Transcript
Page 1: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

Transcription and Translation

Page 2: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

RNA: Composition and Shape

• Composition:– Ribose (a sugar)– Phosphate group--N-base: Adenine(A),

Uracil(U), Cytosine (C), and Guanine (G)

• Shape: single-stranded

Page 3: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

RNA: Types• mRNA – messenger RNA carries info from DNA

in the nucleus to the cytoplasm.• tRNA- transfer RNA takes info from the mRNA

and binds to amino acids.• rRNA- ribosomal RNA exists where proteins are

made.

Page 4: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine
Page 5: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

• DNA codes for DNA = REPLICATION

• DNA codes for RNA = TRANSCRIPTION

• RNA codes for protein = TRANSLATION

Page 6: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

How do we know what to transcribe?• Promoter– Characteristic region of DNA that signals the start of a

gene. – A sequence of letters that signals “gene ahead!”– Start and stop codons ( 3 consecutive nucleotides that

specify a single amino acid)

Page 7: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

Transcription - Step One:RNA

Polymerase unwinds and unzips the DNA double helix.

Page 8: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

Transcription: Step Two:RNA polymerase adds on

free-floating nucleotidesA, G, C, U

What does each bind with?

Stops at STOP codonReleases RNA polymerasereleases mRNA mRNA

Page 9: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

RNA Editing

While still in the nucleus:

a. INTRONS are cut out, and

b. EXONS are spliced together

c. before the RNA sequence is sent to the cytoplasm for translation

Page 10: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine
Page 11: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

http://www.youtube.com/watch?v=ztPkv7wc3yU

• Transcription animation

Page 12: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

Translation• The mRNA leaves the nucleus cytoplasm• Message is read at the ribosome• 1 Codon (3 letter message) is translated into 1

amino acid• tRNA molecule has one end (anticodon) that

matches the mRNA . Each anticodon specifies an amino acid.

• The amino acids are bonded together as peptide chains…which fold into proteins

Page 13: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

The Genetic Code:3 letters = 1 codon 1 amino acid

Page 14: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

http://www.youtube.com/watch?v=PEDQoQuIhkg

• Animation of translation

Page 15: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine
Page 16: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

Practice with this sequence• DNA: TCGATGTTCCGCCGTACGTCGTAACCG

AGCTACAAGGCGGCATGCAGCATTGGC Use the bottom strand as the complement to the mRNA.

What’s that mean? Hint: Look for where it starts. How do you know?Once you’ve found the “reading frame”, write in tripletsmRNA Use your genetic code wheel to write the amino acid

sequence. How will you know when to stop?

Page 17: Transcription and Translation. RNARNA: Composition and Shape Composition: – Ribose (a sugar) – Phosphate group --N-base: Adenine(A), Uracil(U), Cytosine

Try again without helpDNA: CCGTCATGTTCGCGCTACAAATGAAATGA

GGCAGTACAAGCGCGATGTTTACTTTACT

mRNA:

Polypeptide:


Top Related