![Page 1: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/1.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Synthetic Biology: DNA Digital Storage,Computation and the Organic Computer
Alex Widdel
University of Minnesota, Morris
1 / 27
![Page 2: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/2.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Outline
1 Overview of Synthetic Biology
2 Background: Systems Architecture and Biology
3 Memory: DNA Storage
4 Building a Biological CPU
5 Conclusions
2 / 27
![Page 3: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/3.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
What is Synthetic Biology?
Biology is viewed as technology.
One central goal: construction of a universal bio-computer.
A union of biology, computer science, and engineering.
The interdisciplinary nature and youth of synthetic biology hasled to debate over the term.
3 / 27
![Page 4: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/4.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Background: Systems Architecture
4 / 27
![Page 5: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/5.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Systems: Von Neumann Architecture
Four parts:
Memory
Input/output device (IO)
Control Unit
Arithmetic Logic Unit (ALU)
I/O Arithmetic Logic
Memory Control
I
O
5 / 27
![Page 6: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/6.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Background: Biology
6 / 27
![Page 7: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/7.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Biology: DNA and Protein Synthesis
Structure of DNA:
DNA can encode bits in a way that is compatible with the waycomputers store information. The equivalent to writing bits in abiological system is DNA synthesis, while the equivalent of readingbits is DNA sequencing.
7 / 27
![Page 8: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/8.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Biological Information Flow: Transcription and Translation
DNA
RNA
PROTEIN
Transcription
Translation
ATG GTG AGC AAG GGC GAG
AUG GUG AGC AAG GGC GAG
Met Val Ser Lys Gly Glu
TAC CAC TCG TTC CCG CTC
8 / 27
![Page 9: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/9.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Transcription
1
9 / 27
![Page 10: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/10.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
DNA Storage: Writing/Reading/Copying Data
10 / 27
![Page 11: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/11.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Writing: DNA Synthesis
Encoding Data into DNA
Low-level representation of data is in bit form.
Two encoding schemes: one bit or two bits per base.
2-bit scheme:
Binary Sequence Base
00 T
01 G
10 C
11 A
1-bit scheme:
Binary Sequence Base
1 A or T
0 G or C
11 / 27
![Page 12: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/12.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Writing: DNA Synthesis
“HELLO WORLD” converted to binary: 01001000 0110010101101100 01101100 01101111 00100000 01010111 0110111101110010 01101100 01100100Binary to DNA:GTCTGCGGGCATGCATGCAATCTTGGGAGCAAGATCGCATGCG
Empirically achieved storage density of 5.5 petabits per mm3 (108
times higher than the best disk drives), or 700 terabytes per gram.Theoretical maximum of 455 exabytes of raw data.
12 / 27
![Page 13: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/13.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Unnatural Base Pairs
Synthesized DNA strands can include nucleotides not found innature.
Two artificially-created nucleotides (d5SICSTP and dNaMTPor X and Y for short) have been incorporated into apartially-synthetic E.coli.
UBP also allow for multiple alternative encoding schemes.
13 / 27
![Page 14: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/14.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Reading Data: DNA Sequencing
Processing requires amplification of DNA.
Sequencing is done by application of fluorescent dyes.
A laser excites the dyes and a photograph is taken todetermine ATCG content.
14 / 27
![Page 15: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/15.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Copying DNA: Polymerase Chain Reaction (PCR)
1 million copies yielded after 20 cycles, 1 billion after 30.
Roughly 2 hours processing time required.
About 1 in 10,000 bases are duplicated incorrectly per cycle.
Typical desktop HDD has transfer rate up to 1030 Mbit/s.
15 / 27
![Page 16: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/16.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Building a Biological CPU
16 / 27
![Page 17: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/17.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
The Bio-Computer: Components
Each unit (in a traditional computer) is made up of many circuits,which are turned on (1) or off (0) by switches. Operations onthese logic inputs are performed by logic gates to produce a logicoutput. This makes switches and logic gates the basic atomic unitsof the ALU and control unit.
17 / 27
![Page 18: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/18.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Simple Arithmetic Logic Unit
ALU
8 8
8
S1 S2 Operation
0 0 C = A XOR B
0 1 C = A + 1
1 0 C = NOT A
1 1 C = 0
S1S2
A B
C
A 0 1 1 1 0 0 1 1B 1 1 1 0 0 1 1 0
A XOR B 1 0 0 1 0 1 0 1
18 / 27
![Page 19: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/19.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Systems: Von Neumann Bio-Computer
BioBrick are the basic unit in the three levels of syntheticbiology: parts, devices, and systems.
BioBricks can be considered as active elements generatingsignals (proteins) when stimulated by a control signal (aprotein of a certain shape).
Structurally, a BioBrick is a specialized DNA strand.
BioBricks convert inputs to outputs via transcription andtranslation.
19 / 27
![Page 20: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/20.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Execution of Logic in Biological Systems
Key component: transcriptor.
Gates based off of transcriptors are called Boolean IntegraseLogic (BIL) gates.
Single-layer architecture.
Flip with the introduction of an enzyme (specialized protein)control signal.
20 / 27
![Page 21: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/21.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Transcriptor Structure: XOR Gate
Two nested sets of recombination sites flank a transcriptionterminator T.The terminator exists in either it’s un-inverted,transcription-blocking state or an inverted,transcription-allowing state.The presence of an integrase flips the terminator.
21 / 27
![Page 22: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/22.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Gate Architecture/Control Signal Thresholds
T: Asymmetric Transcription TerminatorControl 1 (ara): arabinoseControl 2 (aTc): anhydrous tetracycline
22 / 27
![Page 23: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/23.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
XOR Gate in Transistor-Transistor Logic
23 / 27
![Page 24: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/24.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
BIL Gates
24 / 27
![Page 25: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/25.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
Concluding Thoughts
Proof of concept accomplished:
Digital DNA storage
Cell-cell Communication
Transcriptor Logic
The next great challenge is the organization of BioBricks intolarger, integrated systems. Existing BioBricks and transcriptors areslow, taking up to an hour to process input and generate anoutput. However, computing from within living systems can bevery valuable.
25 / 27
![Page 26: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/26.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
References I
G. Moe-Behrens.The Digital Microprocessor, or How to Build a Computer WithBiological Parts.Computational and Structural Biotechnology Journal, 2009.
G. M. Church, Y. Gao, S. Kosuri.Next-generation Digital Information Storage in DNA.Science, 337(6102):1628, 2012.
J. Bonnet, P. Yin, M. E. Ortiz, P. Subsoontorn, D. Endy.Amplifying Genetic Logic Gates.Science, 340(6132):599-603, 2013.
26 / 27
![Page 27: Synthetic Biology: DNA Digital Storage, Computation and ... · What is Synthetic Biology? Biology is viewed as technology. One central goal: construction of a universal bio-computer](https://reader035.vdocuments.mx/reader035/viewer/2022071211/6023ce2ddefbff57624fc517/html5/thumbnails/27.jpg)
Overview of Synthetic BiologyBackground: Systems Architecture and Biology
Memory: DNA StorageBuilding a Biological CPU
Conclusions
References II
D. A. Malyshev, K. Dhami, T. Lavergne, T. Chen, N. Dai, J.Foster, C. I. R., F. E. Romesberg.A Semi-Synthetic Organism With an Expanded GeneticAlphabet.509(7500):388, 2014.
27 / 27