![Page 1: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/1.jpg)
EoC Review Game
![Page 2: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/2.jpg)
Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6
100 100 100 100 100 100
200 200 200 200 200 200
300 300 300 300 300 300
400 400 400 400 400 400
500 500 500 500 500 500
![Page 3: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/3.jpg)
Unit 1 - 100
• If someone was interested in a career with responsibility to determine the cause of death, what careers should he or she consider and investigate?
![Page 4: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/4.jpg)
Unit 1 - 200
• What is the structure of the body starting with the smallest unit and moving to the largest.
• (hint: Cell ______________________)
![Page 5: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/5.jpg)
Unit 1 – 300
• Name at least 2 organs from and describe the function of the Respiratory System
• A system of organs, functioning in the process of gas exchange between the body and the environment, consisting especially of the nose, nasal passages, nasopharynx, larynx, trachea, bronchi, and lungs.
![Page 6: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/6.jpg)
Unit 1 - 400
• Name at least 2 organs from and describe the function of the Digestive System
• The group of organs that break down foods into chemical components that the body can absorb and use for energy, and for building and repairing cells and tissues.
![Page 7: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/7.jpg)
Unit 1 - 500
• Name at least 3 organs from and describe the function of the Cardiovascular System
• The transport system of the body responsible for carrying oxygen and nutrients to the body and carrying away carbon dioxide and other wastes; composed of the heart, blood vessels, and blood.
![Page 8: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/8.jpg)
Unit 2 - 100
• What is a pump?
• A device that raises, transfers, delivers, or compresses fluids or gases especially by suction or pressure or both.
![Page 9: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/9.jpg)
Unit 2 - 200• Name the structure at # 2
Superior Vena Cava
![Page 10: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/10.jpg)
Unit 2 - 300
• What are the four major components of blood and what do they do?
• Plasma – liquid of blood• Platelets – clotting• White blood cells – immune system• Red blood cells – carry oxygen
![Page 11: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/11.jpg)
Unit 2 - 400What is happening during the “T” wave?
Relaxation of the ventricles
![Page 12: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/12.jpg)
Unit 2 - 500
• Fill in the blanks:• Body – Vena Cava – Right Atrium– Tricuspid
Valve – Right Ventricle– Pulmonary artery –Lungs – Pulmonary vein – Left atrium – Mitral/Bicuspid– Left ventricle – Aortic semilunar valve – Aorta – Body
![Page 13: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/13.jpg)
Unit 3 - 100
• Where is insulin made and what is its function?
• Pancreas; Function: regulate blood sugar(regulate amount of sugar entering cell)
![Page 14: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/14.jpg)
Unit 3 - 200
• This picture shows the process of ________.
hydrolysis
![Page 15: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/15.jpg)
Unit 3 – 300
• Name the two types of enzymes we learned about in this class. Tell me which on is represented in the picture below.
Lock and Key modelInduced fit modelPicture shows a catabolic lock and key
![Page 16: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/16.jpg)
Unit 3 - 400
• What are the monomers of the 4 different types of macromolecules?
• Proteins –Amino Acids• Nucleic acids – Nucleotides• Carbohydrates – Glucose• Lipids – Glycerol and Fatty acid chains
![Page 17: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/17.jpg)
Unit 3 - 500
• Label the insulin/glucose model. Use the following labels: insulin, glucose, cell membrane, receptor molecule, glut4, mitochondrion, energy
![Page 18: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/18.jpg)
Unit 4 - 100
• How many individuals have sickle cell disease?
3
![Page 19: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/19.jpg)
Unit 4 - 200
• What is one symptom of sickle cell disease?• What is one complication of sickle cell
disease?
• Symptoms – low oxygen, pain in muscles• Complications – heart damage
![Page 20: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/20.jpg)
Unit 4 - 300
• Who is Henrietta Lacks and describe how her cells are related to the idea of HIPAA.
• Source of the HeLa cell line. The use of her cells without her permission and tying her name to the cells
![Page 21: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/21.jpg)
Unit 4 - 400
• If generation IV individual 3 married someone without sickle cell disease or sickle cell trait, what is the probability that their child would have sickle cell disease?
0%
![Page 22: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/22.jpg)
Unit 4 - 500
• What is the third amino acid in the chain made by the DNA above?CACGTGGACTGAGGACTCTTCAGAG
Leucine
![Page 23: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/23.jpg)
Unit 5 - 100
• What is the difference between saturated and unsaturated fats?
• Saturated – solid at room temperature, no double bonds in fatty acid chains
• Unsaturated – liquid at room temperature, at least one double bond in fatty acid chains
![Page 24: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/24.jpg)
Unit 5 - 200
• Describe the health risks associated with elevated levels of LDL that have earned it the nickname of “bad cholesterol.”
• Low density lipoprotein ; travels slowly/builds up in blood stream; carries more cholesterol than HDL
![Page 25: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/25.jpg)
Unit 5 - 300
• Which patient is:– Homozygous
recessive?• #3
– Homozygous dominant?• #2
– Heterozygous?• #1
DNA Markers
Normal Control
+FH Control
Patient #1
Patient #2
Patient #3
![Page 26: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/26.jpg)
Unit 5 – 400• Based on the molecular
structures below, label each of the following as saturated, monounsaturated, or polyunsaturated
• Palmitic acid =– saturated
• Stearic acid =– saturated
• Oleic acid = – monounsaturated
• Linoleic acid =– polyunsaturated
![Page 27: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/27.jpg)
Unit 5 - 500
• Explain the process and importance of Polymerase Chain Reaction (PCR) when dealing with small amounts of DNA
• Process: use restriction enzymes to find the specific piece of DNA you want to copy, replicate the DNA
• Importance: Amplify DNA so that we can use it in gel electrophoresis
![Page 28: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/28.jpg)
Unit 6 - 100
• What are 3 differences between Viruses and Bacteria?
• Virus: not alive unless it’s in a host, cannot replicate on its own
• Bacteria: replicates by itself, prokaryotic
![Page 29: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/29.jpg)
Unit 6 – 200
• How is a Gram + cell different than a Gram – cell?
• + = thick cell wall• - = thin cell wall
![Page 30: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/30.jpg)
Unit 6 - 300
• Describe difference between broad spectrum and limited spectrum antibiotics
• Broad – works on many different types of bacteria
• Limited – works on only select types of bacteria
![Page 31: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/31.jpg)
Unit 6 - 400
• Draw the basic structure of an animal virus and label the following parts clearly: capsid, DNA, protein keys
![Page 32: EoC Review Game. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500](https://reader031.vdocuments.mx/reader031/viewer/2022032606/56649eb65503460f94bbfd63/html5/thumbnails/32.jpg)
Unit 6 - 500• Describe the process of the Gram staining procedure.
• Step 1 – stain with purple stain• Step 2-wash • Step 3-stain with pink stain• Step 4-wash• Cells that are purple still = Gram + since they have a
thick cell wall• Cells that are pink = Gram – since they do not have a
thick cell wall