Download - The History of Cancer and Its Treatments
The History of Cancer and Its Treatments
Russell Doolittle, PhD
Osher Lecture 5 May 8, 2013
Recent History
(after a reminder of how DNA encodes proteins)
DNA: A Double-Helix
phosphate
Complementary nitrogen bases(A:T, G:C) directed inward
One base pair
Sugars(desoxyribose)
A:TG:C
links
During the 1950’s techniques were developed that allowedthe sequence of amino acids in a protein to be determined.
Proteins are composed of long chains of amino acids.
During the 1960’s and 70’s, numerous proteins were “sequenced”and the relationship of proteins and organisms at the molecularlevel was firmly established.
In 1978, new cutting and pasting techniques set the stage forDNA sequencing and eventually to the Human Genome project.
Current methodology allows DNA sequencing to be conducted on a massive scale.
The sequence of amino acids in a protein is simply the orderin which the amino acids occur, starting at the amino-terminus.
It is much easier to find the sequence of a protein by translating the DNA sequence of its gene than by the old chemical methods.
What all cancers have in common is DNA damage that leads to run-away cell division.
It is a kind of cellular evolution where natural selection favors those that divide most rapidly.
The DNA damage results in altered proteins, the interactions of which often promote more DNA damage.
It is much easier to disrupt a protein’s structure and function than it is to make it more active, but both kinds of alteration occur.
DNA RNA Protein
DNA is composed of 4 kinds of unit: A, G, C, T.
RNA is composed of 4 kinds of unit: A, G, C, U.
proteins are composed of 20 kinds of unit: amino acids
A triplet code (three units of DNA or RNA) is necessary to distinguish 20 amino acids.
For example, AAA (DNA) is transcribed as UUU, which is translated as the amino acid phenylalanine.
If one of the units in the DNA is mutated, e.g., AAA -> ATA,this will be transcribed as UAU, which is translated as theamino acid tyrosine.
DNA: TACTCTATGAGGAAATTTCCC…etc
RNA: AUGAGAUACUCCUUUAAAGGG…etc
Protein: Met-Arg-His-Ser-Phe-Lys-Gly…etc
Protein: MRHSFKG…etc (in single-letter code)
RNA: AUG AGA UAC UCC UUU AAA GGG…etc
ATGAGATACTCCTTTAAAGGG…etc
(taken three at a time)
Coding
Synonymous mutations
Non-synonymous mutations
base substitution gives rise to same amino acid
base substitution gives rise to different amino acid
The ratio of non- synonymous mutations to synonymous ones is an index of non-random survival.
Today the determination of DNA sequences is a highly automated process.
Most protein sequences are gotten by translating (decoding) DNA sequences.
It is possible to sequence the DNA of cancer cells taken directly from tumors to see what changes have occurred during their lifetime compared with nearby healthy tissue.
A reminder about signaling pathways.
Bumping into old pals in the subway crowd.
The cell is crowded.
Things can go awry during all these cell divisions.
Gene Expression
Although all your cells (well, almost all) have all the DNA encoding all yourgenes, different cells express different genes.
They are able to do this because the expression of genes is highly regulatedby factors that prevent or encourage copying to RNA (by the enzyme RNApolymerase) .
Regulation occurs at the gene product stage also, by activating or inactivating enzymes and other proteins.
Various forms of somatic damage to DNA
Deletions or insertions of pieces of DNA.
Simple base replacements (e.g., A for G, C for T, etc.)
Chromosomal translocations (exchanges of pieces).
Amplification (increase in “copy number”).
Speaking very generally, there are two kinds of alteredproteins in cancer cells.
In one kind, the mutated protein acquires new power: “gain-of-function.” Many of these are hyperactive kinases (often “gatekeepers”).
In the other kind, the mutated protein is inactivated. Many of these are “tumor suppressors” (“caretakers”).
Generally speaking, it is easier to make a drug thatcan inactivate a “gain-of-function” sort than it is tofind one that can restore function to a “caretaker.”
An example of a suppressor gene: p53 and cell death
More than half of all cancers involve a gene product called p53.
In 1993, Science magazine named p53 “Molecule of the Year”and had its structure on the cover.
In an accompanying editorial the hope was expressed that “a cure of a terrible killer (would occur) in the not too distant future.”
The “hope” was that damaged molecules of p53 could be fixed.
p53 is a tumor suppressor; here is how it works.
When p53 is not working properly, cells with damaged DNA keepdividing.
Moreover, the progeny of those cells with damaged DNA spawneven more cells with even more damaged DNA.
Those progeny cells with stuck accelerators quickly outrace the others.
Carriers of a mutated p53 gene (in their genome) have a 95% lifetime risk of developing cancer.
Now for the recent stuff.
A few terms:
WGS = Whole Genome Sequencing.
exome = the 1-2% of the genome that is expressed as protein.
sbs = single base substitution = snv = single nucleotide variant.
cancer susceptibility genes (caretakers and gatekeepers).
driver gene mutations, directly or indirectly, confer a selectivegrowth advantage for the cell in which they occur.
passenger gene mutations have no direct or indirect effect on thegrowth of the cell in which they occur.
CNV = copy number variation (more than one gene for the same protein as a result of gene duplication)
The March 29, 2013 issue of Science carried a special section on
Cancer Genomics
Many of the following slides are from those very recent articles.
The main theme has to do with the sequencing of cancer genomes.
Numbers of non-synonymous mutations per cell line
CLL ALL
breast
lungmelanoma
AML
colorectal
colorectal
Fig. 2 Genetic alterations and the progression of colorectal cancer.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
Fig. 3 Total alterations affecting protein-coding genes in selected tumors.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
p53 complex
PIK3CA
mutant PIK3CA
Fig. 4 Distribution of mutations in two oncogenes (PIK3CA and IDH1) and two tumor suppressor genes (RB1 and VHL).
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
B. Vogelstein et al, Science 2013;339:1546-1558
Fig. 5 Number and distribution of driver gene mutations in five tumor types.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
Fig. 6 Four types of genetic heterogeneity in tumors, illustrated by a primary tumor in the pancreas and its metastatic lesions in the liver.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
Fig. 7 Cancer cell signaling pathways and the cellular processes they regulate.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
Fig. 8 Signal transduction pathways affected by mutations in human cancer.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
Like snowflakes and fingerprints, no two cancers are exactly alike.
However, there are a limited number of very susceptible locations in the genome, and the same signaling pathways are disrupted in many different settings.
On other fronts, there have been some spectacular successes recently in treating adult leukemias (AML and CML) by modifying the patient’s own white cells that makes themattack cancer cells.
However,
The future: cancer prevention by DNA screening
It will soon be routine to have some aspect of WGSperformed at birth (think PKU screening at present)or during pregnancy.
It will also be possible to screen for certain cancersbefore they become malignant, perhaps includinglung (sequence DNA from cells in sputum), colon (DNA from stool samples), and prostate (urine)
But who will pay?
Treatment will take various guises, including theusual routes (surgery), as well as very targetedchemotherapy directed at the altered signaling pathways.
Beware the military-industrial-complex (Eisenhauer, 1961)
Today we would say:
Beware the pharmaceutical-congressional-complex.