downloaded from on june 23, 2019 by guest · 26 a protein fraction exhibiting 1-hydroxy-2-naphthoic...
TRANSCRIPT
1
HETEROLOGOUS EXPRESSION AND CHARACTERIZATION OF TWO 1-1
HYDROXY-2-NAPHTHOIC ACID DIOXYGENASES FROM ARTHROBACTER 2
PHENANTHRENIVORANS 3
Elpiniki Vandera1 #, Konstantinos Kavakiotis1 #, Aristeidis Kallimanis1, Nikos C. 4
Kyrpides2, Constantin Drainas †1 and Anna-Irini Koukkou1 5
6
1. Sector of Organic Chemistry and Biochemistry, University of Ioannina, 45110 7
Ioannina, Greece 8
2. Genome Biology Program, Department of Energy Joint Genome Institute, 2800 9
Mitchell Drive, Walnut Creek, CA 94598, USA 10
11
12
Running Title: 1-H2NA dioxygenases from A. phenanthrenivorans 13
14
Keywords: Arthrobacter sp., 1-hydroxy-2-naphthoic acid dioxygenase, PAH biodegradation, 15
phenanthrene biodegradation, dioxygenases. 16
17
# equal contribution 18
*Author for correspondence: Anna I. Koukkou, Biochemistry Laboratory, Department of 19
Chemistry, 45 110, University of Ioannina, Greece, Tel: +32651008371, email: 20
† In memory of professor Constantin Drainas who so unexpectedly lost his life in a car 22
accident on July 5th, 2011.23
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.07137-11 AEM Accepts, published online ahead of print on 18 November 2011
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
2
Abstract 24
25
A protein fraction exhibiting 1-Hydroxy-2-Naphthoic Acid (1-H2NA) dioxygenase 26
activity was purified via ion exchange, hydrophobic interactions and gel filtration 27
chromatography from Arthrobacter phenanthrenivorans sp. nov. strain Sphe3 isolated 28
from a Greek creosote-oil polluted site. MALDI-TOF MS and MS/MS analysis revealed 29
that the amino acid sequence of oligopeptides of the major protein species of 45 kDa, as 30
analyzed by SDS-PAGE and silver-stain, comprising the 29 % of the whole sequence, 31
exhibited strong homology with 1-H2NA dioxygenase of Nocardioides sp. strain KP7. 32
BLAST search of the recently sequenced Sphe3 genome revealed two putative open 33
reading frames, named diox1 and diox2, showing 90 % nucleotide identity to each other 34
and 85 % identity at the amino acid level with the Norcardia sp. homologue. diox1 was 35
found on an indigenous Sphe3 plasmid, whereas diox2 was located on the chromosome. 36
Both genes were induced by the presence of phenanthrene when used as a sole carbon 37
and energy source, and, as expected, both were subject to carbon catabolite repression. 38
The relative RNA transcription level of the chromosomal (diox2) gene was significantly 39
higher than that of its plasmid (diox1) homologue. Both diox1 and diox2 putative genes 40
were PCR amplified, cloned and overexpressed in E. coli. Recombinant E. coli cells 41
expressed 1-H2NA dioxygenase activity. Recombinant enzymes exhibited Michaelis-42
Menten kinetics with an apparent Km of 35 μM for Diox1 and 29 μM for Diox2, whereas 43
they showed similar kinetic turnover characteristics with Kcat/Km values of 11x106 M-1s-1 44
and 12x106 M-1s-1, respectively. Occurrence of two diox1 and diox2 homologues in the 45
Sphe3 genome implies that a replicative transposition event has contributed to the 46
evolution of 1-H2NA dioxygenase in Arthrobacter phenanthrenivorans. 47
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
3
48
INTRODUCTION 49
50 Polycyclic Aromatic Hydrocarbons (PAHs) are widespread pollutants found in many 51
contaminated soils by natural or industrial activities threatening human and animal life. Their 52
removal from polluted environmental niches largely depends on microbial degradation (4, 22, 53
41, 46). Apart from its environmental impact, microbial transformation of PAHs is also 54
important for various technological applications, such as wastewater treatment, 55
biodegradation, bioremediation and biocatalysis. Among PAHs, phenanthrene, a three 56
benzene ring compound, has often been used as a model for experimental biodegradation. 57
Two metabolic pathways are currently known for the metabolism of phenanthrene (2, 9, 16, 58
26), one leading to the formation of protocatechuic acid via o-phthalic acid, and the other to 59
catechol via salicylic acid, which follow a further catabolic pattern through ortho- and meta-60
cleavage (Fig.1). Both pathways involve the formation of 1-H2NA at early steps. In bacterial 61
pathways for degradation of phenanthrene via o-phthalate, the 1-H2NA is ring cleaved by a 62
1-H2NA dioxygenase producing 2΄-carboxybenzalpyruvate. Ring cleavage dioxygenases play 63
a central role to the decomposition of doubly hydroxylated aromatic compounds. 1-H2NA 64
dioxygenase is unique among such dioxygenases, because it can cleave a singly hydroxylated 65
aromatic ring. However, although degradative pathways via o-phthalate are described in 66
several microorganisms (26, 23, 47), 1-H2NA dioxygenase has been purified only from 67
Nocardioides sp. KP7 and Pseudomonas sp. strain PPD (17, 7). The deduced amino acid 68
sequence of this enzyme was different from other dioxygenases cleaving doubly 69
hydroxylated aromatic rings (17). No significant similarity to any other dioxygenases, except 70
for a moderate similarity (33 %) to the gentisate 1, 2-dioxygenase from Xanthobacter 71
polyaromaticivorans 127W has been reported (14). Comparative studies of the properties of 72
different 1-H2NA dioxygenases from various bacterial species will enlighten the 73
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
4
identification of the structural determinants of particular functions, such as substrate 74
specificity and catalysis, and are expected to facilitate the engineering of microorganisms 75
with improved degrading abilities. 76
We have previously reported the isolation of Arthrobacter phenanthrenivorans strain 77
Sphe3, which can grow on phenanthrene as the sole source of carbon and energy, efficiently 78
catabolizing phenanthrene up to 400 mg·L-1 at high rates (21). In the present work we 79
describe the purification, catalytic properties, cloning and characterization of two1-H2NA 80
dioxygenases isolated from Arthrobacter phenanthrenivorans sp. nov. (19). 81
82
MATERIALS AND METHODS 83
84
Bacterial Strains and growth conditions. Arthrobacter phenanthrenivorans strain Sphe3, 85
was isolated from a creosote polluted area in Epirus, Greece (12 Km North from the city of 86
Ioannina), as described (19). Minimal medium (MM M9) was supplemented with 0.02 % 87
(w/v) phenantrene or 0.04 % (w/v) glucose as described (21). Cultures were incubated at 30 88
oC on a rotary shaker, agitated at 180 rpm. 89
Escherichia coli strains DH5 (alpha) and BL21 [DE3] were cultured in Lysogeny 90
Broth (LB) medium in presence of the appropriate antibiotics when necessary for selection. 91
92
Preparation of cell extracts. Cells were harvested by centrifugation (6,000xg, 20 min) at 4 93
oC, washed with 10 mM Tris-H2SO4 buffer, pH 7.5, containing 1 mM DTT, resuspended in 2 94
ml of the same buffer and disrupted with a mini Bead Beater (Biospec Product, Oklahoma: 95
10x1 min periods using zirconium beads 0.1 mm diameter). The homogenate was centrifuged 96
(12,000 rpm, 30 min, 4 oC), supernatant was centrifuged again (40,000 rpm. 60 min, 4 oC) 97
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
5
and the final supernatant was used as the crude cell-free extract. Protein concentrations were 98
determined by the Bradford method, using an assay kit (Bio-Rad) with BSA as standard (3). 99
100
Enzyme Assays. All enzyme assays were performed at 25 oC using a Shimadzu UV-1201 101
spectrophotometer. The activity of 1-H2NA dioxygenase under standard conditions was 102
estimated spectrophotometrically by measuring the product formation as the increase of 103
absorbance at 300 nm (extinction coefficient [ε300] =11.5 mM-1cm-1) in 10 mM Tris-H2SO4 104
(pH=7.5) containing 0.1 mM 1-hydroxy-2-naphthoate as described by Iwabuchi and 105
Harayama (17). 2-Carboxybenzaldehyde dehydrogenase, 4,5-protocatechuate dioxygenase, 106
3,4-protocatechuate dioxygenase, 1-hydroxy-2-naphthoate hydroxylase, catechol 2,3-107
dioxygenase and salicylate hydroxylase were assayed as described previously (16, 33, 10, 25, 108
50, 49). Kinetic data were calculated with Origin Microcal software, ORIGIN (31) by non-109
linear curve fitting of Michaelis-Menten equation. 110
111
Purification of native 1-H2NA dioxygenases. 1-H2NA dioxygenases were purified from 112
crude cell-free extract of Sphe3 cells, grown for 34 h at 30 οC in 20 liters of MM M9 113
containing 0.02 % (w/v) phenanthrene. Crude cell-free extract was prepared as described 114
above and loaded onto an anion-exchange column (DEAE-Sepharose CL-6B, 12 cm x 1.6 115
cm, Pharmacia). Proteins were eluted from the column by a linear gradient of 0.0-0.5 M 116
Na2SO4 in 120 ml of 10 mM Tris-H2SO4 buffer (pH=7.5) containing 1 mM DTT at a flow 117
rate of 2 ml·min-1. Active fractions were pooled and dialyzed against 10 mM Tris-H2SO4 118
buffer (pH 7.5) containing 1 mM DTT. The dialyzed fractions were adjusted to 0.5 M 119
(NH4)2SO4 at 4 οC. The precipitated proteins were removed by centrifugation at 12,000 rpm 120
for 30 min at 4 οC. 1-H2NA dioxygenase activity was recovered in the supernatant fluid. This 121
supernatant was loaded onto a hydrophobic interactions column (Phenyl-Sepharose CL-4B, 6 122
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
6
cm x 1.6 cm, Pharmacia) pre-equilibrated with 10 mM Tris-H2SO4 buffer (pH=7.5) 123
containing 1 mM DTT and 0.5 Μ Na2SO4. Proteins were eluted from the column by a linear 124
gradient of 0.5-0.0 M Na2SO4 in 120 ml of 10 mM Tris-H2SO4 buffer (pH=7.5) containing 1 125
mM DTT at a flow rate of 1 ml·min-1. Active fractions were pooled, condensed to 2 ml and 126
loaded onto a gel filtration column (Sephacryl S-200 High Resolution, 75 cm x 1.6 cm, 127
Pharmacia). The proteins were eluted from the column with a mobile phase of 20 mM Tris-128
H2SO4 buffer (pH=7.5) containing 1 mM DTT and 100 mM Na2SO4 at a flow rate of 0.5 129
ml·min-1.. The molecular mass of the enzyme was determined from its mobility through the 130
gel filtration column relative to those of standard proteins (Blue Dextran 2000 kDa, β-131
Amylase 200 kDa, Alcohol Dehydrogenase 150 kDa, Bovine Serum Albumin 66 kDa, 132
Carbonic Anhydrase 29 kDa and Cytochrome c 12.4 kDa). The absorbance of the protein 133
effluent was monitored at 280 nm (Shimadzu UV-1201). 134
135
SDS-PAGE of native 1-H2NA dioxygenases. The purity of protein preparations was 136
evaluated by coomassie or silver-stained 12 % SDS-PAGE in the presence of molecular mass 137
markers (Fermentas-unstained marker) by standard methodology (27, 32). 138
139
Amino acid sequencing. Protein bands of 55, 45 and 35 kDa were excised from SDS-PAGE 140
gel electrophoresis of the fraction samples collected from gel filtration chromatography on 141
the basis of 1-H2NA dioxygenase activity and analyzed by mass spectrometry (MALDI-TOF 142
MS and MS/MS). 143
Mass spectrometry analysis was done at the Proteomics Research Unit, Biomedical Research 144
Foundation, Academy of Athens, under the supervision of Dr. G. Th. Tsangaris as has been 145
previously described (48). 146
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
7
Gene cloning. The complete genome sequence of A. phenanthrenivorans Sphe3 was 147
analyzed by the DOE-Joint Genome Institute and published recently (Genomes OnLine 148
Database accession number Gi01675) (29, 20). The identification of the Sphe3 1-H2NA 149
dioxygenase genes was based on BLAST searches within the IMG-ER platform (30), using 150
sequences of the oligopeptide fragments deduced from the mass spectrometry analysis as 151
described above. This search revealed two putative orfs (open reading frames), each one 152
coding for a putative protein of 387 amino acids with 90 % sequence similarity to each other 153
at the nucleotide level. One of the orfs was found on an indigenous plasmid (pASPHE301) 154
and named diox1. The second orf was located on the chromosome and named diox2. Because 155
the two orfs share a strong sequence similarity, primers Diox1F/Diox1R and Diox2F/Diox2R 156
(Table 2) were designed according to sequences flanking diox1 and diox2 at either side. 157
Using these primers in a PCR reaction with total DNA from Sphe3 as a template we obtained 158
1373 and 1408 nt amplification products for the two orfs, respectively. These fragments were 159
cloned in vector pCR-blunt (Invitrogen), verified by nucleotide sequence analysis and used as 160
templates in a PCR reaction for a second amplification of diox1 and diox2, as an effort to 161
overexpress their putative products in E. coli. For this purpose, a second pair of primers was 162
designed (pETdiox1F/pETdiox1R and pETdiox2F/pETdiox2R, (Table 2) carrying NdeI-163
BamHI restriction sites, appropriate for subcloning in the expression vector pET29c(+) . The 164
amplified fragments were once again cloned in vector pCR-blunt (Invitrogen) and verified by 165
nucleotide sequence analysis. Finally, the diox1 and diox2 orfs were cloned in pET29c(+) 166
expression vector (Novagen) following restriction with NdeI-BamHI. These constructs were 167
transformed in E. coli BL21 [DE3] for expression analysis. 168
The PCR cycles applied here were: an initial step at 95 °C for 5 min, followed by 30 cycles 169
consisting of three steps each (denaturation 95 °C for 1 min, annealing at 60 °C for 2 min and 170
extension for 3 min) and a final elongation step at 72 °C for 10 min. 171
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
8
Amplificaton reactions were carried out in a PTC-100 version 7.0 thermocycler (MJ 172
Reasearch Inc., USA) using the Phusion High-Fidelity DNA Polymerase (Finnzymes, Espoo, 173
Finland) and 1.5 mM MgCl2 (final concentration). The amplicons produced were purified 174
using NucleoSpin Extract 2 in 1 (Macherey-Nagel, Germany). Molecular cloning was 175
performed using Zero Blunt Kit (Invitrogen, USA) according to the manufacturer’s 176
recommendations. E. coli strain DH5 (αlpha) was used as the recombinant plasmid host (12). 177
When E. coli strain BL21 [DE3] was used as a recipient, transformation was carried out 178
according to the method of Chung and Miller (5). Cloned fragments were sequenced by 179
Macrogen (Korea). Sequence alignments were performed using the program BLAST (1) at 180
the NCBI website. 181
Sphe3 genomic DNA was isolated from cells grown on MM M9 containing 0.02 % 182
(w/v) phenanthrene according to the standard JGI (Joint Genome Institute) (CA, USA) 183
protocol for Bacterial genomic DNA isolation using CTAB (Cetyl trimethylammonium 184
bromide). Restriction enzyme digestions, ligations and agarose gel electrophoresis were 185
carried out using standard methodology (39). 186
DNA sequences were aligned with Lalign software (15). Amino acid sequences 187
exhibiting similarity were retrieved from protein databases and aligned using CLUSTALW 188
(44). Phylogenetic tree and molecular evolutionary analyses were conducted using MEGA 189
version 4. (43). 190
191
Purification of recombinant 1-H2NA dioxygenases. E. coli BL21[DE3]-pET29c(+) host-192
vector overexpression system was used to overproduce the Diox1 and Diox2 polypeptides. 193
Cells, containing the pET21/diox1 or pET21/diox2 plasmids were incubated in 2 L LB 194
containing Kn (Kanamycin sulphate) (50 μg ml -1). The culture was grown at 37 oC with 195
aeration in an Orbital shaker (Forma Scientific) fermentation system. Cultures were induced 196
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
9
at A600=0.6 by adding 1 mM IPTG (Isopropyl-β-D-1-thiogalactopyranoside) and incubation 197
continued for four additional hours. The cells were harvested by centrifugation, washed with 198
100 mM Tris/HCl, pH 8.0 and stored at -20 °C. 199
Frozen cells were thawed in the appropriate volume (5 ml·g of cells-1) of 100 mM Tris/HCl 200
pH 8.0, containing 0.5 M sodium chloride, 20 mM imidazole hydrochloride and 0.5 mM 201
PMSF (Phenylmethanesulfonyl fluoride). The suspension was subjected to ultrasonic 202
treatment (8 pulses/ 10 sec/ 300 Watt with interval pauses of 10 sec for the cooling of the 203
samples on ice) and centrifuged. The supernatant was applied to a Ni+-chelating column 204
(Qiagen) previously equilibrated with 100 mM Tris/HCl, pH 8.0, containing 0.5 M sodium 205
chloride and 20 mM imidazole (flow rate 2 ml·min-1). The column was washed with 50 ml of 206
100 mM Tris/HCl, pH 8.0 containing 0.5 M sodium chloride and 20 mM imidazole and run 207
with a gradient of 20-100 mM imidazole in 20 ml of 100 mM Tris/HCl, pH 8.0, followed by 208
a gradient of 100-500 mM imidazole in 100 mM Tris/HCl, pH 8.0 containing 0.5 M sodium 209
chloride (total volume 120 ml) (37). Fractions exhibiting 1-H2NA dioxygenase activity were 210
collected, analysed by SDS-PAGE, pooled and used for further kinetic analysis. The Km 211
values were determined in a broad concentration range of substrate varying from 0.005 to 212
0.15 mM in the presence of 0.1 mM FeSO4 and 0.1 mM L- ascorbic acid. 213
214
RNA isolation and quantitative real-time (qPCR). Total RNA was isolated from 5 ml 215
fresh Sphe3 cultures grown on phenanthrene, glucose or glucose plus phenanthrene (as the 216
sole carbon source) at the mid exponential phase, by using the NucleoSpin RNA II kit 217
(Macherey-Nagel), according to the manufacturer’s instructions. Residual DNA was removed 218
by additional treatment with RNase-Free DNase I (TaKaRa). RNA integrity was observed by 219
electrophoresis in 1.2 % agarose gel and quantified by measuring the absorbance at 260 nm 220
(Shimadzu UV-1201). Reverse transcription (RT) was performed by using 0.5 μg of hot 221
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
10
denatured DNA-free RNA with the PrimeScriptTM 1st strand cDNA Synthesis Kit (TaKaRa), 222
using 100 pmol of Random Hexamer primers and 200 U of PrimeScriptTM RTase at a final 223
volume of 20 μl, according to the manufacturer’s instructions 224
Quantitative real-time (qPCR) was performed in 96-well plates on the ABI PRISM 7700 225
Sequence Detection System (Perkin-Elmer Applied Biosystems, Foster City, CA) using the 226
KAPATM SYBR® FAST qPCR Kit Master Mix (2X) Universal. The 20 μl reaction mixtures 227
contained 19 μl of SYBR Green master mix (containing the KAPA SYBR® DNA 228
Polymerase), 200 nM of each oligonucleotide primer and 1 μl of different dilutions of the 229
reverse transcriptase product. The sequences of the primers are shown in Table 2. To 230
determine the specificity of the primer pairs, experiments were initially performed with the 231
optimum conditions determined by conventional PCR. The reaction conditions were as 232
follows: 3 min at 95 °C, followed by 40 cycles of 10 s at 95 °C, 20 s at 58 °C and 30 s at 72 233
°C. To confirm accuracy and reproducibility of quantitative real-time (qPCR) each sample 234
was analyzed in triplicate. A non-template control for each primer pair was included in all 235
real-time plates to detect any possible contamination. Fluorescence measurements were taken 236
during the final temperature ramp. The observation of a unique fluorescence fall at the fusion 237
temperature specific for the PCR product certified its purity. 238
The exact amount and quality of total RNA was determined in each sample by quantifying 239
transcripts of the gyrase β (gyr) gene, a housekeeping gene used as a reference. Each 240
unknown sample was normalized to the gyrase β mRNA content. The relative standard 241
curves were plotted using the diox1, diox2 and gyrase β primers amplified with 10, 5, 1, 0.5, 242
0.2 and 0.1 ng of total RNA from glucose grown cells (18). Quantitative real-time (qPCR) 243
efficiencies were calculated from the given slopes. The corresponding quantitative real-time 244
(qPCR) efficiency (E) of one cycle within the exponential phase was calculated according to 245
the equation: E=10[-1/slope]. The transcripts under investigation exhibited high quantitative 246
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
11
real-time (qPCR) efficiency rates such as 1.76, 1.86 and 1.77 for diox1, diox2 and gyrβ 247
respectively, within the range of cDNA input 0.1 to 10 ng and with high linearity (correlation 248
factors 0.9924 <r2< 0.9968) (6, 34). The quantitative real-time (qPCR) results were analyzed 249
by the relative quantification method which calculates the amount of a target transcript in 250
relation to an internal standard (a suitable housekeeping gene, in our case gyrβ) within the 251
same sample. Moreover, samples were normalized through a calibrator introduced in each 252
run. Results were expressed as the target/internal standard concentration ratio of the sample 253
divided by the target/internal standard concentration ratio of the calibrator (45). 254
255
EMBL Accession No. diox1 and diox2 sequences were deposited at EMBL under the 256
accession No AM931437 and AM931438 respectively. 257
258
RESULTS 259
260
Phenanthrene metabolism. Evidence for the phenanthrene degradation pathway utilized by 261
strain Sphe3 was obtained by assaying the activity of several key enzymes in crude cell-free 262
extracts after growth on phenanthrene. Enzyme activities of 1-H2NA dioxygenase, 2-263
carboxybenzaldehyde dehydrogenase and 4, 5-protocatechuate dioxygenase were estimated 264
as 1, 0.2 and 0.1 μmoles·min-1·mg-1, respectively, in cells grown on phenanthrene. However, 265
no 1-H2NA hydroxylase, 3, 4-protocatechuate dioxygenase, 2, 3-catechol dioxygenase, or, 266
salicylate hydroxylase activities were found in these samples. In addition, Sphe3 could grow 267
on 2-carboxybenzaldehyde, protocatechuate and phthalate as sole carbon sources, all 268
intermediates of phenanthrene degradation via the phthalate pathway (2), whereas no growth 269
was observed on salicylic acid. 270
271
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
12
Purification of 1-H2NA dioxygenases. 1-H2NA dioxygenases were purified from crude 272
cell-free extract of strain Sphe3 grown on M9 MM in the presence of phenanthrene as sole 273
carbon and energy source (Table 1). 1-H2NA dioxygenase activity was not detectable in 274
crude cell-free extracts from cells grown in the presence of glucose. The active fraction was 275
eluted from a DEAE column (anion exchange) at a Na2SO4 concentration of 0.3 M, followed 276
by a Phenyl-Sepharose hydrophobic interactions chromatography by a declining 277
concentration gradient of Na2SO4. Finally, the active fraction exhibiting 1-H2NA 278
dioxygenase activity was eluted as a single peak equivalent to a molecular mass of 180 kDa 279
by gel filtration chromatography as described in materials and methods (Table 1). SDS-280
PAGE analysis of this fraction showed one major protein band corresponding to a molecular 281
mass of ~ 45 kDa, and two minor bands at 55 and 35 kDa, respectively (Fig. 2). Protein 282
bands were excised from the gel and analyzed by mass spectrometry (MALDI-TOF MS and 283
MS/MS). The amino acid sequences of the oligopeptides from the individual 55 and 45 kDa 284
bands, covering up to 18 and 29 % of the total sequence, respectively, were quite revealing. 285
Blast analysis of the 55 kDa band fragments showed 100 % sequence identity with parts of 286
(PhnF) dehydrogenase Q9ZHHF from Burkholderia sp. RP007 (28). Most interestingly, 287
peptides deduced from the 45 kDa band showed 100 % sequence identity with parts of 1-288
H2NA dioxygenase from Nocardioides sp. strain KP7. The peptides from the third band (35 289
kDa) did not perfectly match any known protein sequence. 290
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
13
Catalytic properties of native 1-H2NA dioxygenases. The fraction obtained from the gel 291
filtration chromatography exhibiting 1-H2NA dioxygenase activity was used for further 292
kinetic studies. Temperature and pH optima of 1-H2NA dioxygenase catalytic activity were 293
40 °C and 8.5, respectively (see Fig. S1 in the supplemental materials). The purified enzyme 294
was stable when stored at 4 oC for 48 h in the presence of DTT (1 mM). No activity was 295
detected when 3-hydroxy-2-naphthoic acid was used as substrate at a concentration of 0.1 296
mM in a 10 mM Tris-H2SO4 buffer (pH 7.5) at 25 οC. 297
The effect of chelators on the activity of 1-H2NA dioxygenase was examined in a 10 298
mM Tris-H2SO4 buffer (pH=7.5) containing 0.1 mM 1-H2NA at 25 οC. EDTA (at 1 or 10 299
mΜ) had no influence on the activity of the enzyme, but inhibition was observed in the 300
presence of o-phenanthroline (10 μM) – a chelator specific for ferrous iron. Addition of 0.1 301
mM FeSO4 to the o-phenanthroline treated enzyme restored the activity, implying that Sphe3 302
1-H2NA dioxygenase is iron dependent. 303
304
Cloning and heterologous expression of diox1 and diox2. The amino acid sequences 305
deduced from the 45 kDa band were further used in a BLAST search analysis of the strain 306
Sphe3 genome (20). This analysis led to the identification of two putative orfs in the Sphe3 307
genome coding for 1-H2NA dioxygenase, thereafter named as diox1 located on an indigenous 308
plasmid pASPHE301and diox2 located on the chromosome (Fig.3). 309
The predicted protein products of the two putative 1-H2NA dioxygenase genes diox1 310
and diox2 shared 93 % sequence identity to each other at the amino acid level (90 % identity 311
at the nucleotide level), and 85 % identity at the amino acid level with 1-H2NA dioxygenase 312
from Nocardioides sp. strain KP7. Multiple alignment of Diox1 and Diox2 with other ring-313
cleavage dioxygenases revealed the presence of conserved cupin domains (see Fig. S2 in the 314
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
14
supplemental materials). Fig. 4 shows the phylogenetic analysis of Diox1 and Diox2 and 315
related ring-cleavage dioxygenases. 316
Heterologous expression of Diox1 and Diox2 in E. coli BL21 resulted in intense 317
protein bands of ~ 42 kDa as determined by SDS-PAGE analysis (Fig.2), corresponding well 318
to the native subunit molecular mass of ~ 45 kDa. Purification of Diox1 and Diox2 was 319
achieved by a single-step Ni+-NTA column, using a step gradient as described in materials 320
and methods. Overexpressed protein fractions were eluted at 110 mM imidazole, pooled, 321
analysed by SDS-PAGE (Fig.2) and assayed for activity. Both recombinant Diox1 and Diox2 322
exhibited 1-H2NA dioxygenase activity estimated as 2.44 μmoles·min-1·mg-1 and 3.17 323
μmoles·min-1· mg-1 respectively. Their activity increased more than 50 % when Fe (II) and 324
ascorbic acid were added to the reaction buffer. The purified Diox1 and Diox2 lost 95% and 325
60% of their initial activity when they were stored for one week at 4 oC or -80 oC, 326
respectively. Ethanol (10 % v/v), glycerol (20 % v/v), DTT (1 mM) and Fe (II) (0.1 mM) did 327
not stabilize the enzyme during storage. 328
329
Catalytic properties of recombinant Diox1 and Diox2. The apparent Km of Diox1 and 330
Diox2 for 1-H2NA estimated at 25 oC were 35±5.7 μM and 29±5.8 μM, respectively. In 331
addition, the turnover numbers were similar exhibiting Kcat values of 385 s-1 and 358 s-1 for 332
Diox1 and Diox2, respectively, whereas Kcat/Km values were 11x106 M-1s-1 and 12x106 M-1s-1, 333
respectively. The presence of 10 μM o-phenanthroline completely inactivated both Diox1 and 334
Diox2 polypeptides, whereas the presence of Fe (II) restored activities to their initial levels. 335
Concentrations of ferrous ion exceeding 0.1 mM caused decrease in the activity of both 336
Diox1 and Diox2 homologues. 337
338
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
15
Transcription of diox1 and diox2. Using quantitative real-time (qPCR) we were able to 339
distinguish quantitative differences in the relative transcripts of the two genes encoding 1-340
H2NA dioxygenase in strain Sphe3. Expression of diox1 and diox2 genes was measured in 341
cultures of Sphe3 on M9 with glucose or phenanthrene or glucose plus phenanthrene as sole 342
carbon sources. The housekeeping gyrase β (gyrβ) was used as a reference gene. Both genes 343
were induced in cells grown on phenanthrene whereas only minimal transcription was 344
detected in cultures grown in the presence of glucose or glucose plus phenanthrene 345
Interestingly, diox2 upregulation was about twice as much as compared to diox1 (69-fold 346
versus 34-fold, respectively). 347
348
DISCUSSION 349
350
Two 1-H2NA dioxygenase homologous genes were identified in Arthrobacter 351
phenantrenivorans strain Sphe3 involved in the degradation of phenanthrene via the o-352
phthalate pathway. Strain Sphe3catabolizes phenanthrene at concentrations up to 400 mg·L-1 353
as a sole source of carbon and energy, at higher rates than those reported for any other 354
member of this genus before (21). 355
Phenanthrene degradation by two distinct routes, via either phthalate or salicylate, has 356
been well documented (16, 38). Both pathways involve the formation of 1-hydroxy-2-357
naphthoic acid, which is further metabolized via either dioxygenation and subsequent ring 358
opening to trans-2-carboxybenzalpuruvate as previously reported for Nocardioides and 359
Mycobacterium (17, 42), or de-carboxylation and hydroxylation to produce naphthalene-1,2-360
diol (35, 36). Little is known about PAH degradation within the Arthrobacter genus (38). 361
Recently, Seo et al. (40) reported that phenanthrene degradation by Arthrobacter sp. P1-1 362
occurred via a dominant phthalic acid, or a minor salicylic acid pathway (40). Our results 363
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
16
suggest that Sphe3 metabolizes 1-H2NA via dioxygenation and subsequent ring opening to 364
trans-2-carboxybenzalpyruvate. This pathway is evident by the identification of (a) detection 365
of 1-H2NA dioxygenase and 2-carboxybenzaldehyde dehydrogenase activities in 366
phenanthrene-grown cells, as well as (b) by the absence of 1-H2NA hydroxylase or salicylate 367
hydroxylase activities - enzymes involved in the decarboxylation and hydroxylation of 1-368
H2NA via the salicylate pathway. In addition, Sphe3 cells could grow on 1-H2NA, 2-369
carboxybenzaldehyde, protocatechuic acid and phthalic acid as sole C sources, whereas no 370
growth was observed on salicylic acid. Phenanthrene catabolism by strain Sphe3 via the 371
phthalate pathway is also confirmed since putative operons containing genes that encode 372
enzymes involved in the degradation of phthalic acid and protocatechuic acid have been 373
found in its total genome (20). It is likely that the enzymes involved in phenanthrene 374
degradation are expressed only in the presence of phenanthrene as no activity was detected in 375
glucose-grown cells. These results are consistent with a previous report demonstrating that 376
phenanthrene can cross the membrane of Sphe3 cells by two mechanisms: (i) a low activity 377
passive diffusion system detected also in glucose-grown cells, and (ii) a phenanthrene-378
inducible active transport dependent on proton motive force detected in phenanthrene grown 379
cells (21). 380
Our data demonstrate that Sphe3 cells, when grown in the presence of phenanthrene as a sole 381
carbon source, produce a 180 kDa 1-H2NA dioxygenase as evaluated by gel filtration 382
chromatography. The subunit molecular mass of the enzyme was determined to be 45 kDa, 383
indicating that the enzyme apparently should be a homotetramer (Fig.2), which is similar in 384
subunit molecular mass (as evaluated by SDS-PAGE) to a previously reported 1-H2NA 385
dioxygenase from Nocardioides sp. strain KP7, also degrading phenanthrene via the o-386
phthalate pathway (17). However, the Nocardioides enzyme was found to be a homohexamer 387
with a native molecular mass of 270 kDa (17). Very recently Deveryshetty and Phale (7) have 388
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
17
reported the purification of 1-H2NA dioxygenase from Pseudomonas sp. strain PPD. The 389
mass of the denatured enzyme was 39 kDa and the molecular mass of the native proteins was 390
160 kDa indicating that the enzyme was also a homotetramer. Apparently, the native enzyme 391
isolated from column chromatography is a mixture of the products of two homologous genes, 392
one plasmid and one chromosomally encoded. The catalytic properties of the polypeptides of 393
the two genes, both overexpressed in E. coli and purified, were found similar, with the 394
chromosomally encoded protein exhibiting higher substrate affinity. Moreover, no substrate 395
inhibition was found for concentrations up to 150 μM. Generally, this result is in agreement 396
with those reported for Nocardioides sp. KP7 (17), whereas, Deveryshetty and Phale (7) have 397
shown that the enzyme from strain PPD exhibited substrate inhibition at a concentration over 398
25 μM, with a Ki value 116 μM. The Sphe3 enzyme was specific for 1-H2NA since no 399
activity was determined using 3-H2NA as a substrate. Specificity of Sphe3 1-H2NA 400
dioxygenase for 1-H2NA is in agreement with what was found previously in Nocardioides 401
sp. KP7 and Pseudomonas sp. strain PPD (17, 7). The Km values of Diox1 and Diox2 were 402
twofold and threefold higher respectively, than previously reported for those of Nocardioides 403
sp. KP7 and Pseudomonas sp. strain PPD, whereas the specificity constants (Kcat/Km ) of both 404
recombinant enzymes were about twofold higher (17, 7). In addition, 1-H2NA dioxygenase 405
from strain Sphe3 required Fe (II), as previously reported for its Nocardioides sp. KP7 and 406
Pseudomonas sp. strain PPD homologues (17, 7). 1-H2NA dioxygenase seems to be a 407
member of cupin family proteins which contain a set of motifs, a metal-binding motif 408
G(X)5HXH(X)3,4E(X)6G and a second motif G(X)5PXG(X)2H(X)3N. Two histidines (HXH) 409
in the first motif and a histidine in the second motif, essential for dioxygenase activity, were 410
completely conserved in both Diox1 and Diox2 (see Fig. S2, in the supplemental materials) 411
(14). 412
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
18
diox1 (plasmid encoded) and diox2 (chromosomally encoded), although differentially 413
expressed, are both induced in the presence of phenanthrene and are both subject to carbon 414
catabolite repression. The individual dioxygenase activity of both recombinant enzymes was 415
verified, but it was found to be lower compared to its native equivalent, even after the 416
addition of Fe (II). Protein misfolding in combination with the presence of a His-tag on the 417
carboxyl-end of the recombinant enzymes could be a plausible explanation of the lower 418
activity of the individually overexpressed enzymes. Furthermore, the native enzymes are 419
partially purified and their higher specific activity may be due to co-eluting unidentified co-420
factors. The difference on the -10 promoter sequences predicted for the two genes may 421
account for the higher expression of the chromosomal homologue diox2 (see Fig. S3 in the 422
supplemental materials), but this remains to be investigated. Nevertheless, induction of PAH 423
degrading enzymes in presence of their substrate apparently is a common occurrence in 424
nature, as confirmed recently with the increase of the pool of dioxygenase genes in 425
environments spiked with phenanthrene (8). This observation, in combination with the 426
significant sequence conservation between the two 1-H2NA dioxygenase genes identified in 427
the Sphe3 genome at the nucleotide level, strongly indicates that induction along with 428
collateral existence of multi-copies of PAH degradation genes as a result of replicative 429
transposition events, facilitates the versatile adaptation of microorganisms to more efficient 430
degradation of organic pollutants. The syntenic occurrence of the 1-H2NA genes, regardless 431
of whether they are found on the chromosome or a plasmid, with a proximal trans-2´-432
carboxybenzalpyruvate hydratase-aldolase, an enzyme involved in the transformation of 433
trans-2´-carboxybenzalpyruvate (the product of 1-H2NA oxidation), and 434
transposase/integrase genes at close vicinity in both locations (Fig.3) is rather supportive of a 435
replicative transposition event. Additionally, in strain Sphe3 both diox1 and diox2 genes do 436
not cluster with all the structural genes required for phenanthrene degradation as reported for 437
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
19
aromatic degradation by gram-negative bacteria (13). Our results are similar to those 438
published for Mycobacterium vanbaalenii PYR-1, where genes involved in particular 439
degradation processes are dispersed throughout several different gene clusters (24). Anyhow, 440
occurrence of two copies of 1-H2NA dioxygenase in Sphe3 renders this strain more 441
advantageous to PAH biodegradation, and hence better adjustable to polluted environments. 442
It is well known that gene duplications provide an advantage for microbial adaptation to 443
environmental changes (11). Our present results demonstrate that A. phenanthrenivorans 444
isolated from a creosote polluted soil provides an evolutionary example that such duplications 445
facilitate survival in contaminated environments. 446
447
ACKNOWLEDGEMENTS. This work was is co-funded by the European Union - European 448
Social Fund (ESF) & National Sources, in the framework of the program “HRAKLEITOS II” 449
of the “Operational Program Education and Life Long Learning” of the Hellenic Ministry of 450
Education, Life Long Learning and religious affairs. NCK is supported by the US 451
Department of Energy's Office of Science, Biological and Environmental Research Program, 452
and by the University of California, Lawrence Berkeley National Laboratory under contract 453
No. DE-AC02-05CH11231, Lawrence Livermore National Laboratory under Contract No. 454
DE-AC52-07NA27344, and Los Alamos National Laboratory under contract No. DE-AC02-455
06NA25396. Additionally, the authors wish to thank Dr. J. Samelis of the National 456
Agricultural Research Foundation, Dairy Research Institute, Katsikas, Ioannina for providing 457
the Real-time PCR facilities and Dr. E. Papamichael, University of Ioannina, for his 458
contribution on the determination of kinetics constants. Mass spectrometry analysis 459
was performed at the Proteomics Research Unit, Biomedical Research Foundation, Academy 460
of Athens, under the supervision of Dr. G. Th. Tsangaris. 461
462
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
20
REFERENCES 463
1. Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller 464
and D. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of 465
protein database search programs. Nucl. Acids Res. 25:3389-3402. 466
2. Barnsley, E. A. 1983. Phthalate pathway of phenanthrene metabolism: Formation 467
of 2’-Carboxybenzalpyruvate. J. Bacteriol. 154:113-117. 468
3. Bradford, M. M. 1976. A rapid and sensitive method for the identification of 469
microgram quantities of protein utilizing the principle of protein-dye binding. 470
Anal. Biochem. 72:248-254. 471
4. Cerngilia, C. E. 1992. Biodegradation of polycyclic aromatic hydrocarbons. 472
Biodegradation 3:351-368. 473
5. Chung, C. T. and R. H. Miller. 1988. A rapid and convenient method for the 474
preparation and storage of competent bacterial cells. Nucl. Acids Res. 16:3580. 475
6. Corbella, M. E. and A. Puyet. 2003. Real-Time Reverse Transcription-PCR 476
analysis of expression of Halobenzoate and Salicylate catabolism-associated 477
operons in two strains of Pseudomonas aeruginosa. Appl. Environ. Microbiol. 478
69(4):2269-2275. 479
7. Deveryshetty, J. and P. S. Phale. 2009. Biodegradation of phenanthrene by 480
Pseudomonas sp. strain PPD: purification and characterization of 1-hydroxy-2-481
naphthoic acid dioxygenase. Microbiology. 155:3083-3091. 482
8. Ding, G-C., H. Heuer, S. Zuhlke, M. Spiteller, G. J. Pronk, K. Heister, I. 483
Kogel-Knabner, and K. Smalla. 2010. Soil type-dependent responses to 484
phenanthrene as revealed by determining the diversity and abundance of 485
polycyclic aromatic hydrocarbon ring-hydroxylating dioxygenase genes by using 486
a novel PCR detection system. Appl. Environ. Microbiol. 76(14):4765-4771. 487
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
21
9. Evans, W. C., H. N. Fernley, and E. Griffiths. 1965. Oxidative metabolism of 488
phenanthrene and anthracene by soil Pseudomonads. The ring fission mechanism. 489
Biochem. J. 95:819-831. 490
10. Fujisawa, H. and O. Hayaishi. 1968. Protocatechuate 3, 4- dioxygenase. 491
Crystallization and characterization. J. Biol. Chem. 43(10):2673-2681. 492
11. Gevers, D., K. Vandepoele, C. Simillon, and Y. Van de Peer. 2004. Gene 493
duplication and biased functional retention of paralogs in bacterial genomes. 494
Trends Microbiol. 12:148-154. 495
12. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. 496
J. Mol. Biol. 166:4895-4901. 497
13. Harayama, S., M. Rekik, A. Wasserfallen, and A. Bairoch. 1987. Evolutionary 498
relationships between catabolic pathways for aromatics: conservation of gene 499
order and nucleotide sequences of catechol oxidation genes of pWW0 and NAH7 500
plasmids. Mol. Gen. Genet. 210:241-247. 501
14. Hirano, S., M. Morikawa, K. Takano, T. Imanaka, and S. Kanaya. 2007. 502
Gentisate 1,2-dioxygenase from Xanthobacter polyaromaticovorans 127W. 503
Biosci. Biotechnol. Biochem. 71(1):192-199. 504
15. Huang, X. and W. Miller. 1991. A Time-efficient, Linear-Space Local Similarity 505
Algorithm Adv. Appl. Math. 12:373-381. 506
16. Iwabuchi, T. and S. Harayama. 1997. Biochemical and genetic characterization 507
of 2-Carboxybenzaldehyde dehydrogenase, an enzyme involved in phenanthrene 508
degradation by Nocardioides sp. Strain KP7. J. Bacteriol. 179:6488-6494. 509
17. Iwabuchi, T. and S. Harayama. 1998. Biochemical and molecular 510
characterization of 1-hydroxy-2-naphthoate dioxygenase from Nocardioides sp. 511
KP7. J. Biol. Chem. 273:8332-8336. 512
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
22
18. Johnson, M. R., K. Wang, J. B. Smith, M. J. Heslin, and R. B. Diasio. 2000. 513
Quantitation of Dihydropyrimidine dehydrogenase expression by Real-Time 514
Reverse Transcription Polymerase Chain Reaction. Anal. Biochem. 278:175-184. 515
19. Kallimanis, A., K. Kavakiotis, A. Perisynakis, C. Spröer, R. Pukall, C. 516
Drainas and A. I. Koukkou. 2009. Arthrobacter phenanthrenivorans sp. nov., to 517
Accommodate the Phenanthrene-Degrading Bacterium Arthrobacter sp. Strain 518
Sphe3. Int. J. Syst. Evol. Micr. 59(2): 275-279. 519
20. Kallimanis, A., K. M. LaButti, A. Lapidus, A. Clum, A. Lykidis, K. 520
Mavromatis, I. Pagani, K. Liolios, N. Ivanova, L. Goodwin, A. Pitluck, A. 521
Chen, K. Palaniappan, V. Markowitz, J. Bristow, A. D. Velentzas, A. 522
Perisynakis, C.C. Ouzounis, N. C. Kyrpides, A. I. Koukkou, and C. Drainas. 523
2011. Complete genome sequence of Arthrobacter phenanthrenivorans type strain 524
(Sphe3). Stand. Genomic Sci. 4(2):123-130. 525
21. Kallimanis, A., S. Frillingos, C. Drainas, and A. I. Koukkou. 2007. Taxonomic 526
identification, phenanthrene uptake activity, and membrane lipid alterations of the 527
PAH degrading Arthrobacter sp. strain Sphe3. Appl. Microbiol. Biotechnol. 528
76:709-17. 529
22. Kanaly, R. A., and S. Harayama. 2000. Biodegradation of High-molecular-530
weight PAHs by bacteria. J. Bacteriol. 182:2059-2067. 531
23. Kang, H., S. Y. Hwang, Y. M. Kim, E. Kim, Y. S. Kim, S. K. Kim, S. W. Kim, 532
C. E. Cerniglia, K. L. Shuttleworth, and G. J. Zylstra. 2003. Degradation of 533
phenanthrene and naphthalene by a Burkholderia species strain. Can. J. Microbiol. 534
49(2):139-144. 535
24. Kim, S.-J., Z. O. Kweon, R. C. Jones, R. D. Edmondson, and 536
C. E. Cerniglia. 2008. Genomic analysis of polycyclic 537
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
23
aromatic hydrocarbon degradation in Mycobacterium 538
vanbaalenii PYR-1. Biodegradation. 19:859–881. 539
25. Kiyohara, H., and K. Nagao. 1978. The catabolism of phenanthrene and 540
naphthalene by bacteria. J. Gen. Microbiol. 105:69-75. 541
26. Kiyohara, H., K. Nagao and R. Nomi. 1976. Degradation of phenathrene 542
through o-phthalate in an Aeromonas sp. Agr. Biol. Chem. 193:1075-1082. 543
27. Laemmli, UK. 1970. Cleavage of structural proteins during the assemply of the 544
head of bacteriophage T4. Nature. 227:680-685. 545
28. Laurie, A. D., and G. Llloyd-Jones. 1999. The phn genes of Burkholderia sp. 546
strain RP007 constitute a divergent gene cluster for polycyclic aromatic 547
hydrocarbon catabolism. J. Bacteriol. 181:531-540. 548
29. Liolios, K, K. Mavromatis, N. Tavernarakis, and N. C. Kyrpides. 2008. The 549
Genomes OnLine Database (GOLD) in 2007: status of genomic and metagenomic 550
projects and their associated metadata. Nucl. Acids Res. 36:D475-9. 551
30. Markowitz, V. M., K. Mavromatis, N. N. Ivanova, I-M. A. Chen, K. Chu and 552
N. C. Kyrpides. 2009. IMG-ER: a system for microbial genome annotation expert 553
review and curation. Bioinformatics. 25:2271-8. 554
31. Microcal Software, ORIGIN version 6. 1999. Northampton, MA 5,147 and 581. 555
32. Morissey, J. H. 1981. Silver stain for proteins in polyacrylamide gels: a modified 556
procedure with enhanced uniform sensitivity. Anal. Biochem. 117:307-310. 557
33. Noda, Y., S. Nikishawa, K. I. Shiozuka, H. Kadokura, H. Nakajima, K. Yoda, 558
Y. Katayama, N. Morohoshi, T. Haraguchi, and M. Yamasaki. 1990. 559
Molecular cloning of the protocatechuate 4, 5-dioxygenase genes of Pseudomonas 560
paucimobilis. J. Bacteriol. 172:2704-2709. 561
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
24
34. Pfaffl, M. W. 2001. A new mathematical model for relative quantitation in Real-562
Time RT-PCR. Nucl. Acids Res. 29(9):2002-2007. 563
35. Pinyakong, O., H. Habe, N. Supaka, P. Pinpanichkarn, K. Juntongjin, T. 564
Yoshida, K. Furihata, H. Nojiri, H. Yamane, and T. Omori. 2000. 565
Identification of novel metabolites in the degradation of phenanthrene by 566
Sphingomonas sp. strain P2. FEMS Microbiol. Lett. 191:115-21. 567
36. Prabhu, Y., and P. S. Phale. 2003. Biodegradation of phenanthrene by 568
Pseudomonas sp. strain PP2: novel metabolic pathway, role of biosurfactant and 569
cell surface hydrophobicity in hydrocarbon assimilation. Appl. Microbiol. 570
Biotechnol. 61:342-351. 571
37. Rohdich, F., W. Eisenreich, J. Wungisintaweekul, S. Hecht, C. A. Schuhr, 572
and A. Bacher. 2001. 2C-Methyl-D-erythritol 2,4-cyclodophosphate synthase 573
(IspF) from Plasmodium falciparum. Eur. J. Biochem. 268:3190-3197. 574
38. Samanta, S. K., A. K. Chakrabarti, and R. K. Jain. 1999. Degradation of 575
phenanthrene by different bacteria: evidence for novel transformation sequences 576
involving the formation of 1-naphthol. Appl. Microbiol. Biotechnol. 53:98-107. 577
39. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A 578
Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring 579
Harbor, NY. 580
40. Seo, J. S., Y. S. Keum, Y. Hu, S. E. Lee and Q. X. Li. 2006. Phenanthrene 581
degradation in Arthrobacter sp. Pl-1: Initial 1,2-, 3,4- and 9,10-dioxygenation, and 582
meta- and ortho-cleavages of naphthalene-1,2-diol after its formation from 583
naphthalene-1,2-dicarboxylic acid and hydroxyl naphthoic acids. Chemosphere 584
65:2388-2394. 585
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
25
41. Shuttleworth, K.L., and C. E. Cerniglia. 1995. Environmental aspects of PAH 586
biodegradation. Appl. Biochem. Biotechnol. 54:291-302. 587
42. Stingley, R.L., A. A. Khan, and C. E. Cerniglia. 2004. Molecular 588
characterization of a phenanthrene degradation pathway in Mycobacterium 589
vanbaalenii PYR-1. Biochem. Biophys. Res. Commun. 322:133-46. 590
43. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular 591
Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 592
24:1596-1599. 593
44. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTALW: 594
improving the sensitivity of progressive multiple sequence alignment through 595
sequence weighting, position specific gap penalties and weight matrix choice. 596
Nucl. Acids Res. 22:4673-4680. 597
45. User Bulletin No.2. 1997. ABI PRISM 7700 Sequence Detection System, 598
Revision A. 599
46. Van Hamme, J. D., A. Singh, and O. P. Ward. 2003. Recent advances in 600
petroleum microbiology. Microbiol. Mol. Biol. Rev. 67:503-549. 601
47. Vila, J., Z. López, J. Sabaté, C. Minguillón, A. M. Solanas, and M. Grifoll. 602
2001. Identification of a novel metabolite in the degradation of pyrene by 603
Mycobacterium sp. strain AP1: actions of the isolate on two- and three-ring 604
polycyclic aromatic hydrocarbons. Appl. Environ. Microbiol. 67(12):5497-5505. 605
48. Vretou, E., E. Katsiki, E. Psarou, K. Vougas, and G. Th. Tsangaris. 2008. 606
Identification and characterization of Inc766, an inclusion membrane protein in 607
Chlamydophila abortus-infected cells. Microb. Pathog. 45:265-272. 608
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
26
49. Yamamoto, S., M. Katagiri, H. Maeno, and O. Hayaishi. 1965. Salicylate 609
hydroxylase, a monooxygenase requiring flavin adenine dinucleotide. J. Biol. 610
Chem. 240:3408-3413. 611
50. Zukofski, M. M., D. F. Gaffney, D. Speck, M. Kauffmann, A. Findeli, A. 612
Wisecup, and J. P. Lecocq. 1983. Chromogenic identification of genetic 613
regulatory signals in Bacillus subtilis based on expression of a cloned 614
Pseudomonas gene. Proc. Natl. Acad. Sci. 80:1101-1105. 615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
27
FIGURE LEGENDS 634
Fig.1 Proposed pathways for bacterial degradation of phenanthrene. 1, 1-Hydroxy-2-635
naphthoate dioxygenase; 2, 2-carboxybenzalpyruvate hydratase/aldolase; 3, 2-636
Carboxybenzaldehyde dehydrogenase; 4, 1-Hydroxy-2-naphthoate hydroxylase; 5, Salicylic 637
hydroxylase. Single arrows indicate one-step reactions, double arrows transformations of two 638
or more steps 639
640
Fig.2 SDS-PAGE protein analysis A. Purification of native 1-H2NA dioxygenases. Protein 641
molecular mass markers in kDa (Lanes M), Cell-free extract (Lane 1), DEAE-Sepharose CL-642
6B column eluate (Lane 2), Phenyl Sepharose CL-4B column eluate (Lane 3) and Sephacryl 643
S-200 column eluate (Lane 4). B. Purification of overexpressed Diox1 (i) and Diox2 (ii) from 644
A. phenanthrenivorans. Cell-free crude extract from E. coli BL21/ pET29c::diox1 (Lane 5) 645
and E. coli BL21/ pET29c::diox2 (Lane 7), sample of the Ni+-NTA chromatography-purified 646
Diox1 (Lane 6) and Diox2 (Lane 8) proteins. 647
648
Fig.3 Graphical representation of the gene neighborhood of the diox1 (A) and diox2 (B) 649
genes in the genome of Arthrobacter phenanthrenivorans sp. nov. strain Sphe3. 650
(A): 1: diox1, 2: trans-2-carboxybenzalpyruvate hydratase-aldolase, 3: ribulose-5-phosphate-651
4-epimerase, 4: NAD-dependent aldehyde dehydrogenase, 5: hypothetical proteins, 6: DNA 652
replication protein, 7: transposases 653
(B): 1: diox2, 2: trans-2-carboxybenzalpyruvate hydratase-aldolase, 3: arabinose efflux 654
permease, 4: hypothetical proteins, 5: integrase core domain, 6: transposases and hypothetical 655
proteins, 7: transposase IS4 family 656
657
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
28
Fig.4 Phylogenetic tree of Diox1, Diox2 and other related ring-cleavage dioxygenases. 658
Bootstrap values are indicated at the corresponding nodes. Enzyme abbreviations in the 659
figure are as follows (accession numbers in parentheses):Diox1: A.phenanthrenivorans, 1-660
hydroxy-2-naphthoic acid dioxygenase (YP_004243241.1); Diox2: A. phenanthrenivorans, 1-661
hydroxy-2-naphthoic acid dioxygenase (YP_004241483.1); Noc_HNDO: Nocardia sp. KP7, 662
1-hydroxy-2-naphthoic acid dioxygenase (BAA31235.2); Myc_HNDO: Mycobacterium sp. 663
CH1, 1-hydroxy-2-naphthoic acid dioxygenase (ACN38281.1); B.hal_GDO: Bacillus 664
halodulerans C-125, gentisate 1,2-dioxygenase (NP242868.1); P.sal_SDO: 665
Pseudaminobacter salicylatoxidans, salicylate 1,2-dioxygenase (AAQ91293.1); X.pol_GDO: 666
Xanthobacter polyaromaticivorans, gentisate 1,2-dioxygenase (BAC98955.1); E.col_GDO: 667
E. coli O157:H7 strain EDL933, gentisate 1,2-dioxygenase (Q8X655); B.cen_GDO: 668
Burkholderia cenocepacia MCO-3, gentisate 1,2-dioxygenase (YP_001777018.1); 669
A.aven_GDO: Acidovorax avenae ATCC19860, gentisate 1,2-dioxygenase 670
(YP_004232675.1) 671
672
673
674
675
676
677
678
679
680
681
682
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
29
Table 1. Purification of 1-H2NA dioxygenase from A. phenanthrenivorans strain Sphe3. 683
Purification
Step
Total activity
(μmol/min)
Specific activity
(μmol/min /mg)
Yield
(%)
Purification
(fold)
Crude extract 9.7 1.0 100 1
DEAE-Sepharose 9 2.0 93 2
Phenyl-Sepharose 3.6 5.8 37 5.8
Sephacryl S-200 0.1 15.5 1 15.5
684
685
Table 2. Oligonucleotides used in this study. 686
687
688
689
690
691
Designation Oligonucleotide sequence Purpose
Diox.1F 5’- AAAGTCCGGGTGCATCGCG -3’
Cloning of
flanked genes
Diox.1R 5’- GGTCTCGTCGAGATTGATCG -3’
Diox.2F 5’- ACGATGAGCTCGACCATGCG -3’
Diox.2R 5’- CGTTCCCGGACCTTTTACG -3’
pETdiox.1F 5’- CGAAGGCAACATATGGATTCAGTC –3’
pET29c cloning pETdiox.1R 5’- GAGGATCCCATAGTTCATCC -3’
pETdiox.2F 5’- CGAAGGAGACCACATATGGATTCAGTC -3’
pETdiox.2R 5’- CGTGCGGGATCCCACAGTTCG -3’
1mRNAfor 5’-GAC GCG GGC AAC CCT TA-3’
Quantitative real-time PCR 1mRNArev 5’-TGA TCG GTG ACG AAC GA-3’
2mRNAfor 5’-TCA GCC GGG AAT GAG TT-3’
2mRNArev 5’-GTG TCA GTC TGC ATC GT-3’
gyrβfor 5’- GGC TAA CGA CAA TAC AGA TA-3’
gyrβrev 5’- ACC ACT TCA TAA ACA AGG T-3’
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Figure 1
Phenanthrene
COOH
OHOH
OH4
1-Hydroxy-2-naphthoic acid1,2-Dihydroxynaphthalene
COOH
1
Salicylic acid
2’-Carboxybenzale-pyruvic acid OH
COOH
COOH
O
COOH
2
OH
OHCOOH
CHO2-Carboxybenzaldehyde
3
5
Phthalic acid
Catechol
OH
COOH
Protocatechuic acid
TCA pathwayOH
OH
COOH
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Figure 2
116.066.2
45 0
M 1 2 3 4
116.066.2
M 5 6 M 7 8
i ii
45.035.0
25.0
18.4
45.035.0
25.0
18.414 418.4
14.4
A B
14.4
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
(A) Plasmid gene neighborhood
Figure 3
(B) Chromosome gene neighborhood
4 3 2 1 567 5
1234 5 67 1234 5 67
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Diox1
Diox2100
100
FIGURE 4
Diox2
Noc_HNDO
Myc_HNDO
B.hal_GDO
P.sal_SDO
100
97
_
X.pol_GDO
E.col_GDO
B.cen_GDO
A.aven_GDO100
96
100
0.05
on January 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from