![Page 1: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/1.jpg)
www.sciencemag.org/cgi/content/full/315/5808/107/DC1
Supporting Online Material for
Differential Antigen Processing by Dendritic Cell Subsets in Vivo
Diana Dudziak, Alice O. Kamphorst, Gordon F. Heidkamp, Veit Buchholz, Christine Trumpfheller, Sayuri Yamazaki, Cheolho Cheong, Kang Liu, Han-Woong Lee, Chae
Gyu Park, Ralph M. Steinman, Michel C. Nussenzweig*
*To whom correspondence should be addressed. E-mail: [email protected]
Published 5 January 2007, Science 315, 107 (2007) DOI: 10.1126/science.1136080
This PDF file includes:
Materials and Methods Figs. S1 to S11 References
![Page 2: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/2.jpg)
Dudziak et al (SOM) Supporting Online Material
Materials and Methods
Mice. Specific pathogen-free, adult (6-8 weeks) C57BL/6, CD45.1/B6.SJL (B6.SJL-
Ptprc), C3H/HeJ, B10.BR and C57BL/6 OT-II transgenic mice were purchased from
Jackson Laboratory. C57BL/6 OT-I transgenic mice were bred at the Rockefeller
University. Human DEC205 cDNA (GenBank Accession number AY682091) was
cloned into a synthetic CD11c promoter (GenBank Accession number DQ658851) (S1,
S2) The linearized construct was injected into C57BL/6 fertilized pronuclei, and
transgene positive mice were backcrossed to C57BL/6 or B10.BR. All experiments with
mice were performed in accordance with NIH guidelines and approved by the
Rockefeller University animal care and use committee.
Flow Cytometry. Antibodies were biotin-, PE- or FITC- conjugated anti CD1d (1B1),
CD3 (145-2C11), CD4 (L3T4), CD8 (53-6.7), CD11b (M1/70), CD11c (N418, HL3),
CD22 (Cy34.1), CD24 (HSA, M1/69), CD40 (3/23), CD44 (IM7), CD45.1 (A20),
CD45.2 (104), CD69 (H1.2F3), CD80 (B7.1, 16.10A1), CD86 (B7.2, GL1) Vα2 (B20.1),
MHCII (AF6-120.1), αH2-M (kindly provided by L. Denzin), mouse IgG1 (A85-1), goat
anti mouse IgG, control rat IgG2a and rat IgG2b (all from eBioscience, BD Pharmingen
or Jackson Immunotech). αDEC205 (NLDC-145), 33D1 (DC) and Aw3.18.14 (αI-Ak-
HEL, ATCC) (17), were purified and labeled with biotin, Alexa Fluor 488 or Alexa Fluor
647 (MSKCC, Rockefeller Monoclonal Antibody Core Facility). Isotype controls rat
IgG2a and rat IgG2b A488 and A647 were from Molecular Probes. Intracellular staining
was performed according to the manufacturer’s protocol (BD Pharmingen). Data was
2
![Page 3: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/3.jpg)
Dudziak et al (SOM) acquired on a FACSCaliburTM. Analysis was performed using FlowJo (Treestar) and
WinMDI.
Cloning of 33D1 and hDEC205 antibodies. RNA was prepared from 33D1 (rat IgG2b,
kappa) or αhDEC205 (mouse IgG2b, lambda, clone MG38.2 (18)) hybridoma cells,
respectively using RNeasy Midi Kit (Qiagen). For cloning the variable regions of the rat
33D1 antibody 5’RACE PCR was performed according to the manufacturer’s instructions
(Invitrogen) using the following oligonucleotides for light chain (LC) and heavy chain
(HC): 3.1 33D1-LC: 5’-GGGTGAGGATGA-3’, 3.2 33D1-HC: 5’-CTTGGTGCTGC
TG-3’. In the second amplification round the following nested primers were used: 3.3
33D1-LC 5’-CAACCTCACAGGTATAGAG-3’ and 3.3 33D1-HC 5’-GGGCTACGTTG
CAGGTGAC-3’. The variable regions were subcloned by overlapping PCR into
DEC205-OVA HC and DEC-kappa LC (S3) with 5.1 33D1-HC 5’-GCGGGGGAATTC
GCCACCATGGACATCAGGCTCAGCTTG-3’, 5.12 33D1-HC 5’-CATGGTCACAG
TCTCCTCAGCCAAAACGACA-3’, 3.27 33D1-HC 5’- ATGGGGGTGTCGTTTT
GGCTGAGGAGACTGT-3’, 3.28 33D1-HC 5’-CCCCGGGCTAGCTTTACCAGGA
GAGTGGGAG-3’and 5.1 33D1-LC 5’-GC GGGGGAATTCGCCACCATGGCCGTG
CCCACTCAG-3’, 5.2 33D1-LC 5’-CCAAGCTGGAATTGAAACGGGCTGATGCT
GCAC-3’, 3.7 33D1-LC 5’-GTGCAGCATCAGCCCGTTTCAATTCCAGCTTGG-3’,
3.8 33D1-LC 5’-CCCCGGGCGGCCGCTCAACACTCATTCC-3’.
The variable regions of the αhDEC205 antibody were produced with 5’-RACE PCR
(Invitrogen) using primers specific for 3’-ends of mouse IgG2b and Ig lambda. Specific
primers for cloning of mouse IgG2b and Ig lambda V region: 2bI GSP1-hDEC-HC 5’-
3
![Page 4: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/4.jpg)
Dudziak et al (SOM) TACTTGTGGAGCTCTGACTAG-3’, 2bI GSPII-hDEC-HC 5’-TTAATTTTTGA
GATGGTTCTCTCG-3’; Lambda 2+3 GSP1-hDEC-LC 5’-ACTCTTCTCCACAGTGT
CC-3’; Lambda 2+3 GSP2-hDEC-LC 5’-AACTGTTGTGAGATCTCCACTGGTC-3’.
To obtain full-length heavy Ig cDNA, the V region encoding for heavy chain was cloned
in frame with a signal peptide and IgG1 constant domain expressing the HEL peptide at
its C-terminus (14) using the following primers: 5’leader-SP 5’-TGCCAAGAGT
GACGTAAGTACCGC-3’, V1 heavy-hDEC-HC 5’-GCAACTGGAGTACATTCAGA
GGTCCAGCTGCAACAGTCTGGAC-3’, V2 heavy-hDEC-HC 5’-TGGGCCCTTGG
TGGTGGCTGAGGAGACTGTGAGAGTGGTGCCTTG-3’, C1 heavy-hDEC-HC 5’-
ACTCTCACAGTCTCCTCAGCCACCACCAAGGGCCCATCTGTC-3’, 3’end-hDEC-
HC 5’-CAAACCACAACTAGAATGCAG-3’. Full-length lambda Ig cDNA was
obtained by cloning the lambda V region in frame with a signal peptide (14) and mouse
Ig lambda constant domain using 5’leader-SP 5’-TGCCAAGAGTGACGTAAGTACC
GC -3’, V1 lambda Dec 5’-GCAACTGGAGTACATTCACAGGCTGTTGTGACTC
AGGAATCAG-3’, V2 lambda Dec 5’-GGGAGTGGACTTGGGCTGACCTAGGACA
GTGACCTTGGTTCC-3’C1 lambda Dec 5’-AAGGTCACTGTCCTAGGTCAGCCCAA
GTCCACTCCCACACTC-3’, 3’end lambda Dec 5’-ATAGTTTAGCGGCCGCTTA
GAGACATTCTGCAGGAGACAGAC T-3’.
Production of chimeric antibodies and targeting. Chimeric antibodies were expressed
by transient transfection as described (14). All antibodies were tested for LPS
contamination (Fisher-Cambrex) and decontaminated when necessary (Pierce). Each
batch was tested for binding to splenic DCs by FACS analysis. Mice were injected
4
![Page 5: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/5.jpg)
Dudziak et al (SOM) intraperitoneally (i.p.) or intravenously (i.v.) with antibodies with or without 50 µg IC10
agonistic αCD40 monoclonal antibody (MSKCC, Rockefeller Monoclonal Antibody
Core Facility), or 30 µg LPS (E.coli Serotype 0111:B4, Sigma).
Adoptive transfer and T cell proliferation responses. CD4+ OT-II T cells were
enriched and labeled with CFSE (Molecular Probes, 5-(6)-carboxyfluorescein diacetate
succinimidyl diester) as described (14, 16) and 1-2 x 106 OT-I or 3-4 x 106 OT-II T cells
were injected i.v. into B6.SJL mice; targeting antibodies were injected i.p. 24 hours later
with or without maturation stimuli. In the experiments to address antigen persistence
antibodies were injected 10, 7, 5, 3 or 1 day before T cell transfer. In vitro proliferation
assays with CD4+ OT-II or CD8+ OT-I T cells were performed as described (14, 16). For
subset purification, DCs from C57BL/6 or CD11c-hDEC205 transgenic mice were
negatively enriched with a mixture of CD19, DX5, CD90.2 beads (Milteny) and sorted
into CD11cHighCD8- and CD11cHighCD8+ DCs. FACS sorting resulted in 99% pure
populations. CD4+ OT-II or CD8+ OT-I T cells were as described above. In control
experiments either H-2Kb-restricted OT-I peptide (SIINFEKL, 1.0 µM) or I-Ab-restricted
OT-II peptide (LSQAVHAAHAEINEAGR, 2.0 µM) was added to the cultures. T cell
proliferation was determined by [3H]-thymidine incorporation.
Internalization Assay. DCs were purified from collagenase treated spleens by negative
enrichment with CD19, DX5 and CD90.2 microbeads (Milteny) and incubated with 3
µg/ml purified rat 33D1, αDEC205 (NLDC-145), rat IgG2a, and rat IgG2b antibodies for
30 min on ice. Cells were further incubated on ice (0 min) or at 37°C for 30 to 60 min in
5
![Page 6: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/6.jpg)
Dudziak et al (SOM) a heating block in 100 µl RPMI medium supplemented with 5% FCS, 100 U/ml
penicillin, 100 µg/ml streptomycin, 1 mM sodium pyruvate, 2 mM L-glutamine. The
reaction was terminated by fixation with paraformaldehyde before staining with mouse
anti rat Cy5 labelled secondary antibody (Jackson ImmunoResearch), CD11c PE and
CD8 FITC (BD Pharmingen).
Retroviral infection of BMDCs. DCIR2 was cloned into the vector pMX-PIE carrying
an IRES-GFP. BOSC 23 cells were cotransfected with pMX-PIE::DCIR2 and pCL-ECO
plasmids and supernatants harvested after 48 hours. BMDCs were prepared with GM-
CSF (S4) and spin-infected with supernatants containing retrovirus carrying DCIR2-
IRES-GFP mixed with 10 µg/ml polybrene and 20 mM HEPES on day 2, 3 and 4. Cells
were assayed for expression of DCIR2, DEC205 and GFP on day 6, and sorted into
CD11c+GFP+ and CD11c+GFP- BMDCs. The purified cells were incubated for 16 hours
with 0.5 µg/ml 33D1-OVA, αDEC205-OVA, Iso-OVA or PBS and further 12 hours in
the presence of 100 ng/ml LPS, then washed and cocultured with 1x105 OT-II T cells. T
cell proliferation was determined by [3H]-thymidine incorporation 48 hours later.
Immunoblots. Purified DCs (see above) were lysed in RIPA-buffer (Triton-X 100,
NP40) containing protease inhibitors (PMSF, Na-vanadate, EDTA-free protease-inhibitor
cocktail (Roche)), incubated on ice for 30 min, and debris spun out at 14,000 rpm, 4°C.
Samples (50 µg) were separated on 4-20% acrylamide Tris/Glycine/SDS gels (Fisher),
transferred to PVDF membranes (Millipore) and blotted with antibodies in TBST/3%
milk as described (S5, 21) to Cathepsin H (N-18), Gilt (T-18), TAP1 (M-18), Tapasin (D-
6
![Page 7: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/7.jpg)
Dudziak et al (SOM) 16), Cystatin C (P-14), Calnexin (H-70), Calreticulin (T-19) (all from Santa Cruz),
LAMP-1 (1D4B, BD-Pharmingen), AEP (kindly provided by Collin Watts, UK), beta-
Actin (AC15, Sigma), and incubated with secondary goat anti mouse, donkey anti sheep,
donkey anti rat or donkey anti rabbit antibodies respectively (Jackson Immunotech).
Western blots were developed using enhanced ECL (Pierce). Immunoblots were
quantified using Scion Image analysis software.
Immunofluorescence. Spleens from C57BL/6 mice were embedded in optimum cutting
temperature compound and frozen at -80°C. Frozen tissue was sectioned 20 µm in
thickness on a microtome and was fixed in acetone. All incubations were done in a
humidified chamber. Sections were blocked in 5% BSA in PBS and were sequentially
blocked with excess streptavidin and biotin (Vector Laboratories). The primary
antibodies were B220 A647 (CalTag), purified 33D1 and biotin-anti-mouse DEC205 (the
Rockefeller University Monoclonal Antibody Core Facility, New York, New York). The
33D1 signal was then amplified by incubation with FITC-anti-rat IgG followed by Alexa
488-anti-FITC (Jackson ImmunoResearch). The DEC205 signal was amplified by
sequential incubation with PE-streptavidin (BD Pharmingen), purified rabbit-anti-PE
(Acris) followed by Cy3-anti-rabbit IgG (Jackson ImmunoResearch). Sections were
mounted in Fluoromount-G (Southern Biotech) and were stored at 4°C until microscopic
examination.
Confocal microscopy. Confocal images were acquired on a Zeiss LSM 510 system with
488-, 543- and 633-nm excitation lines at the Rockefeller University Bio-Imaging
7
![Page 8: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/8.jpg)
Dudziak et al (SOM) Facility. Tiled images were obtained with the motorized stage using a 40x objective.
Microarray. CD11c cells were enriched from spleens of WT or B16 melanoma cells
secreting Flt3L injected mice (S6) by negative depletion with DX5, CD19 and CD90.2
MACS beads. Cells were stained with DEC205-bio, then with CD11c-PE, 33D1-A647
and SAPECy7, and purified by cell sorting into CD11cHigh33D1 and CD11cHighDEC205.
B cells (enriched with CD43 beads) were sorted into B220+CD19+ B cells. T cells were
enriched with Thy1.2 beads (Milteny) and FACS sorted into CD3+CD4+ or CD3+CD8+ T
cells. All cell samples were purified to more than 99% homogeneity. Total RNA was
prepared using Qiagen RNeasy Mini kit (Qiagen). DNA microarray analysis of gene
expression was performed at the gene array facility (MSKCC, New York). Fluorescent
images of hybridized microarrays (Affymetrix, MOE-430 2.0) were obtained using an
Affymetrix Genechip Scanner. Microarray data were analyzed using Affymetrix
GeneSpring 7.0 software. All samples were repeated at least three times with individually
sorted cells and averaged. The data discussed in this publication have been deposited in
NCBIs Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) and are
accessible through GEO Series accession number GSE6259.
Cloning of Lectins. Total RNA of mouse splenocytes was extracted using the RNeasy
Midi kit (Qiagen). Single-stranded cDNA was synthesized from 5 µg of total RNA by
reverse transcription using Superscript II reverse transcriptase (Invitrogen Life
Technologies) and an oligo-dT primer (Amersham Biosciences) at 42°C. cDNA was
amplified with primers designed to amplify the entire coding sequence of DCIR1 5’-
8
![Page 9: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/9.jpg)
Dudziak et al (SOM) GCGGGGGAATTCGCCACCATGGCTTCAGAAATCACTTATG-3’,5’-CCCCGG GC
GGCCGCTCATAAGTTTATTTTCTTCATCTG-3’ DCIR3 5’-GCGGGGGAATTC
GCCACCATGTTTTCAGAAAACATTTATGTTAAC-3’, CCCCGGGCGGCCGCTCA
TAAGTATATTTTTTTCACATGGC-3’, Dectin-2 5’-CCCCGGGCGGCCGCTCATAG
GTAAATCTTCTTCAT-3’, 5’-GCGGGGGAATTCGCCACCATGGTGCAGGAAA
GACAATCC-3’ DC-Sign 5’-GCGGGGGAATTCGCCACCATGAGTGATTCTAAG
GAAATG-3’, 5’-CCCCGGGCGGCCGCTCACTTGCTAGGGCAGGAAG-3’, DCAR
5’-GCGGGGGAATTCGCCACCATGGTTCAGGAAAGACAGCTACAAG-3’, 5’-
CCCCGGGCGGCCGCTCATAAGTTTATTTTCTTCATCTGAC-3’, Clec4g 5’-
GCGGGGGAATTCGCCACCATGAACACTGGTGAATACAACAAGC-3’, 5’-CCCC
GGGCGGCCGCTTAGTAGCAACTGCTCCTCTTCTCAC-3’, as well as candidate
genes DCIR2 5’-GCGGGGGAATTCGCCACCATGGCTTCAGAAATCACTTATGC
AG-3’, 5’-CCCCGGGCGGCCGCTCATAAGTATATTTTCTTCACCTGAC-3’ and
DCIR4 5’-GCGGGGGAATTCGCCACCATGGCATTACCAAACATTTATACTGAC
GTG-3’, 5’-CCCCGGGCGGCCGCTCATACATAGAGCTGCCTCATCTCACAAA
TC-3’ (Note: DCIR2 and DCIR4 were not included in MOE-430 2.0 micro array
Afffymetrix chip). PCRs were performed using PFU DNA Polymerase (Promega) as
follows: 94°C for 4 min, than 35 cycles of 94°C for 1 min, 54°C for 1 min, and 72°C for
1-3 min, followed by a final extension step at 72°C for 10 min (PerkinElmer). The
amplified fragments were cloned into the pcDNA3.1 vector and sequenced. Candidate
cDNAs were transfected into 293T cells using Lipofectamine (Invitrogen) and 2 days
later transfected cells were FACS analyzed for binding of 33D1-A647 antibody.
9
![Page 10: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/10.jpg)
Dudziak et al (SOM) Supporting Figures and Legends
Fig. S1
Fig. S1. Surface features of 33D1 expressing DCs in the spleen. (A) Dot plots show
comparison of spleen cells gated on CD11cHigh, stained with 33D1 A647 and DEC205
bio/SAPerCP (upper panel) vs. CD4 PerCP and CD8 APC (lower panel). (B) Dot plots
show expression of CD1d, CD4, CD8, CD11b, CD22, CD24, CD44, CD80, CD86 and
MHCII on 33D1 (upper row) or DEC205 (lower row) expressing cells (C) Isotype
control staining with IgG2b A647 and IgG2a bio/SAPerCP (upper panel) or IgG2a A488
and IgG2b A647 (lower panel).
10
![Page 11: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/11.jpg)
Dudziak et al (SOM) Fig. S2
11
![Page 12: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/12.jpg)
Dudziak et al (SOM)
Fig. S2. 33D1 antibody recognizes the C-type lectin DCIR2. (A) Splenocytes were
incubated with 33D1-A647 antibody in the presence of different concentrations of EDTA
for 30 min. Cells were fixed in 2% PFA and further incubated with anti CD11c-PE and
DEC205-A488. FACS analysis shows gated CD11cHigh cells. 33D1 staining was
diminished at a concentration of 0.05 mM EDTA. A representative experiment of three is
shown. (B) List of candidate genes of Affymetrix microarray showing differences
between CD8+DEC205+ and CD8-33D1+ subsets in WT and Flt3 injected mice (Fold
difference). (C) Sequence of DCIR2. Shown are the nucleotide sequence and the
corresponding amino acid sequence. DCIR2 is a type II transmembrane C-type lectin
(transmembrane domain is underlined) of 236 aa consisting of 6 exons. The molecular
weight is 27.25. The intracellular N-terminus contains an potential ITIM (ITYAEV, S7)
and an endocytosis (YAEV) motif as well as an additional Tyr at position 22. The
extracellular domain codes for a C-type lectin domain. DCIR2 belongs to the mannose
binding lectins as it includes an EPN motif. The Poly A tail of the mRNA contains rapid
RNA degradation motifs (ATTTA, underlined).
12
![Page 13: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/13.jpg)
Dudziak et al (SOM) Fig. S3
Fig. S3. Cloning the 33D1 antibody. (A) Diagrammatic representation of chimeric
antibodies. (B) A Coomassie stained 12% SDS-PAGE reducing gel comparing chimeric
33D1-OVA, and 33D1-rat antibodies with molecular weights in kDa indicated. (C) Dot
plot shows splenocytes stained with chimeric antibody 33D1-OVA and anti-mouse IgG
PE secondary, αDEC205-A647 and αCD11c-FITC after gating on CD11cHigh DCs. (B-C)
Antibody purity and binding was tested for every newly produced batch of antibody.
13
![Page 14: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/14.jpg)
Dudziak et al (SOM) Fig. S4
Fig. S4. Internalization of 33D1-OVA and DEC-OVA. Histogram shows intracellular
αDEC205 or 33D1 antibodies in CD8+DEC205+ and CD8-33D1+ DCs 30 minutes after
intravenous injection of 10 µg of αDEC205-OVA or 33D1-OVA or Iso-OVA control,
visualized with anti-mouse IgG-FITC. Arrows indicate significant staining when
compared to controls.
14
![Page 15: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/15.jpg)
Dudziak et al (SOM) Fig. S5
Fig. S5. Chimeric antibody injection does not induce DC maturation in vivo.
Histograms show expression of the indicated maturation markers by CD8+DEC205+ and
CD8-33D1+ spleen DCs 12 hours after mice received OT-II T cells (4x106) and 6 hours
after injection with 3 µg 33D1-OVA, αDEC-OVA, Iso-OVA or PBS (A) or in (B) with
additional 30 µg LPS. Data represent four independent experiments.
15
![Page 16: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/16.jpg)
Dudziak et al (SOM) Fig. S6
Fig. S6. CD8+DEC205+ and CD8-33D1+ DCs present processed MHC-I and MHC-II
peptides. Bar graphs show [3H]-thymidine incorporation by (A) OT-I or (B) OT-II T
cells cultured with CD8+DEC205+ and CD8-33D1+ DCs purified from C57BL/6 mice
injected with either 3 µg 33D1-OVA or αDEC-OVA and pulsed in vitro with the
appropriate cognate peptide at a concentration of (A) 1 µM OT-I or (B) 2 µM OT-II. The
panels are representative of two experiments.
16
![Page 17: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/17.jpg)
Dudziak et al (SOM) Fig. S7
Fig. S7. Cloning the hDEC205 antibody. (A) A Coomassie stained 4-20% SDS-PAGE
reducing gel comparing hDEC205-HEL chimeric, and hDEC205 (MG38.2) antibodies
with molecular weights in kDa indicated. (B) Histogram shows staining of hDEC205
transfected CHO and untransfected controls stained with 1 µg/ml hDEC205-HEL or Iso-
HEL antibody followed by anti-mouse IgG PE secondary antibody. (C, D) Dot plot
shows CD11cHigh splenocytes from (C) CD11c-hDEC205+ transgenic and (D) or B10.BR
WT mice stained with biotinylated αhDEC205 (MG38.2) followed by incubation with
SAPE, αCD8 APC and αCD11c FITC.
17
![Page 18: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/18.jpg)
Dudziak et al (SOM) Fig. S8
Fig. S8. Both CD8+DEC205+ and CD8-33D1+ DCs in CD11c-hDEC205+ transgenic
mice are targeted by αhDEC205-HEL in vivo. Histograms show extracellular IgG1 on
CD8+DEC205+ and CD8-33D1+ DCs 30 minutes after intravenous injection of 30 µg of
αhDEC205-HEL (black) or PBS (grey) on CD11c-hDEC205+ transgenic (left) and
CD11c-hDEC205- (right) control WT mice. Arrows indicate significant staining when
compared to controls.
18
![Page 19: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/19.jpg)
Dudziak et al (SOM) Fig. S9
Fig. S9. CD4 T cell response to antigen targeted to DCs in CD11c-hDEC205
transgenic mice in vitro. Graphs show [3H]-thymidine incorporation by 1x105 OT-II T
cells cultured with the indicated number of irradiated CD8-33D1+hDEC205+ and
CD8+DEC205+hDEC205+ DCs purified from CD11c-hDEC205 transgenic mice injected
with 10µg 33D1-OVA (top panel), αDEC-OVA (middle panel) or αhDEC-OVA (lower
panel) 12 hours earlier. Control CD11c cells were purified from Iso-OVA and PBS
injected mice. Panels are representative of experiments repeated 2 times. The experiment
shows that only CD8-33D1+hDEC205+ DCs efficiently present on MHCII when both
subsets are targeted in the hDEC205 transgenic mice.
19
![Page 20: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/20.jpg)
Dudziak et al (SOM) Fig. S10
Fig. S10. Comparative analysis of DCIR2 and DEC205 expressing BMDCs. BMDCs
were prepared and retrovirally transduced with DCIR2. (A) Histograms show 33D1 and
IgG2b (left) and αDEC205 and IgG2a (right) staining on day 6 gated on CD11c+GFP-
positive (GFP pos) and CD11c+GFP negative (GFP neg) DCs. (B) Retrovirally
transduced BMDCs were sorted into CD11c+GFP+ (DCIR2+, left) and CD11c+GFP-
(DCIR2-, right) DCs. BMDCs were incubated o/n with 1 µg/ml 33D1-OVA, αDEC-
OVA, Iso-OVA or PBS and for further 12 hours in the presence of 100 ng LPS to
stimulate DC maturation and antigen presentation (22), washed and cocultured with
1x105 OT-II T cells. Graph shows [3H]-thymidine incorporation. Data represent three
independent experiments. This experiment cannot be done with spleen or LN DCs since
they do not divide in vitro and die rapidly.
20
![Page 21: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/21.jpg)
Dudziak et al (SOM) Fig. S11
21
![Page 22: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/22.jpg)
Dudziak et al (SOM) Fig. S11. Analysis of expression pattern of MHC class I and MHC class II associated
molecules. (A) List of MHCII (upper part) and MHCI (lower part) processing pathway
associated molecules on Affymetrix microarray showing expression differences between
CD8+DEC205+ and CD8-33D1+ DC subsets in WT and Flt3L injected mice (Fold
difference). (B) Ratio of the expression of MHCII (upper part) and MHCI (lower part)
associated proteins in CD8+DEC205+ and CD8-33D1+ DC subsets of WT mice measured
by immunoblot data as analyzed by Scion Image software (Fold difference). LAMP1 was
used as a loading control and all data were corrected based on LAMP1 expression before
calculating the ratios.
22
![Page 23: Supporting Online Material for - Sciencescience.sciencemag.org/content/suppl/2007/01/02/315.5808.107.DC… · Supporting Online Material for Differential Antigen Processing by Dendritic](https://reader034.vdocuments.mx/reader034/viewer/2022042217/5ec18491c1aac86d9c3cb748/html5/thumbnails/23.jpg)
Dudziak et al (SOM) Supporting References
S1. T. Brocker, M. Riedinger, K. Karjalainen, J Exp Med 185, 541 (1997). S2. R. L. Lindquist et al., Nat Immunol 5, 1243 (2004). S3. S. Boscardin et al., J Exp Med 203, 599 (2006) S4. K. Inaba et al., J Exp Med 176, 1693 (1992). S5. D. Dudziak et al., J Virol 77, 8290 (2003). S6. J. R. Mora et al., Nature 424, 88 (2003). S7. E.E. Bates et al., J Immunol 164, 1973 (1999)
23