Martelli (Eds), Graft-transmissible diseases of Grape-vines: handbook for detection and diagnosis, 45–54. Food and Agriculture Organization of the United Nations, Rome.

Meng, B., Pang, S-Z, Forsline, P.L., McFerson, J.R., Gonsalves, D., 1998. Nucleotide sequence and genome structure of grapevine Rupestris stem pitting associated virus-1 reveal similarities to Apple stem pitting virus. J. Gen. Virology 79, 2059–69.

Murolo, S., Romanazzi, G., Rowhani, A., Minafra, A., La Notte, P., Branzanti, M., Savino, V., 2007. Genet-Genet-ic variability and population structure of Grapevine virus A coat protein gene from naturally infected Italian vines. Euro. J. Plant Pathol. 120, 137-145.

Osman, F., Leutenegger, C., Golino, D. and Rowhani, A. (2007). Real-time RT-PCR (TaqMan®) assays for the detection of Grapevine Leafroll associated viruses 1-5 and 9. J. Virol. Methods 141, 22-29.

Osman, F., and Rowhani, A. 2006. Application of a spotting sample preparation technique for the detec-tion of pathogens in woody plants by RT-PCR and real-time PCR (TaqMan). J. Virol. Methods 133: 130-136.

Shi, B.J., Habili, N., Gafny, R., Symons, R.H., 2004. Extensive variation of sequence within isolates of grapevine virus B. Virus Genes 29 (2), 279-85.

Zhang, Y-P, Uyemoto, J.K., Golino, D.A., Rowhani, A., 1998. Nucleotide sequence and RT-PCR detection of a virus associated with grapevine rupestris stem-pitting disease. Phytopathology 88, 1211–17.

RNA GES RNA GES RNA GES RNA GES RNA GES RNA GES RNA GES RNA GESAfganistan 3 3 2 3 3 − − − − − − − − − − 1 − − − −Australia 7 5 4 7 6 − − − − − − − − − − − − − − −Belgium 1 1 − 1 1 1 1 1 1 1 1 − 1 − 1 1 − 1 −Chile − − − − − 2 2 1 2 2 2 − − 2 − 2 − − − −China 2 2 1 2 2 − − − − − 1 − − 1 1 1 − − − −Egypt − − − − − 2 2 1 2 1 2 1 − 1 − 2 − − − −France 38 32 25 36 33 9 5 1 5 − 9 4 1 6 4 7 1 − 1 −Germany 7 3 2 6 5 4 4 2 4 4 − − − − − − − − − −Greece 1 − − 1 − 1 − − 1 − − − − − − − − − − −Hungary 2 2 − 1 1 3 1 − 1 − − − − − − − − − − −India 1 1 − 1 1 1 1 − 1 1 1 − 1 − − − − − −Italy 18 15 10 16 13 8 7 3 8 5 8 5 2 5 3 8 3 1 5 2Israel 3 2 1 2 2 3 1 − 1 1 3 − − 1 − − − − − −Mexico 1 1 − 1 − 1 1 − 1 1 − − − − − 2 − − 1 1Portugal 6 6 4 6 5 5 3 1 4 4 5 − − 4 3 5 − − 1 −South Africa 3 1 − 3 2 2 2 1 2 2 2 − − 1 − 2 − − 1 1Spain 2 2 − 2 2 2 1 2 2 − − − − − 2 − − − −Russia 12 8 5 10 7 11 4 1 6 5 11 4 1 8 3 10 − − − −USA 2 2 1 2 2 9 4 1 5 3 9 4 1 8 5 9 2 − 4 2Yugoslavia 2 2 1 2 2 − − − − − − − − − − − − − − −Unknown 12 10 8 11 9 23 15 8 17 11 23 12 6 18 9 23 8 4 16 6Total 123 98 65 104 96 87 54 20 63 43 77 31 11 57 28 75 15 5 30 12

% of detection 80% 53% 85% 78% 62% 23% 72% 49% 40% 14% 74% 36% 20% 7% 40% 16%

# of grape

variety tested

Origin

# of grape

variety tested

TaqMan®

PCR # of grape

variety tested

RT-PCR TaqMan ®

PCR

GVD CP 7V - 471C

primers

GVD TaqMan

assay

GVA C1 - V1 primers

RT-PCR

RSP CP 48F-49R primers

RSPaV TaqMan

assay

RT-PCR RT-PCR TaqMan ®

PCR

GVA TaqMan assay

# of grape

variety tested

GVB C1 - V1 primers

GVB TaqMan

assay

TaqMan®

PCR

Table 1 Comparison between conventional RT-PCR and real-time TaqMan RT-PCR for the detection of Rupestris stem pitting associated virus (RSPaV), Grapevine virus A (GVA), Grapevine virus B (GVB) and Grapevine virus D (GVD). Virus isolates from different regions of the world were selected. Two different sample preparation

methods of GES and total RNA extraction (RNA) were compared. ‘-‘indicates negative result.

RSPaV GVBGVA GVD


66

Table 2, A comparison between the efficiency of RT-PCR, TaqMan® RT-PCR and low density arrays (LDA) for the detection of Rupestris stem pitting associated virus (RSPaV), Grapevine virus A (GVA), B (GVB) and D (GVD). Total of 29 plants with multiple virus infections were selected for this experiment. Number of plants tested positive for each virus by different detection methods are recorded in the table.

Virus RT-PCR TaqMan®

RT-PCRLow Density

Arrays using 2X AB RNA

RSPaV 15 24 25GVA 8 12 13GVB 12 17 20GVD 4 5 6

RNA

1: 401: 160

1: 640

1: 2560

1: 409601: 10240

1: 81920

1:163840

GES

1: 401: 1601: 640

1: 2560

1: 409601: 10240

1: 81920

1:163840

RNA GES

1 2 3 4 5 6 7 8 9 2 3 4 51RNA

Purified RNA Crude Extract A B

C D

Fig. 1. Sensitivity comparison between conventional RT-PCR and TaqMan and assays for the detection of GVB using three replications of dilution series ranging from 1 to 1:163.840) from purified RNA (A and C) and infected grapevine crude extract (B and D). A and B Plots of the RNA dilution series against the threshold cycles values showing the dynamic range of detection of real-time RT-PCR assay. (B) Agarose gels showing the amplification products obtained by conventional RT-PCR with primers GVB V1 and GVB C1. Lane 1: 1 kb+ molecular weight marker (Invitrogen); lane 2: undiluted infected tissue; lane 3: 1:20 dilution, lane 4: 1: 40 dilution; 1:80 dilution; lane 5: 1: 160 dilution; lane 6: 1: 320 dilution; lane 7: 1:640dilution; lane 8: 1:1280 dilution, lane 9: 1: 2560 dilution.


67

Effects of Long-Term Floor Management on the Bacteria and Nematode Communities in a Salinas Valley Vineyard

Shane Parker1, Kerri Steenwerth2, and Daniel Kluepfel2 1Department of Plant Pathology, University of California, Davis

2Crops Pathology and Genetic Research Unit, USDA-ARS

In the final year of a 5-year vineyard floor management field study, the bacterial and nematode communities present in the grapevine row and inter row area across floor management strategies were examined. Samples were assayed for total bacteria and nematode populations in addition to identifying members of these communities.

The nematode community in the inter row area was significantly affected by both weed management and cover crop practices. In the row, nematodes were not affected quantitatively or qualitatively under the six management regimes. Moreover, the nematode community of the row was different from that found in the inter rows. Weed management and cover cropping practices had no significant quantitative effect on the culturable bacteria community in the inter rows. However, qualitatively, bacterial populations were altered as a function of cover crop and weed management practices. The grapevine rhizosphere bacterial populations were greater than populations in the inter row bulk soil during the grape root flush in the spring. During harvest and dormancy, bulk soil bacterial populations were greater in the inter rows than in the row.

This data suggests that changes in the inter row microbial community do not influence the microbial community of the row where the roots of the vine are concentrated. In addition, inter row weed and cover crop management strategies had no detectable effect on microbial and nematode communities in the grape rhizosphere.


68

Identification of Critical Output Parameter for Grape based on Mathematical Principles

Dr. Radhakrishna M. Putcha1 , Dr. Chandrasekhar Putcha2, Dr. B.S. Rao3, Dr. G. Ram Reddy4 and Dr. D. Vijaya5

1 Principal Scientist, Grape research Station, APAU, Rajendranagar, Hyderabad, A.P. India2 Professor, Department of Civil and Environmental Engineering, California State University, Fullerton, CA 92834, USA

(e-mail address of corresponding author: [email protected])3 Senior Scientist, Grape research Station, APAU, Rajendranagar, Hyderabad, A.P. India

4 Scientist, Grape research Station, APAU, Rajendranagar, Hyderabad, A.P. India5 Scientist (Soil Science), Grape research Station, APAU, Rajendranagar, Hyderabad, A.P. India

Extensive data has been collected at the Grape research station in India which has been published in the form of a report (Putcha et al., 2006). This data deals with the input parameter of average pruning weight. The output parameters considered are: average yield (kg/vine), average juice, average TSS (sweetness) and average acidity of grape. The aim is to identify the most critical parameter based on the mathematical principles. For this, first functional relationship is developed between the input parameter and each of the output parameters. The input parameters considered are: average pruning weight of grape tree. This is done using the principles of regression analysis (Putcha, 2007a; Putcha,2007b). The well known MATLAB (Gilat,2004) has been used for statistical analysis. The data used for the input parameter of average pruning weight is given below:

Pruning weight (p): [1.92 1.51 1.82 2.76 1.58 2.51 2.29 2.20 3.09 2.30 1.42 1.50 2.46]t

t represents the fact that the pruning weight vector is really a column vector shown here as a row vector for lack of space.

The data for the output parameters [average yield(y), average juice(j), average sweetness (TSS), average acidity (a)] is shown below again as a row vector.

Data for yield (y): [ 4.27 6.47 3.74 3.57 2.61 4.84 3.80 3.40 3.40 1.96 2.87 3.44 3.08]t

Data for average juice (j): [ 65.84 65.39 71.91 74.84 73.84 55.36 67.35 56.72 61.76 67.19 55.64 55.41 63.11]t

Data for average sweetness (TSS): [16.10 19.40 15.42 18.58 21.71 22.62 18.13 21.15 22.30 16.11 22.46 21.25 18.30]t

Data for average acidity (j): [ 0.82 0.70 0.91 0.63 0.57 0.52 0.62 0.57 0.52 0.70 0.67 0.61 0.68]t

The following regression equations were obtained for the four output parameters [average yield(y), average juice(j), average TSS, and average acidity (a) as a function of input parameter of average pruning weight (p). y = -.2851 p + 4.2501 (1)j = 1.1834 p + 61.69 (2)tss = -0.047 p + 19.6028 (3)a = -0.0804p + 0.8245 (4)Before the above equations (linear regression equations) were derived for various output parameters,


69

polynomials of different degrees (n=2, n=3 and n=4) were fitted for the data of average yield and pruning weight. These are given as follows:

Second degree polynomial (n=2)

y = 0.2542 p2 – 1.3883 p + 5.3805 (5)

Third degree polynomial (n=3)

y = 0.2044 p3 – 1.1318 p2 + 1.6361 p + 3.2666 (6)

Fourth degree polynomial (n=4)

y = -6.39 p4 +57.60 p3 -189.97 p2 + 271.22 p – 137.52 (7)

After visual observation of the plots for yield versus the pruning weight, it was decided that the linear regression (as shown in Eq.1) is best suited for the data between yield and pruning weight.Similar conclusions were drawn between the data for average juice, sweetness (TSS) and acidity (a). Hence, the linear regression equations between various output parameters [yield (y), juice (j), sweetness (TSS) and acidity (a)] as shown in eq. 1-4 are recommended.

MATLAB has been successfully used to develop functional relation between various output parameters related to grape: average yield, average juice, average TSS, and average acidity as a function of input parameter of average pruning weight.

Identification of critical parameterTo identify the critical parameter, the slopes for each of the above linear equation is calculated. The equation for the output parameter for which the maximum absolute value of slope is maximum is the most critical parameter.

Using this basic principle, the absolute values of slopes of the above linear equations are given below.

m(for yield) = 0.2851; m (for juice) = 1.1834; m (for TSS) = 0.047; m (for acidity) = 0.0804

For this study, the output parameter is found to be the most critical parameter for grape.

The optimum value of the pruning weight can be obtained from the actual plots of output and pruning weight from the points of intersection. These results have practical applications.

References:Gilat (2004). MATLAB: An Introduction with Applications. John Wiley & Sons, Inc.Putcha, Radhakrishna, B.Srinivasa Rao, G.Ram Reddy and D.Vijaya (2006). All India Coordinated

Research Project on Subtropical Fruits (Grape). Report prepared by Grape Research Station, Acharya N.G. ranga Agricultural University, Rajendranagar, Hyderabad, A.P. India.

Putcha (2007a).Calculation of Forces in lumbar spines with multiple guy wires. Proceedings of ACSM(American College of Sports Medicine), New Orleans.

Putcha (2007b). Mathematical formulation of poverty index. European Journal of Scientific Research, October.


70

Grapevine Fanleaf Virus, Tomato Ringspot Virus and Grapevine Rupestris Stem-pitting Associated Virus are Present in Chardonnay

with a Severe Vein-clearing Disease

Shaista Lunden1, Baozhong Meng2, John Avery, Jr.1 and Wenping Qiu1

1 Department of Agriculture, Missouri State University, Mountain Grove, MO 65711, USA 2 Department of Molecular and Cellular Biology, University of Guelph

50 Stone Road East, Guelph, Ontario, Canada N1G 2W1

A severe disease was observed on the grape variety Vitis vinifera ‘Chardonnay’ in a two-acre vineyard in Missouri (Qiu et al. 2007). More than 90% of vines were affected. Symptoms resembled those caused by virus-like pathogens, including short internodes of zigzagged growth, deformed leaves with a mosaic pattern of dark green and light yellow tissue, vigor decline, small clusters, and few fruits. The vineyard became unprofitable 10 years after planting, and hence the vines were removed and destroyed in 2007.

Severe deformation of young leaves and conspicuous vein-clearing on expanded leaves were observed on leaves of bud-grafted asymptomatic Chardonnay, suggesting that the causal pathogens are graft-transmissible. Two buds of originally infected source Chardonnay vines were also grafted onto virus indicator grapevines, V. vinifera ‘Cabernet Franc’, V. vinifera ‘Baco Blanc’, and hybrid ‘LN-33’. Vein-clearing appeared on all grafted vines although grafted LN-33 showed very mild vein-clearing. No visible symptoms were observed on herbaceous plants Chenopodium quinoa, Nicotiana benthamiana, cucumber, tomato, pepper, and cowpea after mechanical inoculation with leaf sap of diseased Chardonnay vines. This new disease of Chardonnay is tentatively named as ‘grapevine vein-clearing disease’.

ELISA failed to detect four nepoviruses Tomato ringspot virus (ToRSV), Tobacco ringspot virus, Arabis mosaic virus, and peach rosette mosaic virus as well as Grapevine leafroll-associated virus 3. Through reverse-transcription polymerase chain reaction (RT-PCR) using degenerate primers for detecting grapevine nepoviruses, we detected the presence of Grapevine fanleaf virus (GFLV)-specific sequences (Qiu et al. 2007). We then conducted RT-PCR to determine whether other members of the Nepovirus genus as well as viruses that belong to different taxonomic groups were also present in the infected Chardonnay. Using virus-specific primers, we detected ToRSV and Grapevine rupestris stem pitting-associated virus (GRSPaV). Electron microscopic observations provided evidence that nepovirus-like particles were present in infected grapevines. To investigate if the three viruses were simultaneously present in single vines, we sampled leaves with severe vein-clearing symptoms from three individual vines and performed RT-PCR assays with primers that are specific to the capsid protein (CP) genes of GFLV, ToRSV, and GRSPaV. Sequences of each of virus-specific PCR-amplified DNA fragments were also determined and their identities were confirmed each specific virus. These results demonstrated that GFLP, ToRSV, and GRSPaV were co-existent in individual vines.

The results from this study suggested that mixed infection of multiple viruses can result in severe disease on a cultivated grape variety. Infection of multiple viruses either reveals symptoms or remains symptomless in grape varieties and rootstocks. Symptomless scions could develop symptoms once they were grafted onto different rootstocks and planted in commercial vineyards, such as in the case of the Grapevine leafroll associated virus-2 Redglobe virus (Rowhani et al. 2005). Frequent exchanges of grapevine germplasms and grafting of various combinations of scions and rootstock create numerous opportunities for different viruses and viral isolates to merge within a single vine. Mixed infection of multiple virus species frequently aggravates the severity of symptoms in a single vine. Afterwards, a viral complex will remain and perpetuate in the progeny vines via large-scale vegetative propagation. This study presents a typical case supporting that it is imperative to develop a network for national and


71

international exchange of clean grapevine propagation materials (Golino and Savino 2008). Propagating certified grapevines will greatly reduce the incidences of mixed infections and hence new diseases in grape growing regions with diverse climatic, environmental and soil conditions.

AcknowledgementsThis project was supported by funding from the Missouri Wine and Grape Board and from USDA-Viticulture Consortium-East Section under the Subaward number 51401-8279 through Cornell University. We thank Keith Striegler for informing us about this disease, and the owner and manager of the Chardonnay vineyard for their permission and assistance of collecting samples.

ReferencesGolino, D. A., and V. Savino. 2008. Certification and international regulation of plant materials. In

Compendium of Grape Diseases, edited by W. F. Wilcox, W. G. Gubler and J. K. Uyemoto. St. Paul, MN: APS Press (in press).

Qiu, W. P., J. D. Avery, and S. Lunden. 2007. Characterization of a severe virus-like disease in Chardonnay grapevines in Missouri. Plant Health Progress online publication, November 19, 2007.

Rowhani, A., J. K. Uyemoto, D. A. Golino, and G. P. Martelli. 2005. Pathogen testing and certification of Vitis and Prunus species. Ann. Rev. Phytopatho. 43:261-278.


72

Genetic and Phenotypic Resistance to Pierce’s Disease in Vitis arizonica/candicans Selections from Monterrey, Mexico

Joshua Robert Rubin and M. Andrew WalkerDepartment of Viticulture and Enology, University of California, Davis, California, U.S.A. 95616

Pierce’s disease (PD), caused by the xylem-limited bacterium Xylella fastidiosa, severely limits grape production in affected areas. Insecticides may slow the spread of PD by insect vectors, but they have negative environmental impacts. Given the existence of a single dominant gene for resistance, backcross breeding provides a suitable solution for the production of resistant cultivars and control of the disease. In the present study the genetic and phenotypic resistance of Vitis arizonica/candicans b43-15, b43-17, b43-36 and b43-56 accessions from Monterrey, Mexico were evaluated and compared. These grapevines were previously crossed with V. vinifera breeding selections to generate four F1 populations (04351: b43-15 x C90-100; 04373: F2-35 x b43-17; 04374: F2-35 x b43-36 and 04375: F2-35 x b43-56). The resistance locus PdR1 from b43-17 has been characterized in previous work.

In this study, the 04351, 04374 and 04375 populations were mapped with 10 PdR1-associated simple sequence repeat (SSR) markers. Five additional markers were targeted to a region of potential segregation distortion on linkage group 14 in 04351. All F1 families were inoculated in the greenhouse and X. fastidiosa infection was quantified by ELISA to assess phenotypic resistance.

Similarities in the segregation of PdR1-linked SSR alleles among b43-15, b43-17, b43-36 and b43-56 support the presence of PdR1 in all backgrounds. No segregation distortion was found in the 04351, 04374 or 04375 populations and cross-over events did not disrupt resistance. The distribution of resistant genotypes in all populations suggests that resistance is controlled by a single dominant gene with some modification. b43-17 resistance degraded compared to the other Monterrey parents under these test conditions. The results of this project indicate that b43-15, b43-36 and b43-56 may confer more robust PD resistance than b43-17 and should be advanced in future backcross breeding.

AcknowledgementsThe authors gratefully acknowledge research support from the CDFA Pierce’s Disease Board and the Louis P. Martini Endowed Chair funds.


73

Collecting Vitis berlandieri from Native Habitat Sites

Joachim Schmid,1 Frank Manty,1 and Peter Cousins*2

1Fachgebiet Rebenzüchtung und Rebenveredlung, Forschungsanstalt Geisenheim, Germany2United States Department of Agriculture, Agricultural Research Service

630 W. North Street, Geneva, NY 14456 email: [email protected]

Lime content is the major difference between Northern American and European vine growing soils. This resulted in significant difficulties in the development of rootstocks for European conditions at the end of the 19th and the beginning of the 20th century. It was only the introduction of Vitis berlandieri as a breeding partner that led to lime tolerant rootstocks. Despite this key role of V. berlandieri for European viticulture, only a few accessions have so far been used for breeding purposes. In most cases these vines were only used because they were available in Europe at this time. The genetic range of the species is certainly much larger and has so far not been utilized. To preserve and evaluate genetic diversity in V. berlandieri, grape berries were collected in September 2005 from a large range of natural stands in Texas, United States. 86 individual vines were sampled. The collection locations were found in thirteen counties and across a distribution from N 31° 23′ to N 29° 43′ and W 100° 2′ to W 97° 26′. Berries were sent to USDA, Geneva, NY and seeds collected and shipped to Geisenheim for germination. Vines will be planted in germplasm collections and evaluated for their rooting and grafting ability, their lime tolerance, and other viticultural features. Superior types will then be utilized in the Geisenheim rootstock breeding program.

The response to the phylloxera epidemic in Europe was that at Geisenheim at the end of the 19th century rootstock breeding was initiated. At this time there were only a small number of individuals of each of the wild species available for breeding. These were mostly selections from the North American wild species Vi-tis riparia, Vitis rupestris und Vitis berlandieri. Although there is independence of flowering time and flower-ing type (male vs. female), hybridization was accomplished among these species and selections. Rootstock breeding also incorporated V. vinifera. The result was rootstock varieties that had varying amounts of phyl-loxera resistance or tolerance, rooting ability, affinity to scion varieties, and adaptation to different soil types.

All the rootstocks in use today in principal derive from these very few individuals of the wild species of North America. Only a small germplasm pool or genetic variation has been be utilized in rootstock breed-ing, even among these three species. In contrast to the narrow genetic base of our rootstocks, the varia-tion among viticultural soils is large, including pH, drainage, salinity, other chemical constituents, etc. In order to improve the adaptation of rootstocks to soils, we should examine new genetic diversity among the primary rootstock species.

In contrast to the non-European wine producing countries, such as the United States, where low lime content is typical, the European wine producing countries have many soil types with high lime content. Ini-tially the lack of adaptation of the rootstocks to these lime soils was a serious problem. The crosses of V. riparia and V. rupestris were not well adapted to the lime soils and iron deficiency chlorosis was the result in the scions. To improve the adaptation of the rootstock to lime soils, V. berlandieri was introduced as a breeding partner in rootstock improvement. Vitis vinifera also was examined as a partner in breeding for rootstocks adapted to lime soils, but this is a problem because of the phylloxera susceptibility of V. vinif-era and its unsuitability for use as a parent in rootstock breeding.

Carl Börner (1880-1953) working in the 1930’s described the true biological resistance to phylloxera coming from the North American wild species V. cinerea. A large part of his breeding program, which were mostly Vitis riparia x Vitis cinerea hybrids, were determined to be highly resistant to phylloxera and also demonstrated excellent viticultural characteristics. After a long period of selection, three rootstocks (Börn-er, Rici, Cina) were introduced into the wine production and grapevine cultivation. Although they have excellent resistance to phylloxera and broad utility in viticulture, they are not well adapted to lime soils and show chlorosis on high lime content soils. In the 1990s in Geisenheim a new program was initiated to breed new rootstock varieties. The aim of the breeding is complete phylloxera resistance in combination with lime soil adaptation and chlorosis resistance. This extensive program began in 1992.


74

In rootstock breeding V. berlandieri has been the best partner in breeding rootstocks for adaptation to limestone soils. This is why V. berlandieri has shown up over and over again in the pedigrees of root-stocks used on limestone soils. However, only a small sample of V. berlandieri selections were used in breeding, because only a few were available in Europe at the time. Were these the best selections for ad-aptation to limestone soils? This gave us this idea to explore the natural home of V. berlandieri, to collect there a wide variety of genetic diversity of this species for future breeding, with the hope to collect mate-rial that would be useful in improving rootstock adaptation to lime stone soils.

Collection locations and detailsIn September 2005 we collected lots of grapes and berries from V. berlandieri in their natural habitat in Texas, with the intention to use the seeds as a source of germplasm. All collection information, with lati-tude and longitude and habitat descriptions, is available from the corresponding author. The species of Texas live together, side by side in the same habitat, but we did not encounter many natural hybrids. The individual vines are male or female flowering, unlike the cultivated species, and so the plants are not self-pollinating. The difference in flowering times is thought to be responsible for maintenance of pure species populations with minimal interspecific hybridization in nature.

The soil of the Edwards Plateau is built from dark, stony, clay over limestone. It is on this soil that the V. berlandieri is most commonly found. However, this species is also found on the alluvial soils of the river-sides. Here on the flat riverbanks are most often found the bigger leafed formed of the species, as water is abundant. On the hillsides where there is only a shallow soil layer due to the erosion of thousands of years, only the small leafed types are found. This demonstrates the great variability of this species and shows its tolerance not only of limestone soils but also its drought tolerance.

In the area around Fredericksburg, in Gillespie County, west of Austin, are found many small creeks and stands of large trees. There V. berlandieri vines grow thick trunks, growing up to the highest point of the trees and spreading onto the canopy. In contrast is the area of Blanco County, which is fairly dry. In this area the growth of V. berlandieri is less vigorous and only reaches heights of 2 – 3 m. The grapes are mostly smaller and the ripening of the grapes is not uniform, with ripe and green berries found in the same cluster; dark blue berries with brown, ripe seeds, and immature berries with unripe seeds.

Results and discussionTo genetically sample a great range of V. berlandieri and collect it for use in breeding, the collection trip of September 2005 went to the natural habitat in central Texas. We sampled many individual wild plants and berries and 86 individual wild plants and the same number of wild stands or populations. The counties in which we collected are Bandera, Bell, Blanco, Burnet, Coryell, Edwards, Gillispie, Hays, Kendall, Kerr, Kimble, Real, and Travis. The berry samples were delivered to the United States Department of Agricul-ture, Grape Genetics Research Unit, Geneva, New York. About 80,000 seeds were extracted, and 35,117 were sent to Geisenheim. At the Department of Grapevine Breeding and Grafting, Geisenheim the seeds were planted and grown. The seedlings will be planted into the test vineyards and evaluated for rooting ability, callusing, lime tolerance, and different growth habits. The best of these will then be used as breed-ing partners in the new rootstock cross breeding program.

LiteratureAmbrosi, H., Dettweiler-Münch, E., Rühl, E. H., Schmid, J., Schumann, F. 1998. Farbatlas Rebsorten. 300

Sorten und ihre Weine. Ulmer Verlag, Stuttgart.Bailey, L. H. 1934. Gentes Herbarum, Vol. III, Fasc. IV, The Species of Grapes peculiar to North America.

Ithaca, New York.Cousins, P. 2005. Evolution, Genetics and Breeding: Viticultural Applications of the Origins of our

Rootstocks. Proceedings of the 2005 Rootstock Symposium, Osage Beach, Missouri.Müller, K. 1930. Weinbau Lexikon für Winzer, Weinhändler, Küfer und Gastwirte. Verlag Paul Paray, Berlin.Munson, T. V. 1909. Foundations of American Grape Culture. Denison, Texas.Schmitthenner, F. 1911. Die amerikanischen Unterlagsreben des engeren Sortiments für die preussischen

Versuchsanlagen. Verlag Paul Paray, Berlin


75

Preharvest Fungicides to Control Postharvest Decay of Table Grapes in California’s San Joaquin Valley

Smilanick, J. L.1, Hashim-Buckey, J.2, Mansour, M. F.1, Mlikota Gabler, F.1, Schrader, P.2, Pryor, M.2, and Margosan, D. A.1

1USDA ARS, San Joaquin Valley Agricultural Sciences Center, 9611 S. Riverbend Ave., Parlier CA 93648 2UC Cooperative Extension Kern County, 1031 South Mount Vernon Avenue Bakersfield, CA 93307

Vineyard applications of fungicides registered in California were evaluated to control postharvest gray mold on table grapes, caused by Botrytis cinerea, after harvest and cold storage for 30 days or more. Only those with activity to control gray mold were used (Adaskaveg, et al. 2008). Captan has been thoroughly evaluated for this purpose, unlike the more modern USEPA ‘reduced-risk’ fungicides introduced more recently. Captan applied after veraison reduced the prevalence of postharvest decay by gray mold by as much as 90% in some tests (Harvey et al. 1955; Luvisi, personal communication). Its residues are persistent compared to ‘reduced-risk’ fungicides. Our objective was to evaluate ‘reduced-risk’ fungicides to control postharvest gray mold.

Materials and MethodsIn laboratory experiments, in vitro activity against B. cinerea was assessed by measuring colony sizes on agar amended with thiophanate methyl (THM; Topsin M™), iprodione (IPR, Rovral™), cyprodinil (CYP; Vangard™), pyraclostrobin+boscalid (PS/BO; Pristine™), pyrimethanil (PYR; Scala™), or fenhexamid (FEN; Elevate™). A 50% reduction in colony diameter of 4 fungicide-sensitive isolates was estimated by regression. To determine the protective or eradicant activity of the fungicides, JMS Stylet Oil, THM, IPR, CYP, PS/BO, PYR, or FEN were applied to run-off at the equivalent of maximum EPA-approved rates to detached ‘Thompson Seedless’ berries at 9.6% by volume, 600, 500, 270, 59/116, 370, or 290 µg/ml, respectively, 24 or 48 h before or after inoculation with a fungicide-sensitive B. cinerea. Postharvest gray mold was assessed after 2 weeks at 15oC. In vineyard tests, fungicide rates were: Vangard 10 oz/acre, Elevate 16 oz/acre, Pristine 12.5 oz/acre, Topsin M 2 lb/acre, Rovral 2 pint/acre, and Scala 18 oz/acre. Cluster-directed sprays to ‘Thompson Seedless’ grapes were applied with a ATV-mounted hand gun sprayer at 180 gal/ac at flowering, bunch closure, onset of veraison, and 2 weeks before harvest in one of 4 programs: 1) water; 2) FEN, PS/BO, THM, then IPR; 3) THM, IPR, PS/BO, then FEN; or 4) IPR+FEN, PS/BO+IPR, IPR, then FEN+PS/BO. To determine fungicide effectiveness in a commercial ‘Ruby Seedless’ vineyard, water, IPR, CYP, PS/BO, PYR, or FEN were applied with an air-blast sprayer at 200 gal/ac at bunch closure and 2 wk before harvest.

Results and DiscussionTHM, IPR, CYP, PS/BO, PYR, or FEN reduced the diameter of colonies of 4 fungicide-sensitive B. cinerea isolates by 50% at 12.4, 2.5, 0.61, 0.29/0.57, 0.26, or 0.17 µg/ml, respectively.When applied from 48 h before to 48 h after inoculation, postharvest gray mold after 2 weeks at 15oC was lowest after FEN, followed by PYR, CYP, IPR, PS/PO, or THM. Effectiveness of IPR, CYP, PYR, and FEN declined when applied 48 h after inoculation (Fig. 1). Postharvest decay after applications of programs 1, 2, 3 or 4 to ‘Thompson Seedless’ grapes stored for 7 weeks at 0oC was 5.5, 1.9, 1.3, or 0.7%, respectively (Table 1). Program 4 was particularly effective. Only FEN reduced gray mold on ‘Ruby Seedless’ in a commercial vineyard significantly, from 15.0% among water-treated grapes to 5.9%. Fungicide residues did not exceed one third of the USEPA maximum residue limits (data not shown). Results of other tests in commercial vineyards were variable; near-harvest applications reduced postharvest decay by about 50% (data not shown). In the San Joaquin Valley, isolates resistant to these fungicides occur, and we are assembling a large collection now.


76

Fig. 1. Control of postharvest gray mold on single detached ‘Thompson Seedless’ berries by fungicides applied to run-off from 48 before to 48 hours after inoculation with B. cinerea. Rates of the fungicides were the concentrations applied in the vineyard when label maximum rates are used in a volume of 200 gal/ac. Concentrations of each were: 1) JMS Stylet oil (2 gal/acre) 9.6% by volume; 2) Topsin M (2 lb/acre) 600 ppm THM; 3) Pristine (12.5 oz/acre) 59 ppm PS and 116 ppm BO; 4) Rovral (2 pint/acre) 500 ppm IPR; 5) Vangard (10 oz/acre) 270 ppm CYP; 6) Scala (18 oz/acre) 370 ppm PYR; and 7) Elevate (16 oz/acre) 290 ppm FEN. The control was water alone. Each was applied to 3 replicates of 50 berries each. Berries were inoculated by spraying them to run off with a water suspension of 500,000 B. cinerea conidia/ml. After treatment, the berries were stored for 2 weeks at 15oC and infected berries were counted. The test was repeated three times. Values within each interval followed by unlike letters are significantly different according to Tukey’s HSD (P = 0.05).

Table 1. ‘Thompson Seedless’ vineyard fungicide trial. The experiment had 5 replicate plots in a randomized complete block design with 5 vines in each plot. The fruit were harvested August 8 and examined on October 3, 2007 after 11 weeks storage at 1C. After Bunch Veraison 2 wk before flowering closure onset harvest Postharvest decay (%)* May 21 June 13 July 11 July 25 Gray mold Other decay Total 1. Water Water Water Water 5.5 a 1.2 a 6.7 a2. FEN PS/BO THM CYP 1.9 b 1.0 ab 2.9 b3. THM IPR PS/BO FEN 1.3 b 0.8 c 2.1 bc4. CYP-FEN PS/BO-CYP IPR FEN-PS/BO 0.7 c 0.9 b 1.6 c* ANOVA was applied to arcsin transformed values. Actual values are shown. Values with unlike letters are significantly different by Tukey’s HSD (P = 0.05).

ReferencesAdaskaveg, J., Gubler, D., Michailides, T., and Holtz, B. 2008. Efficacy and timing of fungicides,

bactericides, and biologicals for deciduous tree fruit, nut, strawberry, and vine crops. University of California. 42 Pp.

Harvey, J. M. 1955. Decay in stored grapes reduced by field applications of fungicides. Phytopathology 45:137-140.


77

Vineyard Weed Management Practices Influence Soil Microbial Communities and Nitrogen retention

Kerri L. Steenwerth*1 and Kelley M. Belina1

1USDA - Agricultural Research Service, Crops Pathology and Genetics Research Unit, Davis, CA 95616*[email protected]

As cultivation can affect soil characteristics that are important for soil nitrogen (N) dynamics (e.g., soil organic matter content, labile carbon pools, bulk density), we hypothesized that soil N dynamics would differ between these weed management practices that used either chemical control or cultivation. We investigated the effects of two weed management practices (i.e., cultivation and herbicide) on soil N dynamics and microbial communities during a fertigation event.

The experiment was conducted at a Chardonnay vineyard (clone 5) planted on Teleki 5C rootstock in Greenfield, Monterey Co., CA. In the cultivated treatment (‘Cultivation’), the Clemens® vineyard cultivator was used to mechanically till the vineyard rows as needed during the season (i.e. 4-6x). In the herbicide treatment (‘Herbicide’), simazine (2.0 lbs a.i./A) + oxyfluorfen (1.5 lbs a.i./A) was applied in the winter. In summer, post emergence applications of 2% glyphosate + 0.25% oxyfluorfen were applied as needed in the ‘Herbicide’ treatment. These treatments had been established and repeated annually four years prior to the current study. Thus, the current study occurred during the treatments’ fifth year. The soil type was Elder loam with gravelly substratum (Coarse-loamy, mixed, superactive, thermic Cumulic Haploxeroll). Soil texture among all depths and treatments was approximately 60% sand, 25% silt, and 15% clay. Soil characteristics (i.e., cation exchange capacity, soil pH, exchangeable cations, bulk density, total N) varied with depth, but few differences occurred between the ‘Cultivation’ and ‘Herbicide’ treatments. During fertigation, nitrous oxide (N2O-N) efflux was greater in ‘Herbicide’ than ‘Cultivation’. At its greatest efflux rate, which occurred one day after fertigation, N2O efflux from ‘Herbicide’ was approximately 4.3 μg N2O-N m-2 s-1 while it was about 2 μg N2O-N m-2 s-1 in ‘Cultivation’. Nitrous oxide efflux decreased thereafter, reaching pre-irrigation values ten days after fertigation in both treatments. When anionic resin bags that had been installed at 1m depth in November 2005 were removed one year later, inorganic N concentrations under the emitters were 1300-fold greater in the ‘Herbicide’ than ‘Cultivation’.

This, in combination with the reduced N2O-N efflux, suggests that ‘Cultivation’ had increased soil N retention than ‘Herbicide’. Preliminary estimates suggest that approximately 4-6% of the total N added to the vineyard soil during the growing season was captured by the resin in ‘Herbicide’. These preliminary findings suggest that weed management practices had impacts on N2O efflux as well as soil N retention. Microbial community composition also differed between weed management practices and shifted in response to the fertigation event in both weed management treatments.


78

The Physiological Basis of rootstock Control of Grape Fruit Nitrogen Composition

Christine M. Stockert* and David R. SmartDepartment of Viticulture and Enology, University of California, Davis

One Shields Avenue, Davis, CA 95616, USA Fax: 530-753-0382 email: [email protected]

Nitrogen’s central role in the amide bond of proteins renders it as the most important macronutrient to vegetative growth and reproductive development. This holds true for grape growth and development as well. Grape nitrogen (N) status is crucial for successful winemaking. In wine grape juice (“must”), N composition drives fermentation dynamics and wine quality because yeast-assimilable nitrogen (YAN) is the major nutrient for yeast (Bell and Henschke, 2005). YAN consists of all free amino-N compounds (all amino acids except proline) plus ammonium. Therefore, vineyard N management is critical for heightened quality of wine. Standard viticultural practices in the US include grafting a “scion” onto a “rootstock” to control vegetative growth, pests, diseases, and to ameliorate adverse soil conditions such as high lime content. For wine grapevines, the scion is usually a Vitis vinifera cultivar and the rootstock is a non Vitis vinifera cultivar. For these reasons, one of the most important choices made during vineyard establish-ment includes choosing a suitable rootstock.

Rootstocks that confer low vegetative growth (vigor) to the scion are desired in valley floors or on deep fertile soils. Low canopy vigor requires less labor inputs and increases light in the fruiting zone, improv-ing phenolics in red grape varieties. However, research suggests that rootstocks can strongly affect free amino-N concentrations in the fruit of the scion (Sponholtz, 1991). For example, scion fruit grown on low vigor rootstocks tend to have lower amino-N contents than fruit grown on higher vigor rootstocks (Huang and Ough, 1989; Treeby, 2001; Treeby et al., 1998; Zerihun and Treeby, 2002). Wine yeast require at least 140 mg/L of yeast assimilable amino-N (YAN) to complete fermentation (Agenbach, 1977). Low lev-els of must YAN can cause slow or stuck fermentations (Bisson, 1999). To compensate for low YAN, some winemakers add diammonium phosphate (DAP) to their must. However, yeast will preferentially assimilate free ammonium ions over amino acids which can reduce the complexity and desirable flavor aromas of wine (Bisson and Butzke, 2000). Therefore a problem can exist if desirable low vigor leads to undesirable low must YAN concentrations.

In a recent experiment in my laboratory, we compared two rootstock cultivars that differed in potential growth rate. The rootstock 1103 Paulsen (Vitis berlandieri x V. rupestris cv 1103P) has a root system that tends to provide high shoot growth (HSV). The other rootstock was Millardet de Gramanet (V. riparia x V. rupestris cv 101-14 Mgt), a root system associated with lower shoot vigor (LSV). Vines were grown under different quantities of drip irrigation in an established Merlot (Vitis vinifera cv Merlot) experimental block in Oakville, CA. The 1103P rootstock conferred high YAN upon the scion fruit while the 101-14 Mgt. root-stock has consistently, over several seasons, exhibited an inability to acquire sufficient N so as to avert problems with timely completion of fermentations. From our analyses, 1103P had two times the YAN con-centration that 101-14 Mgt. has. Fermentation times have reflected this, with 101-14 Mgt. being sluggish and achieving dryness (depleted sugar) significantly later than 1103P (Fig 1). In essence, the difference in nitrogen levels between the two rootstocks resembles a fertilization study, in which 1103P roots received a high nitrogen fertilizer and 101-14 Mgt. received none.

Averaged over three years (2003-2005), the 101-14 Mgt. root system produced approximately three-fold more roots in the winter months (Dec-Feb.) than the 1103P root system (Bauerle et al., 2007). The stand-ing crop for 101-14 Mgt. roots was highest in the early spring whereas 1103P’s roots were highest in the summer (fig 2). This implies that N applied to 101-14 Mgt. roots in the summer may not be as readily taken up at this time of the year. Our data indicates that a new paradigm for fertilizer timing for certain rootstocks in N-limiting soils may need to be established in order to maximize fertilizer use efficiency.

The experiments were conducted over the last 5 years in an established vineyard at the UC Davis Oakville Research Station. The entire vineyard covers 2.6 acres and was laid out in a randomized com-plete block design (RCBD) of six blocks with subplots of 6 vines of each of the rootstocks 1103P and


79

101-14 Mgt. There were five separately controlled irrigation/treatment systems. The low-N (17 kg/ha) and high-N (35kg/ha) fertilized vines were deficit irrigated June through October (no more than 40% of the estimated crop evapotranspiration, ETc, as determined from an on-site CIMIS Station). At harvest, grapes were crushed and juice must was measured for amino acids, phenolics, Brix, TA, and pH. Each rootstock-treatment combination was fermented at the UC Davis Viticulture and Enology Winery. Wines were as-sayed for tannins, phenolics, and anthocyanins using the Adams assay.

Figure 1: Correlation between Yeast Assimilable Nitrogen compounds (YAN) and initial fermentation rates (first 5 days of fermentation) for all rootstock-treatment combinations. Values are means for three replicate fermentation years (2005-2007). The correlation regression r2=0.90 value clearly shows that fer-mentation rates are dependent on YAN concentrations. Applying N fertilizer significantly increased YAN and fermentation rates compared to non-N fertilized treatments. However, the fermentation rates or YAN levels for fruit from N fertilized rootstock 101-14 Mgt. were consistently lower then fruit from non-N fertil-ized 1103P rootstocks.

References:Agenbach, W. 1977. A study of must nitrogen content in relation to incomplete fermentations, yeast

production and fermentation activity. Proceedings of the South Afican Society of Enology and Viticulture: 66-87.

Bauerle, T.L., D.R. Smart, W. Bauerle, C.M. Stockert, and E.D. M. 2007. Root foraging in response to heterogeneous soil moisture in two grapevines that differ in potential growth rate. New Phytologist. in review.

Bell, S.-J.and P.A. Henschke. 2005. Implications of nitrogen nutrition for grapes, fermentation and wine. Australian Journal of Grape and Wine Research. 11: 242-295.

Bisson, L.F. 1999. Stuck and Sluggish Fermentations. Am. J. Enol. Vitic. 50: 107-119.Bisson, L.F.and C.E. Butzke. 2000. Diagnosis and Rectification of Stuck and Sluggish Fermentations.

Am. J. Enol. Vitic. 51: 168-177.Eissenstat, D.M., T.L. Bauerle, L.H. Comas, A.N. Lakso, D. Neilsen, G.H. Neilsen, and D.R. Smart.

2006. Seasonal patterns of root growth in relation to shoot phenology in grape and apple. Acta Horticulturae. 721: 21-26.

Huang, Z.and C.S. Ough. 1989. Effect of Vineyard Locations, Varieties, and Rootstocks on the Juice Amino Acid Composition of Several Cultivars. Am. J. Enol. Vitic. 40: 135-139.

Kliewer, W.M. 1967. Annual Cyclic Changes in the Concentration of Free Amino Acids in Grapevines. Am. J. Enol. Vitic. 18: 126-137.

Sponholtz, W.R. 1991. Nitrogen compounds in grapes, must and wine. Proceedings of the International Symposium on Nitrogen in Grapes and Wine, Seattle, Washington, USA, June 18-19. p. 67-77.

Treeby, M.T. 2001. Sultana fruitfulness and yield: responses to rootstock and nitrogen supply. Australian Journal of Experimental Agriculture. 41: 681-687.

Treeby, M.T., B.P. Holzapfel, R.R. Walker, and P.R. Nicholas. 1998. Profiles of free amino acids in grapes of grafted Chardonnay grapevines. Australian Journal of Grape and Wine Research. 4: 121-126.

Zerihun, A.and M.T. Treeby. 2002. Biomass distribution and nitrate assimilation in response to N supply for Vitis vinifera L. cv. Cabernet Sauvignon on five Vitis rootstock genotypes. Australian Journal of Grape and Wine Research. 8: 157-162.


80

An Update on research on Grapevine Necrotic Union on 110r rootstock

Mysore R. Sudarshana1*, Maher Alrwahnih2, Rhonda J. Smith3, Larry J. Bettiga4, Adib Rowhani2 and Jerry K. Uyemoto1

1USDA-ARS, Crops Pathology and Genetics Research Unit, Department of Plant Pathology University of California, One Shields Avenue, Davis, CA 95616

Corresponding author and retired Research Plant Pathologist, respectively.2Department of Plant Pathology, University of California, One Shields Av., Davis, CA 95616

3University of California Cooperative Extension, 133 Aviation Blvd., Suite 109, Santa Rosa, CA 954034University of California Cooperative Extension, 1432 Abbott Street, Salinas, California 93901

In September 2004, an inspection of a 7-leaf vineyard (located in Sonoma County) of Pinot noir clone 02A grafted on rootstock 110R (V. berlandieri x V. rupestris) identified a new disease described as 110R necrotic union (Alrwahnih et al., 2007). Symptoms ranged from grapevines with full canopy, red leaves, and grape clusters that appeared normal (termed acute phase) to grapevines with weak shoot growth, small sized reddish leaves, and clusters with reduced set and delayed maturity (chronic phase). Graft unions of symptomatic grapevines showed complete encirclement of necrotic tissue and hence the disease was named ‘grapevine necrotic union’. In repeated surveys of a sub-block in the same vineyard, incidence of diseased grapevines increased from 2.1% in the year 2004 to 13.2% in the year 2007, suggestive of ongoing field spread. To understand the nature of the etiological agent associated with this disease, RT-PCR assays were performed using primers specific for 12 grapevine viruses (Alrwahnih et al., 2007).

The molecular assays revealed that Rupestris stem pitting associated virus (RSPaV) was often present in plant samples and occasionally Grapevine leaf roll associated virus 3, or Grapevine virus B, as single and mixed infections as well as Grapevine rupestris vein feathering virus in symptomatic and asymptomatic collections. However, an association of these viruses with grapevine necrotic union was not apparent (Alrwahnih et al., 2007).

In 2005 and 2006, multiple chip-buds from collections of diseased and asymptomatic canes were grafted onto test plants of Cabernet Sauvignon/110R. All test plants visually inspected up to spring 2008 appeared normal. Previously, using similar protocols, we successfully demonstrated the presence of a deadly strain of Grape leaf roll associated virus-2, designated as the Redglobe strain of GLRaV-2 (Uyemoto et al., 2001). Although graft-transmission assays with grapevine necrotic union failed, our pursuit to confirm the presence of an infectious agent continued. We hypothesized that the agent may be of low titer and/or unevenly distributed in diseased grapevines.

Materials and MethodsIn 2006, a bench-graft experiment was conducted with 11 sources of Pinot noir clone 02A. Six bench grafted vines per source were produced using a two-bud scion piece (ca. 15 cm in length) on dormant canes of 110R. The grafts were callused, then planted into carton sleeves (5 cm square x 250 cm long) filled with moist vermiculite, and placed on heat pads in the greenhouse to encourage root and shoot development. After 60 days, the best five plants per source were transplanted into the field and monitored visually in 2006 and 2007.

Results and DiscussionSeven of the sources produced red leaf (RL) plants and enlarged graft unions with symptoms present in one or more of five grafted vines per source as follows: Four sources produced one RL plant each, two sources produced two RL plants each, and one source produced three RL plants. The propagative nature and uneven distribution of the grapevine necrotic union agent were both demonstrated. However,


81

to confirm the infectious nature of grapevine necrotic union, side-graft assays were made in August-September 2007. This process involved inserting and callusing one end of extended canes from source vines into trunks of test plants of Cabernet Sauvignon on 110R. After 30 days, several inserts were scored as live, a measure of grafting success. Test plants will be monitored during summer 2008.

Current activityIn May 2008, we inspected a vineyard in Monterey County reported to contain grapevines which had red canopy last fall. During our inspections, suspect grapevines exhibited yellow-light green leaves and stunted shoots (Figure 1 A and B). Two symptomatic Pinot noir vines and one Pinot Gris vine, all on 110R were sacrificed and necrotic unions were observed in each. Also, another Pinot noir vine on Freedom (1616C x V. champinii) rootstock showed canopy symptoms and wood cylinder markings of grapevine necrotic union an indication that rootstocks 110R and Freedom respond similarly to the associated agent (Figure C). Recent observations in the Sonoma County vineyard confirmed spring canopy symptoms as above. During the 2008 growing season, an extensive survey and sampling of the Monterey vineyard and an evaluation of responses among different rootstocks are planned. In the laboratory, we will continue our efforts to identify and characterize the associated agent.+

Figure 1. Spring canopy symptoms on grapevines Pinot Noir Pommard on 110R (A) Pinot gris clone 145 on Freedom (B) in a vineyard in Monterey County. Necrotic union (C) on the trunks of grapevines pictured in A (left union specimen) and B (right union specimen).

References:Alrwahnih, M., Uyemoto, J.K., and A. Rowhani. 2007. Investigations on the pathogenicity and etiology of

grapevine necrotic union disease. In Proceedings of the 1st Annual National Viticulture Conference, July 18-20, University of California, Davis, CA.

Uyemoto, J.K., Rowhani, A., Luvisi, D., and C.R. Krag, 2001. New closterovirus in ‘Redglobe’ grape causes decline of grafted plants. Calif.Agri., 55:28-31.


82

Utility of the American Viticultural Areas of Texas Information System (AVATXIS) as a Tool in the Characterization of Texas Wine Regions

Elvis A. Takow1*, Edward Hellman2, Maria D. Tchakerian1 and Robert N. Coulson1

1Knowledge Engineering Laboratory, Department of Entomology, Texas A&M University College Station, TX 77843-2475, USA

2Texas AgriLife Research & Extension Center, Lubbock, TX 79403, USA

The Internet and the advent of the computing age provide the technical framework on which Geographic Information Systems (GIS) are built. As GIS use expands beyond the current core of the GIS community, the need to disseminate these capabilities has grown. The spatial and temporal features of the American Viticultural Areas of Texas Information System (AVATXIS) enable instant access by the user to data that allows wine growers to better understand their growing regions, along with the edaphic and climatic fac-tors that influence grapevine growth and fruit production. Winegrowers can use this improved knowledge of growing conditions to help decide which grape varieties to plant and to determine the management practices to employ for high quality wine production.

An Internet- based approach to AVATXIS facilitates wine growers in evaluating factors of climate and soil for various wine regions by using annotated base maps representative of these factors. These maps provide the basis for characterization of the Texas wine regions based on physical characteristics such as soil, climate, and topography. The ability to understand how the character and conditions of a vineyard site affect the quality of wine is a key goal of a wine grower. This is often ultimately dependent on the at-tributes of the site or the vineyard’s “terroir”. Terroir is a holistic concept (Jones et al., 2004). The term encompasses vineyard location, soils, climate and topography as well as other environmental factors. Spatial references are important to many of the determining factors of terroir. The spatial and temporal variables associated with grapevine growth and fruit production are ideally suited to the application of spatial information systems (Smith 2002).

Climate and soils have been recognized as the most important environmental factors for growing great wine grapes (Cox, 1999). According to Gladstones (2001), “Climate governs whether grapes will survive and ripen, what varieties do best where, and some of the characteristics of the resulting wines”. Climate variables can yield predictive indices that will help characterize the Texas wine regions as well as pro-vide indicators for vineyard site selection. Climate variables critical to wine grape growing were identified through literature reviews and consultation with viticultural experts. Some of these climate variables in-clude daily maximum temperature (tmax), daily minimum temperature (tmin), daily average temperature (tavg), precipitation, and growing degree-days (GDD). Degree-days is a rough measure of the cumulative amount of functional heat experienced by grapevines during a growing season defined as April 1 through October 31. The importance of soil type to vine growth is well recognized, but its relationship to wine qual-ity remains controversial (Gladstones, 1992). Many modern scientific writers have minimized the direct influence of soil type on wine quality. Nevertheless, it is clear that soil characteristics impact grapevine growth, which can ultimately influence fruit and wine quality. Grapes are adapted to a wide variety of soil conditions, thus soil characteristics must be understood to properly manage vine nutrition and water avail-ability, and for selection of varieties and rootstocks for new vineyards. To characterize the Texas AVA’s soils, data was obtained from the Soil Information for Environmental Modeling and Ecosystem Manage-ment (http://www.soilinfo.psu.edu) website. This soil data included pH, soil texture class, depth to bed-rock, permeability, and soil bulk density. AVATXIS integrates appropriate soil and climate data particularly using spatial relationships as the key to allowing potential as well as current viticulturist to compare and contrast the factors/constraints that are important to grape production. This tool can be expanded to accommodate greater spatial scales beyond the Texas wine regions thus giving wine growers the ability to characterize potential growing regions at unlimited spatial extents.


83

Figure 1: Maps of Texas Hill Country American Viticultural Area illustrating cumulative GDD in degrees centigrade and soil texture type at a depth of 5cm.

ReferencesCox, J. (1999). From Vines to Wines: The Complete Guide to Growing Grapes and Making Your Own

Wine, Storey Books.Gladstones, J. (1992). Viticulture and Environment, Australia, Winetitles.Gladstones, J. (2001). Climatic indicators guide site selection: Practical Winery & Vineyard: v. 23.Jones, G. V., P. Nelson, et al. (2004). Modeling viticultural landscapes: A GIS analysis of the terroir

potential in the Umpqua Valley of Oregon. Geology and Wine 8: 167-178.Smith, L. (2002). Site Selection for Establishment & Management of Vineyards. Proceedings of the 14th

Annual Colloqium of the Spatial Information Research Centre, University of Otago, Dunedin, New Zealand.


84

Study about the Space Variability of Different Soil Properties and its Effect on Yield, Vigour and Quality in the “DOCa rioja” Vineyard

Unamunzaga O.1, Castellón A.2, Ercilla E.2, Gallejones P.2, Usón A.3 and Aizpurua A.21Department of Viticultura & Enology, University of California

Davis, California, U.S.A. 95616. email: [email protected] 2Neiker-Tecnalia. Basque Institute for Agrarian Research and Development

Berrreaga, 1. 48160. Derio. Spain 3Escuela Politécnica Superior de Huesca. Universidad de Zaragoza.Agricultural and Chemical Engineering School

University of Zaragoza. Carretera de Cuarte, s/n 2007. Huesca. Spain

The main objective of modern enology is to elaborate wines of recognised quality, and the “Terroir” concept has been acknowledged factor in European vineyard. However, soil influences, vine behaviour and berry composition it can be considered as the main factors in the “terroir” concept. The aim of this work was to study the spatial variability of the different soil properties at different soil depth and evaluate the effect of these properties on yield, vigour, and juice quality in the DOCa Rioja vineyard.

Materials and MethodsThis study was carried out from 2005 to 2007 in an 8 ha vineyard called Costanillas planted with “Tempranillo” cultivar located in Oyón (Spain), and it is inside the “DOCa Rioja”. The vineyard was planted in 1980 with the exception of a small area situated in the inferior left corner planted in 2000. The vine spacing is 3 x 1.2 m and there is a drip irrigation system. Vines are grafted on 41B roostock and are trained to a double cordon. There are two different areas called “Brazo” (arm) and “Parte grande” (big part), and this last one also divided in three different parts; a sloping one facing South-West, and the slope facing North-East, the third one is an area (Hondón) of flat ground placed in a lower zone, where the other two converge (Figure 1). Mean annual temperatures are 13.5ºC and mean annual rainfall 399 mm. A regular grid was used with sampling points every 8 rows and 12 vines, resulting in 25 samples per ha (190 points). In this points soil samples were taken at different deeps (0-30, 30-60 and 60-90 cm) to measure profundity and analyze organic matter, Mg and K contents. During three years (2005-07) yield and pruning weight were measured in the same referents points. In 80 of the 190 points different quality parameters related to the pulp (sugar content, pH, acidity, tartaric acid and malic acid) were measured in 2005. Later (2006-07) all through were measured in all the points must K, colour, total polifenolic index and antocians in addition to the quality parameters commented previously. The maps were made using ArcMap Geoprocessing tools. Correlations between parameters were realized by correlations analysis. These statistical analyses were made with the Statistical Analysis System package (SAS Institute, 1988). Blue, red and yellow colours represent maximum, minimum and intermediate values respectively in maps.

Results and DiscussionDuring 2005 and 2006 soil deep was the property which had the highest influence on the final yield. Highest yield areas belong to deepest soil areas (Hondón). On the contrary lowest yield areas belong to low soil deep zones (slope areas), but yield spatial patterns vary through years due to different crop management. Soil deep also was related to pruning weight in 2005-07 following the same spatial pattern. Soil depth and quality, however, have not shown such clear relationship, as the change through the years. In addition soil management as organic fertilization had an influence on the first soil layer (0-30 cm). This layer showed high organic matter in the area where cattle manure was applied. The bottom area presented high organic matter content in the deepest layers, due to the erosion from the two sloping areas. In the same way K follow the same behaviour, showing more amounts on the first layers of soil in fertilized areas. There is no apparent link between soil K and quality parameters. It was only in 2005 that a positive correlation between soil K and tartaric acid was found, and in 2007 when soil K seemed to have relations with must K. Magnesium soil spatial distribution is strongly influenced by the presence or lack of


85

soil clay layer showed in the field in previous studies. The influence of soil Mg over the quality changes with years.

Erosive processes determine the distribution of the soil properties in the field, but the viticulturist’s use of the space in the field has a high influence in the organic matter and the soil K. Soil depth, which determines the water availability for the plants, is one of the most important properties, especially its influence on yield and the pruning weight. None of the other soil properties studied showed a stable effect through all the years on the quality properties of grape.

Parte grande

Brazo

Slope areaSouth-West

Slope areaNorth-East

Hondón

Parte grande

Brazo

Slope areaSouth-West

Slope areaNorth-East

Hondón

Figure 1. Differents soil deep areas of Costanillas vineyard. Blue, red and yellow colours represent maximum, minimum and intermediate values respectively.


86

A Novel Approach for Generating Xylella fastidiosa Resistant Grapevines

Tanja M. Voegel1, 2 and Bruce C. Kirkpatrick2*1University of Freiburg, Center for Applied Biosciences, Freiburg, Germany 79102 2Dept. of Plant Pathology, University of California, Davis, California, U.S.A. 95616

* Corresponding author. E-mail: [email protected]

Xylella fastidiosa (Xf), a Gram-negative, xylem-inhabiting bacterium, causes economically important plant diseases including Pierce’s disease (PD) of grapevines (Hopkins, 1989). Xf is transmitted by xylem feed-ing insects such as sharpshooters. The bacteria multiply in the xylem of infected plants and form three-dimensional biofilms that cause blockages of the vessels. Blockage of grapevine vessels results in water-stress like symptoms and in eventual death of Vitis vinifera vines (Hopkins, 1989).

Biofilm formation is a key element in Xf survival and replication because Xf cells are exposed to high turbulences, an environment low in nutrients, and host defense responses. Haemagglutinins (HAs) are large Xf adhesins that play a major role in biofilm formation in both pathogen-vector (Killiny et al., 2007) and pathogen-plant (Guilhabert et al., 2005) interactions. Knock-out mutants in either Xf HA gene hxfA (PD2118) or in hxfB (PD1792) result in hypervirulent strains that lose the ability to form bacterial aggre-gates by cell-cell aggregation. These mutant strains are biofilm deficient in vitro and in planta, spread faster through grapevine xylem than wild type Xf cells (Guilhabert et al., 2005), and are impaired in their ability to bind to various carbohydrate substrates (Killiny et al., 2007).

To determine the underlying mechanism of Xf HA-mediated biofilm formation, we raised polyclonal anti-bodies against the N-terminal portion of the HA protein. The antibodies were used in Western blot analy-sis of isolated Xf outer membrane proteins, secreted proteins and secreted vesicles and we detected HA proteins in all three fractions. These findings were interesting since adhesins such as HAs are typically only present on the cell surface, but not secreted into the medium as soluble proteins or as vesicles. The size of the mature protein detected by Western blot analysis (220 kD) was smaller than the predicted size based on the amino acid sequence of the protein (360 kD). To identify the processing site of the mature HA proteins, we isolated secreted HA proteins by size exclusion chromatography and subjected the native HA proteins to LC MS/MS mass spectrometry (Genome Center Proteomics Core, University of California, Davis). Identified peptides were associated only with the N-terminal portion of the HA protein, suggesting that the C-terminal portion is cleaved off in the mature protein and does not play a role in cell-cell aggre-gation.

In-silico analysis of HA proteins identified a two-partner secretion domain located in the N-terminus of the HA proteins. This domain is necessary for secretion of proteins via a two-partner secretion (TPS) pathway (Jacob-Dubuisson et al., 2001). We identified the pore forming outer membrane protein that recognizes the TPS domain of HA proteins and mediates their translocation through the outer membrane (PD1933). Knock-out mutants in the gene PD1933 were generated by site-directed mutagenesis and the mutant strains analyzed for presence of HA proteins using Western blot analysis. No HA proteins could be detect-ed in the outer membrane or in the supernatant of PD1933 mutant strains indicating that the gene product of PD1933 is responsible for HA secretion.

We propose that only the secreted N-terminal portion of the HA proteins plays a role in cell-cell aggrega-tion and biofilm formation and believe that free Xf HA protein in the plant xylem may mediate cell-cell ag-gregation of Xf cells. Therefore we are generating HA-expressing grapevines in a collaborative effort with the Dandekar lab at UC Davis. We hope that the expressed N-terminal portion of HA protein will act as a ‘molecular glue’ and increase the agglutination of Xf cells in the plant xylem, thereby retarding the sys-temic colonization of grapevines and possibly providing a novel resistance to Pierce’s Disease.


87

Acknowledgements This research was supported by the California Department of Food and Agriculture Pierce’s Disease/Glassy Winged Sharpshooter Research Program. We also like to thank Dr. Carl Greve, Dr. Michele Igo, Dr. Ayumi Matsumoto, and Sandra Uratsu.

References Guilhabert, M. R., and Kirkpatrick, B. C. 2005. Identification of Xylella fastidiosa antivirulence genes:

hemagglutinin adhesins contribute to X. fastidiosa biofilm maturation and colonization and attenuate virulence. Mol Plant Microbe Interact 18 (8):856-868.

Hopkins, D. L. 1989. Xylella fastidiosa - Xylem-Limited Bacterial Pathogen of Plants. Annual Review of Phytopathology 27:271-290.

Jacob-Dubuisson, F., Locht, D., and Antoine, R. 2001. Two-partner secretion in Gram-negative bacteria: a thrifty, specific pathway for large virulence proteins. Mol Microbiol 40 306-13.

Killiny, R., and Almeida, R. 2007. Biology of Xylella fastidiosa vector interface. in: Proceedings, Pierce’s Disease Research Symposium, California Department of Food and Agriculture.


88

Hunt For resistance Genes To Combat Pierce’s Disease In Grapevine

Summaira Riaz, Stephanie Pao, Alan Tenscher, and M. Andrew Walker*Department of Viticulture and Enology, University of California, Davis, California 95616 USA

Corresponding Author: M.A. Walker

New grape cultivars that resist Xylella fastidiosa infection and subsequent expression of Pierce’s disease (PD) symptoms can be obtained by conventional breeding through the introgression of resistance from Native American species into elite vinifera wine and table grapes. They can also be obtained by identify-ing and characterizing disease resistance genes from grape so that they could be used for genetic trans-formation and perhaps have a more limited impact on the vinifera parent’s fruit characteristics. Genetic mapping is an essential tool for the identification of genomic regions associated with resistance and al-lows the identification of DNA markers that are tightly linked to resistance.

In previous studies, PD resistance has been mapped as a single major locus from one form of V. arizo-nica, b43-17 (Krivanek et al. 2006, Riaz et al. 2006). The V. arizonica selection b43-17 is homozygous resistant (all F1 progeny were resistant to PD) and two of its resistant progeny F8909-17 and F8909-08 carry sister chromatids of b43-17 and represent two allelic forms of resistance (Riaz et al. 2008: In press). Both allelic forms PdR1a and PdR1b have been mapped within 0.5 cM window of genetic distance in two populations: 9621 (D8909-15 x F8909-17) and 04190 (V. vinifera x F8909-08), respectively (Riaz et al. 2006; Riaz et al. 2008 In press). Selections from these populations have been key parents in a PD resis-tance breeding program and genetic mapping provided tightly linked markers for marker-assisted screen-ing for PD resistant wine, table and raisin grape varieties. Tightly linked markers are extremely valuable to breeders and can greatly accelerate the breeding process for relatively long generation time perennials such as grape, saving time, labor and money by selecting at the seedling stage. The physical location of these loci requires a bacterial artificial chromosome (BAC) library). BAC libraries have been prepared to physically map the Run1 powdery mildew resistance locus in grape (Adam-Blondon et al. 2005). Here we summarize the results of BAC library from b43-17 that can be used to clone PD resistance genes.

Materials and MethodsTwo BAC libraries (each from a different restriction enzyme) from the homozygous resistant b43-17 were developed. Young leaves were used to isolate high molecular weight DNA. Two restriction enzymes, Hind III and Mbo I were used to digest the DNA. The development of two libraries was done to reduce the bias in the distribution of restriction sites in the grapevine genome.

Library screening was carried out twice with two markers (VVCh14-10 and VVCh14-56), which are tightly linked to PdR1a and PdR1b. There were a total of 10 positive BAC clones with marker VVCh14-10 and 14 positive clones were identified with marker VVCh14-56. Four of the positive clones that were selected based on the VVCh14-10 screening were also positive for the VVCh14-56 marker. These four clones are H23-P13, H34-B5 and H64-M16 and H45-J22. VVCh14-10 and VVCh14-56 flank the PdR1 locus and the identified clones should contain the complete PdR1 region. The positive BAC clones were amplified with marker VVCh14-56 that is polymorphic for b43-17 with two alleles and could be used to distinguish and group clones into two categories: group ‘a’ for clones carrying PdR1a, and group b for clones carrying PdR1b (Fig. 1).

BAC end sequencing was carried out for 12 clones, and clones were aligned based on the BAC end se-quences to the Pinot noir genome sequence from chromosome 14. The scaffold 21 carries both flanking markers and the region between the two markers is 109Kb. Primers were also developed from the BAC end sequences to verify the alignment of BAC clones. For further confirmation, we also amplified the positive BAC clones with both flanking markers and sequenced them to compare results. In all cases the


89

sequences with the VVCH14-10 marker matched among all positive clones as was the case for marker VVCH14-56 and H34-B5-RP2. Next, we chose clone H23P13 for shotgun sequencing to obtain a se-quence of the entire clone. A total of 5X sequencing is complete. Sequence assembly will be carried with DNA Star software and primer walking will be used to fill gaps.

Results and DiscussionResults from this project have allowed us to: 1) understand the segregation of PD resistance in two dif-ferent backgrounds; 2) develop a framework genetic map for Xf resistance; 3) select markers for effective MAS for grape breeding; 4) and finally begin development of a physical map of genomic fragments that carry the PdR1a and PdR1b locus, that would lead towards map-based positional cloning of PD resis-tance genes. The bacterial artificial chromosome (BAC) library for b43-17 was used to identify 24 BAC clones, four of which carry both flanking markers on each side of the PD resistance locus. Sequence analysis of a BAC clone that contains PdR1a is in progress. A 5X sequencing of the clone H23P13 is complete; it is more than 200Kb long. This sequencing data will enable us to identify the PdR1a resistant gene.

AcknowledgementsThe authors gratefully acknowledge research support from the CDFA Pierce’s Disease Board and the Louis P. Martini Endowed Chair funds.

ReferencesAdam-Blondon et al. (2005) Construction and characterization of BAC libraries from major grapevine

cultivars. Theor Appl Genet 110:1363-1371The French-Italian Public Consortium for grapevine Genome Characterization (2007). The grapevine

genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449: 463-467

Riaz et al. (2008) Fine-scale genetic mapping of Pierce’s Disease resistance loci (PdR1a and PdR1b) and identification of a major segregation distortion region along Chromosome 14 in grape. Theor Appl Genet In press

Riaz et al. (2006) Refined mapping of the Pierce’s disease resistance locus, PdR1, and Sex on an extended genetic map of Vitis rupestris x Vitis arizonica. Theor Appl Genet 113:1317-1329

Velasco et al. (2007) A high quality draft consensus sequence of the genome of a heterozygous grapevine variety. PLoS ONE 2(12): e1326.doi:10.1371/journal.pone.0001326

Fig. 1. PCR amplification of 22 BAC clones with the marker VVCh14-56, which distinguishes the F8909-17 and F8909-08 related genomic fragments. Top band represents F8909-17, and the lower band repre-sents F8909-08. BAC clones represented with blue dot are positive with both markers flanking the PdR1 resistance locus. The first 10 clones were positive with VVCh14-10 and last 12 clones were positive with VVCh14-56. Clones represented with blue dots were positive with both markers.

F8909-17

F8909-08

ÊÊÊÊ 6 - mavo nvrc scientific program thursday, july 10, 2008 8:00–9:00 a.m. registration and...

Documents