![Page 1: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/1.jpg)
Characterization of a Cruciferin Deficient Mutant , ssp- 1, of Arabidopsis thaliana
Jane Sung Yun Lee
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Botany University of Toronto
O Copyright by Jane Sung Yun Lee 2000
![Page 2: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/2.jpg)
National Library !*m ofCanada Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Sewices services bibliographiques
395 Wellington Strwt 395, nie Wellington Ottawa ON K1A ON4 OttawaON K I A W Canada Canada
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distriiute or sell copies of this thesis in microform, paper or electronic formats.
The author retains ownership of the copyight in this thesis. Neither the thesis nor substantid extracts fiom it may be printed or otherwise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant a la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/film, de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraite substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
![Page 3: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/3.jpg)
ABSTRACT
C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana
Master of Science 2000
Jane Sung Yun Lee
Ssp-7 is a mutant deficient in the accumulation of a major seed
storage protein, the 12s cruciferins. The mutation is caused by a G-A
transition in the CRU3 gene, resulting in a premature stop codon. Ssp-1
seeds contain 20-27% less protein than wild type seeds. To determine if the
level of expression of a transgene in this mutant background would be
greater than that found in wild type, the mutant was transformed with the
phytohernagg lutinin (PHA) gene and PHA expression was quantified . The
PHA transformants were also crossed to wild type so that each transgene
would be in the same copy number and chromosomal context. PHA levels in
seeds varied from 0.17% to 1.5% of the total seed protein. One of the
transformants gave five times the level of expression compared to its
backcross. Therefore a mutant such as ssp-1 may prove useful for
overexpression of foreign proteins.
![Page 4: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/4.jpg)
ACKNOWLEDGMENTS
I would like to express my gratitude to my supervisor, Dr. Dan Riggs
for his patience. tutelage and confidence in my scientific abilities. I also
need to thank my cornmittee members, Dr. Peter McCourt and Dr. Thomas
Berleth. for their always helpful direction and suggestions. I would also like to
express my appreciation to Dr. Clare Hasenkampf for her guidance,
encouragement and infectious enthusiasm for science. Recognition should
be given to Dr. Camille Steber for her assistance on SSLPs and transgenics,
Dr. Majid Ghassemian for doing some initial studies and the lipid analysis
and Annette Rzepczyk for technical training. To my fellow graduate students
and lab mates, Najeeb Siddiqui, Scott Douglas and Rhoda De Guzman, I am
grateful for your friendship and support and your useful input and scientific
troubleshooting. I would also like to acknowledge my parents and Raymin
Chen for their strong moral and emotional support and unwavering faith in
me, without which I could never have accomplished as much as I have.
![Page 5: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/5.jpg)
TABLE OF CONTENTS
Page ABSTRACT ................................................................................... ii
ACKNOW LEDGMENTS ................................................................... iii
TABLE OF CONTENTS ................................................................... iv
LIST OF TABLES ........................................................................... vi
LIST OF FIGURES ......................................................................... vii
INTRODUCTION ............................................................................ 1
MATERIALS AND METHODS ........................................................... 24
Seed Lots ........................................................................... - 24 ................................ Single Pot Plantings of Arabidopsis fhaliana 24
........................................................ Isolation of Seed Proteins 24 ........................................... Quantitation of Seed Protein Levels 25
.......................... Isolation and Quantitation of Seed Starch Levels 26 Germination and Growth of Arabidopsis thaliana
............................................... for Screening of F2 plants 27 ....................................... Screening of F2 lndividuals of Crosses 27
............................................................. Isolation of Plant DNA 28 Southern Blotting of F2 Individuals ............................................ -30 Probes and Hybridization ....................................................... 31 PCR for SSLP analysis ........................................................... 32 Production of DNA constructs ................................................. 34 Transformation of E.coli .......................................................... 35 Transformation of Agrobacterium .............................................. 36 Arabidopsis transformation ...................................................... 38 Selection of transformants ....................................................... 39 Immunoblotting .................................................................... -39 Screening for Homozygotes ..................................................... 41 TA cloning ........................................................................... -41 Large Scale DNA Preparation .......................... ... ................. 42
......................................... Autosequencing Preparation of DNA 44 .................. Subcloning and Analysis of the ssp- I CRU3 sequence 45
Crossing PHA homozygote to Wild Type Arabidopsis thaliana ......... 45 PHA Levels in Transgenic Plants .............................................. 46
![Page 6: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/6.jpg)
TABLE OF CONTENTS
Page RESULTS .................................................................................... -48
Preface ............................................................................... 48 Biochemical Characterization of ssp4 ....................................... 49 Screening for F2 ssp4 mutants ............................................... 55
............................... The ssp-1 mutation maps to chromosome 4 55 ................... The wild type CRU3 gene rescues the ssp-1 mutation 60
ssp4 has a premature stop codon .......................................... 60 The empty container hypothesis ............................................... 65 Strategy for testing the empty container hypothesis ...................... 66 Homozygote t ransformants ...................................................... 66 Homozygote bac kcross ........................................................... 70 PHA assay .......................................................................... -71
DISCUSSION ................................................................................ 76
SUMMARY AND CONCLUSIONS ...................................................... 90
LITERATURE CITED ...................................................................... 91
![Page 7: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/7.jpg)
TABLE
LIST OF TABLES
Page
................... Chernical Composition of Cereal. Legume and Oil Seeds 6
SSLP primers and RFLP probes used in rnapping ssp-1 .................... 30
Segregation Patterns from SSLPs and RFLPs of ssp-1 mutants .......... 59
Primers used for PCR amplification of the ssp-1 CRU3 gene ......................................................................... for sequencing 62
Summary of Results for PHA Transformants .................................... 68
Summary of Results for PHA backcross ......................................... 71
![Page 8: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/8.jpg)
vii
FIGURE
LIST OF FIGURES
Page
SDS-PAGE of seed extracts from various F2 individuais from crosses between s s p l and Col or Ler ..................................... 48
Comparison of seed protein levels from A . thaliana ecotypes ......................... col and ler with a seed storage protein mutant ssp-1 52
Comparison of seed starch levels from A . thaliana ecotypes ......................... col and ler with a seed storage protein mutant ssp-1 53
Previous lipid analysis of col and s s p l seeds showing the fatty ........................... acid composition of the lipid fraction from the seed 54
............................ SSLP analysis using primers nga 8 and nga 11 39 57
The ssp-1 mutation is linked to chromosome 4 ................................. 58
SDS-PAGE of seed extracts from ssp-1 plants transformed with a construct containing the wild type CRU3 gene ................................. 60
Sequencing strategy for the cru3 gene in s s p l ................................ 63
Wild type nucleotide sequence of CRU3 with 1 kb of upstream Prornoter ................................................................................. -64
10.Arabidopsis seeds do not contain any endogenous PHA .................... 65
. 11 Determination of copy number for transformants ............................... 69
. ......................... 12 PHA copy number in the backcross F3 homozygotes 72
13 . Analysis of PHA expression in primary transformants and their backcrosses ................................................................. 74
14 . Quanütation of PHA levels in primary transfonnants and their backcrosses ................................................................. 75
![Page 9: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/9.jpg)
Introduction i
Introduction
Unlike humans and animals which do not have a haploid multicellular
stage, plants undergo a phenomena called alternation of generations in their
life cycle where haploid and diploid multicellular stages reproduce each other
(Raven et al., 1981). In the general life cycle of plants, specialized cells of
the diploid multicelluar organism or sporophyte divide meiotically to produce
haploid spores. Mitotic divisions of these spores result in a haploid
multicellular organism called the gametophyte, which forms gametes by
mitosis. The fusion of male and female gametes in fertilization produces the
diploid zygote that will develop into an embryo that will complete the cycle by
giving rise to a sporophyte. The plant body that is observed in nature
represents the sporophyte phase of the life cycle for vascular plants (e.g. lily)
and the gametophyte phase of non-vascular plants (e.g. moss).
In angiosperms, the sporophyte will produce flowers complete with
anthers and an ovary where spores will form and eventually give rise to
gametes. In the anthers, pollen mother cells develop and divide meiotically
to give rise to haploid microspores (Esau. 1977). The haploid microspores
divide by mitosis to form pollen grains containing two sperm cells. Within the
ovule, one megaspore mother cell develops and divides meiotically to give
rise to four megaspores of which only one survives to become the embryo
sac containing an egg (Esau. 1977). Fertilization or fusion of the gametes
![Page 10: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/10.jpg)
l ntroduction i
results in a diploid zygote which develops into the embryo, encased in a seed
coat.
Pollination occurs when the pollen attaches to the stigma, stimulating
pollen tube germination. The pollen tube enters the embryo sac through the
micropyle and the two sperm cells from the pollen are carried into the ovule.
In the embryo sac, one sperm cell fuses with the egg, forming the zygote,
and the other sperm cell fuses with two polar nuclei. forming the primary
triploid endosperm nucleus. This is termed double fertilization and is unique
to flowering plants. The zygote divides in an organized pattern resulting in a
highly polarized cell with a distal or chalazal (shoot) end and a proximal or
micropylar (root) end. At this point the endosperm starts to divide before the
embryo undergoes any further cell division (West and Harada, 1993). In this
proembryo phase, the first division is asymmetric in the transverse plane
forming an apical or terminal cell which will develop into the embryo proper
(Esau. 1977). The basal cell contributes rnostly to the suspensor that
anchors the embryo to the embryo sac and pushes it into the endosperm.
The suspensor cells divide by transverse divisions and longitudinal divisions
in the embryo proper create a four-celled or quadrant embryo not much
bigger than the suspensor (Raven et al., 1981). The embryo grows and
expands beyond the suspensor and enters the octant stage, as transverse
divisions create an eight celled embryo. Periclinal divisions result in an outer
layer of cells. the protoderm, that represents the onset of the formation of the
![Page 11: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/11.jpg)
Introduction 3
dermal system (Esau, 1977). As the embryo expands by longitudinal
divisions in this early globular stage, the protoderm accommodates the
increase by repeatedly dividing anticlinally. allowing it to remain a single layer
of cells. The onset of cell division in relation to the initiation of the formation
and enlargement of the cotyledons, causes the top of the embryo proper to
flatten. The cells divide longitudinally to form the procambium and the cells
next to these divide transversely to form the ground meristem which become
visible after the globular stage. The growth of the cotyledons result in a heart
shaped embryo in dicots and a cylindrical embryo in monocots (Raven et al..
1981). The upper cell of the suspensor becomes the hypophysis cell whose
subsequent derivatives form a portion of the root apical meristem. The shoot
apical meristem forms between the cotyledons and the endosperm also
starts to form around the embryo. The basal cell of the suspensor also has a
role in nutrient uptake as its filliform apparatus (infolding of the membrane)
increases the surfacr area for nutrient absorption. More transverse divisions
followed by cell enlargement help to f o n the torpedo stage of the embryo
that can then develop into a mature embryo with hypocotyl, epicotyl and
radicle. The expansion of the embryo slowly crushes the suspensor and the
suspensor begins to degenerate. The mature ovule becomes the seed coat
to provide protection to the embryo. Therefore the seed houses part of the
development of the sporophyte (as the ernbryo) and is essential for the
germination of the next generation of plants.
![Page 12: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/12.jpg)
Introduction 4
Plant seeds contain high levels of reserves that provide a source of
energy, carbon and reduced nitrogen for germination of seeds and seedling
growth. The storage of nutrient reserves is one of the primary functions of the
seed. Depending on the species, the seed contains varying amounts of
carbohydrates, lipids and proteins (refer to Table 1 ). The amount of protein in
the seed accounts for 8-15% of the dry weight in cereals and 20-40% of the
dry weight in legumes and oil rape seeds (Shewry et al.. 1995). Seed
development in most plants can be divided into 2 phases: an initial phase of
active cell division and morphogenesis, followed by a preparatory phase for
seed dormancy and germination characterized by the accumulation of seed
storage proteins and other reserves (Meinke, 1994). Seeds remain white until
the late globular stage of embryogenesis when the seed coat and embryo
begin to appear pale green. Beyond the torpedo stage the embryo is
completely green and the seed coat is translucent. Pigments are made
through various biosynthetic pathways to give the seed coat its final color.
The mature seed dehydrates to approximately 5-15% water by weight and
the seed remains quiescent until conditions are favorable for germination.
Plant hormones such as abscisic acid and gibberellins have an important role
in seed dormancy.
The seed develops from the ovule as a consequence of double fertilization
and growth of the ovule is followed by growth of the endosperm before the
embryo enlarges. The endosperm is the primary site for nutrient storage in
![Page 13: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/13.jpg)
Introduction 5
seeds and can persist after embryo maturation as seen in monocots so the
seedling can use it after germination. Altematively, the endosperm may be
absorbed, as in dicots, where the food is restocked into the cotyledons
before the seed completes development (Lopes and Larkins, 1993). Starch
is the main source of carbon, while the seed is still green, and exists as two
a-glucan polymers, the linear amylose and the more highly branched
amylopectin. These polymers of glucose are synthesized and packed in
plastids called amyloplasts. In the cytoplasm, sucrose is cleaved by
sucrose synthase to form UDP-glucose and fructose. UDP phosphorylase
and enzymes from the glycolytic pathway convert these sugars to glucose-1-
phosphate, which is then used to produce ADP-glucose by the enzyme,
AD?-glucose phosphorylase, using ATP. ADP-glucose is then transported
into the amyloplasts (Martin and Smith, 1995). 60th amylose and
amylopectin chains are made similariy as many different forms of starch
synthase create a-1, 4 linkages between a between glucose and a growing
glucan chain, releasing AD P. Different isoforms of starch branching
enzymes (SBEs) then break some of the original linkages to produce
branches having a-1, 6 linkages. SBEs favor longer lengths of glucan chains
that develop into the highly branched amylopectin (Lopes and Larkins, 1 993).
These starch molecules exist as starch grains that anse as single or multiple
granules in amyloplasts. The proportions of the two forms of starch are
dependent on the activity of starch synthase and starch branching enzymes
![Page 14: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/14.jpg)
Introduction 6
Table 1. Chernical Composition of Cereal, Legume and Oil Seeds
Seed Type Protein Carbohydrate Li pid Ash
CEREALS
Bariey
Maize
Oats
Rice
Sorghum
W heat
LEGUMES
Soybean
French bean
Broad bean
Pea
OIL
Cotton 19 19
Sunflower 25 40
Flax 22 40
Canola 25 5 43 7 - - - - - - - - --
reproduced from Habben and Larkins, 1995, additional numbers from Kiegel and Galili, 1995
![Page 15: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/15.jpg)
lnt roduction 7
(Martin and Smith, 1995).Starch synthesis occurs in the endosperm, and
during germination starch grains are hydrolyzed and their contents are
broken down by a-amylase and maltase.
Lipids, mostly in the forrn of triacylglycerols (TAGs), are densely
stored in oil bodies in the seed and can be another source of carbon. Free
fatty acids rarely exist in the plant cell as they are usually esterified to
glycerol (Ohlorogge and Browse, 1995). The synthesis of the fatty acid
backbones occurs in undifferentiated plastids in the seed by a group of
enzymes collectively called fatty acid synthase. Two chains, each composed
of 2 to 18 carbon units, are linked to an acyl carrier protein (ACP). The fatty
acids are cleaved from ACP and exported into the cytoplasm where they are
then linked to CO-enzyme A (Battey et al., 1989). In the endoplasmic
reticulum (ER), the fatty acids are transferred to glycerol-3-phosphate,
producing a phosphatidic acid. The phosphate is removed, leaving a
diacylglycerol, and another fatty acid is added in a reaction catalyzed by
diacylglycerol acyltransferase (Ohl rogge and Browse, 1 995). These lipids
are then packaged into oil bodies which are hydrolyzed by lipases to glycerol
and fatty acids at the time of germination.
Seed storage proteins are copiously synthesized and are sinks for
nitrogen. They accumulate almost exclusively during the cell expansion
phase in the embryonic cotyledons and/or the endosperm. Since most seed
storage proteins contain sulphur, low levels of available sulphur can limit their
![Page 16: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/16.jpg)
Introduction Y
synthesis. Most plants contain groups of storage proteins that are both high
and low in sulphur, providing flexibility in dealing with sulphur levels. This is
just an example of the high polymorphism exhibited by seed storage protein
genes. This high level of polymorphism is produced by two main methods-
posttranslational processing and the existence of multigene families (Shewry
et al., 1995). Seed storage protein fractions are usually made of a mixture of
polypeptides that can be split into different groups based on relatedness and
chemical properties. There are four classifications of seed storage proteins
that are based on solubility or extraction methods: These are the albumins
(water), globulins (dilute saline), prolamins (alcohol/water mixture) and the
glutelins (alkalifdilute acid). Their genes are developmentally regulated and
these proteins are produced on ribosomes attached to the ER. An N-
terminal signal peptide directs the translocation of the proteins into the lumen
of the ER (Casey et al., 1997). They are then folded into their proper
conformation by chaperone proteins, shipped to the Golgi apparatus and into
a vesicle. The vesicle then fuses with the vacuolar membrane. which
pinches off to form a vacuole containing the seed storage proteins. The
vacuole then fragments producing the protein bodies that exist in mature
seeds until germination. Hydrolytic enzymes, such as proteinases and
peptidases, are targeted to the protein bodies and are produced at this time
so that the emerging seedling can metabolize the resewes for carbon and
nitrogen sources until it can become photosynthetically competent.
![Page 17: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/17.jpg)
Introduction 9
Currently the most harvested plant organs by man, seeds are the
major source of protein for most of the world. For example, about 70% of al1
food for human consurnption cornes from seeds (Kiegel and Galili. 1995). As
a part of these reserves, seed storage proteins have been utilized as a
primary source of nutrition for humans and livestock and have a crucial role
in supplying essential amino acids (Yamauchi and Minamikawa, 1998).
Although proteins usually have metabolic or structural roles, there are one or
more groups of seed storage proteins whose sole function is to provide the
seed or seedling with a store of amino acids during germination or
embryogenesis (Shewry et al., 1995). Seeds are also harvested as the raw
materials for food processing and other industries. For example, soybean
protein is used in infant formula (Kriz and Larkins, 1991) and the malting of
barley is used in the production of alcoholic beverages (Shewry et al., 1994).
The advent of genetic engineering and advances in gene manipulation
methods create the potential for great advances in the biological sciences
with many practical applications. The use of these techniques is of particular
interest to many industries, including agriculture, as improvement of
agronomic crops provides a means to increase their value by altering the
composition of plant or seed products. Additionally , novel and desirable
traits can be introduced to increase the yield andlor quality of commercial
products. These alterations also may provide resistance to pathogens,
insects, herbicides, desiccation or other environmental stresses such as high
![Page 18: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/18.jpg)
Introduction 10
salt concentrations or cold temperatures. For example, seed oils are used
for vegetable oils, cosmetics, surfactants and lubricants but the number of
applications frorn a certain crop is restricted due to limited variability of fatty
acids (Ivy et al., 1998). There have been attempts to rnodify the fatty acid
composition of transgenic plants in order to increase the number of
applications of seed oils that are economically favorable. The composition of
lipids in some oil rape seeds have been modified such that the levels of
desired oils were increased thereby improving taste ( K r k and Larkins, 1991).
Crops are often attacked by insects and other pests that may
irrevocably damage months or even years of work. The spraying of
insecticides may negatively affect even more plants directly or indirectly (e.g.
contamination of soi1 or water table). If plants could be given the ability to
ward off these attacks then the farmer could inexpensively Save their crops.
Cotton crops have been modified to provide resistance to certain insects by
transfer of the gene encoding a toxin from Bacilius thuringiensis (Bt) (Perlak
et al., 1990). Field tests have been performed and confirm that plants
expressing the Bt gene were capable of effectively controlling the infestation
of tobacco budworm, pink bollworm and cotton bollworrn (Wilson et al., 1992,
Benedict et al., 1996, Halcomb et al., 1996) without significant loss in
agronomic performance and yield (Jenkins et al., 1997). Bt cotton made up
approximately 13% of the total US cotton crop in 1996 and the Bt gene has
![Page 19: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/19.jpg)
Introduction I I
also been introduced into corn, canola and potato (Lynch et al, 1999. Moran
et al., 1998, Ramachandran et al., 1998).
Weeds also pose a similar problem as their growth depletes the
available nutrients, water and space for the desired crop. Application of
herbicides may have similar affects on crop plants as insecticides.
Therefore, herbicide resistant plants have also been generated by the
introduction of genes that encode bacterial enzymes that inactivate the
herbicides (Stalker et al., 1988). For example, sugar cane is a monocot that
can be stably transformed and is a valuable crop grown mainly in the tropics
and subtropics. The bar gene encodes an enzyme called phosphinothricin
acetyltransferase (PAT) that can give plants the ability to detoxify
phosphinothricin (PPT) and its derivatives, which are active ingredients in
herbicides (Hartman et al., 1994). Sugarcane has successfully been
transformed with the bar gene and was found to be resistant to a herbicide
called lgnite (Gallo-Meagher and Irvine, 1996). Herbicide evaluations were
performed under greenhouse and small plot conditions and individuals with a
high and intermediate levels of resistance were found (Enriquez-Obregon et
al., 1998). However, field tests have not been performed and agronornic and
sugar quality characteristics have not been studied.
Rice (Oryza sativa L.) has also been genetically engineered to be sait
and cold tolerant by introduction of the choline oxidase codA gene from the
soi1 bacteria Arthrobacter globformis (Sakamoto et al., 1998). This enzyme
![Page 20: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/20.jpg)
lnt roduction 13
is responsible for the synthesis of çlycinebetaine, a quarternary ammonium
compound. Glycinebetaine acts as a compatible solute that ailows cells to
adjust their osmotic potential. It is also known to protect proteins from salt
induced dissociation of subunits, which is important in plants as it can protect
photosystem II under conditions of salt stress (0.15m NaCI) and at low
temperatures (Sakamoto et al.. 1 998).
The quality of a crop can also be improved by identifying the
molecular basis of traits and using biotechnology to improve them. The
breadmaking quality of milled flour from wheat has been a popular trait to
modify because of its commercial value. The breadrnaking quality is
dependent on the combination of elasticity and extensibility of the dough that
enables the entrapment of carbon dioxide for fermentation and is largely
determined by the arnount and properties of gliadins and glutenins (Shewry
et al., 1994). It has been shown that high molecular weight (HMW) glutenins
are important for breadmaking quality. Increasing the total amount of HMW
subunits or increasing cysteine residues to increase crosslinking between
polymers has been shown to improve this trait (Shewry et al., 1994). A novel
hybrid subunit (a fusion of two native HMW glutenin subunit genes) under the
controi of a native prornoter was used to transform wheat (Bechl and
Anderson, 1996). The recombinant protein accumulated to native levels and
increasing the number of transgene copies seerned to increase the amount
![Page 21: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/21.jpg)
Introduction 13
of HMW glutenins produced, which enhanced the strength of the bread
dough (Bechl and Anderson. 1996).
Plants provide an economic alternative for the large-scale production
of recombinant proteins and altered lipids for industrial and pharmaceutical
uses. Proteins produced in Ecoli are not glycosylated nor processed, and
many recombinant proteins can be degraded by proteases or may prove to
be toxic to the bacteria. Eukaryotic systems such as yeast and insect and
mammalian cell cultures can carry out glycosylation and processing
accurately, but only transgenic animals are capable of performing correct
post-translational modifications such as complex glycosylation (Kusnadi et
al., 1997). However, in the latter case, feeding and sheltering the animals
will be an expense. For plants, the cost of biomass production is low and it is
easy to scale up production simply by increasing acreage (Kusnadi et al.,
1 997). Plants also have the ability to compartmentalize recombinant proteins
in organelles or other available storage organs. There are established
practices for efficient harvesting, transportation, sorting and processing of
plants that offer an edge over other systems (Kusnadi et al ., 1 997). Also, the
purification of recombinant protein from plant tissue can be eiiminated by
direct delivery of the protein if the organ harboring the protein is used as feed
or food.
A major goal of agricultural biotechnology is to provide a basis for
improving nutritional quality of traditional crops. Potentially, seeds could ~e
![Page 22: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/22.jpg)
Introduction 1 1
used to house the overproduction of foreign proteins of economic value.
These seeds can be easily hawested and their contents extracted by
established and efficient processes. The composition of these proteins is an
important agronornic trait that potentially could be modified using
biotechnology. Plant breeding to increase the nutritional value of crops has
not been very successful for any given species due to the lack of genes
encoding seed storage proteins with high levels of essential amino acids. It
is now possible to produce transgenic plants in a variety of species by
various methods such as electroporation or Agrobacterium-rnediated
transformation. Therefore, many attempts have been made to alter traits or
increase the nutritional value of crops using transgenic plants. One direct
method is the modification of the coding region of existing seed storage
proteins. Unfortunately, this created another problern related to the three
dimensional structure of the protein (Kusnadi et al., 1997). Seed storage
proteins assume specific conformations and modifications may affect the
structure and proper deposition of these proteins within the seed. In vitro
mutagenesis has been used to increase the methionine content of phaseolin
(a protein naturally occuring in the bean) and the gene was then inserted
into tobacco. Although the gene was transcribed, the quantity of the modified
protein was much less than normal phaseolin in tobacco and was quickly
degraded during transport to protein bodies (Hoffman et al., 1988). Genes
encoding zeins have also been modified to increase the lysine content in
![Page 23: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/23.jpg)
Introduction 15
transgenic tobacco. Using the phaseolin promoter, modified a-zein was
synthesized in transgenic tobacco but after one hour was degraded due to
protein instability (Ohtani et al., 1991). There have also been examples of
increasing the amount of free amino acids in plants. Aspartate kinase (AK) is
an enzyme in the biosynthetic pathway of the aspartate family and a few AU
isoforms are inhibited by threonine or lysine as a form of feedback inhibition.
lntroduction of the E.coliAK gene encoding a desensitized enzyme was used
to transform tobacco, as these mutants in bariey, maize and carrot
expressing desensitized isozymes, were shown to overproduce free
threonine (Shaul and Galili. 1992). The transfonants were not affected by
threonine or lysine (10 PM) (enough to inhibit endogenous AK activity) and
an increase in free threonine was correlated to an increase AK activity (Shaul
and Galili, 1992). This increase of free threonine in the leaves elevates the
nutritional quality at the plant level but using tissue specific promoters, it may
be possible to target these desensitized enzymes to the seed.
An alternative approach to improving nutritional quality has been to
transfer a gene for a protein rich in an essential amino acid into the crop of
interest. For example, the maize 15 kD zein contains the highest number of
methionines of al1 the zeins (Hoffman et al., 1987). The gene for this protein
was attached to phaseolin flanking regions and used to transforrn tobacco,
where the protein was correctly processed and accumulated in the ernbryo
and endosperm (Hoffman et al., 1987).
![Page 24: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/24.jpg)
Introduction 16
Barley has limiting levels of lysine but the Hiproly strain was found to
have increased levels of chymotrypsin inhibitors (CI) that are high in lysine
(Shewry et al., 1994). Transgenic tobacco plants containing chimeric CI-
21gus genes displayed tissue specific expression. Under a stronger
endosperm-specific promoter, such as the HMW glutenin subunit gene
promoter, expression of CI-2 (1 1.59 % Lys) may have an impact on lysine
content of a transgenic cereal grain (Shewry et al., 1994). Legumin is a pea
seed storage protein that is rich in lysine was expressed in transgenic rice
under the control of the rice glutenin promoter (Sindhu et al., 1997). It was
demonstrated that the protein was properiy processed and was found in the
endosperm of rice (up to 4.24% of the total protein) thereby increasing its
lysine content and its nutritional value (Sindhu et al., 1997). The most
common example is the 2s albumin of Brazil nut which has been analyzed
and found to contain 20% methionine residues. This protein is synthesized
as a single precursor then proteolytically cleaved to form 9 kDa and 3 kDa
polypeptide chains which are then linked by two disulphide bonds. The Brazii
nut 2s albumin has been widely exploited in biotechnology to increase the
methionine content of many species of plants. In tobacco, the cDNA of the
intermediate for the 25 albumin subunits was attached to the phaseolin
promoter (Altenbach et al., 1989). There was an increase of methionine
content of the seed extract but the recombinant protein only accounted for a
srnall fraction of the total extractable protein in the seed. Also, a chimeric
![Page 25: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/25.jpg)
Introduction 17
gene consisting of the coding and the 5' flanking regions of Arabidopsis 2s
albumin gene and the Brazil nut 2s albumin gene was constructed and used
to transform tobacco, Arabidopsis thaliana and Brassica napus. However, in
these plants, the level of expression was too low to quantify accurately (De
Clerq et al., 1990). Canola was also transformed with a chimeric gene
composed of regulatory regions from the phaseolin gene fused to a
sequence encoding a 17 kDa precursor of the Brazil nut 2s albumin and
expressed at low levels. The gene product only accounted for a srnall
portion of up to 4% of the total protein content but due to the high methionine
content (18.8%) of the Brazil nut 2s albumin. the total methionine content
was raised to 33% (Altenbach et al., 1992). However, the Brazii nut 2s
albumin was found to be an allergen (Nordlee et al., 1996) and may not be a
feasible protein to enhance nutrition for crops intended for human
consumption. A 10 kDa sunflower seed albumin was found to contain 16%
methionine residues and was found not to be an allergen (Korrt et al ., 1 991 ).
The cDNA of the sunflower precursor was attached to the pea vicilin gene
promoter and introduced into lupins (Molvig et al., 1997). This doubled the
original methionine levels of the seed extract from 0.199% to 0.386% (by
weight) but again only accounted for a small percentage of the total protein
(Molvig et al., 1997).
Therefore in al1 of these examples, although the inserted genes were
expressed, the level cf expression was restricted. It has been theorized that
![Page 26: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/26.jpg)
Introduction 18
the limited success of such experiments may be due to high expression
levels of endogenous protein targeted to the seed and a bias towards the
accumulation of natural reserves. If the seed could be partially emptied of
some of these proteins then a void would be made which could be filled by
foreign or genetically engineered proteins. This has become known as the
'empty container' hypothesis.
The composition of seeds has already been discussed but alterations
in the level of one component can affect the other components. Often there
is compensation within the seed, with one class of macrornolecules
experiencing an increase in its level in order to offset the decrease in another
class. For example. it is known that the r mutation giving n'se to the wrinkleQ
phenotype in peas results in decreased legumin seed storage protein and an
increase in lipids (Giroux et al., 1994). There is also a mutant in Arabidopsis,
shrunken seed 1 (ssel), that is defective in the biogenesis of protein and oil
bodies (Lin et al., 1999). Unlike wild type seeds, starch is favored over
proteins and lipids in ssellssel seeds. It has been shown that SSEI is not a
direct inhibitor of starch synthesis, implying that protein and oil body
proliferation is associated with a decline in starch accumulation and that
starch formation is a default storage deposition pathway (Lin et al.. 1999).
Also, in soybean there is an inverse relationship between seed storage
protein concentration and oil or seed yield (Escalante and Wilcox, 1993 and
references within). It is obvious that there must be some form of regulation of
![Page 27: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/27.jpg)
Introduction 19
the levels of the macromolecular seed contents. Perhaps this regulation
occurs at multiple levels and involves one or more sensors for seed filling.
Maybe there is a total level of both proteins and lipids programrned into the
sensors, such that protein and lipid levels are adjusted to fiIl the seed for this
predetermined amount of space and starch accumulation is repressed. If
protein and lipid levels cannot be modified to accommodate any changes in
the seed, the default pathway, starch production, takes over to make up the
difference but has a maximum production capacity. This might explain the
shrunken phenotype of ssel, as there was not enough starch production to
compensate for the complete absence of protein bodies and the dramatic
decrease in oil bodies (Lin et al., 1999).
However. decreasing the level of a specific seed storage component
may not necessarily affect other components. When B. napus was
transformed with an antisense gene for CruA (encoding a cruciferin), the total
protein and lipid levels did not differ significantly but an increase in napins
(2s albumins) was observed (Kohno-Murase et al.. 1995). Similady, when B.
napus was transformed with an antisense gene for NapA (encoding a napin),
an increase in cruciferins was observed, with no change in total protein or
lipid levels (Kohno-Murase et al., 1994). However, these authors did find that
the fatty acid composition of the lipids had changed. So it appears the plant
can control the levels of seed macromolecules, as well as the composition of
the macromolecules. So there must be regulation of proteins and lipids within
![Page 28: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/28.jpg)
Introduction 20
their own biosynthetic pathways that determines their composition. Such a
sensor might control the composition of the proteins and lipids individually.
When one of the seed components changes in composition, the composition
of the other could be rnodified accordingly perhaps due to an interaction
between certain intermediates of the two biosynthetic pathways. If there is a
decrease in total seed storage proteins (al1 classes). this might result in an
increase in total lipids (al1 fatty acids) or vice versa. However, if only one
component of seed storage protein decreases, another seed storage protein
can compensate and lipid levels may remain the same, but the fatty acid
composition of the lipids may change. So if a mutation somehow affected or
bypassed this sensor, than it would be possible to generate a seed with
lower amounts of protein without changing the total lipid content. Starch
content would also remain the same since the sensor would not initiate the
change in protein level and hence would not result in the upregulation of
starch production. This would result in the production of a partially empty
container.
The crucifer Arabidopsis thaliana is considered to be a model plant
system in plant biology. Its small genome size, low abundance of repetitive
sequences, well defined RFLP maps, rapid generation tirne and the
extensive knowledge of its genetics make it a useful tool for plant molecular
genetic analysis. Also, the ease of mutagenesis and transformation make it a
useful system for testing the empty container hypothesis. There are two
![Page 29: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/29.jpg)
Introduction 2 I
classes of seed storage proteins in A. thaliana: the 12s globulins called
cruciferins and the 1-7s albumins also referred to as napins. One of the
major seed proteins in A.thaliana is a family of 125 cruciferins. Cruciferins
are hexameric complexes composed of 6 subunit pairs- one acidic (a) and
basic (B) chain linked by disulphide bonds (Pang et al., 1988). Each pair of
cdp subunits are proteolytically cleaved from the same precursor protein after
disulphide bond formation (Higgins, 1984). Three different precursors exist,
coded for by three different genes: CRA. CR8 and CRC (Pang et al., 1988).
To conform to the community standards for naming genes (Meinke and
Koornneef, 1997), and because the symbol CRC is taken by the crab's claw
mutation, CRA, CRB and CRC will hereafter be termed CRUI, CRU2 and
CRU3.
To determine the validity of the 'empty container' hypothesis, mutants
that are defective in the accumulation of seed storage proteins must first be
identified. In Arabidopsis, several mutants have been identified that cause
similar defects in ernbryogenesis. Two mutations, abi3 (abscisic acid
insensitive) and fus3 (anthocyanin biosynthesis) are defective in the
accumulation of the two major seed storage proteins, the 12s cruciferins and
the 2s napins at both the protein and mRNA levels (Nambara et al., 1995,
Baumlein et a1.,1994). This suggests that AB13 and FUS3 gene products
control seed storage protein expression. However, both mutations cause
pleiotropic effects that show they may regulate the expression of many
![Page 30: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/30.jpg)
Introduction - 7 - 7
different genes associated with seed maturation. Therefore, the use of these
types of mutants in this study would be difficult as more than one gene is
aff ected.
It would be more useful to find a seed storage protein mutant that is
defective in only one class of seed storage proteins that does not affect other
traits that may increase the complexity of experiments and interpretation of
results. Hence, A. thaliana seeds were mutagenized by ethylmet hane
sulfonate (EMS) and screened specifically for a seed storage protein mutant.
A mutant was identified through the examination of seed extracts by SDS-
PAGE as the gel profile of the mutant seeds displayed two missing bands at
35 kDa and 25 kDa. Ssp- 7 (seed storage protein mutant 1) is a recessive,
non-lethal mutation deficient in the accumulation of the 12s cruciferins, with
no other observable phenotypic effects. Since each dB pair of subunits
originate from the same polypeptide precursor, it is most likely that the
mutation only involves one gene. RNA gel blots were performed using RNA
preparations from the siliques of wild type and ssp-1 plants. The blots were
probed for each of the three genes establishing that only mRNA from one
gene, CRU3, was missing in the ssp-1 mutant. Therefore, the mutation must
occur in the CRU3 gene or in a regulatory gene controlling CRU3 expression
(transcription factor). Through the efforts of the Arabidopsis Genome
Initiative (AGI), the CRU3 gene has been sequenced and found to reside on
chromosome 4.
![Page 31: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/31.jpg)
Introduction 23
The objectives of this project were three-fold. First, mapping of the
sçp-l mutation was undertaken to determine if the mutation is allelic to
CRU3. Second, a molecular and biochemical characterization of the mutant
was to be performed. Finally, a major goal was to test the feasibility of the
empty container hypothesis by introducing a reporter gene construct into the
ssp-1 mutant and rneasuring reporter gene expression levels as compared to
wild type.
![Page 32: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/32.jpg)
Materials and Methods 24
Materials and Methods
Seed Lots
Seed lots from Landsberg erecta, Landsberg erecta x ssp-7,
Columbia, Columbia x ssp- 7 and ssp- 7 Arabidopsis thaliana plants were
obtained from Dr. Peter McCourt (University of Toronto).
Sinqle Pot Plantinas of Arabidopsis thaliana
The required number of 4" square pots were filled with freshly mixed
Premier Pro-mix PGX@ professional plug and germination growing medium.
For each type of Arabidopsis thaliana required, 20 seeds were suspended in
1 ml of water and the seeds were spread evenly on the surface of the
prewetted soi1 using a pasteur pipette. The single pot plantings were covered
with plastic wrap and vernalized at 4 ' ~ for 3-4 d prior to transferring the pots
to room temperature under white light (16 h photoperiod) at room
temperature (RT) for germination and growth.
Isolation of Seed Proteins
Crude seed protein extracts were made from the seeds of mature
plants. Approxirnately 100 seeds were ground in a Kontes mini-homogenizer
tube and pestle in 75 ul of denaturing buffer (2% SDS, 0.7'/0 P-
mercaptoethanol, 40 mM Tris pH 8.6, 17% glycerol) at 1 0 0 ~ ~ for 3-4 min.
The seed protein extract was clanfied in a ~orvall" MC-12 microfuge at
12,000 rpm for 2 min and the clarified extract was stored at -20 '~ until use.
![Page 33: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/33.jpg)
Materials and Methods 2s
Quantitation of Seed Protein Levels
Seeds were collected from dry siliques of single pot plantings of
Columbia, Landsberg erecta and ssp-7 Arabidopsis thaliana plants. One
week was allowed for after-ripening to occur and seed protein extracts were
made from counted (100 seeds) and weighed seeds (-15 mg) from each
ecotype and ssp-7. Seed protein levels in these extracts were quantitated by
the Lowry assay (Lowry et al., 1951). Aliquots of 5, 10 and 15 pl of each
seed protein extract were taken and the volume was adjusted to 100 pl with
sterile deionized water. Seed proteins were precipitated in 5 volumes (500 pl)
of cold acetone at -20'~ for 1 h. The proteins were pelleted in a microfuge
at 4 ' ~ and washed with 90% cold acetone, air dried, then resuspended in 0.5
ml of 2% Na2C03 in 0.1 M NaOH. Another microfuge tube with 0.5 ml of 20h
NapCOa in 01 .M NaOH was used as a blank. The samples were left standing
for 30 min with occasional vortexing. During this incubation time, 10 ml of
reagent 2 was made (9.6 ml 20h Na2C03 in 0.1 M NaOH, 192 pl 1%
potassium tartrate, 192 pl of 0.5% CuSO$. Before adding 0.5 ml of reagent
2, it was incubated at RT for 10 min. After reagent 2 was added, the
samples were incubated at RT for 10 min with occasional vortexing. The
addition of 100 pl of Folin reagent and incubation at room temperature for 30
min resulted in color development. The absorbante was measured at an
optical density of 700 nm in a LKB Biochrom Ultrospec II UVhisible light
spectrophotometer. This experiment waç repeated three times giving three
![Page 34: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/34.jpg)
Materials and Methods 16
sets of data for each volume of seed extract used. A t-test was done
according to Sokal and Rohlf (1987) to test the difference in means between
results for ssp-1 and Ler or ssp- 7 and Col.
Isolation and Quantitation of Seed Starch Levels
Seeds were collected from dry siliques of single pot plantings of
Columbia, Landsberg erecta and ssp-7 Arabidopsis thaliana plants. One
week was allowed for after-ripening to occur and seed starch extracts were
made from counted (100 seeds) and weighed seeds (-15 mg) from each
ecotype and ssp-7. The protocol from Tissue and Wright (1995) was modified
as follows: The weighed or counted seeds were placed in Kontes mini-
homogenizer tubes and frozen in liquid nitrogen then ground into a fine
powder. The tubes were transferred from liquid nitrogen to ice and 1 ml of
l2:3:l MCW (methanol, chloroform, water) was added to each tube. The
tubes were shaken for 10 min, then spun for 10 min at 4 ' ~ . The supernatant
(soluble sugars) was decanted and 1 ml of l2:3:l MCW was added to each
of the tubes containing the starch pellet. The tubes were shaken and
centrifuged as before and the supernatant was discarded again. The starch
pellets were air dried overnight in a fumehood. In the fumehood, 1 ml of 35%
perchloric acid was added to the dry starch pellets. shaken and left to sit for
1 h to digest polysaccharides into sugars. The tubes were spun and the
supernatant not containing the starch was transferred to an 8 ml çtarstedt
tube. A series of tubes containing 0, 0.2, 0.4. 0.6, 0.8 and 1 mg of glucose
![Page 35: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/35.jpg)
Materials and Methods 27
(from a stock solution of 1 mg/ml) were used as a standard. After the addition
of 1 ml of 5% phenol, the tubes were vortexed briefly and 5 ml of sulfuric acid
was added to each tube. The tubes were vortexed and allowed to sit for 5
min to develop color. The absorbance of 1 ml from each tube was measured
at 490 nm. A t-test was done as before for protein levels comparing results
for ssp-1 and Ler or ssp-1 and Col.
Germination and Growth of Arabido~sis thaliana for Screeninfi plants
For each of the two crosses, Columbia x ssp-7 and Landsberg x ssp-
1, 80 seeds were counted and surfaced sterilized through a series of wash
solutions: 30 min in sterile deionized water, 5 min in 95% ethanol, 5 min in
10% bleach, 0.05% SDS and 5 washes of sterile deionized water. The
seeds were plated ont0 100 x 25 mm deep petri dishes of growth media (GM:
lx MS salts (Murashige and Skoog, 1962), 0.5 g/L MES pH 5.7, 30 g/L
sucrose, 0.1 mg/ml myoinositol, 1 uglml thiamine, 0.5 ug/ml pyridoxine, 0.5
uglul nicotinic acid, 0.8O/0 phytagar). The plates were wrapped in foil,
incubated at 4% for 3-4 days, then transferred to a tissue culture incubator
(16 h photoperiod with white light, 25'~). One week after germination,
individual seedlings were transferred to Kord cells filled with Premier Pro-mix
PGP growing medium.
Screeninq of individuals of Crosses
Each F2 seedling was grown to maturity and seeds were collected
from their mature, dry siliques. Seed protein extracts were made from the
![Page 36: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/36.jpg)
Mate rials and Methods 28
seeds of each individual plant as described above. These seed extracts
were subjected to electrophoresis in a 15% polyacrylamide gel by SDS-
PAGE (Sambrook et al., 1989) at 100 V for 2 h in SDS-PAGE running buffer
(0.02 M Tris pH 7.5, 0.2 M Glycine, 0.1% SDS) using a BioRad mini-2D gel
apparatus. The polyacrylamide gel was fixed in destain solution (9% acetic
acid, 25% rnethanol) for 10 min, stained in 0.5% Coomassie brilliant blue in
destain for 1 h, then destained overnight. The gel was then dried in a Novex
Dry EaseTM mini-gel dryer using Novex Gel Dtynf drying solution.
Isolation of Plant DNA
Single pot plantings of each Col x ssp-7 and Ler x ssp-7 F2 progeny
that displayed the ssp-7 gel phenotype, as well as parental Col and Ler
ecotypes and ssp-1 were made and used for DNA preparations. These
plants were allowed to bolt and DNA was isolated before they formed
siliques. Each plant from a single pot was rernoved gently from the soi1 and
washed thoroughly with water to remove any residual soil. The protocol for
maize DNA miniprep by Dellaporta et al. (1985) was scaled up as follows:
After plants were frozen in liquid nitrogen, a mortar and pestle were used to
grind the plants into a fine powder. The powder was poured into a Servall'"
Omnimixer homogenizer tube containing 15 ml of extraction buffer (100 mM
Tris-HCI pH 8.0, 50 mM EDTA pH 8.0, 500 rnM NaCI, 10 mM P-
mercaptoethanol) at 65'~. The cells were homogenized by grinding with the
Omnimixer at medium speed for 20 s, then mixed with 1 ml of 20% SDS in a
![Page 37: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/37.jpg)
Mate rials and Methods 29
stenle Falcon 50 ml conical tube. The tubes were shaken vigorously to mix
the contents and were incubated at 65'~ for 10 min. The tubes were
transferred to ice and 5.0 ml of 5 M potassium acetate was added. The
contents of the tubes were mixed thoroughly and then incubated on ice for 20
min. The extracts were transferred to 30 ml Corex tubes and centrifuged in a
Dupont ~orvall' RC 5C Plus centrifuge at 9,000 rpm in a HB4 swinging
bucket rotor. The supernatant containing the DNA was filtered through
~iracloth' (Calbiochem) into a 30 ml Corex centrifuge tube containing 10 ml
of isopropanol. The samples were mixed and incubated at - 2 0 ' ~ for 30 min,
then centrifuged at 9,000 rprn for 15 min to pellet the DNA. After discarding
the supernatant, the pelleted DNA was resuspended in 750 pl of 10X TE pH
8.0 (100 mM Tris, 10 mM EDTA) and centrifuged to remove any insoluble
debris. The supernatant was transferred to a clean sterile 1.5 ml Eppendorf
tube. The DNA was precipitated by the addition of 75 pl of 3 M sodium
acetate pH 5.2 and 500 pl of ethanol, then pelleted in a microfuge at 12,000
rprn for 30 S. The DNA pellet was washed in 80°h ethanol, vacuum dried in a
Savant SVCl O0 speed vac and resuspended in 200 pl of 1 X TE pH 8.0 (1 0
mM Tris, 1 mM EDTA). In order to check the quality of the DNA preparation,
a 1 pl aliquot of each DNA sample was digested with 1 pl EcoRl (Gibco), 1 pl
RNase (1 mglml) and 2 pl React 3 buffer in a total volume of 20 pl at 37'~ for
1 h. The digests were then electrophoresed on a 0.goA agarose gel in 0.5X
TBE (45 mM Tris, 45 mM boric acid and 1 mM EDTA) using a BioRad mini-
![Page 38: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/38.jpg)
Materials and Methods 30
gel electrophoresis apparatus for 1 h at 100 V and visualized by staining with
ethidium bromide.
For PCR amplification, DNA was made from single leaves of plants.
Following the protocol of Mckinney et al. (1995), a young leaf approximately
0.5 cm wide was ground briefly in a Kontes mini-homgenizer tube with a
pestle. Following the addition of 100 pl of freshly prepared extraction buffer
(50 mM Tris-HCI pH 8.0,200 mM NaCI. 0.2 mM EDTA, 0.5% SDS, 100 pg/ml
proteinase K), the leaf was ground again and the homogenate was incubated
at 37'~ for 30 min. The leaf DNA was then extracted with 50 pl each of
phenol and chloroform-isoamyl alcohol (24: 1 ). DNA precipitation was
facilitated by using 0.1 volumes of 3 M sodium acetate pH 5.2 and 2 volumes
of cold 10O0/0 ethanol and incubating on ice for 15 min. The DNA was
pelleted in a microfuge at 12,000 rpm for 3 min, then washed twice with 70%
ethanol and vacuum desiccated in a speed vac. The dried pellet was
resuspended in 100 pl of 1 X TE.
Southern Blottiri-F2 - Individuals
Genomic DNA (-5-6pg) was digested with EcoRl in a total volume of
30 pl. Samples were electrophoresed on 0.9% agarose gels with a h Hind III
marker at 100 V until30 min after the bromophenol blue dye had run off the
gel. The Dupont Genescreenm salt transfer protocol was used for the
transfer of the DNA from the gel to the hybridizaüon transfer membrane. The
gel was trimmed and measured, then agitated in 0.25 N HCI for 10 min. A
![Page 39: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/39.jpg)
Materials and Methods 3 1
piece of Genescreenm was cut to the same size then prewet in 10X SSC
(1.5 M NaCI, 0.1 5 M sodium citrate pH 7.0) for 15 min. The gels were rinsed
in deionized water then incubated in GenescreenThL denaturant (0.4 N NaOH,
0.6 M NaCI) for 30 min with gentle rocking. The gels were washed twice with
GenescreenTM neutralizer (1.5 M NaCI, 0.5 M Tris-HCI pH 7.5) for 15 min
each with gentle rocking. Whatman 3MM paper and paper towels were cut
to the same size as the gel and a longer piece of 3MM to serve as the wick.
The capillary blot device (Sambrook et al., 1989) was set up using 10X SSC
as the transfer solution and left overnight. After the transfer was completed,
the membrane was removed and agitated in 0.4 N NaOH for 1 min,
neutralized in 0.2 M Tris-HCI pH 7.5, 1X SSC (0.1 5 M NaCI, 0.015 M sodium
citrate pH 7.0) for 1 min then baked for 2 h in vacuum oven at 80 '~ .
Probes and Hvbridization
The Arabidopsis mapping set (ARMS) are subcloned DNA markers
that detect restriction fragment length polymorphisms (RFLPs) in Ler versus
Col after EcoRl digestion. A chromosome 4 specific sequence, ARMS d l 04C
(CD3-71) (Fabri and Schaffner, 1994) was used as the probe for
hybridization and was made according to standard random oligonucleotide
labeling protocol (Feinberg and Vogelstein, 1 983) using (CX~~P) -~CTP and
was added to 0.62 mg/ml of salmon sperm DNA in 5X SSC to serve as a
competitor. After prehybridization of the blot in a Hybaid bottle containing
50% formamide prehybridization solution (1% SDS, 2X SSC. 10% dextran
![Page 40: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/40.jpg)
Materials and Methods 32
sulphate-Na salt, 50% deionized formamide) at 4 2 ' ~ for 1-1.5 h, most of the
prehybridization solution was poured out leaving only 10-1 5 ml to which the
denatured radioactive probe was added. Hybridization was allowed to
proceed overnight at 4 2 ' ~ in a Hybaid Micro-4 Hybridization oven. The blot
was washed for 10 min in each of 2X SSC/0.2% SDS at 4 2 ' ~ ~ 1 X SSC/0.2°/~
SDS, 0.5X SSC/0.20h SDS and 0.2X SSC/O.âO/~ SDS, al1 at 65 '~. The blot
was exposed to a piece of Kodak scientific imaging film (XARQ) with an
intensifying screen at - 7 0 ' ~ for 3-4 days (time varies depending on the
radioactivity) and the autoradiogram was developed.
PCR for SSLP analvsis
DNA from each mutant F2 individual from either cross, one wild type
Fa from each cross, ssp-7 and parental Col and Ler plants were used in PCR
reactions for simple sequence length polymorphism (SSLP) analysis. SSLPs
detect polymorphisms. based on microsatellites. between ecotypes by PCR
and agarose gel electrophoresis. A 1 pl aliquot of template DNA (0.1-0.5 pg)
from each plant was put into a 50 pl PCR reaction of 1 pl of fonvard primer
(10 PM), 1 pl of reverse primer (10 PM), 5 pl of 10X PCR buffer (Gibco), 4 pl
2.5 mM dNTPs, 1.5 pl 50 mM MgCl2 sterile deionized water and 0.5 pl (2.5
units) of Taq polymerase (Gibco). The PCR reactions were topped with 2
drops of light mineral oil (Sigma) and placed in a PTC-1 OOTM Programmable
Thermal Controller (MJ Research Inc.). The following cycling parameters
were used: 1 cycle at 9 4 ' ~ for 2 min, followed by 40 cycles of 9 4 ' ~ for 15 s,
![Page 41: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/41.jpg)
Mate rials and Methods 3 3
5 3 ' ~ for 30 S. 72'~ for 1 min. Extension was then carried out at 72'~ for 5
min. The prirners used were obtained from Research Genetics Inc. and are
listed as follows: nga 8, nga 1139 and nga 11 11 (from Bell & Ecker, 1994).
Table 2 lists the map locations and sequences of the primers. The PCR
products and segregation patterns were visualized on 2-4% agarose gels,
depending on the size of the fragment. For 2-4% agarose gels, the agarose,
0.5X TBE and ethidiurn brornide were ail mixed in a Erlenmeyer flask. The
mixture was heated in a microwave until the agarose dissolved. The flask
with the agarose was placed in a water bath set at 55% for 10-1 5 min before
the gel was poured to eliminate most of the small bubbles produced during
heating .
![Page 42: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/42.jpg)
Materials and Methods 34
Table 2. SSLP primers and RFLP probes used in mapping ssp-1
Probe
nga I l l 1
nga 1 1 39
CD3-7 1 (PCITd 1 04)
F- TAGCCGGATGAGTTGGTACC R- m c c l - r G T G r r G C A r r C C
Location (CM) Tel4N = 0.0
1 NIA
Sequence Ex pected bands 7
Location on chromosome 4 given relative to position of Tel4N. The bigger the distance between loci, the greater the chance of recombination by the occurrence of crossing over between them. The O/* of gametes in which recombination occurs is equal to the genetic map distance in centimorgans (CM). The closer two loci are to each other, the greater the probability of the loci segregating together.
Production of DNA constructs
Both the CRU3 gene (Pang et al., 1988) and the PHA gene (Riggs et
al., 1989) were cloned previously in other labs. The vector chosen was
pGPTV-HPT (obtained from Dr. Detlef Bleeker) that contains two selectable
marker genes for kanamycin and hygromycin resistance. Approximately 10
pg of a CRU3 EcoRl fragment was digested with Sal I (Gibco), resolved on a
0.9% agarose slot gel at 100V for 1 h and the 6.3 kb CRU3 EcoRI/Sal I
fragment was cut out with a razor blade and gel purified using the Qiagen
![Page 43: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/43.jpg)
Mate rials and Methods 3 5
Qiax II Gel Extraction Kit. The same amount of vector, pGPTV-HPT, was
also digested with the same enzymes, EcoRl and Sal 1, and the 11.8 kb
pGPTV-HPT fragment was also isolated in the same manner. Similady, the
plasmid, pDR214, containing the PHA gene and the vector, pGPTV-HPT,
were digested with EcoRl and Hind III (Gibco) then electrophoresed on a
0.9O/0 agarose gel. The 2.8 kb PHA fragment and the 1 1.8 kb pGPTV-HPT
fragment were also gel purified using the Qiagen kit. The ligation of CRU3
Sal IEcoRI to pGPTV-HPT Sal IlEcoRl and PHA EcoRllHind III to pGPTV-
HPT EcoRllHind III was performed in a total volume of 20 pl containing 2
units T4 ligase (Gibco) and 4 pl 5x T4 ligase buffer. These ligations were
incu bated at room temperature overnight.
Transformation of E.Coli
Competent E.coli, strain XI 1 -bluet was prepared using CaCI2 and
aliquots were frozen in liquid nitrogen and stored at - 7 0 ' ~ (Sambrook et al.,
1 989). For each construct, two 200 pl aliquots of thawed cells were pipetted
into cold sterile 1.5 ml Eppendorf tubes on ice. With one tube serving as a
control, 8 pl of the ligation was added to the other tube of cells. The tubes
were incubated on ice for 30 min. heat shocked at 42% for 90 s and then
placed in ice for 2 min. After adding 800 pl of LB to each tube, cells were
grown 1 h at 37% in a ab-line" Orbit Environ shaker. Aliquots of 50, 150
and 250 pl were plated on LB + kanarnycin (kan, 50 pglml) and incubated
overnight at 37'~. Randomly picked colonies were used to inoculate 2 ml
![Page 44: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/44.jpg)
Materials and Methods 36
minicultures of LB + kan50 and were growri overnight at 3 7 ' ~ in an orbital
shaker at 250 rpm. Plasmid DNA was isolated from minicultures by the
alkaline lysis method (Sambrook et al., 1989). The CRU3 construct was
digested with Sal I and EcoRl and PHA construct with EcoRl and Hind III to
validate the selection of the correct construct.
Transformation of Aarobacterium
The gentamycin resistant Agrobacterium tumefaciens strain GV3101
was obtained from Dr. Peter McCourt. GV3101 was grown in 5 ml of LE3 +
gentamycin (gentJO pg/ml) overnight at 28'~ in the orbital shaker at 250
rpm. A 250 ml Erlenmeyer flask containing 50 ml of LB + gent was
inoculated using 2 ml of the overnight culture and was shaken at 28'~ until
the ODsoo was between 0.5 and 1 .O. The culture was chilled on ice and
centrifuged at 3,000 rpm for 5 min in 2 sterile 30 ml Corex tubes. The
harvested cells were resuspended in 1 ml of ice-cold 20 mM CaCI2 (500 pl
per tube), then 0.1 ml aliquots were transferred to pre-chilled 1.5 ml
Eppendorf tubes. These cells were frozen in liquid nitrogen and stored at -
70'~ until used.
GV3101 was transforrned by the direct freeze-thaw rnethod (An et al.,
1988) with 1 pg of either the CRU3 and the PHA constructs. Aliquots of 50,
150 and 200 pl were plated on LB + gent (10 pg/ml) + kan (50 pglml) and
incubated at 28'~ for 2-4 days. The Agrobacterium colonies were used to
inoculate minicultures of 2 ml of LB + gent + kan. These cultures were
![Page 45: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/45.jpg)
Materials and Methods 37
assayed for the correct constructs by the plasmid quick screen procedure
based on the alkaline lysis procedure (An et al., 1988). Approximately 1 ml
of each culture was transferred to a separate 1.5 ml Eppendorf tube and
centrifuged for 30 S. After discarding the supematant. the bacterial pellet
was resuspended in 0.1 ml of ice cold solution 1 (4 mg/ml lysozyme, 50 mM
glucose, 10 mM EDTA, 25 mM Tris-HCI pH 8.0) and incubated at RT for 10
min. A 0.2 ml aliquot of solution 2 (1% SDS. 0.2 N NaOH) was added to
each tube and the tubes were shaken gently. After incubating at RT for 10
min, 30 pl of phenol equilibrated with solution II was added to each tube,
then gently vortexed. Next. 150 pl of 3 M sodium acetate, pH 4.8 was
added to each tube and the tubes were stored at -20°C for 15 min. The
tubes were centrifuged for 3 min and the supematant was transferred to a
new Eppendorf tube. The tube now containing the supernatant was filled
with ice-cold 95% ethanol, mixed by inversion and stored at -80°C for 15
min. As before, the supematant was collected after centrifugation. To each
tube, 0.5 ml of 0.3 M sodium acetate, pH 7.0 was added then filled with ice-
cold 95% ethanol. The tubes were incubated at -80°C for 15 min and
centrifuged as before. The supernatant was discarded and the pellet was
washed with ice-cold 70% ethanol then briefly dned in a vacuum dessicator.
The dry pellet was resuspended in 50 pl of TE. A 5 pl aliquot from each tube
was used in diagnostic restriction digests.
![Page 46: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/46.jpg)
Materials and Methods 3s
Arabidopsis transformation
Twenty ssp-7 seeds were surfaced sterilized and plated on GM as
before, then transferred to soil. Once the bolts began to emerge from the
plants they were cut to promote secondary growth. Four days after clipping,
a 5 ml LB + gent + kan of Agrobacterium containing the correct construct was
started and was grown for 2 days at 2 8 ' ~ in the orbital shaker. One day
prior to infiltration, 300 pl of the 5 ml culture was used to inoculate a 300 ml
culture. The cells were harvested at 5,000 rpm for 10 min and resuspended
at an ODsoo of -0.8 in 3 volumes of infiltration medium ( 0.5X MS pH 5.7,
5.0°h sucrose, 1X 65 vitarnins, 0.044 pM benzylaminopurine, 0.03% Silwet
(Lehle seeds) (Bent and Clough, 1997). The Agrobacterium culture was then
placed in a 1 L beaker and ssp-7 plants were inverted into the solution,
stems and rosette leaves fully submerged for 4 min. The plants were
removed from the solution and placed on their side in a plastic flat and
covered with saran wrap. The plants were uncovered and set upright the
next day and allowed to grow. To increase transformation efficiency, these
plants were redipped into Agrobacterium harboring the correct construct
suspended in infiltration media (as done before) 2-6 days after the initial
transformation. These Agrobacterium infected plants were allowed to grow
and mature. The seeds were harvested frorn dry siliques and stored at RT in
labeled Eppendorf tubes.
![Page 47: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/47.jpg)
Materials and Methods 39
Selection of transformants
Approximately 150-200 seeds from each of the Agrobacferium
infected plants were counted and surface sterilized in 20°h bleach, 0.1 % SDS
for 1 min, 7OoA ethanol, 0.1% SDS for 5 min and then washed 4-5 times in
sterile water. The seeds were resuspended in 400 pl of sterile deionized
water and transferred to a 100 x 15 mm hygromycin selection plate (0.5X
MS, 5 mM MES pH 5.7. 15 pglml hygromycin b). To spread the seeds evenly
over the surface of the media, 0.8% agar was used. After solidification of the
top agar, the plates were wrapped in foi1 and the seeds were vernalized for 4
days at 4 ' ~ . The plates were then transferred to the TC incubator and
allowed to germinate. Seedlings susceptible to hygromycin germinated but
soon becarne bleached and died. The dark green hygromycin resistant
seedlings that formed true leaves and had roots penetrating into the agar
were transferred to soil. These resistant seedlings (Tl generation) were
grown to rnaturity and their seeds harvested.
lmmunoblottinq
An immunoblot was performed to examine PHA levels in bean seed
protein extracts and wild type Arabidopsis thaliana extracts (previousl y made
in the lab of Dr. Riggs). Seed protein extracts were made frorn the seeds of
PHA transformants and a second immunoblot was done using a few of these
seed protein extracts to confirrn successful transformation. Initially, the
samples were run on a 15% polyacrylarnide gel by SDS-PAGE in duplicate at
![Page 48: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/48.jpg)
Materials and Methods 40
100 V until the protein dye was run off the gel. Half the gel was fixed.
stained, destained and dried. The other identical half was used for an
immunoblot. Using a BioRad mini-gel apparatus. the proteins were
transferred to a piece of nitrocellulose (BioRad) at 100 V for 1 h in cold
transfer buffer (25 mM Tris, 192 mM glycine. 15% methanol). Upon
completion of transfer, the nitrocellulose was transferred to a small (100 ml)
plastic container containing 50 ml of 3% gelatin in 1X TTBS (20 mM Tris pH
7.5. 0.5 M NaCI, O.lO/~ Tween 20) and was incubated for 30 min on a rocker
platform. The plastic container holding the blot and gelatinmBS solution
was transferred to 4 ' ~ ovemight. The next day, the gelatin was liquefied by
placing the container in a 37% waterbath for 5 min. After discarding the
gelatinfiTBS solution. 30 ml of 1% gelatin, 1X TTBS and 10 pl of rabbit
antibody raised against ?HA (1 :3000), designated 880-4 was added (Voelker
et al., 1987). The primary antibody reaction was carried out for 1 h with
gentle rocking, then the blot was washed 4 times with 1X TTBS. Another 30
ml of 1% gelatin in 1 X TTBS was added to the blot with 10 pl of blotting
grade affinity purified goat anti-rabbit IgG conjugated to alkaline phosphatase
(1 :3000) (BioRad). The secondary antibody was incubated with the blot for 1
h, then washed 4 times with 1X TTBS. Developer (0.1 M Tris-HCI pH 9.5,
0.1 M NaCI, 50 mM MgCI2 containing 44 pl of 75 mglrnl nitroblue tetrazolium
chloride (NBT) and 33 pl of 50 mglml 5-Bromo-4-chloro-3-indolyl phosphate
p-toludine salt (BCIP) was made and added after decanting the TTBS. Once
![Page 49: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/49.jpg)
Materials and Methods -41
colored bands were visible, the developer was discarded and the blot was
washed 4-5 times with 1X TE. The immunoblot was then air dried on
Whatman 3MM paper and sealed in a plastic Seal-a-mealJ bag.
Screeninq for Homozvqotes
Approximately 100 seeds of each PHA T2 generation plants were
surface sterilized in 95% ethanol for 5 min. The ethanol was discarded using
a pasteur pipette and the seeds were vacuum dried in a speed vac. The
dried seeds were plated on separate hygromycin selection plates for each
plant. After vemalization of the seeds for 4 days at 4 ' ~ . the plates were
transferred to the TC incubator. The seeds were allowed to germinate and
grow until the seedlings formed true leaves. Six of the healthiest looking
seedlings for each PHA transformant were transferred to soi1 and allowed to
grow to maturity. Each plant was given a designation and seeds were
hanrested from each plant. T2 generation seeds from each of theçe T2
plants. about 100-300 seeds, were surfaced sterilized and plated on
hygromycin selection plates as before. A homozygote containing one
transgene locus would produce offspring, al1 of which would be resistant to
hygrornycin. Once a homozygote was found, that seed lot was used to grow
plants for DNA preparations and crossing.
TA cloninq
The nucleotide sequence of the wild type CRU3 gene has been
determined (Pang et al., 1988). Primers were designed such that the mutant
![Page 50: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/50.jpg)
Materials and Methods -13
(ssp-7) cru3 gene could be amplified in two ovedapping sections (made by
Cortec DNA Services Laboratones Inc., see Fig 6, Table 3). Primers 2 and
10 amplified a 2kb fragment of the gene while 9 and 12 amplified a 1.5 kb
fragment (see Table 3 for primers). Using a 1 pl aliquot of a ssp-1 leaf DNA
preparation as template DNA, 50 pl PCR reactions were set up as before
using pairs of primers: CRU3 2.11 0 and CRU3 9/12. Each PCR product was
then ligated into pCR2.1 "sing an lnvitrogen TA cloning kit. One ShotTM
cells provided in the kit were transformed with the ligation mix and plated on
2xYT + ampicillin (50 pg/ pl) + color substrate (300 pl 2xYT, 8 pl of 200 mM
IPTG, 50 pl of 20 mglm1 X-GaVplate). Colonies were used to inoculate 2 ml
mini-cultures of 2xYT + ampicillin which were shaken at 37'~ overnight.
Mini-lysate preparations were subjected to cleavage with EcoRl then
visualized on an agarose gel stained with ethidium bromide to ascertain if the
correct inserts were obtained.
Larcie Scale Plasmid DNA Pre~aration
Once the correct constnict was identified, the remaining 1 ml of
culture was used to inoculate 200 ml of 2xYT + amp50. The culture was
shaken at 37'~ overnight. The next day, cells were harvested into two 40 ml
polypropylene centrifuge tubes in a Dupont ~orvall" RC 5C Plus centrifuge at
6,000 rpm for 5 min. This step was repeated until al1 the cells were
harvested. The following procedure is based on the alkaline lysis large scale
plasmid preparation (Sambrook et al.. 1989). The harvested cells in one tube
![Page 51: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/51.jpg)
Materials and Methods 43
were resuspended in 4 mi of 50mM glucose, 1 mM EDTA pH 8.0, 10 mM Tris
pH 8.0 by vortexing then transferred to the other tube to resuspend the
second pellet. Two volumes of freshly made 0.1% SDS, 0.2 M NaOH was
added to the tube and mixed gently by inversion. After incubation on ice for
5 min, 1.5 volumes of 3 M potassium acetate, 1 1.5% acetic acid was added,
gentiy mixed and the tube was incubated on ice for another 5 min. The lysed
cells were spun at 8,000 rpm for 10 min then the supematant was filtered
through a piece of ~iracloth" (Calbiochem) into a new 40 ml polypropylene
tube. The tube was then filled with absolute (10Ook) ethanol and nucleic
acids were allowed to precipitate on ice for 15 min. The precipitate was
pelleted at 8,000 rprn for 5 min and resuspended in 10 ml of 1X TE pH 8.0.
RNA was precipitated using 2 g of ammonium acetate and incubating on ice
for 15 min. The RNA was then sedimented at 8,000 rpm for 5 min. The
supernatant was poured into a clean 30 ml Corex centrifuge tube and filled
with 100% ethanol. After 15 min on ice, the tubes were spun at 8,000 rpm
for 5 min. The DNA pellet was resuspended in 4 ml of 1X TE pH 8.0 and
extracted twice with one-half volume of phenol and chloroform-
isoamylalcohol (241). The plasmid DNA was precipitated on ice for 10 min
using 0.1 volumes of 3M sodium acetate pH 5.2 and 2 volumes of 100%
ethanol. After the DNA was collected at 5,000 rprn for 5 min and washed
twice with 70% ethanol. the pellet was vacuum dried in a speed vac and
resuspended in 400 pl of 1 X TE.
![Page 52: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/52.jpg)
Materials and Methods u
Autosequencincr Preparation of DNA
DNA sequencing was performed by the Core Molecular Biology
Facility at York University and Cortec at Queen's University. The modified
minilysate preparation of DNA from the large scale plasmid preparation was
used to prepare the DNA for sequencing. A volume containing approximately
15 pg of DNA was pipetted into a 1.5 ml Eppendorf tube and the volume was
adjusted to 100 pl with sterile deionized water. After 5 pl of RNase A (1
mglml) was added, the DNA was incubated at room temperature for 10 min.
A volume of 2.5 pl of 20% SDS and 2 pl of proteinase K (20 mg/ml) was
added and the DNA was incubated for 15 min at 5 5 ' ~ . The sarnples were
extracted twice with one-half volume of phenol and one-half volume
chloroform-isoamyl alcohol (24:l) and once with an equal volume of
chloroform-isoamyl alcohol (243). The DNA was precipitated at room
temperature for 15 min after the addition of 0.1 volumes of sodium acetate
pH 5.2 and 2.5 volumes of 100% ethanol. After spinning at 12,000 rpm in a
microfuge, the pelleted DNA was washed twice with 70% ethanol, vacuum
dried and resuspended in 25 pl of sterile deionized water. A 10 pl aliquot
was diluted (15X) with 140 pl of sterile deionized water. A 5 pl aliquot of the
diluted DNA was used for a test digest and the rest (1 45 pl) was used to take
OD readings at 260 nm and 280 nm using quartz cuvettes. Since a
0D26d0D280 ratio of 1.8 is equivalent to pure DNA, only samples with ratios
greater than 1.7 were used for autosequencing. Universal primers in the
![Page 53: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/53.jpg)
Mate rials and Methods 15
multiple cloning site and gene specific primers were used to amplify up to
500 bp of both ends of each fragment.
Subcloninq and Analvsis of the SSD-1 CRU3 semence
The restriction maps of each fragment were known from the wild type
sequence (Genbank). The orientation of the fragments was determined by
diagnostic digests with Spe I for CRU3 2/10 and Bam HI for CRU3 9/12. Spe
I and Hind III fragments were cut out of the plasmid cariying CRU3 2/10 and
the vector was religated and used to transform subcloning efficiency DH5a
Ecoli cells (Gibco). The first 500 bp of each subclone was sequenced as
before, using universal primers in the multiple cloning sequence. The last
section of CRU3 2/10 required the production of primers for sequencing. The
last section of CRU3 9/12 was sequenced by cutting out a Barn HI fragment.
The fully sequenced ssp-7 mutant CRU3 gene was compared to the wild
type CRU3 gene using the MacVector program.
Crossina PHA homozvqote to Wild Tvpe Arabidopsis thaliana
Single pot plantings were made of each potential homozygote and of
wild type Columbia plants. A bud that has yet to flower of a Col plant was
chosen and any other interfering parts of the plant such as other buds,
leaves and siliques. were cut from that stem. The bud of the wild type plant
was carefull y dissected under a dissecting microscope using watch maker's
forceps, leaving only an undamaged carpe1 (stigma. style and ovary). The
anthers of a slightly open flower from one of the putative homozygotes was
![Page 54: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/54.jpg)
Materials and Methods -16
then dissected and used to dust fine yellow pollen ont0 the stigma. The
cross was then marked with a label on a piece of sewing thread tied loosely
at the base of the carpel. If the cross was successful, a silique would f o m in
a week. When the silique was dry, the seeds were collected. The seeds
were plated on hygromycin selection media and the seedlings were
transferred to soil and allowed tu self. The F2 seeds were plated on
hygromycin selection media and segregation data was examined. The
hygromycin seedlings were transferred to soil from plates and segregation
ratios of hygromycin resistant to hygromycin susceptible seedlings was
recorded. DNA was isolated from the mature plants and these DNA
preparations were used in Southern blot analysis of the progeny frorn the
cross using a P"-radiolabeled 0.8 kb Xba IIEcoRV piece of PHA as a probe.
PHA Levels in Transqenic Plants
Crude seed protein extracts were made from the seeds of
homozygote PHA transformants and the homozygote backcross. These
extracts were run on a 15% polyacrylamide gel by SDS-PAGE, along with a
standard of 10 ng, 25 ng, 50 ng and 100 ng of PHA (Boehringer Mannheim).
An immunoblot was performed and the blot was probed with the 880-4
antibody (refer to section on immunoblotting). The immunoblot was analyzed
using a Bio-Rad Model GS-700 lrnaging Densitometer and Bio-Rad Multi-
AnalystTM software. The known concentrations of PHA were used to
generate a standard curve. When analyzing the samples, the same area
![Page 55: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/55.jpg)
Mate rials and Methods 47
was measured in al1 lanes and the values were adjusted for local
background. Most lanes had several bands appearing at lower molecular
weights than the band for purified PHA. These were processing products of
?HA and were still indicative of PHA expression. The same size
densitometry window (area measured) was used to analyze al1 lanes of a
single blot and included bands from these processing products. The levels of
PHA present in each lane (analyzing al1 bands in a single lane) were
estimated by cornparison to the standard.
![Page 56: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/56.jpg)
Results -18
Results
Preface
Ssp-1 is a mutant, identified from an EMS mutagenized seed lot. It is
defective in the accumulation of one of the 12s cruciferins. The misçing
protein is usually represented by two bands that are absent in the gel profile
from SDS-PAGE of ssp-llssp-7 seed extracts (Figure 1). Three genes,
CRUI, CRU2 and CRU3, encode precursors that are cleaved into the a and
p subunits of the cruciferin. Previous studies show that only the CRU3
transcript is missing in ssp-7 plants. The CRU3 gene has been cloned,
sequenced and mapped to chromosome 4. near cer2.
Figure 1. SDS-PAGE of seed extracts from various Fa individuals from crosses behiveen ssp-1 and Col or Ler. The ssp-1 mutation is visualized in its gel profile as two missing bands at 35 kDa and 25 kDa. Wild type and ssp-1 gel profile are marked and other lanes are Fps from crosses. Only the second to last lanes on each side show the mutant profile.
![Page 57: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/57.jpg)
Results -19
Bioc hemical Characterization of ssp-7
In order to generate an empty container to test the 'empty
container' hypothesis. the mutant must have significant reduction in the total
amount of storage protein within the seed. To ascertain how much of the total
seed storage protein the missing protein constituted, seed protein levels in
seeds of Col and Ler ecotypes, and the ssp-l mutant lines were quantified
using the Lowry assay. The procedure (starting from seed protein extraction
from the same seed lots) was repeated three times for both weighed
(-1 5mg) and counted seeds (1 00) in order to give three sets of data for each
aliquot of extract used. Col and Ler ecotypes exhibited higher protein levels
than the mutant ssp-7 for both weighed and counted seed protein extracts
(Figure 2). However, the results from the counted seed protein extract gave
lower standard deviations between the three trials for al1 plants and hence
rnay be considered to be more accurate (Figure 28). The reason for this
discrepancy rnay be due to the slight differences in weight of seeds used, as
M.1 mg difference may constitute hundreds of seeds. The weighed seed
extract trials suggest that ssp-7 contains about 79% of the total seed protein
content in Ler seeds and 76% in Col seeds. The protein concentration from
counted seed extracts indicates that ssp- 7 has 870h of proteins in Ler seeds
and 73% of protein in Col seeds. Therefore, ssp-1 has 13-21% less seed
storage proteins than Ler and 24-27% than Col. Results of the t-test show
that for weighed seeds there is no significant difference between ssp-1 and
![Page 58: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/58.jpg)
Results 50
Ler or ssp-1 and Col for 5 and 15 pl but there was a 80°h confidence level
that protein levels in ssp- 1 are significantly different from both Ler and Col for
10 pl. For counted seed thals. only Col and ssp-1 showed significant
differences with 95% confidence levels in protein levels for 5 and 10 pl but
not for 15 pl or between values for Ler and ssp-1. The inaccuracies due to
weighing and also srnail sarnple size can probably account for the lower
confidence levels of the other volumes. Repetition of this experiment to
increase the number of samples would resolve the inaccuracy. Although not
al1 of the trials generated statistically significant differences, the trend is that
ssp-7 appears to have less seed protein than wild type.
To determine if any other seed component levels had also changed,
starch levels in Col, Ler and ssp-7 seeds were also assayed (Figure 3). The
same sampling method used for the protein assay was used. The counted
seed trials gave approxirnately 5 ng starch/seed for Col and -3 ng
starchkeed for Ler and ssp-1 and in weighed seed trials the results were 9%,
1 1 O/O and 10% starch respectively. Although the standard of deviation was
lower in the counted seed trials, results from both sampling methods show no
significant difference in starch content between seeds from Col and Ler
ecotypes as well as ssp-1. This is confirmed by the results of the t-test with a
confidence of 95% that these deviations occurred purely by chance and not
due to any difference between populations.
![Page 59: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/59.jpg)
A previous study done by Majid Ghassemian (Dr. Peter McCourt,
Department of Botany, University of Toronto) on the lipid content revealed
that there were only a few differences in types of lipids produced by ssp-1
seeds as compared to wild type col seeds (Figure 4). There was three times
more 16: 1 cis and an increase in the l8:l fatty acids levels in ssp- 1 versus
wildtype Col seeds (Figure 4). It has been shown that the same soluble
desaturase is responsible for both events (Mazliak, 1994) and resulting
increases in these fatty acids may be a result of the mutant trying to
compensate for lower levels of other fatty acids or the deficiency of 12s
cruciferins in the seed.
![Page 60: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/60.jpg)
Results 5 2
Figure 2.
ul of protein extract used
Comparison of seed protein levels from A.thaliana ecotypes col and ler with a seed storage protein mutant ssp-1. Error bars represent standard deviations from 3 trials for each sample for each aliquot used. A) Protein levels in extracts made from weighed (-15mg) seeds, B) Protein levels in extracts made from counted (100) seeds
![Page 61: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/61.jpg)
Results 53
Figure 3. Cornparison of seed starch levels from AJhaliana ecotypes col and ler with a seed storage protein mutant ssp-1. Error bars represent standard deviations from 12 trials for each plant. A) Starch levels (% starch of fresh weight) levels in extracts made from weighed (-15mg) seeds, B) Starch levels (ngkeed) in extracts made from counted (100) seeds
![Page 62: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/62.jpg)
Results
Figure 4. Previous lip composition of the lip
d anelysis of col and ssp-1 seeds showing d fraction from the seed.
![Page 63: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/63.jpg)
Results 55
Screeninqfor F2 - SSD-1 mutants
In order to map the ssp-1 mutation, molecular mapping strategies
were employed using both RFLP and SSLP technologies. The original ssp-1
mutant, created in a Ler genetic background, was crossed to a different
ecotype, Col, resulting in a jumbling of markers such that the chromosomes
are a combination of regions from both ecotypes. Therefore, two
populations of plants were screened: Col x ssp-1 and Ler x ssp-7. Crude
seed storage protein extracts were made from the seeds of F2 individuals
from both crosses. These seed storage protein extracts were analyzed by
SDS-PAGE for the ssp-1 gel phenotype (Figure 1). Since the mutation is
recessive, a ratio of 3 wild type: 1 ssp-llssp-7 Fa individuals was expected.
Out of 75 plants screened Col x ssp-1 gave rise to 10 mutants (7.5:1 ratio)
and Ler x ssp-7 gave rise to 20 mutants out of 95 plants (4.75:l ratio). Dr.
McCourt tested the germination efficiency of the plants on MS with gibberellic
acid (GA) and found it to be 100%. Deviation from the expected 3:1 ratio
was observed and perhaps environmen ta1 conditions such as heat, humidity
and application of pesticides negatively affected the growth of ssp- 1 mutants.
Once the ssp-llssp-7 F2 mutants were identified, single pot plantings of were
made in order to grow plants for DNA preparations.
The ssp-1 mutation maPs to chromosome 4
Mapping was accomplished by simple sequence length pol ymorp hism
(SSLP) analysis using leaf DNA preparations made from plants grown from
![Page 64: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/64.jpg)
the seeds of F2 mutants, as well as parental Col and Ler plants. Previous
RNA gel blots demonstrated that the CRU3 transcript is missing from the
mutant (Riggs, personal communication). The wild type CRU3 gene has
been cloned, sequenced and mapped to chromosome 4 near cer2 (74.5 CM).
Since the wild type gene is located on chromosome 4, three primers also
located on chromosome 4 were used for SSLP analysis (refer to Materials
and Methods, Table 2). After the primers were used to arnplify the DNA using
PCR, the products were visualized on a high percentage (2-4%) agarose
gels (Figure 5). Two of the primers, nga 8 and nga 1111, gave random
segregation patterns for the ssp-l/ssp-7 F2 mutants (see Table 3). For
primer nga 1139, the ssp-1 mutation segregated with Col for nearly al1 the
mutant ssp- l/ssp- 1 F2 plants, exhibiting a low frequency of recombination. It
is uncomrnon for crossing over to occur between the location of the marker
and the mutation, sa the genetic distance between them rnust be low.
Therefore the marker rnust be located close to the mutant gene, establishing
linkage to chromosome 4, close to the position of 83.14cM (Figure 5).
RFLP analysis was used to confirm the results from the SSLP
analysis. DNA gel blots of EcoRl-digested genomic DNA made from single
pot plantings of F2 ssp1/ssp-I mutants and parental Col and Ler were
hybridized with one of the Schaffner Arabidopsis restriction mapping set
(ARMS) probes, CD3-71 (pCTTdl04) labeled with P~~ (refer to Materials and
Methods, Table 2). The resulting autoradiogram shows bands at 2.6 kb for
![Page 65: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/65.jpg)
Results 57
the Col parent and at 4.8 kb for the Ler parent (Figure 6). Nearly al1 the
mutants gave bands identical to Col confirming the segregation pattern seen
in SSLPs (Figure 6). Again, the genetic distance between the marker (CD3-
71) and the mutant gene must be close enough so that there is infrequent
genetic recombination. The results of the DNA gel blots substantiate the
conclusion from the SSLP analysis: the ssp-1 mutation is Iinked to
chromosome 4. The segregation patterns of each FÎ plant tested are listed
in Table 3. These results indicate that the ssp-1 mutation is located on the
distal arm of chromosome 4, near map position 83 CM. These results have
recently been confirmed by the AGI sequence of a BAC clone containing the
wild type CRU3 gene (Genbank accession no. AL021 749).
Figure 5. SSLP analysis using primers nga 8 and nga 1139. PCR products visualized by ethidiurn bromide fluorescence following agarose gel electrophoresis. Lanes marked Ler contain parental Landsberg erecta DNA and unmarked lanes contain various mutant Fz DNA samples. Analysis with nga 1139 shows the ssp-1 mutation is linked to chromosome 4.
![Page 66: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/66.jpg)
Results 58
- K z: coi x sspl mutants $ ler x ssp l mutants
i & - ' " ' s ; G G 0 0 - O
r+-*
Figure 6. The ssp-1 mutation is linked to chromosome 4. A DNA gel blot of parental Ler, Col and F2 SSP-1 mutant DNA frorn crosses as shown using probe CD3-71. The resulting segregation pattern reinforces findings of the SSLPs that the mutation is on chromosome 4, near 83.33 CM.
![Page 67: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/67.jpg)
Table 3. Segregation Patterns from SSLPs and RFLP of ssp-l mutants L = Ler, C = Col, H = Heterozygous; All markers are located on chromosome 4 where Tel4N=O.
1
t ssp- 7 I C C C C
Individual Primer and Segregation Pattern
L36 L40 L48 L50 L52 L56 L64 L66
L
L67 L75 L79 L82 L9 1 L95
nga 8 24.18 CM
C L H L H C H C
nga 1111 29.64 CM
nga 11 39 83.1 4 CM
C L
not tested not tested
C C
CD3-71 83.33 CM
C L C L H C H C C L
not tested not tested
C C
C C
not tested C
not tested C C C
C H C C C
not tested C
not tested H C
not tested not tested
C C
H C C C C C
![Page 68: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/68.jpg)
Results 60
The wild Wpe CRU3 gene rescues the ssp-1 mutation
The ssp-1 mutant was transformed with a wild type CRU3 gene using
the vector pGPN-HPT. After selection on hygromycin plates, plants were
grown to rnaturity and allowed to self. Seeds of putative transformants were
collected and used to produce seed protein extracts. These extracts were
analyzed by SDS-polyacrylamide gel electrophoresis (Figure 7). The missing
protein bands at 35 kDa and 25 kDa both reappear in the transformants,
hence the wild type copy of the CRU3 gene rescued the mutation.
transformants 0)
Figure 7. SDS-PAGE of seed extracts from ssp-1 plants transformed with a construct containing the wild type CRU3 gene. The wild type copy rescues the mutation as seen by the reappearance of the 2 missing bands seen in ssp-1.
ssp-7 has a premature stop codon
Since the wild type copy of CRU3 rescues the ssp-1 mutant, the
mutation must exist in the CRU3 structural gene and not in a regulatory gene
controlling CRU3 expression. Therefore, sequencing the mutant gene may
![Page 69: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/69.jpg)
Results 6 1
identify the nature of the mutation. Initially, primers were designed and used
to amplify the mutant CRU3 gene in two overiapping fragments using primer
pairs of 2/10 and 9/12 (Table 4). The PCR amplified fragments were cloned
using a TA cloning kit (Invitrogen) which provides primer sites for
sequencing. The fragments were sequenced from both sides using Ml3
reverse and T7 primers (Figure 8). Sequencing was only reliable up to 500
bp. Therefore, each PCR fragment had to be further subcloned in order to
obtain the full sequence of the CRU3 gene. Figure 8 shows the location of
the restriction sites used to subclone the fragments and additional areas
which were sequenced using primers. The product from primer pair 2/10
was subcloned using Spe I and Hind III, and 9/12 was subcloned using Pst 1
and Bam HI (Figure 8). The first pass sequence revealed two possible point
mutations in the promoter region, and some single base pair mutations and
insertions leading to two possible stop codons. Therefore, the promoter area
and the area containing the first premature stop codon were arnplified using
primers 4/5 and 618, cloned and resequenced (see Figure 8, Table 4). The
second pass sequence revealed no mutations. The rest of the gene was then
resequenced. Figure 8 also shows the subsequent sequencing strategies
such that the whole gene was resequenced to confimi the initial findings.
The gene was amplified using primers 2/5 (1.1 kb product) and 4/12 (2.4 kb
product), cloned and sequenced from both directions. The sequencing was
reliable up to 750bp. The 2.4 kb clone was cut with Cla I and Barn HI
![Page 70: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/70.jpg)
resulting in a 1.3kb fragment which was then subcloned and sequenced. The
mutant gene was found to differ at only one site when compared to the wild
type CRU3 sequence. This single base pair mutation occurs at position
2796, where a guanine is replaced with an adenine in the mutant, turning a
tryptophan codon (TGG) into a premature stop codon (TGA) in the reading
frame. The entire gene sequence is shown in Figure 9.
Table 4. Primers used for PCR amplification of the ssp-1 CRU3 gene for sequencing
Primer Sequence
1 CRU3 1302/1325 5' CAGAGTACCATCTGAAGATCACGG 3'
2 CRU3 203812057 5' CGAACGCTCATGCTAAGCTG 3'
4 CRU3 286312881 5' GACATATGCGGAGAGTGAG 3'
5 CRU3 31 46131 27 5' CAAGTGACTGCCTCGCAAGG 3'
6 CRU3 325613275 5' CCACCCTCAGCTCCGATGTG 3' 1
7 CRU3 377513796 1 5' GTGGAACATGTGAGACGCGGAG 3' I
9
10
1 1
12
CRU3 382513843
CRU3 41 26141 06
CRU3 507615057
CRU3 530915290
5' CCACTGGATCTACAACTCAGG 3'
5' CTATGACCTGTGCGTCGAACC 3'
5' ACAATCTCCTCGATCAACTG 3'
5' GCTCAAGCTACAGTAGATGG 3'
![Page 71: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/71.jpg)
Results 63
1 Spe 1 (2470) Hind 111 (2940) 5 6 Cla 1 (3440) Pst 1 (4315) Barn HL (4750) 11 12
Figure 8. Sequencing strategy for the CRU3 gene in ssp-1. The restriction sites used to subclone the mutant CRU3 gene for sequencing are shown. Arrows show the direction of sequencing. Double arrowheads represent the sequencing of same area but from both directions. Triangle arrowheads represent the first pass sequencing and open arrowheads represent any subsequent sequencing. Primers locations are shown on the map and those used for sequencing are labeled above the arrow (numbers corresponding to CRU3 specific primers are listed in Table 4). BAP3 is a plant homologue of the mammalian prohibitin gene which is associated with antiproliferative activity (tumor suppression) (Snedden and Fromm, 1997).
![Page 72: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/72.jpg)
Results 64
. . . . . . . . . A - > . ~ W < A 7 A . T W T - - ~ . ~ - A T A 7 A 7 - A CA, ' ~ A . : A t Y ? Y T ? ~ M A - A - A - . U T i " - A 7 ; r ' I ' C I 7 W A T A - W A l l j l A : ; - f M * y * Z A Y : > P * f X Y ! l A . L
-AAA -&-?:-A 75-A ;.-A.:M ;-a;;;*7-AA;-rE-MMMA 'M:?:A,:A :M ';TC > X I ' A A < I > ? Z b f M ;=,:A X Y 7 7 * ; ? A ? 7 I A IM > T ; - X ' A E : : r 7 : : ; ; ; d : ; . : ' . ' ! l = : ; ; - : J ' . ' L : ; ; ' : ; r : ; : ~ ; ~ : : p ; ; 7 A
YA 'l?-.l:- -YA:-.;UhïM 777-2 ~ ? . - W : f M T M * . ~ ~ X ~ M T , A - A Sih-rT7-ZF-XA.T7.T7-.I-A i--TA-+'AT.7A ;:.I ~ . . - - : ; : H : T K F E * : ; F ~ T : ~ E : ~ A Y : : : L A : ~ T ; L L ~ A L ? L E :
A 7 h ? M T e - - X A ;A- -+--A>-w,Z.y&..U.-4Y-M ;F '&&-&.&.-A 2 , : T A .-.LX-.- . . A . A. a.. A ----- . r . . A - E X M - M 'MX ;-A- A >:A i A - 7 - . : ; N ; F : : : ? E Z A P C : ~ P - ; : : E - : L : ~ A A : Q : : : . : : : : : . , '
'A >-+-AM?:AAML":. . . . . . . . . . . . . . . A L U ? T A 9 > 7 7 A r C 7 h A T - A I . ' X 7 Y L T A M - - X A - : ? Z W + A . i r ? i f E A '
Figure 9. Wild type nucleotide and amino acid sequence of CRU3 with 1 kb of upstream promoter. The asterisk (*) represents the stop codon. Putative CAAT and TATA boxes are underlined in the promoter region. The polyadenylation signal is also underlined. The mutant version of the gene has a single base pair mutation from guanine (bold, underlined) to adenine at position 2796, creating a premature stop codon.
![Page 73: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/73.jpg)
Resuits 65
A. B.
Arabidopsis bean Arabidopsis bean
-0
Figure 10. Arabidopsis seed do not contain endogenous PHA. Two aliquots of seed extracts from wild type Arabidopsis and from bean were run side by side. The second lane for each sample represents twice the amount of extract used in the first. The first lane is the molecular weight standard. A) Coomassie stained gel 6) Immunoblot. Only bean extracts show the presence of PHA (doublet due to PHA-E and PHA-L).
The emptv container hvpothesis
The second goal of this project was to determine if foreign proteins
can be overexpressed in seed storage protein mutants defective in seed
filling. The Lowry assay demonstrated that ssp-7 seeds contain 20-25% less
protein than wild type seeds and therefore an ssp-1 seed may act as the
'empty container'. To gauge the usefulness of the ssp-7 genetic background
as an empty container, 1 transformed ssp-1 plants with a DNA construct
using a reporter gene encoding phytohemagglutinin (PHA). PHA is a
naturally occurring seed protein native to the bean and hence already has
elements that target this polypeptide to the protein bodies of the seed.
lmmunoblots with seed extracts from bean and wild type Arabidopsis
![Page 74: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/74.jpg)
Results 66
established that wild type seeds of Arabidopsis thaliana do not contain any
PHA (Figure 10). Thus, PHA can be used as a reporter to test the empty
container hypothesis.
Strateciv for testins the hv~othesis
Due to the nature of Agrobacteriummediated transformation, the
transgenes are inserted into the genome at random. Therefore it is
necessary to determine the copy number of the PHA gene in each
transformant in order to be able to compare how much PHA is actually being
produced on a per gene basis. It is also necessary to backcross the
transformants to wild type. Such a cross would eliminate the ssp-1 mutation
and a copy of PHA would exist in a wild type genetic background in the same
chromosornal context and copy number. This is important in order to
compare levels of PHA in the homozygote transformant with the homozygote
backcross and determine if PHA is actually expressed to a greater extent in
the 'empty container'.
Homozvqote transforrnants
Ssp-1 plants were transformed with the PHA construct and 14
transformants (Tl generation) were selected on hygromycin plates, allowed
to self and make T2 seeds. The Tg seeds were then plated on hygromycin
and the T2 segregation ratios were recorded (Table 5). Individual T2 plants
were transferred to soi1 and allowed to mature. The TJ seeds from each
individual were plated on hygromycin and the segregation ratios were
![Page 75: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/75.jpg)
Results 67
recorded (Table 5). A homozygote would be expected to have 100°h
hygromycin resistant offspring. These resistant seedlings were dark green in
color, with roots penetrating the agar and formed true leaves. These plants
were transferred to soi1 and used for DNA preparations for Southern blots to
determine transgene copy number (Figure 11). A sumrnary of results for al1
the homozygote transformants and their copy numbers are listed in Table 5.
The genetic data does not correspond well to the copy number possibly due
to initiai inclusion of ungerminated (inviable) seeds in as hygromycin
susceptible seeds in the calculation of the segregation ratios and exclusion of
green seedlings that may be resistant but did not develop true leaves or have
their roots growing into the media. Another possibility is that since the ratios
were obtained prior to DNA analysis, not enough seeds were screened to
accurately reflect actual segregation patterns as increased copy numbers
also increases the complexity of the genetics.
![Page 76: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/76.jpg)
Results 68
Table 5. Summary of Results for PHA Transformants
RI bands (kb) represents the sizes of the fragments of EcoRl digested DNA hybridizing with the PHA probe. ~ y g ~ = hygrornycin resistance, H ~ ~ ~ = susceptible to hygromycin.
Tl
PHA1
PHA2
T2 Ratio ~ ~ g ~ : ~ y g ~
121
9: 1
T3
(% hyg ) R
89 95 96
T2 individual
A B A
Gene copy #
4
2
R I bands (kb)
4.9, 5.3 7.3 10.9
4.8, 9.4
![Page 77: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/77.jpg)
Resu lts 69
Figure 11. Determination of copy number of PHA transformants. DNA gel blots of homozygote F3 transformant genomic DNA digested with EcoRl and in some cases EcoRüHindlll to verify that the whole transgene was inserted. The inserted fragment containing the PHA gene is the bottom 2.8 kb piece. An 0.8kb EcoRVXbal fragment containing most of the PHA gene was used as a probe. All transformants (PHA designation was omitted from the labels) have more than one copy.
![Page 78: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/78.jpg)
Results 70
Homozvqote backcross
The PHA homozygotes were crossed to the wild type. Columbia. The
FI seeds from the cross were plated on hygromycin and expected to give
100% hygromycin resistant seedlings as each progeny should get at least
one copy of the PHA gene (Table 6). The seeds from individual FI plants
were used to grow up F2 individuals and the segregation ratios were
recorded in Table 6. Aphid infestations, damping off as well as some other
environmental factors played a role in the incompletion of this section of this
research. All plants were successfully crossed, but many of their progeny
died off at various stages leaving only a few crosses left for analysis. Only
crosses for which there is information from the Fz generation are listed in
Table 6. Hygromycin resistant F2 seedlings were transferred to soit and
allowed to self. The Fg seeds collected from ihese individuals were grown on
hygromycin and 100% hygromycin resistance should indicate a homozygote.
Plantings of F3 homozygote plants were grown for the purposes of making
genomic DNA and to collect seeds to make crude protein extracts. Genomic
DNA was made for Southern blots to determine PHA gene copy number
(Figure 12). Again the segregation ratios do not match the copy numbers
seen in the DNA gel blot. The pattern seen in the DNA gel blots from the
backcross homozygote plants matches that of the homozygote PHA
transformants demonstrating that the PHA gene is in the same copy number
and same chrornosomal context.
![Page 79: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/79.jpg)
Results 7 I
Table 6. Summary of Results for PHA Backcrosses
cross
PHA1 backcrossA
PHA7 backcrossA 1 100% 1 2.7:1 1 NIA 1 NIA 1 NIA
P HA4 backcrossA
PHA11 backcrossA
~ y g ~ = hygromycin resistance, ~ y g ' = susceptible to hygrornycin, N A = information unavailable RI Bands are the fragments from EcoRl digested genomic DNA that hybridized with the PHA probe.
FI HygR 100%
PHA assav
Despite the unusual segregation ratios for some of the plants, the
1 00%
100%
results of the DNA gel blots for the transformants and their backcrosses
FZ ratio ~ y g ~ : HygS
1 4.9: 1
seem to indicate that the transformants were homozygotes, as the
3.8:1
1 1.8:1
PHAl 4 backcrossA
generation of the same pattern in the backcross would be otherwise
F3
~ y g ~ NIA
3.7:1 98%
improbable. Since the segregation data does not correspond to gene copy
1 0O0/~ 1 0O0/o NIA
number, the seeds of the hemizygotes were used in the PHA assay to
PHA Copy number
4
NIA
compare expression between the PHA transformants and the progeny of
RI Bands (kb)
5, 5.5, 7.3, 11
4
NIA
their backcross with Columbia. Crude protein extracts were prepared from
4.8, 5.3, 7, 10.8
NIA
NIA NIA
![Page 80: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/80.jpg)
Resul ts 72
Figure 12. PHA copy number in the backcross FI homozygotes. A DNA gel blot was probed with the same 0.8kb EcoRVXbal fragment of the PHA gene that was used for the PHA homozygote transformants. Two individuals from each backcross were analyzed using digestions with EcoRl and EcoRVHindlll. The latter digests gave the expected band at 2.8kb representing the intact transgene.
approximately 100-200 seeds from each individual seed lot. Aliquots of 2 pl
and 4 pl were used to perform a Lowry assay to determine protein
concentration of the crude extracts. An SDS-PAGE was loaded with 20 pg
of protein from each sample as well as known amounts of purified PHA
(Figurel3). An immunoblot of the SDS-PAGE was done and incubated with
the 880-4 antibody (Figure 13). The immunoblots were then analyzed by
densitometry using the known amounts of PHA to create a standard curve.
The PHA levels ranged from 0.5Oh to 1.4% of the total protein in
![Page 81: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/81.jpg)
Resu lts 73
transformants, similar to the levels in the backcrosses of 0.17% to 1.5%.
Since no signal was detected for PHA8, the data obtained for PHA8 and its
backcrosses was not analyzed as no comparison can be made. The
backcrosses of transfomants PHA1, PHA4 and PHAlO al1 exhibited higher
amounts of PHA, whereas results for PHA2, PHA7 and PHAl 1 revealed
higher expression of PHA than seen in their corresponding backcrosses
(Figure 14). An interesting trend has emerged as the former set of plants
have 3 or 4 transgene copies while the latter al1 have only two (Table 5 and
6). The results from PHA7 backcross B may not be authentic as the
cruciferin bands are not seen in the corresponding SDS-PAGE (Figure 13).
The only valid explanation seems to be human error in the preparation of
samples. For many of the sets of plants, the levels of PHA detected did not
differ greatly. Only PHA2 displayed a significant enhancement of PHA
expression (1% of the total seed protein) in comparison to its backcrosses
(0.2% of the total seed protein). Therefore. there is some evidence to support
the validity the empty container hypothesis.
![Page 82: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/82.jpg)
Results 74
Q (II
1A 2 O
. - X U 0 n
m m (II
P X 0 m n 9 x a
Figure 13. Analysis of ?HA expression in primary transformants and their backcrosses. 1A, 2A) Coomassie blue stained SDS-PAGE of 20 pg of crude seed protein extracts run with long, 25ng, 50ng and lOOng of purified PHA (not detected). IB, 28) lmmunoblot of an identical SOS-PAGE gel as seen in 1A and 2A probed with antibody 880-4.
![Page 83: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/83.jpg)
--- - - -- --
% total seed protein - - A
0 R B 8 t L i u e a , PHA1
PHA1 backcross A
PHAl backcross 6
PHA2
PHA2 backcross A
PHA2 backcross B
PHA4
PHA4 backcross
PHA7
PHA backcross A
PHA backcross B
PHA10
PHAI 0 backcross
PHA11
PHAl 1 backcross - - - - - - -- - --- - - - - -- -- -A-
![Page 84: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/84.jpg)
Discussion 7 6
Discussion
Many attempts have been made to genetically enhance seed crops to
increase their agronomic or nutritive value. The limited success of such
experiments may be attributed to the high levels of endogenous proteins of
the seed and a bias toward accumulation of natural reserves. If the seed
could be partially emptied, the void could be filled by foreign or genetically
engineered proteins. This became known as the 'empty container'
hypothesis. This project had three goals: First to map the ssp-l mutation,
second to characterize the mutation at the molecular and biochemical levels,
and third to test the viability of the empty container hypothesis.
In order to validate the hypothesis, a mutant defective in the
accumulation of seed storage proteins must first be identified. Ssp-7 is such
a mutant. Defective in the accumulation of a major seed storage protein, the
12s cruciferin, ssp-7 is missing two bands from its gel profile that represent
the a and p subunits of this protein. Since the subunits are proteolytically
cleaved from the same precursor, only one gene is suggested to be
defective. Previous RNA gel blots conf in that only mRNA from one of the 3
cruciferin genes, CRU3, is missing (Riggs, unpublished results). Therefore,
the mutation exists either in the CRU3 gene or in a regulatory gene
controlling CRU3 expression.
The ssp-7 mutation was mapped by both SSLPs and RFLPs to the
distal a m of chromosome 4 near 83 CM (Tel4N=O). CRU3 has already been
![Page 85: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/85.jpg)
Discussion 7 7
cloned and mapped to chromosome 4, near cer2 (74.5 CM) (Riggs,
unpublished results). Therefore, the mapping data is consistent with a
mutation in the CRU3 gene rather than in a regulatory gene controlling its
expression. When ssp-7 was transformed using a construct containing the
CRW wild type gene, the missing protein bands in the gel profile reappeared
in ail the transformants. Therefore, the wild type gene rescued the ssp-7
mutation, confirming that the mutation exists in the CRW gene and not in a
regulatory gene.
The second goal was the molecular and biochemical characterization
of the ssp-7 mutation. The sequence of the wild type CRU3 gene has
already been detemined. Hence, sequencing the mutant copy may provide
answers as to the exact nature of the mutation as it could be in the promoter
or in the structural gene. The only difference between the wild type and
mutant CRU3 genes. was a single point mutation, in which an adenine
replaces a guanine near the end of the coding sequence of the gene (Figure
9). This transition mutation corresponds to that expected from the method of
mutagenesis (EMS). EMS is an alkylating agent that produces point
mutations but more specifically produces G-A transitions (Ahmed et al.,
1995). Therefore any tryptophan codons in the coding sequence can be
easily mutated, in frame, from TGG to TAG or TGA, with either producing
premature stop codons. This is the case in the ssp-7 cru3 gene that has a
tryptophan mutated to a premature stop codon at position 2796 in the
![Page 86: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/86.jpg)
Discussion 78
sequence (Figure 9). The cru3 transcript in ssp-7 siliques is nearly
undetectable, suggesting that the premature stop codon may be affecting the
stability of the mRNA. The causes for this phenomenon are still not fully
understood, as it is not clear how prernature termination of translation can
cause the destabilization of transcripts. The sarne behavior has been shown
in other plants, such as the Sie4 pseudogene in soybean (Calvo et al., 1997),
the cer2 mutant in Arabidopsis (Xia et al., 1996) and the globulinl nuIl allele
(Glbl -NIHb) in maize (Bhattramakki and Kriz, 1996). It has also been shown
that the PHA pseudogene (Pdlecl) in Phaseolus vulgaris has a lower level of
transcript in transgenic tobacco than wild type, and repairing the frameshift
that causes the premature stop codon returns transcript levels back to
normal (Voelker et al., 1990). More recently, the accumulation of PHA mRNA
was found to be a direct result of the affect of a frarneshift or nonsense
codon on transcript stability (Voelker et al., 1990). Also in soybean, Kunitz
trypsin inhibitor (Kti3) transcripts for the nuIl mutant and wild type gene were
transcribed at the same rate, yet the mRNA for the nul1 mutant accumulated
to greatly reduced levels (Jofuku et al., 1989). This suggests that there is a
pathway that accelerates the decay of mRNA when nonsense mutations
occur within them. This type of pathway has already been found to exist in
yeast. The UPF1 gene encodes a trans-acting factor that accelerates the
degradation of mRNAs that specifically contain a premature stop codon due
to frarneshift or nonsense mutations (Leeds et al., 1991). A homologue of
![Page 87: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/87.jpg)
Discussion 79
UPF1, RENTI, has been identified in mammals and contains the same
functional elements as the yeast gene (Perlick et al., 1996). Although there
is no direct evidence of this in plants, the fact that this pathway exists in other
eukaryotes is compelling. Previous evidence of premature stop codons
occurring at less than 60% of the coding sequence show that these
transcripts are recognized as abnormal and are rapidly degraded (Abler and
Green, 1996). Conversely, premature stop codons found to occur past 80%
of the coding sequence are not subjected to degradation and are translated
as usual (Abler and Green, 1996). If this is correct. then the ssp-1 cru3
transcript should be stable, as the mutation occurs at about 90°h of the
coding region. Although this is not the case, it is still probable that any
requirement for translation of a specific region in order to maintain transcript
stability is already present and more iikely the transcript was degraded by the
aforementioned pathway. It is possible that the machinery for degradation of
transcripts may recognize a cis factor in the last 10% of the mutant transcript
that is normally covered by ribosomes (Abler and Green, 1 996).
Biochemical analysis of the mutation showed that only the seed
protein fraction exhibits a significant difference relative to the wild type seed
protein levels. There was no significant difference in the levels of starch
within the seed for ssp-7, compared ta wild type. Also, the lipid component
of the seeds was analyzed and it was determined that the composition of
lipids was relatively unchanged. Antithetically, the protein fraction differed
![Page 88: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/88.jpg)
Discussion 80
greatly between the ssp-1 and the wild type seeds. If a mutant, such as ssp-
1, is deficient in a major seed storage protein, one would expect to see the
lower levels of total protein that is seen in ssp-1 but the literature contradicts
this assumption. In previous studies, it has been demonstrated that if there
is a decrease in one type of seed storage protein, another type of protein is
overexpressed in order to compensate resulting in unchanged or increased
total protein levels. If a major endogenous seed protein could be repressed
then there may be an increase in other endogenous or transgene proteins.
The absence of lectin in one strain of Phaseolus vulgaris (bean), led to the
overproduction of phaseolin without any decrease in seed size or total seed
protein (Osborn and Bliss, 1985). Sirnilar results where reduction of one
protein fraction resulted in the increase of another, were found in corn, bariey
and soybean (Osbom et al., 1985). In another line of P.vulgaris, a gene for
the protein arcelin was introduced whose expression resulted in a 50%
decrease of phaseolin (Romero-Andreas et al., 1 986). Crosses were made
to create strains where arcelin and PHA genes were expressed in nuIl
phaseolin bean plants (Hartweck and Osbom, 1 997). Elevated arcelin and
PHA levels compensated for the lack of phaseolin without decreasing the
total amount of protein (Hartweck and Osbom, 1997). Finally, there is the
inverse relationship between napin and cruciferin in Brassica napus. The
introduction of antisense genes for either protein resulted in the increase in
the other without affecting the total protein or lipid content (Kohno-Murase et
![Page 89: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/89.jpg)
Discussion 8 I
al., 1994, Kohno-Murase et al., 1995) and fatty acid composition (Kohno-
Murase et al., 1995). These results provide good evidence that some sort of
regulation of seed storage protein composition must exist, perhaps in the
form of a sensor that can detect the levels of macromolecules in the seed. If
abnormal levels were detected, the sensor would somehow modulate
expression patterns of seed components to compensate. The existence of a
sensor may explain, in part, why foreign transgenes are not expressed at
high levels. In addition to positional effects on transcriptional activation. the
transgene mRNA would be in competition with endogenous mRNAs and
would contribute a small percentage to the total which is measure by the
sensor. Also, because these are foreign mRNAs. they may be prone to
degradation. Thus, the transgenic seed may fiIl normally and low levels of
foreign protein could be considered normal.
The ssp-1 mutant is abnormal in that the cruciferins fail to accumulate
to normal levels and there appears to be no obvious increases in the other
proteins, nor in the lipids or starch levels. Hence, ssp-1 is a non-
cornpensating mutant which might have bypassed the sensor mechanism.
Molecular analysis revealed that the ssp-1 phenotype is due to the
introduction of a premature stop codon. Previous RNA gel blot experirnents
showed that there is very little CRU3 mRNA. Together, these results are
consistent with the interpretation that the CRU3 mRNA is unstable, and
suggests that the sensor operates at the level of transcriptional activation.
![Page 90: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/90.jpg)
Discussion
A similar mutant was characterized in soybean. A mutant was found
to be lacking the 7s globulin (P-conglycinin) subunits produced by a single
recessive gene (Hayashi et al., 1998). These authors suggested that the
lack of 7s globulin subunits is not due to any defect in the structural gene but
occurs at the transcript level. either at the level of transcription or it may be
due to rapid degradation of transcripts (Hayashi et al., 1998). However,
transient expression of chimeric genes of 7s promoters and GUS in seeds,
and gel shift mobility assays using soybean embryo extracts both suggest
that transcription factors are present (Hayashi et al.. 1998). The gene was
not cloned or sequenced and hence the exact nature of the mutation is not
known, but this mutant also may provide an 'empty container' and be useful
in improving the quality of soybean.
The third goal of this project was to test if foreign proteins can be
overexpressed in seed storage protein mutants defective in seed filling. To
determine if çsp-1 can be useful as a 'empty container', the amount of protein
that is missing from its seeds must be determined. The Lowry assay
demonstrated that ssp-1 seeds contain less protein than wild type seeds and
therefore may act as the 'empty container'. To gauge the usefulness of the
ssp- 1 genetic background as an empty container, I transformed ssp- 1 plants
with a DNA construct using a seed specific gene from bean called
phytohemagglutinin (PHA) as the reporter gene.
![Page 91: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/91.jpg)
Discussion 83
Only recently has a high level of expression of foreign proteins in
seeds been shown in transgenic experiments. Tobacco has been
transformed with many genes under the control of their own promoters. The
results have been limited as expression levels have been generally low:
0.2% of the total seed protein for soybean lectin (Okamuro et al., 1986).
0.02-0.05% for PHA-L (Voelker et al., 1989), 0.2% -0.9% for PSI lectin (de
Pater et al., 1996) and 0.5% for vicilin (Higgins et al., 1988). Perhaps these
findings were a result of using the genets own promoter which does not result
in high expression or that tobacco seeds cannot tolerate high expression
levels of foreign proteins. However, the maize 15 kD zein was placed under
the regulation of the French bean P-phaseolin gene flanking regions and
expressed in transgenic tobacco. The amount of zein accumulation varied
between 0.02% and 1.6% of the total seed protein (Hoffman et al.. 1987).
Similarly, the coding region of the Brazil nut methionine-rich 2s albumin gene
(18% Met) was also placed under the control of the phaseolin promoter and
in transgenic tobacco increased the levels of Met by 30% in the seed
proteins as compared to that of untransfoned plants (Altenbach et al.,
1989). The Brazil nut protein may represent up to 8% of the total salt-
extractable seed protein in tobacco. The Brazil nut albumin was also
expressed in transgenic canola which accurnulated the protein from 1.7% to
4.0% of the total seed protein and contained and increase of 33% Met
(Altenbach et al., 1992). Sunflower seed albumin is rich in methionine and
![Page 92: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/92.jpg)
Discussion 81
cysteine and was transformed into lupin (Lupinus angustifolius L.) under
control of the pea vicilin gene. One transgenic plant expressed a single
tandem insertion of the gene that resulted in the accumulation of the protein
to 5% of extractable seed protein. This was accompanied by a 94% increase
in methionine content and 12% decrease in cysteine content as compared to
wild type (Molvig et al., 1997). The pea legumin gene under the control of
the rice glutenin promoter was expressed in the endosperrn of transgenic rice
plants to a maximum of 4.24% of the total protein (Sindhu et al., 1997).
Based on these results, it appears that the expression of foreign genes in
plants seems variable and may depend on factors such as the type of host
plant and the type of promoter used.
Recently, Goosens et al. (1 999A) transforrned bean and Arabidopsis
with the gene coding for arcelin. Arcelin is an abundant seed storage protein
(30-40% total seed protein) encoded for by 2 genes found in some wild type
bean genotypes and is related to PHA and a-amylase inhibitor genes. High
expression in the bean at 1525% and 145% of the total seed protein in
Arabidopsis was observed (Goosens et al., 1999A). Such a high level of
transgene expression in the seed has never been reported before. This
seems to suggest that an 'empty container' may not be needed as it is
possible to achieve high levels of expression without further modification of
any other seed protein fractions. However, Goosens et al. (1999A) used only
1-2 seeds per assay for bean which introduces a large probability of error. It
![Page 93: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/93.jpg)
Discussion 85
has been previously shown in soybean that analysis of small seed samples
or individual seeds may not accurately reflect protein values for an individuai
plant, as protein content has been shown to Vary between seeds from
different parts of the plant (Escalante and Wilcox, 1993 and references
within).
Goosens et al. (19998) also examined the expression of the arcelin
gene in transgenic plants also carrying an antisense napin gene for
Arabidopsis. It was thought that expression levels couid be enhanced due to
the negative relationship between different protein fraction within the seed
(as discussed earlier). This research would also seem to test the empty
container hypothesis. This group reported that expression levels rose to 8-
25% of the total seed protein in transgenic plants carrying both the arcelin
gene and napin antisense gene as compared to transformants still producing
napin at wild type levels. The fact that they only used the highest expressing
lines of the transformants in their cornparisons rnust be considered in the
evaluation of the vaiidity of these results. The amount of expression varies
greatly between lines and does not have a strong correlation to transgene
copy number. Therefore, the comparison must consider other factors such
as the transgene insertion site, as it may play a role in determining the level
of expression of the transgene. However, what these findings do seem to
establish is that the seed has the biosynthetic capacity to direct its energy
towards the production of a foreign protein when an endogenous protein is
![Page 94: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/94.jpg)
Discussion 36
repressed. This is supported by Kohno-Murase et al. (1994) where the
introduction of an antisense gene for napin into B.napus, resulted in the
increase of endogenous cruciferin, the other major seed protein in the seed.
Goosens et al. (19998) did not report seeing a significant increase in this
protein class. It can be theorized that once the resources are freed as a
consequence of the seed not producing napins, the available resources were
used in the production of arcelin as opposed to cruciferin. Perhaps the
arcelin gene out competed the cruciferin genes for factors and transcription
machinery. Evidence for this is the over 50°h decrease in phaseolin levels in
strains of Pwlgaris containing a novel arcelin gene, suggesting it may have
a stronger promoter than the endogenous protein (Romero-Andreas et al.,
1 986).
Now that it has been shown that the seed has the capacity to highly
express a foreign protein. what remains is to demonstrate whether or not
seeds c m be genetically rnodified in order to increase agronomic value
through increases in traits such yield, quality and nutritive value. If so, the
seed also has the potential to harbor and express genes for
biopharmaceuticals. I generated PHA transformants in the ssp-1 background
(the empty container) where the gene was placed under the control of its own
promoter. Arcelin and ?HA are related and so perhaps one rnight expect to
produce a line with same amount of expression seen in the study mentioned
previously. Unfortunately, the transgenic plants gave low expression levels
![Page 95: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/95.jpg)
Discussion
of PHA ranging from 0.5% to 1.4% of the total seed protein but transgenic
plants with low levels of expression were also seen in the aforementioned
study. Therefore, further research needs to be performed to increase Our
understanding of how the expression of seed storage genes iç regulated. It
may be a matter of trial and error to find a transgenic line of plants with high
expression of the desired protein in the seed.
These PHA transfonants were backcrossed to Col to produce an
individual with the same ?HA transgene copy number and in the same
chromosomal context but in a wild type background (full container).
Theoretically, if the empty container hypothesis is correct then the
transformant should exhibit higher expression levels as compared to its
backcrosses. I found that the levels were actually lower in the wild type
genetic background versus the ssp-1 genetic background for transfonants
with 3 or 4 copies of the transgene (PHAl. PHA4. PHAIO). The amount of
expression of the transgene may be attributed to the copy number of the
inserted gene but a direct correlation was not observed in this or other
studies (Goosens et al.. f999B). Expression may also depend on the site of
integration of the transgene in the genome and there exists the possibility
that the transgene inserted itself into an area of the genome that cannot be
transcribed at high rates.
Results lending credibility to the empty container hypothesis were
seen for three of the transformants, PHA2, PHA7 and PHAI 1 and their
![Page 96: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/96.jpg)
Discussion 8s
corresponding backcrosses. All of these plants carried 2 copies of the PHA
transgene. Only PHA2 showed a significant enhancement of expression ( I o h
of total seed protein) relative to levels of PHA accumulation in the seeds of
its backcrosses (0.2% of total seed protein) albeit overall expression of PHA
in each plant was extremely low. This provides potential evidence to support
the empty container hypothesis, as expression was five times greater in the
ssp-7 background as opposed to the wild type background. The results of
this research do not hold convincing arguments in favor of the empty
container hypothesis but do show some promise. Another attempt should be
made to gather concrete evidence that the empty container hypothesis is
valid. It would be wise to repeat these experiments with a few changes.
Firstly, it is important to identify a transformant with a single copy of the
inserted gene as it simplifies genetic analysis and quantification of
expression levels as the effects of multiple copy number are unknown. Also.
it would be beneficial to screen for a homozygote transgenic line that
expresses and accumulates the desired protein to high levels. It would be
interesting to also investigate if there is a molecular basis for the differences
in expression between transgenic lines containing the same copy number.
Nevertheless, these findings demonstrate that further research must be done
in order to gain a greater understanding into the control of seed storage gene
expression. This might provide clues on how scientists might manipulate
![Page 97: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/97.jpg)
Discussion
genes to overproduce proteins for crop improvement and as a means for low
cost production of proteins of interest to pharmaceutical and other industries.
![Page 98: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/98.jpg)
SUMMARY AND CONCLUSIONS
The ssp-1 mutation was mapped to chromosome 4 near the CRU3
gene, at position 83 CM. This research has determined that the molecular
basis for the deficiency is a single base pair mutation, a G-A transition, in the
CRU3 gene that results in a prernature stop codon. Not much is known about
how premature stop codons can affect transcript stability or degradation so,
future studies may prove useful in understanding this phenornenon.
The biochemical characterization of the mutant shows that the protein
content of ssp-Vssp-1 seeds is 20-27OI0 less than wild type whereas the other
protein fractions, the çtarch levels and lipid composition remain relatively
unchanged. Previous evidence dictates that when one protein is reduced
another one overexpresses itself to compensate. Therefore, ssp-1 can be
considered a novel non-compensating mutant.
PHA was successfully expressed in transgenic ssp-7 plants but at very
low levels of 0.5'' to 1.4% of the total seed protein. Such low expression has
been reported previously in different transgenic experiments. These PHA
transgenic plants were al1 backcrossed to see if the ssp-1 genetic background
could enhance expression of the reporter gene. One transformant with 2
transgene copies showed five times the PHA accumulation level in its seeds
than the seeds of its backcrosses. These results suggest that the empty
container hypothesis is indeed valid and future studies into the regulation and
control of seed storage proteins must be done.
![Page 99: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/99.jpg)
References 9 I
References
Abler, M. L. and Green, P. L. (1996). Control of mRNA stability in higher plants. Plant Mol. Biol. 32: 63-78
Ahmad, M., Lin, C. and Cashmore, A. R. (1995). Mutations throughout an Arabidopsis blue-lig ht photoreceptor impair blue-light-responsive anthocyanin accumulation and inhibition of hypocotyl elongation. Plant J. 8 (5): 653-658
Altenbach, S. B., Pearson, K. W., Meeker, G., Staraci, L. and Sun, S. S. M. (1989). Enhancement of the methionine content of seed proteins by the expression of a chimeric gene encoding a methionine-rich protein in transgenic plants. Plant Mol. Biol. 13: 513-522
Altenbach, S. B., Kuo, C., Staraci, L., Pearson, K. W., Wainwright, C., Georgescu, A. and Townsend, J. (1 992). Accumulation of a Brazil nut albumin in seeds of transgenic canola results in enhanced levels of seed protein methionine. Plant Mol. Biol. 18: 235-245
An, G., Ebert, P. R., Mitra, A. and Ha, S. B. (1988). Binary vectors. Plant Molecular Bioloqy Manual A3: 1-1 O Kluwer Academic Publishers, Dordrecht
Battey, J. F., Schnid, K. M. and Ohlrogge, J. B. (1989). Genetic engineering for plant oils: potential and limitations. TIBTECH 7: 122- 126
Bâumlein, H., Miséra, S., LuerOen, H., Kollee, K., Horstmann, C., Wobus, U. and Müller, A. J. (1994). The FUS3 gene of Arabidopsis thaliana is a regulator of gene expression during late embryogenesis. Plant J. 6(3): 379-387
Bechl, A. E. and Anderson, O. Dm (1996). Expression of a novel high- molecular-weight glutenin subunit gene in transgenic wheat. Nature Biotechnology 14: 875-879
Bell, C. J. and Ecker, J. R. (1994). Assignment of 30 microsatellite loci to the lin kage map of Arabidopsis. Genomics 19: 1 37-1 44
![Page 100: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/100.jpg)
References 92
Benedict, J. H o , Sachs, E. S., Altman, D. W., Deaton, W. R., Kohel, R. Jo, Ring, Do R. and Berberich, S. A. (1 996). Field performance of cottons expressing transgenic CrylA insecticidal proteins for resistance to Heliothis virencens and Helicoverpa zea (Lepidoptera: Noctuidae). J. Econ. Ent. 89 (1): 230-238
Bent, A and Clough, S. (1 997). Agrobacterium germ-line transformation: Transformation of Arabidopsis without tissue culture. Plant Molecular Biolocw Manual, Second edition Kluwer Acadernic Pubiishers, Dordchect
Bhattramakki, D. and Kriz, A. L. (1 996). Nucleotide sequence analysis of a novel globulinl nuIl allele from the Illinois high protein strain of maize. Plant Mol. Biot, 32: 121 5-1 21 9
Calvo, E. S., Wurtle, E o S. and Shoemaker, R o C. (1997). Cloning, mapping and analyses of expression of the Em-like gene family in soybean [Glycine max (L). Merr.] Theor. Appl. Genet. 94: 957-967
Casey, R., Bewley, J. Do and Greenwood, J. S. (1997). Protein storage and utilization in seeds. Plant Metabolism, Second edition pg. 539- 557 Addison Wesley Longman Limited Essex
DeClerq, A. Dmy Vandewiele, M o , Van Damme, Jo, Guerche, P., Van Montagu, M., Vandekerckhove, J. and Ktebbers, E. (1990). Stable accumulation of modified 2s albumin seed storage proteins with higher methionine contents in transgenic plants. Plant Physiol. 94: 970-979
Dellaporta, S. L., Wood, J. W. and Hicks, J o B o (1985). Maize DNA miniprep. Molecular Bioloav of Plants: A Laboratorv Course Manual Cold Spring Harbor Laboratory Press NY
de Pater, S., Pham, K., Klitsie, I and Kijne, J o (1996). The 22bp W1 element in the pea lectin promoter is necessary and as a multimer, sufficient for high gene expression in tobacco seeds. Plant Mol. Biol. 3251 5-523
Enriquez-Obregon, G. A., Vazquez-Padron, R. I., Prieto-Samsonov, D. L., De la Riva, G. A. and Selman-Housein, G. (1998). Herbicide- resistant sugarcane (Saccharum officinarum L.) plants by Agrobacterium-mediated transformation. Planta 206: 20-27
![Page 101: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/101.jpg)
References 93
Esau, K. (1977). Anatomv of Seed Plants. Second edition. John Wiley & Sons, lnc. NY
Escalante, E. E. and Wilcox, J. Ra (1993). Variation in seed protein among nodes of normal- and high-protein soybean genotypes. Crop Sci. 33: 1164-1 166
Fabri, C. O. and Schaffner, A. R. (1994). An Arabidopsis thaliana RFLP mapping set to localize mutations to chromosomal regions. Plant J. 5 (1): 149-1 56
Feinberg, A. P. and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-1 3
Gallo-Meagher, M. and Irvine, J. E. (1 996). Herbicide resistant transgenic sugarcane plants containing the bar Gene. Crop Sci. 36: 1367-1374
Giroux, M. J., Boyer, C., Feix, G. and Hannah, L. C. (1994). Coordinated transcriptional regulation of storage product genes in the maize endosperm. Plant Physiol. 106: 71 3-722
Goosens, A., Dillen, W., De Clerq, J., Van Montagu, M. and Angenon, G. (1 999A). The arcelin-5 gene of Phaseolus vulgaris directs high seed- specific expression in transg enic Phaseolus acutifolius and Arabidopsis plants. Plant Physiol. 120: 1 095-1 1 O4
Goosens, A., Van Montagu, M. and Angenon, G. (1999B). Co- introduction of an antisense gene for an endogenous seed storage protein can increase expression of a transgene in Arabidopsis thaliana seeds. FEBS Letters 456: 160-1 64
Habben, J. E. and Larkins, B. A. (1995). lmproving the protein quality in seeds. In Seed Develo~ment and Germination. edited by Kigel, J. and Galili, G. Marcel Dekker, New York pg 791 -81 0
Halcomb, J. La, Benedict, J. H., Cook, B. and Ring, D. R. (1996). Sumival and growth of bollworm and tobacco budworm on nontransgenic and transgenic cotton expressing a CrylA insecticidal protein (Lepidoptera: Noctuidae). Env. Ent. 25 (2): 250-255
Hartman, C. L., Lee, L., Day, P. R., and Turner, N. E. (1994). Herbicide resistant turfgrass (Agrostis palustris Huds.) by biolistic transformation. Biotechnology. 12: 9 1 9-923
![Page 102: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/102.jpg)
References 94
Hartweck, L. M. and Osborn, T. C. (1997). Altering protein composition by genetically removing phaseolin from common bean seeds containing arcelin or phytohemagglutinin. Theor. Appl. Genet. 95: 101 2-1 01 7
Hayashi, M., Harada, K., Fujiwara, T. and Kitamura, K. (1998). Characterization of a 7 s globulin deficient mutant of soybean (Glycine max (L.) Merrill). Mol. Gen. Genet. 258: 208-214
Higgins, T. J. V. (1984). Synthesis and regulation of major proteins in seeds. Ann. Rev. Plant Phys. 35: 191 -221
Higgins, T. J. V., Newbigin, E. J., Spencer, D., Llewellyn, D. J. and Craig, S. (1 988). The sequence of a pea vicilin gene and its expression in transgenic tobacco plants. Plant Mol. Biol. 1 1 : 683-695
Hoffman, L. M., Donaldson, D. D., Bookland, Roger and Herrnan, E. M. (1987). Synthesis and protein body deposition of maize 15-kd zein in transgenic tobacco seeds. EMBO J. 6(11): 321 3-3221
Hoffman, L. M., Donaldson, D. D. and Herman, E. M. (1988). A modified storage protein is synthesized, processed, and degraded in the seeds of transgenic plants. Plant Mol. Biol. 1 1 : 71 7-729
Ivy, J. M., Beremand, P.D. and Thomas, T. L. (1998). Strategies for modifying fatty acid composition in transgenic plants. Biotech. and Gen. Eng. Reviews 15: 271-288
Jenkins, J. N., McCarty, J. C., Buehler, R. E., Kiser, J., Williams, C. and Wofford, T. (1997). Resistance of cotton with gendotoxin from Bacillus thuringiensis var. kurstaki on selected Lepidopteran insects. Agron. J. 89: 768-780
Jofuku, K. Dm, Schipper, R. D. and Goldberg, R. B. (1989). A frameshift mutation prevents kunitz trypsin Inhibitor mRNA accumulation in soybean embryos. Plant Cell 1 : 427-435
Kiegel, J and Galili, G. (1995). Seed develo~ment and oenination. Marcel Dekker Inc., New York
Kohno-Murase, J., Murase, M., Ichikawa, H. and Imamura, J. (1994). Effects of an antisense napin gene on seed storage compounds in transgenic Brassica napus seeds. Plant Mol. Biol. 26: 1 1 15-1 124
![Page 103: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/103.jpg)
References 95
Kohno-Murase, J., Murase, M., Ichikawa, H. and Imamura, J. (1995). lmprovement in the quality of seed storage protein by transformation of Brassica napus with an antisense gene for cruciferin. Theor. Appl. Genet. 91: 627-631
Kortt, As A., Caldwell, Js B., Lilley, G. G. and Higgins, Tm J. V. (1991). Amino acid and complimentary DNA sequence of a methionine-rich 2s protein from sunflower seed (Helianthus annus L.). Eur. J. Biochem. 195: 329-
Kriz, A. L. and Larkins, B.A. (1 991). Biotechnology of seed crops: Genetic engineering of seed storage proteins. Hort. Sci. 26 (8): 1036-1 038
Kusnadi, A. R., Nikolov, 2. L. and Howard, J. A. (1997). Production of recombinant proteins in transgenic plants: Practical considerations. Biotech. 8ioeng. 56 (5): 473-484
Leeds, P., Peltz, S. W., Jacobson, A. and Culbertson, M. R. (1 991). The product of the yeast UPFI gene is required for rapid turnover of mRNAs containing a premature translational termination codon. Genes and Dev. 5: 2303-2314
Lin, Y., Lin, S., Nguyen, L. V., Rachubinski, R. A. and Goodman, H. M. (1999). The Pexl6p homolog SSEl and storage organelle formation in Arabidopsis seeds. Science 284: 328-330
Lopes, M. A. and Larkins, B. A. (1993). Endosperm origin, development, and function. Plant Cell 5: 1383-1399
Lowry, O. H., Rosebrough, N. J., Fm, A. L. and Randall, R. J. (1951). Protein measurement with the folin phenol reagent. J. Biol. Chem. 193: 265-275
Lynch, R. E., Wiseman, B. R., Plaisted, Dm and Warnick, Dm (1999). Evaluation of transgenic sweet corn hybrids expressing CrylA(b) toxin for resistance to corn earworrn and fall armyworm (Lepideptera: Noctuidae). J. Econ. Ent. 92(1):246-252
Martin, Ce and Smith, A. M. (1 995). Starch biosynthesis. Plant Ceil. 7: 971 - 985
Mazliak, P. (1994). Desaturation processes in fatty acid and acyl lipid biosynthesis. J. Plant Physiol. 143: 399-406
![Page 104: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/104.jpg)
References (16
McKinney, E. C., Ali, N., Trau?, A., Feldmann, K. A., Belostotsky, D. A., McDowell, J. M. and Meagher, R. B. Sequence-based identification of T-DNA insertion mutations in Arabidopsis: actin mutants act2-1 and act4-1. Plant J. 8 (4): 61 3-622
Meinke, D. (1 994). Seed development in Arabidopsis thaliana. Arabidopsis. pg 253-295 Cold Spring Harbor Laboratory Press, New York
Meinke, D. and Koornneef, M. (1997). Community standards for Arabidopsis genetics. Plant J . 1 2(2): 247-253
Molvig, Lm, Tabe, Lm M., Eggum, B. O., Moore, A. E., Craig, S., Spencer, D. and Higgins, T. J. V. (1997). Enhanced methionine levels and increased nutritive value of seeds of transgenic lupins (Lupinus angustifolius L.) expressing a sunflower seed albumin gene. Proc. Natl. Acad. Sci. USA 94: 8393-8398
Moran, R., Garcia, R., Lopez, A., Zaldua, Z., Mena, J., Garcia, M., Armas, Ra, Somonte, Da, Rodriguez, J. Gomez, M. and Pimentel, E. (1 998). Transgenic sweet potato plants carrying the delta-endotoxin gene form Baci//us thuringiensis var. tenebrionis. Plant Sci. I N @ ) : 175-1 84
Murashige, T. and Skoog, Fm (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 15: 473- 497
Nambara, E., Keith, K, McCourt, P. and Naito, S. (1995). A regulatory role for the AB13 gene in the establishment of embryo maturation in Arabidopsis thaliana. Development 1 21 (3) : 629-936
Nordlee, J. A., Taylor, S. Lm, Townsend, J. A., Thomas, L. A. and Bush, R. K. (1996). Identification of a Brazil-nut allergen in transgenic soybeans. N. Eng. J. Med. 334: 688-692
Ohlorogge, J. and Browse, J. (1995). Lipid Biosynthesis. Plant Cell 7: 957-970
Ohtani, T., Galili, Ga, Wallace, J. C., Thompson, G. A. and Larkins, B. A. (1 991). Normal and lysine-containing zeins are unstable in transgenic tobacco seeds. Plant Mol. Biol. 16: 117-128
![Page 105: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/105.jpg)
References 97
Okamuro, J. K., Jofuku, K. D. and Goldberg R. B. (1986). Soybean seed lectin gene flanking nonseed protein genes are developmentally regulated in transformed tobacco plants. Proc. Natl. Acad. Sci. USA 83: 8240-8244
Osborn, T. C. and Bliss, F. A. (1985). Effects of genetically removing lectin seed protein on horticultural and seed characteristics of common bean. J. Amer. Soc. Hort. Sci. 11 O(4): 484-488
Osborn, T. C., Brown, J. W. S. and Bliss, F. A. (1985). Bean lectins. Theor. Appl. Genet. 70: 22-31
Pang, P. P., Pruitt, R. E. and Meyerowitz, E. M. (1988). Molecular cloning. genomic organization, expression and evolution of 12s seed storage protein genes of Arabidopsis thaliana. Plant Mol. Biol. 11 : 805-820
Perlak, F. J., Deaton, R. W., Armstrong, T. A., Fuchs, R. L., Sims, S. R., Greenplate, J. T. and Fischoff, O. A. (1990). lnsect resistant cotton plants. Biotechnology 8: 939-943
Perlick, H.A., Medghalchi, S. M., Spencer, F. A., Kendzior Jr., R. J. and Dietz, H. C. (1996). Mammalian orthologues of a yeast regulator of nonsense transcript stability. Proc. Natl. Acad. Sci. USA 93:10928- 10932
Ramachandran, S., Berntin, G. D., AII, J. N., Raymer, P. L. and Stewart, C. N. (1 998). Greenhouse and field evaluations of transgenic canola against diamond back moth, Plutella xyostella and corn earworm, Helicoverpa zea. Entomologia Experimentalis et Applicata. 88(1): 17- 24
Raven, P. H., Evert, R. F. and Curtis, H. (1981). Bioloqv of Plants. Third edition. Worth Publishers, lnc. NY
Riggs, C. D., Voelker, T. A. and Chrispeels, M. J. (1989). Cotyledon nuclear proteins bind to DNA fragments harboring regulatory elements of phytohemagglutinin genes. Plant Cell l(6): 609-622
![Page 106: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/106.jpg)
References 98
Romero-Andreas, J., Yandell, B. S. and Bliss, F. A. (1986). Bean arcelin 1. lnheritance of a novel seed protein of Phaseolus vulgaris L. and its affect on seed composition. Theor. Appl. Genet. 72: 123-128
Sambrook, J., Fritsch, E. F. and Maniatis, Tm (1989). Molecular Clonina: A Laboratory Manual, Second Edition Cold Spring Harbor Laboratory Press NY
Sakamoto, A., Murata, A and Murata, N. (1998). Metabolic engineering of rice leading to biosynthesis of glycinebetaine and tolerance to sait and cold. Plant Mol. Biol. 38: 101 1-1 01 9
Shaul, 0. and Galili, G. (1992). Threonine overproduction in transgenic tobacco plants expressing a mutant desensitized aspartate kinase of Escherichia coli. Plant Physiol. 100: 1157-1 163
Shewry, P. R., Tatham, A. S., Halford, N. G., Barker, J. H. A., Hannappel, P. G., Thomas, M. and Kreis, M. (1994) Opportunities for manipulating the seed protein composition of wheat and bariey in order improve quality. Transgenic Research 3: 3-1 2
Shewry, P. RB, Napier, J. A. and Tatham, A. S. (1995). Seed storage proteins: Structures and biosynthesis. Plant Ce11 7:945-956
Sindhu, A. S., Zheng, Z. and Murai, N. (1997) The pea seed storage protein legumin was synthesized. processed and accumulated stably in transgenic rice endosperm. Plant Sci. 130: 189-1 96
Snedden, W. and Fromm, Hm (1997). Characterization of the plant homologue of prohibitin, a gene associated with antiproliferative activity in mammalian cells. Plant Mol. Biol. 33: 753-756
Sokal, R. R. and Rohalf, Fm J. (1987). Introduction to biostatistics. W. H. Freeman and Company, New York
Stalker, D.M., McBride, K. E. and Malyj, L. D. (1988). Herbicide resistance in transgenic plants expressing a bacterial detoxification gene. Science 242: 41 9-422
Tissue, D. T. and Wright, S. J. (1995). Effect of seasonal water availability on phenology and the annual shoot carbohydrate cycle of tropical forest shru bs. Functional Ecology 9: 5 1 8-527
![Page 107: Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana Master of Science 2000 Jane Sung Yun Lee Ssp-7 is a mutant deficient in the accumulation](https://reader035.vdocuments.mx/reader035/viewer/2022071301/609901b14c14223a6d34d05d/html5/thumbnails/107.jpg)
References 99
Voelker, T. A., Sturm, A. and Chrispeels, M. J. (1987). Differences in expression between two seed lectin alleles obtained from normal and lectin deficient beans are maintained in transgenic tobacco. EMBO J. 6(12): 3571-3577
Voelker, T. A., Herman, E. M. and Chrispeels, M. J. (1989). In vitro mutated phytohemagglutinin genes expressed in tobacco seeds: Role of glycans in protein targeting and stability. Plant Cell 1 : 95-104
Voelker, T. A., Moreno, J. and Chrispeels, M. J. (1 990). Expression analysis of a pseudogene in transgenic tobacco: A frameshift mutation prevents mRNA accumulation. Plant Cell 2: 255-261
West, M. A. L. and Harada, J. J. (1993). Embryogenesis in Higher Plants: An Ovewiew. Plant Cell 5: 1 361 -1 369
Wilson, F. O., Flint, H. M., Deaton, W. R., Fischhoff, O. A., Perlak, F. J., Armstrong, T. A., Fuchs, R. L., Berberich, S. A., Park, N. J. and Stapp, B.R. (1992). Resistance of cotton lines containing a Bacillus thuringiensis toxin to pink bollworm (Lepidoptera: Gelechiidae) and other insects. J. Econ. Ent. 85 (4): 1517-1519
Xia, Y., Nikalau, B. J. and Schnable, P.S. (1996). Cloning and characterization of CER2, an Arabidopsis gene that affects cuticular wax accumulation. Plant Cell 8: 1 29 1-1 304
Yamauchi, D. and Minamikawa, T. (1998). lmprovement of the nutritional quality of legume seed storage proteins by molecular breeding. J. Plant Res. 11 1: 1-6