Upload File

Download - Klinghoffer et al. Table S1

Transcript
Page 1: Klinghoffer et al. Table S1

Klinghoffer et al. Table S1

Table S1. 19-mer sequences used in this study

siRNA sense sequenceCDKN1A-558 GCCGGCTGATCTTCTCCAAE2F1-503 GCTATGAGACCTCACTGAAEZH2-1636 GGATACTCCTCCAAGGAAAEZH2-2292 GTGATCACAGGATAGGTATFDXR-1260 GTGTCATAGCCACAACCATTP53-1026 GACTCCAGTGGTAATCTAC

Top Related

Thoughts - XXV [Compilation, Kurdistan, Temple Mount, Klinghoffer, Guns, Amnesty, Ebola, Midterms, Judge-McCaffrey]
Thoughts - XXV [Compilation, Kurdistan, Temple Mount, Klinghoffer, Guns, Amnesty, Ebola, Midterms, Judge-McCaffrey]
Table S1 Name, waterscape and geographical location of all … · 2020. 7. 24. · 1 S1 Methods S1.1 Information on sampling stations Table S1 Name, waterscape and geographical location
Table S1 Name, waterscape and geographical location of all … · 2020. 7. 24. · 1 S1 Methods S1.1 Information on sampling stations Table S1 Name, waterscape and geographical location
Supplementary Table S1. Class/agent Cell lines/xenograft ......1 46021_1_supp_1_l0z6ns.doc Supplementary Table S1. Preclinical studies of combinations of bortezomib and novel targeted
Supplementary Table S1. Class/agent Cell lines/xenograft ......1 46021_1_supp_1_l0z6ns.doc Supplementary Table S1. Preclinical studies of combinations of bortezomib and novel targeted
Supplementary Table S1 - ncbi.nlm.nih.gov
Supplementary Table S1 - ncbi.nlm.nih.gov
ADAMS I Must Have Been Hysterical (The Death of Klinghoffer)
ADAMS I Must Have Been Hysterical (The Death of Klinghoffer)
Table S1: The function and clinical relevance of select ... · Table S1: The function and clinical relevance of select ... ... Neuron The
Table S1: The function and clinical relevance of select ... · Table S1: The function and clinical relevance of select ... ... Neuron The
Table S1. Bacterial strains and plasmids Strain or plasmid
Table S1. Bacterial strains and plasmids Strain or plasmid
from methylamine during chlorination: The formation ... · Contents Item Page Scheme S1 5 Table S1 6 Table S2 7 Table S3 8 Figure S1 10 Figure S2 11 Standard orientation of TS-0W/B3LYP
from methylamine during chlorination: The formation ... · Contents Item Page Scheme S1 5 Table S1 6 Table S2 7 Table S3 8 Figure S1 10 Figure S2 11 Standard orientation of TS-0W/B3LYP