×
Log in
Upload File
Most Popular
Study
Business
Design
Technology
Travel
Explore all categories
Download -
Supplementary Figure 2
Download
Transcript
Page 1
Supplementary Figure 2
MDA-MB-231 MDA-MB-231 HM
Top Related
Supplementary Figure 1 - Welcome to the UCLA …€¦ · · 2016-06-151 Supplementary Figure 1 Supplementary Figure 1. ... Supplementary Figure 5 Supplementary Figure 5. ... JP10089
Supplementary Figure Legends
Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT
Supplementary figure 2. Guillemin et al. Supplementary figure 2. Expression of BCL2L10 in human oocytes analyzed by immunofluorescence. Detection of BCL2L10
Supplementary Figure 1 - Nature · Supplementary Figure 1 ... Supplementary Figure 3. Activation of HIF-1 activity by UCHL1 overexpression. ... EMT6/EF-Luc/EV-1, 2 and
media.nature.com · 1 Supplementary Materials Supplementary Table S1 Supplementary Table S2 Supplementary Table S3 Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure
Supplementary Figure 1
Supplementary Figure 3
