draft...draft 1 lncrna snhg4 promotes proliferation, migration, invasion and 2...

Draft

LncRNA SNHG4 promotes proliferation, migration, invasion and epithelial-mesenchymal transition of lung cancer cells

by regulating miR-98-5p

Journal: Biochemistry and Cell Biology

Manuscript ID bcb-2019-0065.R2

Manuscript Type: Article

Date Submitted by the Author: 27-May-2019

Complete List of Authors: Tang, Yufu; The General Hospital of Northern Theater Command, Department of SurgeryWu, Lijian; Fourth Affiliated Hospital of China Medical University, Department of Respiratory MedicineZhao, Mingjing; Fourth Affiliated Hospital of China Medical University, Department of Respiratory MedicineZhao, Guangdan; Fourth Affiliated Hospital of China Medical University, Department of Respiratory MedicineMao, Shitao; Fourth Affiliated Hospital of China Medical University, Department of Respiratory MedicineWang, Lingling; Fourth Affiliated Hospital of China Medical University, Department of Respiratory MedicineLiu, Shuo; Fourth Affiliated Hospital of China Medical University, Department of Respiratory MedicineWang, Xiaoge; Fourth Affiliated Hospital of China Medical University, Department of Respiratory Medicine

Keyword: lung cancer, SNHG4, cell proliferation, cell migration/invasion, miR-98-5p

Is the invited manuscript for consideration in a Special

Issue? :Not applicable (regular submission)

https://mc06.manuscriptcentral.com/bcb-pubs

Biochemistry and Cell Biology

Draft

1 LncRNA SNHG4 promotes proliferation, migration, invasion and

2 epithelial-mesenchymal transition of lung cancer cells by regulating

3 miR-98-5p

4

5 Yufu Tang1, #, Lijian Wu2, #, Mingjing Zhao2, Guangdan Zhao2, Shitao Mao2, Lingling

6 Wang2, Shuo Liu2, Xiaoge Wang2, *

7

8 1Department of Surgery, The General Hospital of Northern Theater Command,

9 Shenyang 110016, People’s Republic of China

10 2Department of Respiratory Medicine, The Fourth Affiliated Hospital of China Medical

11 University, Shenyang 110032, People’s Republic of China

12

13 *Corresponding author: Xiaoge Wang, Department of Respiratory Medicine, The

14 Fourth Affiliated Hospital of China Medical University, 4 East Chongshan Road,

15 Shenyang 110032, People’s Republic of China

16 Tel: +86-24-62043227

17 E-mail: [email protected]

18

19 #Yufu Tang and Lijian Wu contributed equally to this study.

20

21

22

Page 1 of 31



Draft

23 Abstract

24 Long noncoding RNA small nucleolar RNA host gene 4 (SNHG4) is usually up-

25 regulated in cancer and regulates the malignant behaviors of cancer cells. However, its

26 role in lung cancer remains elusive. In this study, we silenced the expression of SNHG4

27 in NCI-H1437 and SK-MES-1, two representative non-small-cell lung cancer cell lines,

28 by transfecting them with siRNA (small interfering RNA) that specifically targets

29 SNHG4. We observed a significantly inhibited cell proliferation in vitro and reduced

30 tumor growth in vivo after SNHG4 silencing. SNHG4 knockdown also led to cell cycle

31 arrest at G1 phase, accompanied with down-regulation of cyclin-dependent kinases

32 CDK4 and CDK6. Migration and invasion of these two cell lines were remarkably

33 inhibited after SNHG4 silencing. Moreover, our study revealed that epithelial-

34 mesenchymal transition (EMT) of lung cancer cells was suppressed by SNHG4

35 silencing as evidenced by up-regulated E-cadherin and down-regulated SALL4, Twist

36 and vimentin. In addition, we found that SNHG4 silencing induced elevation in miR-

37 98-5p. MiR-98-5p inhibition abrogated the effect of SNHG4 silencing on proliferation

38 and invasion of lung cancer cells. In conclusion, our findings demonstrate that SNHG4

39 is required by lung cancer cells to maintain malignant phenotype. SNHG4 probably

40 exerts its pro-survival and pro-metastatic effects by sponging anti-tumor miR-98-5p.

41 Key words: lung cancer; SNHG4; cell proliferation; cell migration/invasion; miR-98-

42 5p

43

44 Introduction

Page 2 of 31



Draft

45 Despite the development in imaging, diagnostic techniques and therapies, lung cancer

46 remains the most common cause of cancer mortality for both men and women

47 worldwide (Siegel et al. 2018). Lung cancer accounts for more than 10% cancer deaths,

48 the estimated incidence of lung cancer is anticipated to have an increase over the next

49 decades, especially in developing countries, as a consequence of current high and ever

50 increasing smoking rate (Liam et al. 2015). To date, the major treatment for lung cancer

51 is chemotherapy using drugs like Gefitinib and Erotini which often accompany with

52 limited efficiency and poor prognosis (Reck et al. 2013). Therefore, exploring the

53 mechanisms of proliferation and apoptosis of lung cancer and finding new diagnosis

54 and therapeutic targets are of great significance.

55 Long noncoding RNAs (lncRNAs) are transcripts more than 200 nucleotides that are

56 mostly not translated into proteins (Iyer et al. 2015). LncRNAs are reported to

57 participate in a variety of physiologic functions including gene expression, cell growth

58 and differentiation (Bhan and Mandal 2015). Next-generation sequencing reveals that

59 thousands of lncRNAs are aberrant expressed in cancers and they are implicated in the

60 migration, invasion and proliferation of cancer cells (Balas and Johnson 2018; Bhan et

61 al. 2017). MicroRNAs (miRNAs) are a class of noncoding RNAs containing about 22

62 nucleotides in length. MicroRNAs play crucial roles in numerous physiologic processes

63 and exert their functions mainly by binding to the 3’-untranslated region (3’-UTR) of

64 target mRNAs (Mohr and Mott 2015). Aberrant miRNA expression is also involved in

65 the development and metastasis of lung cancer (Dacic et al. 2010). As the “competitive

66 endogenous RNA (ceRNA)” hypothesis put forward in 2011 by Salmena et al,

Page 3 of 31



Draft

67 messenger RNAs, transcribed pseudogenes, and lncRNAs can communicate with each

68 other through microRNA response elements (MRE), these transcripts can alleviate the

69 repression of target gene by competitive binding to miRNAs (Salmena et al. 2011). On

70 the basis of this hypothesis, many lncRNAs are found to be implicated in the

71 development and progression of cancers by sponging miRNAs. For instance,

72 LncRNA00673 regulates the proliferation, migration and invasion in non-small cell

73 lung cancer (NSCLC) by sponging miR-150 (Lu et al. 2017). LncRNA MIR31HG

74 promotes migration and invasion of lung cancer cells by sponging miR-214 (Dandan et

75 al. 2019).

76 Small nucleolar RNA host genes (SNHGs) are lncRNAs that can encode small

77 nucleolar RNAs, and SNHGs are critical players in various cancers (Williams and

78 Farzaneh 2012). SNHG4 is 1100 bp in length which significantly up-regulated in

79 hepatocellular carcinoma and osteosarcoma tissues compared to adjacent normal

80 tissues (Xu et al. 2018; Zhu et al. 2018). Besides, high SNHG4 expression in

81 osteosarcoma is associated with poor prognosis and SNHG4 promotes tumor growth

82 by regulating miR-224-3p (Xu et al. 2018). Yet the role that SNHG4 plays in the

83 development of lung cancer remains undisclosed. It is reported that overexpression of

84 miR-98-5p suppresses proliferation, migration, and invasion of non-small cell lung

85 cancer cells (Liu et al. 2017). In particular, we found a correlation between miR-98-5p

86 and SNHG4 by bioinformatics prediction. Thus we hypothesize that SNHG4

87 participates in the development of lung cancer by regulating miR-98-5p.

88 In this study, we detected the expression of SNHG4 in lung cancer cell lines and

Page 4 of 31



Draft

89 investigated its effect on cell proliferation, migration and invasion. We also validated

90 the correlation between miR-98-5p and SNHG4. In addition, we explored the effect of

91 SNHG4 on tumor growth by in vivo assay.

92 Materials and methods

93 Cells and reagents

94 NCI-H2170, NCI-H520, SK-MES-1, NCI-H1975 and NCI-H1437 cells were

95 purchased from Sciencell (China). SPC-A-1 cells were purchased from Procell (China).

96 NCI-H2170, NCI-H520 and SK-MES-1 are human squamous carcinoma cell lines,

97 NCI-H1975, NCI-H1437 and SPC-A-1 are human adenocarcinoma cell lines. Primary

98 antibodies used for western blot assay were as follows: SALL4 (1: 1000, Abclonal,

99 China) antibody, Twist (1: 2000), CDK4 (1: 1000), E-cadherin (1: 500), and Vimentin

100 (1: 500) antibodies (CST, USA), CDK6 (1: 1000), MMP2 (1: 500), MMP9 (1: 500) and

101 β-actin (1: 2000) antibodies (Proteintech, China), β-actin was used as internal control.

102 HRP-conjugated goat anti-rabbit IgG and HRP-conjugated goat anti-mouse IgG (1:

103 10000, Proteintech, China) were used as secondary antibodies. Cell culture mediums

104 were purchased from Sigma (USA). SNHG4 short hairpin (shRNA) fragment was

105 inserted into pRNAH1.1 between BamHI/HindIII to knock down SNHG4 expression

106 in mouse model. Sequences of shRNAs and siRNAs used in this study were as follows:

107 SNHG4 siRNA-sense: 5’-GUGACACCAAGAUAAGUAATT-3’; SNHG4 siRNA-

108 antisense: 5’-UUACUUAUCUUGGUGUCACTT-3’; NC siRNA-sense: 5’-

109 UUCUCCGAACGUGUCACGUTT-3’; NC siRNA-antisense: 5’-

110 ACGUGACACGUUCGGAGAATT-3’; SNHG4 shRNA-sense: 5’-

Page 5 of 31



Draft

111 GATCCGGTGACACCAAGATAAGTAATTCAAGAGATTACTTATCTTGGTGT

112 CACTTTTT-3’; SNHG4 shRNA-antisense: 5’-

113 AGCTTAAAAAGTGACACCAAGATAAGTAATCTCTTGAATTACTTATCTTGG

114 TGTCACCG-3’; NC shRNA-sense: 5’-

115 GATCCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGG

116 AGAATTTTT-3’; NC shRNA-antisense: 5’-

117 AGCTAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCG

118 GAGAAGGG-3’.

119 Cell culture and transfection

120 SK-MES-1 cells were cultured in Dulbecco’s modified eagle medium (DMEM) with

121 10% fetal bovine serum (FBS), NCI-H1437 cells were cultured in Roswell Park

122 Memorial Institute (RPMI)-1640 culture medium with 10% FBS. All cells were

123 cultured in a humidified incubator with 5% CO2 at 37°C. Two cell lines were

124 transfected with siRNAs or microRNA mimics with lipofectamine2000 (Invitrogen,

125 USA) following the manufacture’s instruction.

126 Quantitative real-time PCR

127 Total RNAs of cells and tumor tissues were isolated using TRIpure (Bioteke, China)

128 and reversely transcribed into cDNA using the Super M-MLV reverse transcriptase

129 (Bioteke, China). Real-time PCR was carried out using SYBR Green (Sigma, USA)

130 according to the manufacturer’s instruction and data were analyzed using the 2-△△CT

131 method. Homo sapiens 5s ribosomal RNA (rRNA) and β-actin were used as control.

132 Stem-loop RT primers and real-time PCR primers used in this study were as follows:

Page 6 of 31



Draft

133 Has-miR-98-5p specific stem-loop primer, 5’-

134 GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAACAAT

135 -3’; Has-5s rRNA specific stem-loop primer, 5’-

136 GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAAAGCC

137 TAC-3’; SNHG4-F, 5’-GGCTAGAGTACAGTGGCTCG-3’; SNHG4-R, 5’-

138 GCAAATCGCAAGGTCAGG-3’; MiR-98-5p-F, 5’-

139 TGAGGTAGTAAGTTGTATTGTT-3’; miR-98-5p-R, 5’-

140 GTGCAGGGTCCGAGGTATTC-3’; Has-5s rRNA-F, 5’-

141 GATCTCGGAAGCTAAGCAGG-3’; Has-5s rRNA-R, 5’-

142 TGGTGCAGGGTCCGAGGTAT-3’; β-actin-F, 5’-GGCACCCAGCACAATGAA-3’;

143 β-actin-R, 5’- CGGACTCGTCATACTCCTGCT-3’.

144 Western blot

145 Cells or tumor tissues were lysed with RIPA buffer (Beyotime, China) and quantified

146 using commercial BCA kit (Beyotime, China). Then denatured protein was separated

147 by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Protein

148 was transferred to PVDF membranes (Thermo Fisher Scientific, USA) and sealed with

149 5% skim milk. PVDF membranes were then incubated with primary antibodies

150 overnight at 4°C, rinsed by TBST buffer for three times and incubated with secondary

151 antibodies for 40 minutes at 37°C.

152 Trypan blue staining

153 NCI-H1437 and SK-MES-1 cells were transfected with siRNAs. Single cell suspension

154 (106 cells/ml) was stained with 0.4% trypan blue, and viable cells were calculated within

Page 7 of 31



Draft

155 three minutes.

156 MTT assay

157 Cells were seeded into 96-well plate (4×103 cells per well). Cells were then transfected

158 and cultured with 0.5 mg/ml MTT (Beyotime, China) at 37°C for 4 hours. Optical

159 density value at 570 nm of MTT was detected at 0 hour, 12 hours, 24 hours, 48 hours,

160 72 hours and 96 hours after transfection.

161 Cell scratch and transwell assay

162 Cells were cultured to confluence and cultured in serum-free medium with 1μg/ml

163 mitomycin for one hour. Cell scratch was carried out using a 200 μl pipette tip and

164 photographed 24 hours after scratch. Transwell chambers were placed in a 24-well plate

165 and coated with 40 μl diluted Matrigel. Cells were transfected for 24 hours, diluted into

166 cell suspension with serum-free medium and seeded on the upper chamber (1×104 cells

167 per well), 800 μl culture medium containing 10% FBS acted as the chemoattractant in

168 the lower chamber. After 24 hours culture, cells were fixed with 4% paraformaldehyde

169 for 25 minutes and stained with 0.4% crystal violet for 5 minutes, the number of stained

170 cells in five fields of lower chamber were counted under a microscopy (×200

171 magnification) and mean values were obtained.

172 Immunofluorescence assay

173 Cell slides were immobilized with 4% paraformaldehyde for 15 minutes and washed

174 with PBS for three times. Cell slides were then permeated with 0.1% tritonX-100

175 (Beyotime, China) for 30 minutes at room temperature and washed with PBS for three

176 times. Cell slides were blocked with goat serum (Solarbio, China) for 15 minutes.

Page 8 of 31



Draft

177 Afterwards, cell slides were incubated with E-cadherin antibody (1: 50, Proteintech,

178 China) overnight at 4°C and Cy3-labelled goat anti-rabbit secondary antibody (1: 200,

179 Beyotime, China) for one hour at room temperature. Cell slides were then rinsed with

180 PBS, stained with DAPI (Beyotime, China) and sealed with anti-fluorescent quenching

181 reagent (Solarbio, China). Typical images were captured under a microscopy (×400

182 magnification).

183 Dual-luciferase assay

184 293T cells were seeded into 12-well plate and cultured to 70% confluency. The

185 wildtype and mutant type of SNHG4 fragments were inserted into plasmid pmirGLO

186 (Promega, USA) between NheⅠ and SalⅠ. These two plasmids were co-transfected

187 with miR-98-5p mimics and NC mimics into 293T cells respectively. Cells were

188 cultured for 48 hours at 37°C after transfection. Cells were then washed with PBS twice

189 and lysed with 250 μl lysis buffer. The binding activity of miR-98-5p to SNHG4 was

190 assessed by measuring the normalized luciferase activity (firefly luciferase activity /

191 renilla luciferase activity).

192 Cell cycle assay

193 Cells were seeded into a 6-well plate (2×105 cells per well) and cultured to 90%

194 confluence. Cells were then washed with PBS twice and fixed with precooled ethanol

195 overnight at 4°C. Cells were rewashed with PBS and incubated with 500 μl propidium

196 iodide (PI) / RNaseA staining buffer (RNaseA: PI = 1: 9) for 30 minutes away from

197 light, and analyzed by flow cytometry.

198 In vivo tumor growth assay

Page 9 of 31



Draft

199 Healthy 6-8 weeks old male nude BABL/C mice were purchased from HKF (China).

200 All mice were adaptively fed for one week and allowed to drink and eat freely. Tumor

201 cells (5×106 cells per mouse) were inoculated to the right side axillary fossa of mice,

202 10 μg NC shRNA and SNHG4 shRNA were injected into mice (6 mice every group)

203 via tail vein every three days after tumors were visible. Tumor size was measured every

204 four days, tumor tissues were weighed on day 27 and fixed for subsequent detection.

205 All animal experiments were performed follow the guideline for the care and use of

206 laboratory animals and approved by China Medical University.

207 Immunohistochemistry

208 Paraffin-embedded tissues sections of 5 μm were deparaffinized and rehydrated in

209 gradient alcohol. The slides were then soaked in antigen retrieval buffer and boiled over

210 the low heat for 10 minutes. The slides were incubated with 3% H2O2 for 15 minutes at

211 room temperature to eliminate the endogenous peroxidase activities and washed with

212 PBS for three times. The slides were blocked with goat serum for 15 minutes at room

213 temperature, followed by incubating with Ki67 antibody (1: 100, Proteintech, China)

214 and HRP-conjugated secondary antibody. The slides were incubated with DAB

215 developer to show color, stained with hematoxylin, and observed under a microscopy

216 (×400 magnification).

217 Statistical analysis

218 All statistical analysis was carried out using GraphPad Prism 7 (USA). All results were

219 presented as means ± SD, and mean values were compared by Student’s t-test or One-

220 way ANOVA. A p value less than 0.05 were considered as statistically.

Page 10 of 31



Draft

221 Results

222 Expression of SNHG4 was successfully silenced.

223 We examined the expression of SNHG4 in three human squamous carcinoma cell lines

224 and three human adenocarcinoma cell lines, among which NCI-H1437 and SK-MES-1

225 showed higher SNHG4 level (Figure 1, A). Thus, these two cell lines were chosen for

226 subsequent investigations. Significant decrease of SNHG4 expression was observed in

227 two cell lines after transfecting with SNHG4 siRNA compared to control (Figure 1, B,

228 p<0.05), which reveals that SNHG4 was successfully silenced by RNA interference.

229 SNHG4 acts as a sponge of miR-98-5p, which could directly target CDK6 and

230 SALL4.

231 Dual-luciferase assay was carried out to validate the interaction between SNHG4 and

232 miR-98-5p. Figure 2 A showed the binding site of miR-98-5p on lncRNA SNHG4.

233 Cells co-transfected with miR-98-5p mimics and wildtype SNHG4 showed

234 significantly lower luciferase activity compared to cells co-transfected with miR-98-5p

235 mimics and mutant SNGH4 (Figure 2, A, p<0.05). Expression of miR-98-5p was

236 significantly up-regulated after SNHG4 silencing in two cell lines (Figure 2, B, p<0.05).

237 CDK6 and SALL4 are downstream targets of miR-98-5p through prediction on

238 TargetScan database, and they were detected in the subsequent investigations (Figure

239 2, C).

240 SNHG4 silencing suppresses lung cancer cell proliferation in vitro.

241 Trypan blue staining was used to calculate total viable cells. Total viable NCI-H1437

242 and SK-MES-1 cells were significantly reduced since 48 hours after SNHG4 silencing

Page 11 of 31



Draft

243 compared to control (Figure 3, A, B, p<0.05). MTT assay and cell cycle detection by

244 flow cytometry were used to examine the effect of SNHG4 on cell proliferation.

245 SNHG4 siRNA transfected NCI-H1437 and SK-MES-1 cells both showed remarkably

246 lower OD value at 570 nm since 24 hours after transfection in contrast with control

247 (Figure 3, C, D, p<0.05). Similarly, cells at S phase were significantly reduced while

248 cells at G1 phase increased in SNHG4 siRNA transfected group compared to control

249 (Figure 3, E, F, p<0.05). Protein levels of CDK4 and CDK6 were significantly reduced

250 after SNHG4 silencing in two cell lines (Figure 3, G, H, p<0.05). These results indicated

251 that SNHG4 inhibits proliferation of lung cancer cells.

252 SNHG4 silencing inhibits migration, invasion and epithelial-mesenchymal

253 transition (EMT) of lung cancer cells.

254 Cell scratch and transwell assay were performed to determine cell migration and cell

255 invasion. An obviously decrease of migration index was observed in two cell lines 24

256 hours after SNHG4 siRNA transfection compared to control (Figure 4, A, B, p<0.05).

257 Cell invasion showed similar trend, SNHG4 siRNA transfected cell lines displayed

258 lower invasion in contrast with control (Figure 4, C, D, p<0.05). By

259 immunofluorescence assay, expression of E-cadherin was obviously up-regulated in

260 SNHG4 silencing group compared to control (Figure 5, A, B). Similarly, protein level

261 of E-cadherin was increased determined by western blot assay. Protein levels of EMT

262 promoting factors including SALL4, Twist, N-cadherin, vimentin, MMP-2 and MMP-

263 9 in two cell lines were significantly decreased in SNHG4 silencing group compared to

264 control (Figure 5, C, D, p<0.05).

Page 12 of 31



Draft

265 SNHG4 silencing suppresses tumor growth in mouse model.

266 Tumor tissues were weighed on day 27 after implantation. Tumor size was measured

267 every four days since day 7. Both tumor size and weight were remarkably decreased

268 after SNHG4 knockdown (Figure 6, A, B, p<0.05). Expression of SNHG4 was

269 downregulated, while miR-98-5p was up-regulated in the tumors of mice injected with

270 SNHG4 shRNA plasmid, in line with expectations (Figure 6, C, D, p<0.05). The

271 expression of Ki67 in tumor tissues detected by immunohistochemistry was decreased

272 after SNHG4 silencing (Figure 6, E). In addition, protein levels of SALL4, Twist,

273 CDK4, CDK6, vimentin, MMP-2 and MMP-9 was significantly down-regulated after

274 SNHG4 silencing, while E-cadherin expression was up-regulated (Figure 6, F, p<0.05).

275 MiR-98-5p inhibition reverses the effect of SNHG4 silencing on cell proliferation

276 and cell invasion.

277 We further investigated the effect of miR-98-5p inhibition on cell proliferation and cell

278 invasion. NCI-H1437 and SK-MES-1 cells were co-transfected with SNHG4 siRNA

279 and miR-98-5p/NC inhibitor. Proliferation of NCI-H1437 and SK-MES-1 cells was

280 significantly promoted after miR-98-5p inhibition compared to control since 48 hours

281 after transfection (Figure 7, A, B, p<0.05). Besides, invasion ability of NCI-H1437 and

282 SK-MES-1 cells was also enhanced after miR-98-5p inhibition in contrast with control

283 (Figure 7, C, D, p<0.05).

284 Discussion

285 Owing to its high invasiveness and rapid metastasis, lung cancer is still the top killer

286 cancer in both men and women worldwide (Liam et al. 2015). Non-small-cell lung

Page 13 of 31



Draft

287 cancers (NCSLCs) represent more than 85% of all lung cancers, among which

288 squamous cell lung cancers (SQCLC) and lung adenocarcinoma account for more about

289 70% of all lung cancers (Lemjabbar-Alaoui et al. 2015). Sustained cancer cell

290 proliferation plays a critical role in cancer progression and development, accompany

291 with alteration of expression and activity of cell cycle related proteins (Feitelson et al.

292 2015). In the present study, we investigated the effect of SNHG4 on proliferation of

293 lung cancer cells. We chose two lung cancer cell lines with relative higher SNHG4

294 expression, among which NCI-H1437 is a human adenocarcinoma cell line and SK-

295 MES-1 is a human squamous carcinoma cell line. MTT assay showed that SNHG4

296 silencing inhibited cell proliferation in these two cell lines, which was also proved by

297 decreased cells at S phase and reduced Ki67 expression in tumor tissues. Ki67 is a

298 nuclear protein that is closely associated with cell proliferation, it is an excellent marker

299 to determine the cancer cell proliferation in numerous researches (Ishibashi et al. 2017;

300 Scholzen and Gerdes 2000). Decreased CDK4 and CDK6 proved that SNHG4 silencing

301 leads to cell cycle arrest as well. CDK4 and CDK6 are crucial catalytic kinase for G1/S

302 transition of cell cycle (Meyerson and Harlow 1994). LncRNA SNHG12 promotes

303 growth of colorectal cancer cells as evidenced by up-regulated protein levels of CDK4

304 and CDK6, in line with our findings (Wang et al. 2017a). Besides, in vivo mouse model

305 demonstrated that both tumor size and weight were significantly reduced after SNHG4

306 silencing, indicating that SNHG4 might act as a tumor growth promoting factor.

307 Lung cancer is characterized by uncontrolled cell growth in lung tissues, which could

308 metastasize to nearby tissues and other organs. Metastasis is the key feature of cancers

Page 14 of 31



Draft

309 and the leading cause approximately 90% lung cancer deaths. Epithelial-mesenchymal

310 transition (EMT) is a crucial process by which cancer cells lose its cell-cell adhesion

311 and acquire migration capability and invasiveness, and further result in poor prognosis

312 and metastasis of cancer cells (Lamouille et al. 2014; Son and Moon 2010). Cell

313 migration is a central process for normal growth and development of organisms, while

314 abnormal cell migration may have serious consequences including tumor formation and

315 metastasis (Mak et al. 2016). Cancer cell invasion refers to cells penetrated into

316 adjacent tissues and it triggers further cancer cell progression and distant metastasis

317 (Krakhmal et al. 2015). Vimentin is a marker of mesenchymal cells and often up-

318 regulated in EMT. Elevation of N-cadherin is a common feature of EMT and enhances

319 cell migratory and invasive capacity (Hazan et al. 2004). E-cadherin is a marker of

320 epithelial cells, absence of E-cadherin is the fundamental event in EMT, and E-cadherin

321 is suppressed by transcription factors like Twist (Yang and Weinberg 2008). MMP-2,

322 along with MMP-9, is able to degrade basement membrane, which is essential for the

323 metastasis of cancers (Mook et al. 2004). SALL4 acts as an inducer of EMT and

324 metastasis in various cancers, including lung cancer (Liu et al. 2015; Liu et al. 2017).

325 Here migration and invasion of lung cancer cell lines were suppressed by SNHG4

326 silencing as evidenced by cell scratch and transwell assay. EMT was suppressed after

327 SNHG4 silencing proved by decreased expression of SALL4, Twist, vimentin, MMP2

328 and MMP9 as well as up-regulated E-cadherin expression (He et al. 2016). To sum up,

329 our study demonstrated that SNHG4 silencing inhibits proliferation, migration,

330 invasion and EMT of lung cancer cells.

Page 15 of 31



Draft

331 In our study, SNHG4 was identified as a sponge of miR-98-5p by dual-luciferase assay.

332 SNHG4 was reported to promote tumor growth by sponging miR-224-3p in human

333 osteosarcoma and be up-regulated in lung cancer tissues ascertained by microarray

334 analysis, which is highly in accord with our study (Xu et al. 2014; Xu et al. 2018). To

335 date, little is known about the role that SNHG4 plays in the development and

336 progression of lung cancer, our study demonstrated that SNHG4 may act as an

337 oncogenic and potent metastasis promoting factor in lung cancer. MiR-98-5p is down-

338 regulated in both lung cancer cell lines and lung cancer patients, miR-98-5p inhibits

339 proliferation, migration and invasion of lung cancer cell lines, reduced expression of

340 miR-98-5p is positively related with worse TNM stage, lower survival rate and

341 enhanced lymph node metastasis, indicating it is a potential marker for the diagnosis of

342 lung cancer patients (Ni et al. 2015; Wang et al. 2017b; Wu et al. 2019; Yang et al.

343 2015). Our results, in line with previous studies, revealed that miR-98-5p inhibition

344 promote proliferation and invasion of lung cancer cells. In particular, SALL4 is

345 identified as a target gene of miR-98-5p and is up-regulated in lung cancer tissues. MiR-

346 98-5p acts as a tumor suppressor by inhibiting SALL4, which is highly accord with the

347 present study (Liu et al. 2017). CDK6 is another candidate target gene of miR-98-5p

348 predicted on TargetScan database. In addition, miR-98 was reported to be negatively

349 regulated by SNHGs. For instance, SNHG16 contributes to the development of bladder

350 cancer via regulating miR-98 (Feng et al. 2018). Our study, for the first time, revealed

351 that SNHG4 interacts with miR-98-5p and regulates the progression of lung cancer.

352 Taken these together, our study found that lncRNA SNHG4 promotes proliferation,

Page 16 of 31



Draft

353 migration, invasion, and EMT of lung cancer cell lines by regulating miR-98-5p.

354 SNHG4/miR-98-5p could be recommended as potential biomarker and therapeutic

355 targets for patients with lung cancer.

356 Conflicts of interest

357 The authors declare that they have no conflict of interest.

358 Reference

359 Balas, M.M., and Johnson, A.M. 2018. Exploring the mechanisms behind long

360 noncoding RNAs and cancer. Noncoding RNA Res 3(3): 108-117.

361 doi:10.1016/j.ncrna.2018.03.001.

362 Bhan, A., and Mandal, S.S. 2015. LncRNA HOTAIR: A master regulator of chromatin

363 dynamics and cancer. Biochim Biophys Acta 1856(1): 151-164.

364 doi:10.1016/j.bbcan.2015.07.001.

365 Bhan, A., Soleimani, M., and Mandal, S.S. 2017. Long Noncoding RNA and Cancer:

366 A New Paradigm. Cancer Res 77(15): 3965-3981. doi:10.1158/0008-

367 5472.CAN-16-2634.

368 Dacic, S., Kelly, L., Shuai, Y., and Nikiforova, M.N. 2010. miRNA expression profiling

369 of lung adenocarcinomas: correlation with mutational status. Mod Pathol 23(12):

370 1577-1582. doi:10.1038/modpathol.2010.152.

371 Dandan, W., Jianliang, C., Haiyan, H., Hang, M., and Xuedong, L. 2019. Long

372 noncoding RNA MIR31HG is activated by SP1 and promotes cell migration

373 and invasion by sponging miR-214 in NSCLC. Gene 692: 223-230.

374 doi:10.1016/j.gene.2018.12.077.

Page 17 of 31



Draft

375 Feitelson, M.A., Arzumanyan, A., Kulathinal, R.J., Blain, S.W., Holcombe, R.F.,

376 Mahajna, J., et al. 2015. Sustained proliferation in cancer: Mechanisms and

377 novel therapeutic targets. Semin Cancer Biol 35 Suppl: S25-S54.

378 doi:10.1016/j.semcancer.2015.02.006.

379 Feng, F., Chen, A., Huang, J., Xia, Q., Chen, Y., and Jin, X. 2018. Long noncoding

380 RNA SNHG16 contributes to the development of bladder cancer via regulating

381 miR-98/STAT3/Wnt/beta-catenin pathway axis. J Cell Biochem 119(11): 9408-

382 9418. doi:10.1002/jcb.27257.

383 He, J., Zhou, M., Chen, X., Yue, D., Yang, L., Qin, G., et al. 2016. Inhibition of SALL4

384 reduces tumorigenicity involving epithelial-mesenchymal transition via

385 Wnt/beta-catenin pathway in esophageal squamous cell carcinoma. J Exp Clin

386 Cancer Res 35(1): 98. doi:10.1186/s13046-016-0378-z.

387 Ishibashi, N., Maebayashi, T., Aizawa, T., Sakaguchi, M., Nishimaki, H., and Masuda,

388 S. 2017. Correlation between the Ki-67 proliferation index and response to

389 radiation therapy in small cell lung cancer. Radiat Oncol 12(1): 16.

390 doi:10.1186/s13014-016-0744-1.

391 Iyer, M.K., Niknafs, Y.S., Malik, R., Singhal, U., Sahu, A., Hosono, Y., et al. 2015.

392 The landscape of long noncoding RNAs in the human transcriptome. Nat Genet

393 47(3): 199-208. doi:10.1038/ng.3192.

394 Krakhmal, N.V., Zavyalova, M.V., Denisov, E.V., Vtorushin, S.V., and Perelmuter,

395 V.M. 2015. Cancer Invasion: Patterns and Mechanisms. Acta Naturae 7(2): 17-

396 28. Available from http://www.ncbi.nlm.nih.gov/pubmed/26085941 [accessed.

Page 18 of 31



Draft

397 Lamouille, S., Xu, J., and Derynck, R. 2014. Molecular mechanisms of epithelial-

398 mesenchymal transition. Nat Rev Mol Cell Biol 15(3): 178-196.

399 doi:10.1038/nrm3758.

400 Lemjabbar-Alaoui, H., Hassan, O.U., Yang, Y.W., and Buchanan, P. 2015. Lung cancer:

401 Biology and treatment options. Biochim Biophys Acta 1856(2): 189-210.

402 doi:10.1016/j.bbcan.2015.08.002.

403 Liam, C.K., Andarini, S., Lee, P., Ho, J.C., Chau, N.Q., and Tscheikuna, J. 2015. Lung

404 cancer staging now and in the future. Respirology 20(4): 526-534.

405 doi:10.1111/resp.12489.

406 Liu, L., Zhang, J., Yang, X., Fang, C., Xu, H., and Xi, X. 2015. SALL4 as an Epithelial-

407 Mesenchymal Transition and Drug Resistance Inducer through the Regulation

408 of c-Myc in Endometrial Cancer. PLoS One 10(9): e0138515.

409 doi:10.1371/journal.pone.0138515.

410 Liu, W., Xiao, P., Wu, H., Wang, L., Kong, D., and Yu, F. 2017. MicroRNA-98 Plays

411 a Suppressive Role in Non-Small Cell Lung Cancer Through Inhibition of

412 SALL4 Protein Expression. Oncol Res 25(6): 975-988.

413 doi:10.3727/096504016X14791726591124.

414 Lu, W., Zhang, H., Niu, Y., Wu, Y., Sun, W., Li, H., et al. 2017. Long non-coding RNA

415 linc00673 regulated non-small cell lung cancer proliferation, migration,

416 invasion and epithelial mesenchymal transition by sponging miR-150-5p. Mol

417 Cancer 16(1): 118. doi:10.1186/s12943-017-0685-9.

418 Mak, M., Spill, F., Kamm, R.D., and Zaman, M.H. 2016. Single-Cell Migration in

Page 19 of 31



Draft

419 Complex Microenvironments: Mechanics and Signaling Dynamics. J Biomech

420 Eng 138(2): 021004. doi:10.1115/1.4032188.

421 Meyerson, M., and Harlow, E. 1994. Identification of G1 kinase activity for cdk6, a

422 novel cyclin D partner. Mol Cell Biol 14(3): 2077-2086. Available from

423 http://www.ncbi.nlm.nih.gov/pubmed/8114739 [accessed.

424 Mohr, A.M., and Mott, J.L. 2015. Overview of microRNA biology. Semin Liver Dis

425 35(1): 3-11. doi:10.1055/s-0034-1397344.

426 Mook, O.R., Frederiks, W.M., and Van Noorden, C.J. 2004. The role of gelatinases in

427 colorectal cancer progression and metastasis. Biochim Biophys Acta 1705(2):

428 69-89. doi:10.1016/j.bbcan.2004.09.006.

429 Ni, R., Huang, Y., and Wang, J. 2015. miR-98 targets ITGB3 to inhibit proliferation,

430 migration, and invasion of non-small-cell lung cancer. Onco Targets Ther 8:

431 2689-2697. doi:10.2147/OTT.S90998.

432 Reck, M., Heigener, D.F., Mok, T., Soria, J.C., and Rabe, K.F. 2013. Management of

433 non-small-cell lung cancer: recent developments. Lancet 382(9893): 709-719.

434 doi:10.1016/S0140-6736(13)61502-0.

435 Salmena, L., Poliseno, L., Tay, Y., Kats, L., and Pandolfi, P.P. 2011. A ceRNA

436 hypothesis: the Rosetta Stone of a hidden RNA language? Cell 146(3): 353-358.

437 doi:10.1016/j.cell.2011.07.014.

438 Scholzen, T., and Gerdes, J. 2000. The Ki-67 protein: from the known and the unknown.

439 J Cell Physiol 182(3): 311-322. doi:10.1002/(SICI)1097-

440 4652(200003)182:3<311::AID-JCP1>3.0.CO;2-9.

Page 20 of 31



Draft

441 Siegel, R.L., Miller, K.D., and Jemal, A. 2018. Cancer statistics, 2018. CA Cancer J

442 Clin 68(1): 7-30. doi:10.3322/caac.21442.

443 Son, H., and Moon, A. 2010. Epithelial-mesenchymal Transition and Cell Invasion.

444 Toxicol Res 26(4): 245-252. doi:10.5487/TR.2010.26.4.245.

445 Wang, J.Z., Xu, C.L., Wu, H., and Shen, S.J. 2017a. LncRNA SNHG12 promotes cell

446 growth and inhibits cell apoptosis in colorectal cancer cells. Braz J Med Biol

447 Res 50(3): e6079. doi:10.1590/1414-431X20176079.

448 Wang, K., Dong, L., Fang, Q., Xia, H., and Hou, X. 2017b. Low serum miR-98 as an

449 unfavorable prognostic biomarker in patients with non-small cell lung cancer.

450 Cancer Biomark 20(3): 283-288. doi:10.3233/CBM-170124.

451 Williams, G.T., and Farzaneh, F. 2012. Are snoRNAs and snoRNA host genes new

452 players in cancer? Nat Rev Cancer 12(2): 84-88. doi:10.1038/nrc3195.

453 Wu, F., Mo, Q., Wan, X., Dan, J., and Hu, H. 2019. NEAT1/hsa-mir-98-5p/MAPK6

454 axis is involved in non-small-cell lung cancer development. J Cell Biochem

455 120(3): 2836-2846. doi:10.1002/jcb.26442.

456 Xu, G., Chen, J., Pan, Q., Huang, K., Pan, J., Zhang, W., et al. 2014. Long noncoding

457 RNA expression profiles of lung adenocarcinoma ascertained by microarray

458 analysis. PLoS One 9(8): e104044. doi:10.1371/journal.pone.0104044.

459 Xu, R., Feng, F., Yu, X., Liu, Z., and Lao, L. 2018. LncRNA SNHG4 promotes tumour

460 growth by sponging miR-224-3p and predicts poor survival and recurrence in

461 human osteosarcoma. Cell Prolif 51(6): e12515. doi:10.1111/cpr.12515.

462 Yang, G., Zhang, X., and Shi, J. 2015. MiR-98 inhibits cell proliferation and invasion

Page 21 of 31



Draft

463 of non-small cell carcinoma lung cancer by targeting PAK1. Int J Clin Exp Med

464 8(11): 20135-20145. Available from


466 Yang, J., and Weinberg, R.A. 2008. Epithelial-mesenchymal transition: at the

467 crossroads of development and tumor metastasis. Dev Cell 14(6): 818-829.

468 doi:10.1016/j.devcel.2008.05.009.

469 Zhu, Q., Yang, H., Cheng, P., and Han, Q. 2018. Bioinformatic analysis of the

470 prognostic value of the lncRNAs encoding snoRNAs in hepatocellular

471 carcinoma. Biofactors. doi:10.1002/biof.1478.

472

473

474

475 Hazan, R.B., Qiao, R., Keren, R., Badano, I., and Suyama, K. 2004. Cadherin switch

476 in tumor progression. Ann N Y Acad Sci 1014: 155-163. Available from


478

479

480

481 Figure legends

482 Figure 1. Relative expression of lncRNA SNHG4 in lung cancer cell lines. (A) The

483 expression of lncRNA SNHG4 was detected using real time-PCR in six lung cancer

484 cell lines. NCI-H2170, NCI-H520 and SK-MES-1 are human squamous carcinoma cell

Page 22 of 31



http://www.ncbi.nlm.nih.gov/pubmed/15153430

Draft

485 lines, NCI-H1975, NCI-H1437 and SPC-A-1 are human adenocarcinoma cell lines. (B)

486 The lncRNA SNHG4 expression was decreased after transfection with SNHG4 siRNA

487 in both SK-MES-1 and NCI-H1437. All data were presented as mean ± SD, * p<0.05.

488 Figure 2. SNHG4 acts as a sponge of miR-98-5p. (A) Specific binding site of miR-

489 98-5p on SNHG4 was displayed, and the correlation between SNHG4 and miR-98-5p

490 was analyzed by dual-luciferase activity assay. (B) The expression of miR-98-5p was

491 increased after SNHG4 knockdown in SK-MES-1 and NCI-H1437. (C) Specific

492 binding sites of miR-98-5p on CDK6 and SALL4 were shown, *p<0.05.

493 Figure 3. LncRNA SNHG4 knockdown inhibits the proliferation of lung cancer

494 cells in vitro. (A, B) Total viable cells were calculated after trypan blue staining. (C,

495 D) MTT assay was performed to examine cell proliferation. (E, F) Knockdown of

496 SNHG4 could induce the G1-phase arrest. (G, H) Protein levels of CDK4 and CDK6

497 in two cell lines were determined by western blot, *p<0.05.

498 Figure 4. SNHG4 silencing suppresses the migration and invasion of lung cancer

499 cells. (A, B) The migration ability of SK-MES-1 and NCI-H1437 cell lines was

500 assessed by cell scratch assay. (C, D) The invasion ability of SK-MES-1 and NCI-

501 H1437 cell lines was measured via transwell assay 48 hours after SNHG4 siRNA

502 transfection. (Scale bar = 100 μm), *p<0.05.

503 Figure 5. LncRNA SNHG4 promotes EMT of lung cancer cells. (A, B) Expression

504 of E-cadherin was detected by immunofluorescence assay (Scale bar = 50 μm). (C, D)

505 Protein levels of EMT related proteins including SALL4, Twist, E-cadherin, N-

506 cadherin, vimentin, MMP-2 and MMP-9 in two cell lines were determined by western

Page 23 of 31



Draft

507 blot assay, *p<0.05.

508 Figure 6. SNHG4 promotes the proliferation of lung cancer cells in vivo. (A)

509 Tumors were weighed up 27 days after subcutaneous implantation. (B) Tumor volume

510 was measured every four days since day 7 after subcutaneous implantation. (C, D) The

511 expression levels of SNHG4 and miR-98-5p were detected by RT-PCR in tumor tissues.

512 (E) Immunohistochemistry assay was performed to examine the expression of Ki67.

513 (F) The protein levels of SALL4, Twist, CDK4, CDK6, E-cadherin, vimentin, MMP-

514 2, and MMP-9 in tumor tissues was determined by western blot assay, *p<0.05.

515 Figure 7. MiR-98-5p inhibition reverses the effect of SNHG4 silencing on cell

516 proliferation and cell invasion. (A, B) Cell proliferation of two cell lines after miR-

517 98-5p inhibition was evaluated by MTT assay. (C, D) Cell invasion of two cell lines

518 after miR-98-5p inhibition was assessed using transwell assay. (Scale bar = 100 μm),

519 *p<0.05.

Page 24 of 31



Draft

170x99mm (300 x 300 DPI)

Page 25 of 31



Draft

170x140mm (300 x 300 DPI)

Page 26 of 31



Draft

170x268mm (300 x 300 DPI)

Page 27 of 31



Draft

170x181mm (300 x 300 DPI)

Page 28 of 31



Draft

170x188mm (300 x 300 DPI)

Page 29 of 31



Draft

170x251mm (300 x 300 DPI)

Page 30 of 31



Draft

170x161mm (300 x 300 DPI)

Page 31 of 31



draft...draft 1 lncrna snhg4 promotes proliferation, migration, invasion and 2...

Documents