Immunity, Volume 52
Supplemental Information
Single-Cell RNA Sequencing of Tumor-Infiltrating
NK Cells Reveals that Inhibition of Transcription
Factor HIF-1a Unleashes NK Cell Activity
Jing Ni, Xi Wang, Ana Stojanovic, Qin Zhang, Marian Wincher, Lea Bühler, AnnetteArnold, Margareta P. Correia, Manuel Winkler, Philipp-Sebastian Koch, VeronikaSexl, Thomas Höfer, and Adelheid Cerwenka
1
Figure S1
2
Figure S1. NK cells from Hif1af/fNcr1iCreTg mice show unaltered development and
function. Related to Figure 1
(A) Hif1af/f mice were crossed with Ncr1iCreTg mice to generate Hif1af/fNcr1iCreTg mice. Hif1a
mRNA expression was analyzed by qPCR in flow cytometry-sorted splenic T cells
(CD3ε+CD19-), B cells (CD19+B220+), NK cells (CD3ε-CD19-NK1.1+NKp46+) and myeloid cells
(CD3ε-CD19-NK1.1-CD11b+) from 4 individual WT or Hif1af/fNcr1iCreTg mice. Mean + SEM is
shown. n.s., not significant; , P<0.05; Mann-Whitney test.
(B) NK cells in spleen from Hif1af/fNcr1iCreTg or WT mice (n=3) were stained with mAbs against
CD3ε, NK1.1, CD27 and CD11b. Representative plots of NK cell gating and maturation stage
are shown. Graphs indicate numbers of NK cells in different organs (mean + SD).
(C) Splenocytes were stimulated by plate-bound anti-NK1.1 or anti-NKp46 mAbs, by co-culture
with RMA-S or YAC-1 tumor cells, or with PMA/Ionomycin for 4 h. CD107a and IFN-γ
expression by NKp46+ NK cells was measured by flow cytometry. Representative dot plots of
CD107a expression and IFN-γ production from NK cells (gated on CD3ε-NK1.1+) stimulated
by anti-NKp46 mAb are shown. The graphs indicate mean + SD (n=3).
(D) Splenic NK cells were purified, cultured for 7 d in presence of IL-2, and then stimulated by
IL-12 and IL-18. IFN-γ production of NK cells was analyzed. The graph indicates mean + SD
(n=3).
(B-D) Data are representative of 3 independent experiments.
3
Figure S2
4
Figure S2. Tumor growth, lymphocyte infiltration and characteristics of vasculature in
Hif1af/fNcr1iCreTg mice. Related to Figures 1 and 2
(A) B16-Rae1ε cells (5×105) were injected i.v. to WT (n=11) or Hif1af/fNcr1iCreTg (n=8) mice.
Lung metastases were analyzed at d 14. The graph shows the numbers of nodules in lungs
from individual mice with the mean. n.s., not significant using two-tailed Student’s t-test.
(B) RMA-S tumor-bearing Hif1af/fNcr1iCreTg or WT mice received anti-VEGFA mAb (αVEGFA)
or an isotype-matched control antibody (Isotype) (WT/Isotype (n=9), WT/αVEGFA (n=5),
Hif1af/fNcr1iCreTg/Isotype (n=6), Hif1af/fNcr1iCreTg/αVEGFA (n=6)). The graph of tumor growth
displays mean + SEM.
(C) Paraffin-embedded tumor tissue sections were stained with anti-CD31 and anti-αSMA to
detect endothelial cells and pericytes, respectively. Graphs show vessel density and vessel
coverage by pericytes in tumors from Hif1af/fNcr1iCreTg and WT mice, calculated as
CD31-positive area per total tumor area (vessel density) and Manders' coefficients for
CD31/αSMA co-localization (vessel coverage) (n=4 mice/genotype, Mann-Whitney test).
Representative staining of tumor vasculature in WT and Hif1af/fNcr1iCreTg mice is shown: scale
bars 100 µm.
(D) RMA-S tumor cells were injected s.c. in Hif1af/fNcr1iCreTg or WT mice (n=8). T cells (CD4+
and CD8+) and NK cells were analyzed by flow cytometry. Numbers of infiltrating cells were
calculated from flow cytometric data relative to tumor size. The graph indicates means + SEM.
(E) RMA-S tumor cells were injected s.c. to Hif1af/fNcr1iCreTg or WT mice. CD3ε-NK1.1+ cells
were sorted and analyzed by scRNA-seq. Distribution of Eomes and Tbx21 transcript
abundance across clustered cells of both genotypes are shown.
(F) Flow cytometric analysis of tumor-infiltrating CD3ε-NKp46+ cells for expression of Eomes
and T-bet. Graph depicts the frequency of ILC1s, defined as T-bet+Eomesint/low cells, among
gated CD3ε-NKp46+ population. (n=8, representative of 2 independent experiments)
5
Figure S3
Figure S3. Pathway analysis of individual clusters. Related to Figure 3
Heatmap of enriched pathways (based on the BioCarta pathway collection) in each of the 6
clusters defined by scRNA-seq analysis. Color depicts the enrichment significance and the dot
size depicts the enrichment fold. P values were calculated using hypergeometric tests and
adjusted for multiple testing.
6
Figure S4
Figure S4. Gene expression of cytokines/chemokines and treatment of RMA-S tumor-
bearing mice with recombinant IL-18. Related to Figure 4
(A) RMA-S cells were injected s.c. to Hif1af/fNcr1iCreTg and WT mice (n=3 mice/genotype). Two
weeks later, tumors were isolated, lysed and the expression of cytokine and chemokine mRNA
in the RMA-S tumor tissue was analyzed by qPCR. The Fold Change indicates the difference
of gene expression in tumors from Hif1af/fNcr1iCreTg mice compared to WT mice.
7
(B) Rag2 gene-deficient mice were injected s.c. with RMA-S cells. Mice were treated with 2 µg
of recombinant IL-18 (n=6) or PBS as a control (n=4) each day, starting from d 9. Tumor size
was determined every 2-3 d by caliper, mean ± SEM is shown for every time point.
8
Figure S5
Figure S5. Sort of tumor cells and immune cell subsets from tumor tissue. Related to
Figure 4
C57BL6-Ly5.1 mice were injected s.c. with RMA-S cells. Single-cell suspensions were
prepared from pooled tumor tissue of 5-15 mice and tumor cells and indicated immune cells
subset were purified by flow cytometric sort.
(A) Dead cells and doublets were excluded and tumor cells (CD45.2+) and infiltrating immune
cells (CD45.1+) were defined according to the congenic CD45 marker. Among immune cells,
B cells were sorted as CD19highB220high.
(B) Among non-B cells, T cells were defined as CD3ε+SSC-Alow, and NKT (TCRβ+NK1.1+),
CD4+ T (TCRβ+NK1.1-CD4+) and CD8+ T (TCRβ+NK1.1-CD8+) cells were selected for sort.
(C) From the T/B cell-excluded cell fraction, NK cells were purified as NK1.1+NKp46+.
(D) The lymphoid cell-negative fraction was sorted as CD11b+Ly6G-CD11chighMHC-IIhigh
dendritic cells (DCs), and CD11b+Ly6G-DCs- F4/80+Ly6C+ monocytes/macrophages.
9
Figure S6
10
Figure S6. Involvement of MyD88, NF-κB, and HIF-2α in the enhanced effector responses
by Hif1a-deficient NK cells. Related to Figure 5
Splenic NK cells were purified from Myd88-/- or control WT mice (n=3), cultured in IL-2 for 7 d,
and then stimulated by IL-12 and IL-18. IFN-γ production (A), as well as the expression of
NF-κB p-p65, IκBζ and p-STAT4 (B) were analyzed. Graphs indicate means + SEM. , P<0.05;
, P<0.01; , P<0.001 using two-tailed Student’s t-test.
(C) Splenic NK cells were magnetically separated from pooled spleens of WT and
Hif1af/fNcr1iCreTg mice (n=3-4 mice/genotype) and cultured in IL-2-supplemented media in
hypoxic condition (1% O2). After 7 d, cells were stimulated with IL-12 and IL-18 in the presence
of an NF-κB inhibitor (TPCA-1) or solvent control (dmso). Protein (GzmB) and relative mRNA
expression (Gzmb and Prf1; mean + SD) of cytotoxic effector molecules were determined. MFI
was calculated as difference of mAb and isotype control staining, Fold Change indicates
change relative to WT NK cells stimulated in the presence of solvent control.
(D) Splenic NK cells were isolated as in (C) and cultured in IL-2-supplemented media in
hypoxic conditions (1% O2) in presence of medium only, HIF-2α inhibitor (TC-S 7009) or
solvent control (dmso). After 7 d, cells were stimulated with IL-12 and IL-18 under hypoxia.
Expression of Hif2a (left) was determined by qPCR in WT and Hif1a-deficient NK cells (mean
+ SD is shown). IFN-γ production (right) by IL-12/18-stimulated WT and Hif1a-deficient NK
cells was determined by intracellular staining and flow cytometry. MFI was calculated as
difference of mAb and isotype control staining. Fold Change indicates change relative to WT
NK cells stimulated in the presence of solvent control. Dots represent 4 independent
experiments, each with NK cells derived from pooled 3-4 mice/genotype. Mean + SEM is
shown.
11
Figure S7
Figure S7. Effect of inhibitor KC7F2 on HIF-1α target gene expression in human NK
cells. Related to Figure 6
Human NK cells were isolated from 9-10 healthy donors by negative magnetic sort and
expanded in IL-2-supplemented media in presence of HIF-1α inhibitor (KC7F2) or solvent
control (dmso) for 7 d. Expression of HIF-1α target genes was analyzed by qPCR. Fold change
of relative mRNA expression between inhibitor- and control-treated NK cells is shown. ,
p<0.05, Wilcoxon test
12
Table S2. List of signature/pathway genes used in this study, Related to Figures 2I, 3E,
4D, 6B
Name Gene symbols
NK activation
signature
Bcl2, Ccl3, Ccl4, Ccr5, Cd69, Cxcl10, Foxk1, Gbp4, Gzmb, Icam1 Ifih1, Ifng,
Il12rb1, Il12rb2, Il2ra, Irf1, Irf7, Irf8, Klf11, Klf13, Klrg1, Myd88, Nfil3, Nfkbib,
Nfkbiz, Notch1, Nr4a1, Nr4a2, Nr4a3, Socs1, Socs3, Stat1, Stat2, Stat4,
Tbx21
NFkB
pathway
Ikbkg, Myd88, Tradd, Tab1, Il1a, Tnf, Il1r1, Tnfaip3, Ikbkb, Chuk, Tnfrsf1a,
Nfkbia, Map3k1, Ripk1, Nfkb1, Tnfrsf1b, Map3k7, Map3k14, Irak1, Fadd,
Traf6, Tlr4, Rela
IL-18 pathway
Myd88, Ecsit, Il6, Tollip, Chuk, Tgfb3, Jun, Tnf, Ikbkb, Map2k3, Tab1,
Map3k14, Ifna1, Map3k1, Mapk8, Nfkbia, Map3k7, Irak1, Traf6, Map2k6,
Irak3, Irak2, Tgfb1, Mapk14, Tgfb2, Rela, Ifnb1, Nfkb1, Il18r1, Il18rap
Hif1a targets Pfkfb3, Pgk1, Aldoart1, Slc2a1, Abcb1b, Ccng2, Hk2, Tpi1, Plaur, Gpi1,
Aldoa, P4ha1, Pfkl, Trf, Aldoc, Eno1b, Cd274
Table S3. List of oligonucleotides used for qPCR, Related to Figures 4B, S1A, S6C-D,
and S7
Terget mRNA Forward primer sequence
(5‘ → 3‘)
Reverse primer sequence
(5‘ → 3‘)
human LDHA AATGAAGGACTTGGCAGATGA TGGTGTTCTAAGGAAAAGGCT
human HK1 TAAGATCCGCGAGAACAGAGG GTGCATGATTCTGGAGAAGTGTGG
human PGK1 CATCCTGGGCGGAGCTAAAG GGTAAAAGCCATTCCACCACC
human GLUT1 TCTGGCATCAACGCTGTCTT CCGTGTTGACGATACCGGAG
human VEGFA CACGAAGTGGTGAAGTTCATGG GGATGGCTTGAAGATGTACTCG
human B2M ACTACACTGAATTCACCCCCAC CTGCTTACATGTCTCGATCCCAC
mouse Il18 ACACGCTTTACTTTATACCTGAAGA GTCAACGAAGAGAACTTGGTCA
mouse Hif1a CATCAGTTGCCACTTCCCCA GGCATCCAGAAGTTTTCTCACAC
mouse Hif2a ACTGTGACGACAGAATCTTGGA ATGTTCTCCGAATCCAGGGC
mouse Prf1 TGGTTCTTGTGACAGGTCTCC TGAGATGGGGCAGACACTTG
mouse Gzmb CAAAGGCAGGGGAGATCATCG GAAGCCCCCACATATCGCC
mouse B2m ATGGCTCGCTCGGTGACCC AGCATTTGGATTTCAATGTG
mouse Actb CAGATGTGGATCAGCAAGCA GGGTGTAAAACGCAGCTCAGTA