Full Terms & Conditions of access and use can be found athttp://www.tandfonline.com/action/journalInformation?journalCode=imbc20

Download by: [University of Leicester], [Laurence Hall] Date: 14 December 2015, At: 07:59

Molecular Membrane Biology

ISSN: 0968-7688 (Print) 1464-5203 (Online) Journal homepage: http://www.tandfonline.com/loi/imbc20

Cloning, sequence analysis and expression patternof mouse desmocollin 2 (DSC2), a cadherin-likeadhesion molecule

Jo E. Lorimer, L. S. Hall, J. P. Clarke, J. E. Collins, T. P. Fleming & D. R. Garrod

To cite this article: Jo E. Lorimer, L. S. Hall, J. P. Clarke, J. E. Collins, T. P. Fleming & D. R. Garrod(1994) Cloning, sequence analysis and expression pattern of mouse desmocollin 2 (DSC2), acadherin-like adhesion molecule, Molecular Membrane Biology, 11:4, 229-236

To link to this article: http://dx.doi.org/10.3109/09687689409160432

Published online: 09 Jul 2009.

Submit your article to this journal

Article views: 17

View related articles

Citing articles: 1 View citing articles

Molecular Membrane Biology, 1994, 11, 229-236

Cloning, sequence analysis and expression pattern of mouse desmocollin 2 (DSC2), a cadherin-like adhesion molecule

Jo E. Lorimer?., L. S. Hallt, J. P. Clarket, J. E. Collins$, T. P. Fleming# and D. R. Garrod?’

tCancer Research Campaign Epithelial Morphogenesis Research Group, School of Biological Sciences, University of Manchester, Stopford Building, Oxford Road, Manchester, M13 9PT, UK *Department of Biology, University of Southampton, Bassett Crescent East, Southampton, SO9 3TU, UK

Summary Desmocollins are cadherin-like adhesion molecules of desmosomes. We have determined the full cDNA sequence of a murlne desmocollin, the homologue of human and bovine type 2 desmocollins (DSQ), and studied its tissue distribution and expression in stratified epithelia.

An 8.5 day mouse embryo cDNA library was screened ylelding overlapping clones which encoded the mouse DSC2. This gene has an open reading frame of 2710 base pairs (bp) encoding a polypeptide of 902 amino acids (aa). The polypeptide comprises a signal peptide, a precursor peptide, and a mature protein of 766 aa having an extracellular domain of 549 aa, a single transmembrane domain and a cytoplasmic domain of 184 aa.

Like other desmocollins, murine DSC2 has two products, Dsc2a and DscZb, produced by alternative splicing of a 46 bp exon which encodes 11 COOH-terminal aa followed by an in-frame stop codon. Inclusion of this exon forms Dsc2b which is 54 aa shorter than Dscla.

Mouse Dsc2a shows 75.7% amino acid identity to human and 63.39’0 identity to bovine Dsc2a. The mouse desmocollin is also homologous to the cadherins; 32.2% to the most closely related typical cadherin, human N-cadherin. DSC2 is ubiquitously expressed in epithelial tissues and the heart of adult mice and from the blastocyst stage of development. In situ hybridization shows that the gene is most strongly expressed suprabasally in stratified epithelia, similar to the expression of bovine DSC2.

Keywords: Desrnocollins, desrnosornes, cadherins, cell adhesion, intercellular junctions, mouse epithelia.

Introduction

Oesmocollins are cadherin-like transmembrane glycoprotein constituents of desmosomes, which are punctate intercellular adhesion junctions that associate with the intermediate filaments of cells and confer structural continuity between them. Desmosomes are found in epithelia, cardiac muscle, meninges and follicular dendritic cells (for reviews see Schwartz er a/. 1990, Buxton and Magee 1992, Garrod and Collins 1992, Legan er a/. 1992, Magee and Buxton 1992, Garrod 1993).

The role of the desmocollins in cell-cell adhesion has been demonstrated by the inhibition of desmosome assembly in Madin-Darby canine kidney (MDCK) cells by Fab’ fragments of polyclonal anti-desmocollin antibodies (Cowin et a/. 1984). Several desmocollin genes have recently been cloned, two from human and three from bovine sources (Collins etal. 1991, Koch et a/. 1991, Mechanic et a/. 1991, Parker et a/.

§To whom correspondence should be addressed.

1991, King et a/. 1993, Theis er a/. 1993, Legan et a/. 1994, Yue etal. unpublished data). All of these encode proteins with cadherin-like extracellular domains in which cysteine residues, putative N-glycosylation and calcium binding sites present in the cadherins are conserved.

The cytoplasmic domains of desmocollins differ from those of the classical cadherins. Alternative splicing in this region generates two desmocollins with cytoplasmic domains of different sizes, called the ‘a’ and ‘b’ forms (Collins et a/. 1991, Parker era/. 1991, Buxton er a/. 1993). The ‘a’ form is approximately 54 aa longer than the ‘b’ form which is shortened by the inclusion of a 46 or 43 bp exon, encoding 11 unique COOH-terminal aa followed by an in-frame stop codon. Regions of the ‘a’ form-specific C-terminus are homologous to cytoplasmic regions of the classical cadherins and the other major desmosomal cadherin-like glycoproteins, the desmogleins (Collins era/. 1991, Parker er a/. 1991).

Alternative splicing of the desmocollin cytoplasmic domain, so far unique among the cadherins, is presumably important to the structure of the desmosomal plaque. Troyanovsky et a/. (1993) demonstrated that a chimeric molecule with a connexin extracellular domain and a desmocollin ‘a’ form cytoplasmic domain, when expressed in A431 cells, supported plaque assembly and the attachment of intermediate filaments. However, a similar chimera made using the ‘b’ form did not.

Three distinct desmocollin isoforms have been described from bovine tissue (Collins era/. 1991, Hoch et a/. 1991, Legan era/. 1994). These isoforms show different tissue- specific distribution and distinct expression patterns within stratified epithelia (Arnemann era/. 1993, Theis er a/. 1993, Legan era/. 1994), suggesting an important function for desmocollins in epithelial differentiation. DSC7, encoding the protein Dscl, is strongly expressed in epidermis and tongue and at very low levels in other epithelia; DSC2 is widely expressed in all epithelia and cardiac muscle; DSC3 is restricted to stratified epithelia. The three isoforms are expressed in spatially distinct patterns (Arnemann et a/. 1993, Theis et a/. 1993, Legan er a/. 1994). For example, in bovine epidermis DSQ is most strongly expressed basally, DSCl and DSC2 suprabasally (Arnemann er a/. 1993, Theis et a/. 1993, Legan er a/. 1994). Because three desmocollin isoforms have been identified only from bovine tissues, the bovine isoforms are taken as the standard for desmocollin nomenclature (Buxton era/. 1993).

Studies on mouse embryos have shown that mouse desmocollins are first detectable on the lateral membrane contact sites between trophectoderm cells in early cavitating blastocysts, coincident with the onset of desmosome assembly (Fleming et a/. 1991). Metabolic labelling and immunoprecipitation suggests that this initial desrnosome assembly is regulated by the synthesis of desmosomal glycoproteins (Fleming er a/. 1991).

We have isolated cDNAs encoding the complete sequence of a murine desmocollin from a mouse embryo library. Sequence comparisons and in siru hybridization show that

0968-7688/94 510.00 Q 1994 Taylor 8 Francis

Dow

nloa

ded

by [

Uni

vers

ity o

f L

eice

ster

], [

Lau

renc

e H

all]

at 0

7:59

14

Dec

embe

r 20

15

230 J. E. Lorimer et at.

this gene is the homologue of human and bovine DSC2. Reverse transcriptase-mediated polymerase chain reaction (RT-PCR) analysis shows that this gene is widely expressed in all adult epithelia and in the early mouse embryo.

Results

Screening the library

The 8.5 day mouse embryo library (Fahrner el a/. 1987) was screened with a mouse desmocollin cDNA (Buxton et a/. 1994; Probe 1, Figure 1) yielding four overlapping clones (cDNAs 2,5 , 14 and 23; Figure 1). These clones encode an open reading frame from the extracellular domain to an in- frame stop codon (2762 bp; Figure 2) and some 3’ untranslated sequence. cDNA 14 encodes the ‘a’ form of the desmocollin, with no 46 bp exon, while cDNA 5 encodes the shorter ‘b’ form with the exon included. A third screening was performed using a 235 bp EcoRIIBstXI fragment (Probe 2) made from the 5’ end of cDNA 23. This yielded two more clones (cDNAs 33 and 35) which encode the 5 ’ end of the extracellular region, the precursor peptide and most, but not all, of the signal peptide. All of the cDNA clones were subcloned into Bluescript and sequenced in both directions. The transcription start site and immediate 5 ‘ end of the gene was obtained by 5 ’ RACE (Rapid Amplification of cDNA Ends) which yielded an amplified product that completed the coding sequence of the gene. Buxton el a/. (1994) have mapped this gene to mouse chromosome 18. These authors have named this gene DSC3, but by comparison of the complete sequence with other desmocollins it is more closely homologous with DSC2 (see below).

Sequence analysis

The mouse desmocollin has a single open reading frame of 2710 bp from bases 51-2758 (Figure 2). This encodes a peptide of 902 aa (MW = 101 681). There is also 50 bp of 5’ non-coding region from the 5’ RACE clone and 181 bp of 3’ non-coding sequence from cDNA clones 5 and 14. The ATG at position 51 is thought to be the initiation codon by sequence homology to other desmocollins (bovine DSC7, Collins et a/. 1991; bovine DSC2, Koch et a/. 1992; human DSC2, Parker et a/. 1991). The first 27 aa of the open reading frame are

Pm3( ? P l o w

* SPllCS I l l C -

N Extracellular Domain TM

5 RACE product - cCNA 35 C

cDNA 33

Cyloplarmic Domain

cONA 23 - cDYA 2

c0NA 14

c D N A 5 V --___ i O 0 b ~ - Figure 1. Mouse desmocollin cDNA clones obtained by screening the 8.5 day mouse embryo library in lambda gt10. Probe 1, a 889 bp EcoRl fragment, was obtained by screening the library with the human desmocollin clone L5 (Parker et a/. 1991). This probe was used to screen the library identifying clones 2 ,5 , 14 and 23. Clones 33 and 35 were obtained by rescreening the library with a 235 bp EcoRllSstXl fragment (Probe 2) from the 5 ’ end of cDNA 23.

predominantly hydrophobic and probably represent a signal peptide (Figure 2, dash underlined).

The mature protein is presumed to start at aa 135 as this is followed by the highly conserved sequence RWAPIP (Figures 2 and 3) which are found to represent the N-terminus of the bovine 0x7 by protein sequencing (Holton etal. 1990, Collins eta/. 1991). This indicates that the signal peptide is followed by a precursor peptide of 108 aa. The mature protein is 766 aa long with a deduced MW = 85 327. It has an extra- cellular domain of 549 aa and a hydrophobic sequence of 25 aa which is presumed to constitute a transmembrane domain (Figure 2, underlined). Sequence of clones encoding the cytoplasmic domain shows that, in common with other desmocollins, the gene has two alternatively spliced products, Dsc2a and Dsc2b. The ‘b’ form is produced when a 46 bp exon encoding 11 COOH-terminal aa, followed by an in-frame stop codon, is spliced in at aa 837. Dsc2b has a cytoplasmic domain of 130 aa, 54 aa shorter than in the Dsc2a form which does not contain the 46 bp exon.

Sequence homology with other desmocollins

Figure 3 shows a multiple alignment between the six known desmocollins. The extracellular domains are cadherin-like and are highly conserved. If divided into five equal parts the amino acid conservation declines from 6111 12 at the N-terminus. to 5311 12,50/112,34/112 and 2311 12 at the Gterminus. Near the N-terminus of the mouse desmocollin the amino acid sequence HAV, which is believed to be important in adhesion in the cadherins (Blaschuk etal. 1990, Nose eta/ . 1990). is replaced by FAT in the mouse desmocollin. The A is conserved; the others are conservative substitutions. Six putative calcium binding sites found in the cadherins (Ringwald eta/ . 1987) are conserved between the extra- cellular domains of all of the desmocollins. Two of the four putative N-linked glycosylation sites are conserved in all of the desmocollins and in the cadherins; two others are conserved in all of the type 2 and type 3 desmocollins, but are different or absent in the type 1 desmocollins and the cadherins. In the extracellular domain there are seven conserved cysteine residues. Four of these in the membrane proximal region are also conserved in the cadherins and have been previously described (Parker et a/. 1991, Koch et a/ . 1992).

The transmembrane seqeuence (Figure 3, underlined) is well conserved and, like other desmocollins, is immediately followed by a short region rich in positively charged residues. The cytoplasmic domain of mouse Dsc2, like the other desmocollins, differs considerably from that of the cadherins as it is alternatively spliced. Conservation of the 46 bp exon is high amongst the desmocollins, except in bovine DSC3 where it is 43 bp (Legan eta/ . 1994). In the region of the cytoplasmic domain common to both ‘a’ and ‘b’ forms there is a poorly conserved repeat of 14 aa (see Legan et a/. 1994). The mouse desmocollin, like bovine types 1 and 3 and human types 1 and 2, contains two of these repeats and is shorter than bovine type 2 which contains three (Collins et a/ . 1991, Parker et a/. 1991, Koch et a/. 1992, Theis et a/. 1993, Legan eta/. 1994).

Dow

nloa

ded

by [

Uni

vers

ity o

f L

eice

ster

], [

Lau

renc

e H

all]

at 0

7:59

14

Dec

embe

r 20

15

23 1

; \ b ! 5 0 5

2 8 7 9 A r r r r C U ; T C n ; C A G M E r C A ~ ~ C A ~ A U ~ ~ ~ M ~ A C r A ~ ~ C c n r w 3

cDNA14

Figure 2. cDNA and derived amino acid sequence for murine Dsc2a and Dsc2b. The 5 ' and 3 ' ends of cDNA clones 5, 14, 23 and 35, and the 5 ' RACE clone are marked beneath the sequence. Sequence across the internal EcoRl site in clone 35 was confirmed by sequencing across the restriction site in the lambda vector (as it was subcloned into Bluescript as two fragments). The putative signal peptide is underlined with dashes and the transmembrane domain is underlined with a solid line. The FAT cadherin adhesion site is boxed and the seven conserved cysteine residues underlined. The 46 bp exon sequence, found only in the 'b' form in cDNA 5 is boxed. The N-terminus of the mature protein is designated by a large solid arrow and potential N-glycosylation sites are marked by smaller arrows. The sequence corresponding to PCR primers CytoNCytoAAS. GSPl and GSP2 are indicated. This sequence is available from EMBUGenBanWDDBJ under accession number L33779.

Dow

nloa

ded

by [

Uni

vers

ity o

f L

eice

ster

], [

Lau

renc

e H

all]

at 0

7:59

14

Dec

embe

r 20

15

232

Dow

nloa

ded

by [

Uni

vers

ity o

f L

eice

ster

], [

Lau

renc

e H

all]

at 0

7:59

14

Dec

embe

r 20

15

Cloning and expression of murine desmocollin 233

Al l desmocollins show several highly conserved cytoplasmic regions. Close to the transmembrane domain the sequence P(D/E)D XAQQNLl(V/l)S(N/I)TEAGPG is present in all. In the ‘alb’ common region the short sequences EMVKGG and QPRLG are conserved and in the ‘a’ form specific C-terminal region the sequence YEGXGSXAGSVGCCS is conserved. Amino acids immedi- ately 3‘ of this motif also appear to be conserved; unfortu- nately sequence is not yet available for bovine Dsc3. Several putative serinelthreonine phosphorylation sites are conserved in the cytoplasmic region of the desmocollins, three in the region of the cytoplasmic domain common to both ‘a’ and ‘b’ forms, two in the 8-1 1 aa encoded by the ‘b’ form specific exon, and three in the ‘a’ form specific cytoplasmic tail.

Table 1 summarizes the percentage amino acid identity of the mouse desmocollin to other desmocollins, desmogleins (Dsgs) and cadherins. Homology to the other desmocollins is high but homology to the desmogleins is lower than the classical cadherins, illustrating that they are two distinct families of desmosomal glycoprotein.

Tissue expression of the desmocollins Primers which generated a 216 bp fragment from the ‘a’ form specific cytoplasmic tail (Figure 2) were used to investigate the expression of DSC2 in adult mouse tissues by RT-PCR. Extensive precautions were taken to avoid cross contamin- ation during RNA preparation, reverse transcriptase and PCR reactions. The desmocollin was found to be expressed in all epithelia tested and in the heart (Figure 4). The gel was Southern blotted and probed with cDNA 5 (Figure 1) labelled by chemiluminescence, to test that the 216 bp band was amplified DSC2 (data not shown). Such expression patterns are similar to those of bovine DSC2 (Legan et a/. unpublished data). Mouse DSC2 was cloned from an 8.5 day mouse embryo cDNA library and other studies have shown that the gene is expressed from the late 16-cell stage of the pre- implantation embryo (Collins et a/. unpublished data). These results indicate that DSC2 is expressed both in the early embryo and adult and, presumably, throughout embryonic development.

Gene expression and desmosome distribution in stratified epifhelia The expression pattern of the mouse DSC2 in stratified epithelia (tongue, lip and oesophagus) was examined by

Table 1. Percentage amino acid identities of the mouse ‘a’ form desmocollin mature protein compared to other desmosomal glycoproteins and cadherins.

Adhesion Homology of Source molecule mature orotein Human Dsc2 Bovine Dsc2 Bovine Dsc3 Bovine Dscl Human Dscl Human N cadherin Human Dsg3 Bovine Dsgl Human Dsal

75.7 68.3 67.5 54.0 52.0 32.21 28.4 21.4 21.9

Parker etal. (1991) Koch et a/. (1992) Yue eta/ . (unpublished data) Collins ef a\. (1991) Theis etal. (1991) Reid and Hemperly (1991) Amagai eta/ . (1991) Guidice eta/ . (1984) Wheeler e ta / . (1991)

sk t bl st i ti k lu h b cl c2 Figure 4. RT-PCR of desmocollin expression in different mouse tissues. PCR was carried out using a sense primer (CytoA) and an anti-sense primer (CytoAAS), made to sequence in the ‘a’ form specific tail which generated a 216 bp fragment. From left to right PCR was carried out on cDNA synthesis reactions from mouse skin (sk), tongue (t), bladder (bl), stomach (st) intestine (i), liver (li), kidney (k), lung (lu) heart (h), blood (b), control RT reaction with no template (cl) and control PCR with no template (c2). The marker lane is a 1 kb ladder (Gibco-BRL). The blood cDNA, a negative control, gave a positive response when PCR primers for actin were used (data not shown).

in situ hybridization. In all three tissues the gene was expressed suprabasally, but not in the basal layers (Figure 58). Expression was strongest immediately above the basal layer, becoming weaker and ceasing in the upper layers of the tissue. Such expression patterns are consistent with those of bovine DSC2 (Legan et a/. 1994).

lmrnunofluorescent staining of mouse tongue, using a rabbit polyclonal antibody (‘thumper’) raised against bovine epidermal desmocollins, reveals that expression between the cells of the stratified epithelium (Figure 5A) is much more extensive than the distribution of expression of DSC2 mRNA. This suggests that other mouse desmocollin isoforms not yet isolated are present in the cells of the basal layer and possibly the upper suprabasal layers where DSC2 is not expressed.

Discussion

This paper describes the first known mouse desmocollin. The protein shows the characteristic features of other desmo- collins. The bovine desmocollins are taken as standards for desmocollin nomenclature (Buxton er al. 1993, Legan et a/. 1994). Sequence comparison between the new murine desmocollin and the bovine molecules indicates closest homology to bovine Dsc2 (Koch etal. 1992). The new sequence is therefore designated murine DSC2. This gene was previously designated DSC3 by Buxton et al. (1 994) on the basis of a partial sequence, but because of the additional data presented in this paper we have redesignated it. By the same criterion the human sequence DG 11/111 (Parker et al. 1991) should be redesignated as human DSC2. Mouse Dsc2 shows greater homology with human Dsc2 than any other desmocollin (Table 1). In support of this designation in situ hybridizations show a restricted, immediately suprabasal distribution, very similar to that shown by bovine DSCZ in tongue, oesophagus and rumenal epithelia (Legan et a/.

Dow

nloa

ded

by [

Uni

vers

ity o

f L

eice

ster

], [

Lau

renc

e H

all]

at 0

7:59

14

Dec

embe

r 20

15

234 J. E. Lorimer et al.

6 . '

z ,

z - ,

Figure 5 In situ hybridization on transverse sections of mouse tongue epithelium A lmmunofluorescent staining of mouse tongue using a rabbit polyclonal antibody raised against bovine epidermal desmocollins B DSC2 erpression in the underside of tongue C /n srtu control using a sense probe Magnifications x261

Comparing the protein sequences of the six desmocollins so far characterized shows that many features are highly conserved. In the extracellular domain the NH,-terminus is particularly so but the highly conserved amino acid motif HAV in the cadherins varies in the desmocollins according to the isoform. Such differences may impart divergent adhesive properties to the diferent isoforms. Calcium (Ca") binding sites in the extracellular domain are highly conserved and are probably important in adhesion as desmosome assembly is Ca2'-dependent in cell culture (Hennings eta/ . 1980, Mattey and Garrod 1986).

Desmocollins have seven highly conserved extracellular cysteine residues. Four of these are in the membrane proximal region which is thought to be important in cadherin adhesion (Ozawa et a/ . 1990), possibly by regulating protein conformation. The three additional conserved cysteines in the desmocollins may alter protein conformation from that of the cadherins or may increase structural rigidity.

In the cytoplasmic domain alternative splicing generates two forms. The 'a' form specific COOH-terminal region is highly conserved and contains the sequence AGSVGCCS, also found in the cadherins and desmogleins (Koch eta/ . 1990, Nose et a/. 1990, Arnemann et a/ . 1991, Wheeler et a/ . 1991). This may be important in a common function. For example, it may be involved in binding to the plaque protein plakoglobin (Knudson and Wheelock 1992, Peifer er a/. 1992) or i3-catenin.

The functions of the 'a' and 'b' forms of desmocollins may

(Arnemann ef a/. 1993, Theis et a/ . 1993, Legan et a/ . 1994, Yue eta/ . unpublished data). We have evidence for the existence of two other mouse desmocollin isoforms and preliminary data for their differential expression (unpublished) indicating an analogous situation to that found in bovine and human.

Mouse DSCZ described here is expressed in the mid 16cell stage embryo, the blastocyst (Collins et a/. unpublished data), the 8-5 day embryo and in the adult where its expression is ubiquitous in epithelia and heart. This implies that this Dsc isoform is functional in both the early embryo and adult tissues.

Experimental procedures

Library screening and sequencing

Desmocollin clones were isolated by screening an 8 .5 day mouse embryo cDNAs lbrary in lambda gtlO (Fahrner ef a/. 1987) with an 889 bp mouse cDNA clone (Probe 1, Figure 1: Buxton et a / . 1994). The clone was 32P-labelled using the Amersham multiprime labelling kit (Amersham International, Amersham, UK); unincorporated material was removed using Nensorb columns (Dupont Ltd). Hybridization was performed at 65OC using Gene Screen Plus filters (Dupont Ltd) in 1 M NaCI, 1% sodium dodecyl sulphate (SDS), 10V0 PEG (polyethylene glycol) and 0.1 mg/ml denatured salmon sperm DNA. Filters were then washed in lxsalt and sodium citrate (SSC), 1% SDS for 2 h. Positive clones were plaque purified by several rounds of rescreening. Inserts were cut out with EcoRI, subcloned into Bluescript and sequenced in both directions using the dideoxynucleotide chain termination method (Sanqer et a/. 1977) and

also be linked to their different putative phosphovlation sites ,,,,hich may be functionally important in desmosome regulation (Parrish era/. 1990). Identification of putative phosphorylation to obtain 5, (Figure 1, Probe *), sites according to the criteria reviewed by Kennelly and Krebs

the Sequenase 2.1 kit (United States BiochemicajCorp., Cambridge Bioscience). A third round of screening was carried out using a 235 bp EcoRIIEstXI fragment, made from the 5 ' end of cDNA 23, as a probe

(1991) suggests that desmocollins coniain more such sites isolation of the 5 r end of the gene than previously reported.

5 ' RACE (Rapid Amplification of cDNA Ends) kit (Gibco-BRL, Paisley, In both bovine and human stratified epithelia, desmocollin Scotland) was used to isolate the 5, end of the gene according to

isoforms have different but Overlapping expression the manufacturer's instructions. Two anti-sense gene specific primers

Dow

nloa

ded

by [

Uni

vers

ity o

f L

eice

ster

], [

Lau

renc

e H

all]

at 0

7:59

14

Dec

embe

r 20

15

Cloning and expression of murine desrnocollin 235

indicated in Figure 2. GSPl , CTTCTTGGCTGTCTGCTAAAAAGCC; GSP2, CGCCTTAAGCATCTTCTAAGACTTGGAA (EcoRl underlined).

Isolation of total RNA Murine tissues were dissected and frozen immediately in liquid nitrogen. Frozen tissue (29) was pulverized in a mortar and pestle cooled with liquid nitrogen. The ground tissue was used to isolate total RNA by the method of Chomczynski and Sacchi (1987).

PCR reactions

PCR primers (internal restriction sites underlined were employed as follows: CytoA, CGGGGATCCAAGGTACAGTTTTGCC, (BarnHI) 1 00 pmol/reaction; CytoASAS, CGGGAATTCTCACCTCTITGCACA, (EcoRl) 100 pmollreaction. cDNA was generated from total RNA using a random primed first strand cDNA synthesis kit (Amersham International). A 1 pI aliquot of the first strand cDNA reaction was added directly to the PCR mix containing 0.2 mM each of dNTP, 2.5 U Taq DNA polymerase (Promega), sense and anti-sense primers in 100 pI of lxTaw DNA polymerase buffer (50 mM KCI, 1.5 mM MgCI,, 100 mM Tris-HCI, pH 9.0, 1 % Triton X-100). Reactions were overlaid with mineral oil (Sigma). A Hybaid Omnigene Thermal Cycler was used with the following cycling times and temperatures; CytoA and CytoAAS, 94OC 2 min, followed by 35 cycles of 55OC 1 min, 72OC 1 min, 94OC 45 sec, followed by 55OC 1 min, 72OC 5 min. Reaction products were visualized by 2.5% agarose gel electrophoresis and ethidium bromide staining.

Probe purification and labelling Restriction endonuclease fragments from the cDNA inserts of positive clones were separated by agarose gel electrophoresis and extracted from the gel using a Geneclean kit (Stratech Scientific Ltd, Luton, UK.). Purified fragments were random primer labelled with 32P-dCTP (Amersham Multiprime kit) and unincorporated label removed using Nensorb Columns (Dupont Ltd).

For in situ hybridization, cDNA 2 (Figure 1) was subcloned into Bluescript and 35S-labelled sense and antisense RNA transcribed in vitro with T7 and T3 RNA polymerases using a commercial kit (Stratagene). Transcripts were prepared for use as in situ hybridization probes according to the method of Wilkinson and Green (1990).

In situ hybridization Freshly collected mouse tissue samples were fixed in 4% para- formaldehyde in phosphate-buffered saline (PBS) overnight at 4OC, then dehydrated and embedded in paraffin wax according to Sassoon eta/. (1988). Serial sections (6 pm) were spread on 3-amino- propyltriethoxysilane-treated slides and dried overnight at 37OC.

In situ hybridization was carried out according to Wilkinson and Green (1990). After hybridization and washing, slides were coated with K5 (Ilford Ltd, Cheshire) emulsion and exposed at 4OC for various times. Slides were developed for 2 min in Phenisol developer (Ilford), fixed, and washed in water. They were stained lightly with Myers haematoxylin, dehydrated and coverslips applied.

Tissue source

Tissue samples were isolated from the middle section of murine tongue from freshly killed animals.

lmmunofluorescent staining

Murine tongue was embedded in OCT compound (Miles, IN, USA), frozen and cut into 7 prn sections using a cryostat. Sections were air-dried and stained using the indirect immunofluorescence technique (Sun and Green 1978). Sections were blocked with a 1% BSAlPBS for 10 min and then washed in PBS. Sections were treated with the primary antibody ('thumper', a polyclonal rabbit antibody raised against bovine desmocollins) at a 11100 dilution for 30 min.

Slides were washed in PBS and then treated with the secondary antibody (goat anti-rabbit IgG FlTC conjugated at a 1/25 dilution) for 30 min. Slides were washed in PBS, briefly dried, and mounted using Vectashield medium.

Acknowledgements We would like to thank Roger Buxton and Sarah Pidsley for the gift of the initial mouse cDNAclone, Paul Sharpe for the use of the mouse embryo cDNA library and Kevin Yue for the bovine Dsc3 amino acid sequence. I would also like to thank Kevin Legan and Jamie Davies for their help and advice. The work has been supported by grants from the Wellcome Trust and Cancer Research Campaign.

References Arnagai, M., Klaus-Kovtun, V. and Stanley, J. R. (1991)

Autoantibodies against a novel epithelial cadherin in pemphigus vulgaris, a disease of cell adhesion. Cell, 67, 869-877.

Arnemann, J., Spurr, N. K., Wheeler, G. N., Parker, A. E. and Buxton, R. S. (1991) Chromosomal assignment of the human genes coding for major proteins of the desmosome junction, desmoglein DG1 (DSG), desmocollins DGllllll (DSC), desmoplakins DPIlII (DSP), and plakoglobin DGPPP (JUP). Genomics, 10, 640-645.

Arnemann, J., Spurr, N. K. and Buxton, R. S. (1992a) The human gene (DSGS) coding for the pemphigus vulgaris antigen is, like the genes coding for the two other known desmogleins, assigned to chromosome 18. Human Genetics, 89, 347-350.

Arnemann, J., Spurr, N. K., Magee, A. 1. and Buxton, R. S. (1992b) The human gene (DSG2) coding for HDGC, a second member of the desmoglein subfamily of the desmosomal cadherins, is, like DSG1, coding for desmoglein DG1, assigned to chromosome 18. Genomics, 13, 484-486.

Atnemann, J., Sullivan, K. H., Magee, A. I., King, I . A. and Buxton, R. S. (1993) Stratification related expression of isoforms of the desmosomal cadherins in human epidermis. Journal of Cell Science, 104, 741-750.

Blaschuk, 0. W., Sullivan, R., David, S. and Pouliot, Y. (1990) Identification of a cadherin cell adhesion recognition sequence. Developmental Biology, 139, 227-229.

Buxton, R. S. and Magee, A. I. (1992) Structure and interactions of desmosomal and other cadherins. Seminars in Cell Biology, 3, , 157-167.

Buxton, R. S., Cowin, P., Franke, W. W., Garrod, D. R., Green, K. J., King, A. I., Koch, P. J., Magee, A. I., Rees, D., Stanley, J. R. and Steinberg, M. S. (1993) Nomenclature of the desmosomal cadherins. Journal of Cell Biology, 121, 481-483.

Buxton, R. S., Wheeler, G. N., Pidsley, S. C., Marsden, M. D., Adams, M. J., Jenkins, N. A,, Gilbert, D. J. and Copeland, N. G. (1994) Mouse desmocollin (Dsc3) and desmoglein (Osgl) genes are closely linked in the proximal region of chromosome 18. Genomics,

Chomczynski, P. and Sacchi, N. (1987) Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical'Biochemistry, 162, 156-1 59.

Collins, J. E., Legan, P. K., Kenny, T. P., MacGarvie, J., Holton, J. L. and Garrod, D. R. (1991) Cloning and sequence analysis of desrnosomal glycoproteins 2 and 3 (desmocollins): cadherin-like desmosomal adhesion molecules with heterogenous cytoplasmic domains. Journal of Cell Biology, 113, 381 -391.

Cowin, P., Mattey, D. L. and Garrod, D. R. (1984) Identification of desmosornal surface components (desmocollins) and inhibition of desmosome formation by specific FAB '. Journal of Cell Science,

Fahrner, K., Hogan, B. L. M. and Flavell, R. A. (1987) Transcription of H-2 and Qa genes in embryonic and adult mice. EMBO Journal,

Fleming, T. P., Garrod, D. R. and Elsmore, A. J. (1991) Desmosome biogenesis in the mouse preimplantation embryo. Development,

Garrod, D. R. (1993) Desmosomes and hemidesmosomes. Current Opinions in Cell Biology, 5, 30-40.

Garrod, D. R. and Collins, J. E. (1992) Intercellular junctions and

21, 51 0-51 6.

70, 41-60.

6 , 1265-1271.

112, 527-539.

Dow

nloa

ded

by [

Uni

vers

ity o

f L

eice

ster

], [

Lau

renc

e H

all]

at 0

7:59

14

Dec

embe

r 20

15

236 J. E. Lorimer el al.

cell adhesion in epithelial cells. In Epithelial Organisation and Development, T. P. Fleming, Ed. (Chapman and Hall, London),

Giudice, G. J., Cohen, S. M., Patel, N. H. and Steinberg, M. S. (1984) Immunological comparison of desmosomal components from several bovine tissues. Journal of Cell Biochemistry, 26, 35-45.

Hennings, H., Michael, D., Cheng, C., Steinert, P., Holbrook, K. and Yuspa, S. H. (1980) Calcium regulation of growth and differentiation of mouse epidermal cells in culture. Cell, 19, 245-254.

Holton, J. L., Kenny, T. P.. Legan, P. K.. Collins, J. E.. Keen, J. N., Sharma, R. and Garrod, D. R. (1990) Desmosomal glycoproteins 2 and 3 (desmocollins) show N-terminal similarity to calcium- dependent cell-cell adhesion molecules. Journal of Cell Science, 97, 239-249.

Kemler, R. (1992) Classical cadherins. Seminars in Cell Biology, 3, 149- 155.

Kennelly. P. J. and Krebs, E. G. (1991) Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases. Journal of Biological Chemistry, 266,

King, I. A,, Arnemann, J., Spurr, N. K. and Buxton, R. S. (1993) Cloning of cDNA (DSC1) coding for human type 1 desmocollin and its assignment to chromosome 18. Genomics, 18, 185-195.

Knudson. K. A. and Wheelock, M. J. (1992) Plakoglobin, or an 83-kD homologue distinct from 8-catenin, interacts with E-cadherin and N-cadherin. Journal of Cell Biology. 118, 671-679.

Koch. P. J., Walsh, M. J., Schmelz. M., Goldschmidt, M. D., Zimblemann, R. and Franke, W. W. (1990) Identification of desmoglein. a constitutive desmosomal glycoprotein, as a member of the cadherin family of cell adhesion molecules. European Journal of Cell Biology, 53, 1-12.

Koch, P. J.. Goldschmidt, M. D.. Walsh. M. J., Zimblemann. R., Schmelz, M. and Franke, W. W. (1991) Amino acid sequence of bovine muzzle epithelial desmocollin derived from cloned cDNA: a novel subtype of desmosomal cadherins. Differentiation, 47, 29-36.

Koch, P. J.. Goldschmidt, M. D.. Zimblemann, R., Troyanovsky, R. and Franke, W. W. (1992) Complexity and expression patterns of the desmosomal cadherins. Proceedings of the National Academy of Sciences, USA, 89. 353-357.

Legan, P. K., Collins. J. E. and Garrod, D. R. (1992) The molecular biology of desmosomes and hemidesmosomes: “What’s in a name?”. Bioessays, 14, 385-393.

Legan, P. K., Yue, K. K. M., Chidgey, M., Holton, J. L., Wilkinson, R. and Garrod, D. R. (1994) Expression patterns of the desmocollin family of desmosomal adhesion molecules. Journal of Cell Biology,

Magee, A. I . and Buxton, R. S. (1992) Transmembrane molecular assemblies regulated by the greater cadherin family. Current Opinions in Cell Biology. 3, 854-861.

Mattey, D. L. and Garrod, D. R. (1986) Calcium-induced desmosome formation in cultured kidney epithelial cells. Journal of Cell Science,

Mattey, D. L., Suhrbier, A,, Parrish, E. P. and Garrod, D. R. (1987) Recognition, calcium and the control of desmosome formation. In Junctional Complexes of Epithelial Cells. Ciba foundation Symposium, Vol. 125 (Chichester: Wiley I% Sons). pp. 49-65.

Mechanic, S. K., Raynor, J. E., Hill, J. E. and Cowin, P. (1991) Desmocollins form a subset of the cadherin family of cell adhesion molecules. Proceedings of the National Academy of Sciences,

pp. 1-52.

15555-1 5558.

126, 507-518.

85, 95-111.

USA, 88, 476-4480,

Nose, A., Tsuji, K. and Takeichi, M. (1990) Localisation of specificity determining sites in cadherin cell adhesion molecules. Cell, 61,

Ozawa. M., Ringwald, M. and Kemler, R. (1990) Uvomorulin-catenin complex formation is regulated by a specific domain in the cytoplasmic region of the cell adhesion molecule. Proceedings of the National Academy of Sciences, USA, 87, 4246-4250.

Parker, A. E., Wheeler, G. N., Arnemann, J., Pidsley, S. C., Rutman, A. J., Thomas, C. L., Ataliotis, P., Rees, D., Magee. A. I. and Buxton. R. s. (1991) Desmosomal glycoproteins I I and 111: cadherin- like junctional molecules generated by alternative splicing. Journal of Biological Chemistry, 266. 10438-1 0445.

Parrish, E. P., Marston. J. E., Mattey. D. L., Measurets. H. R.. Venning, R. and Garrod, D. R. (1990) Size heterogeneity, phosphorylation and transmembrane organisation of desmosomal glycoproteins 2 and 3 (desmocollins) in MDCK cells. Journal of Cell Science, 96, 239-248.

Peifer, M., McCrea, P., Green, K. J., Wieschaus, E. and Gumbiner, 8. (1992) The vertebrate adhesive junction proteins Oxatenin and plakoglobin and the Drosophila segment polarity armadillo form a multigene family with similar proteins. Journal of Cell Biology.

Reid, R. A. and Hemperly, J. J. (1991) Human Ncadherin: nucleotide and deduced amino acid sequence. Nucleic Acids Research. 18, 19.

Ringwald, M., Schuh, R., Vestweber, D.. Eistetter. H., Lottspeich, F., Engel, J., Dolz, R., Jahnig, F., Epplen, J., Mayer, S., Muller, C. and Kemler, R. (1987) The structure of cell adhesion molecule uvomorulin. Insights into the molecular mechanism of Ca2+-dependant cell adhesion. EMBO Journal, 6, 3647-3653.

Sanger, F., Nicklen. S. and Coulson, A. R. (1977‘) DNA sequencing with chain terminating inhibitors. Proceedings of the National Academy of Sciences, USA, 74, 5463-5467.

Sassoon. D. A., Garner, 1. and Buckingham, M. (1988) Transcripts of u-cardiac and a-skeletal actin are early markers for myogenesis in the mouse embryo. Development. 104, 155-164.

Schwartz, M. A.. Owaribe. K., Kartenbeck, J. and Franke, W. W. (1 990) Desmosomes and hemidesmosomes: constitutive molecular components. Annual Review in Cell Biology, 6, 461-491.

Sun, T. T. and Green, H. (1978) lmmunofluorescent staining of keratin fibres in cultured cells. Cell, 14, 468-476.

Theis, 0. G.. Koch. P. J. and Franke. W. W. (‘993) Differential synthesis of type 1 and type 2 desmocollin mRNAs in human stratified epithelia. lnternational Journal of Developmental Biology, 37,101-110.

Troyanovsky, S. M., Eshkind, L. G., Troyanovsky, R. G., Leube. R. E. and Franke, W. W. (1993) Contributions of cytoplasmic domains of desmosomal cadherin to desmosome assembly and intermediate filament anchorage. Cell, 72, 561 -574.

Wheeler, G. N., Parker, A. E., Thomas, C. L., Ataliotis, P., Poynter, D., Arnemann, J., Rutman, A. J., Pidsley, S. C., Watt, F. M.. Rees, D. A. (1991) Desmosomal glycoprotein I, a component of intercellular desmosome junctions, is related to the cadherin family of cell adhesion molecules. Proceedings of the National Academy of Sciences, USA, 88, 4796-4800.

Wilkinson, D. G. and Green, J. (1990) In situ hybridisation and three dimensional reconstruction of serial sections. In Postimplantation Mammalian Embryos. A Practical Approach, A. J. Copp and D. L. Cockcroft, eds (IRL Press, Oxford), pp. 155-171.

147-1 55.

118, 681-691.

Received 13 June 1994, and in revised form 12 August 1994.

Dow

nloa

ded

by [

Uni

vers

ity o

f L

eice

ster

], [

Lau

renc

e H

all]

at 0

7:59

14

Dec

embe

r 20

15