Transcript
Page 1: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Does (HFE) hemochromatosis exist in India?

Rakesh Aggarwal Department of Gastroenterology

SGPGI, Lucknow

Page 2: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Hemochromatosis

A progressive increase in body iron content, leading to systemic iron loading of parenchymal cells (particularly hepatocytes) and, eventually, to organ disease.

Page 3: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Iron homeostasis in humans

Pietrangelo. New Engl J Med 2004; 350: 2383-97.

Page 4: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Hemochromatosis: Types

• Primary

• Secondary– Parenteral iron overload

• RBCs• Iron

– Anemias

– Chronic liver disease (esp alcohol)

Page 5: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Hemochromatosis

Pietrangelo. New Engl J Med 2004; 350: 2383-97.

Page 6: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

HFE gene frequency in Caucasians

Population sample

Country Sample size

Prevalence of C282

homozygotes

Allele frequenc

y

Electoral roll New Zealand 1,064 1 in 213 6.9%

Field survey Australia 3,011 1 in 188 7.3%

Primary care USA 4,865 1 in 405 5.0%

Health clinic USA 41,038 1 in 270 6.1%

Primary care USA/Canada 20,130 1 in 322 5.6%

Harrison SA, Bacon BR. J Hepatol 2003; 38: S14-S23.

Page 7: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

C282Y HFE mutation: Indian population

Study City Number of

subjects

Number of

Y alleles

Number of total

alleles

% of Y

allelles

Kaur, 2003 Delhi 116 *1 232 0.4

Thakur, 2004 Delhi 134 0 268 0.0

Garewal, 2005 Chandigarh 60 0 120 0.0

Panigrahi, 2006 Delhi 74 0 148 0.0

Dhillon, 2007 Chandigarh 100 0 200 0.0

Dhillon, 2007 Chandigarh 80 0 160 0.0

Agarwal, 2007 Lucknow 421 0 842 0.0

Jain, 2011 Lucknow 502 0 1004 0.0

Total 1 2974 0.034* PCR using sequence-specific primers

Page 8: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

HFE C282Y: Indian Thallassemics

Study City Number of

subjects

Number of

Y alleles

Number of total

alleles

% of Y

allelles

Kaur, 2003 Delhi 75 *6 150 4.0

Garewal, 2005 Chandigarh 215 0 430 0.0

Agarwal, 2006 Lucknow 147 0 294 0.0

Agarwal, 2007 Lucknow 308 0 616 0.0

Sharma, 2007 Delhi 63 0 126 0.0

Total 6 1616 0.371* PCR using sequence-specific primers

Page 9: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

HFE C282Y: Indian liver disease patients

Study City Number of

subjects

Number of

Y alleles

Number of total

alleles

% of Y

allelles

Thakur, 2004 Delhi 249 0 498 0.0

Duseja, 2005** Chandigarh 16 0 32 0.0

Agarwal, 2006 Lucknow 65 0 130 0.0

Panigrahi, 2006*** Delhi 31 0 62 0.0

Dhillon, 2007 Chandigarh 236 0 472 0.0

Jain, 2011 Lucknow 496 *1 992 0.1

Total 1 2186 0.046* PCR-RFLP** Non-alcoholic steatohepatitis*** With transferrin saturation >45%

Page 10: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

H63D HFE mutation in Indian population

Study City Number of

subjects

Number of

Y alleles

Number of total

alleles

% of Y

allelles

Kaur, 2003 Delhi 116 20 232 8.6

Panigrahi, 2006 Delhi 74 6 148 4.1

Dhillon, 2007 Chandigarh 100 13 200 6.5

Dhillon, 2007 Chandigarh 80 6 160 3.8

Agarwal, 2007 Lucknow 421 47 842 5.6

Jain, 2011 Lucknow 502 46 1004 4.6

Total 138 2586 5.3

Page 11: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

HFE H63D: Thallassemia / Liver disease

Study City Number of

subjects

Number of

Y alleles

Number of total

alleles

% of Y

allelles

Thallassemia

Kaur, 2003 Delhi 75 19 150 12.7

Agarwal, 2007 Lucknow 308 49 616 8.0

Sharma, 2007 Delhi 63 8 126 6.3

Total 76 892 8.5Chronic liver disease

Duseja, 2005 Chandigarh 16 4 32 12.5

Panigrahi, 2006 Delhi 31 8 62 12.9

Dhillon, 2007 Chandigarh 236 36 472 7.6

Jain, 2011 Lucknow 496 60 992 6.0

Total 108 1558 6.9

Page 12: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Indian liver disease patients: Fe overload

Author N Findings

Thakur 249 24 (9.6%) had transferrin saturation >60%

Duseja 31 Only 1/23 (5%) had transferrin saturation >45%;

Liver biopsy in 16: none had 3+/4+ Perl stain

Dhillon 236 Only 17 (7.2%) had iron overload

Jain 496 Only 13 (2.6%) had iron overload

Page 13: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Indian patients with iron overload

Shukla et al. Natl Med J India 2006; 19: 20-3.

Page 14: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Indian patients with iron overload

Shukla et al. Natl Med J India 2006; 19: 20-3.

Page 15: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Indian patients with iron overload

Shukla et al. Natl Med J India 2006; 19: 20-3.

Page 16: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Shukla et al. Natl Med J India 2006; 19: 20-3.

Indian patients with iron overload

PCR-RFLP for C282Y

Page 17: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

• HFE gene– None of the 5 patients had C282Y mutation– One had homozygous H63D mutation– None had previously known splice site

mutations– Four had a IVS2+4 T/C change

• HAMP gene (Hepcidin)– None had G71A or IVS2+1(-G) mutation

• SLC11A3 gene (Ferroportin)– None had G71A or IVS2+1(-G) mutation

Indian patients with iron overload

Shukla et al. Natl Med J India 2006; 19: 20-3.

Page 18: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

1 2 3 4 5 6

3 4 52 61

GTATGTGGAGAGGGGGCAAGG

GTATGTGGAGAGGGGGCAAGG

GTACGTCGAGAGGGGGCAAGG

GTAYGTGGAGAGGGGGCAAGG

GTACGTCGAGAGGGGGCAAGG

GTAYGTGGAGAGGGGGCAAGG

Z92910.1

Patient #1

Patient #2

Patient #3

Patient #4

Patient #5 Y = T or C

Splice site

Intron

Exon

Indian patients with iron overload

Shukla et al. Natl Med J India 2006; 19: 20-3.

Page 19: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Other data from the Indian subcontinent

Family Origin Onset age

Protein Exon AA change

A Bangladesh 19 Hemojuvelin 3 C80Y

B Pakistan 26 Hemojuvelin 3 G99R

C Pakistan 11 Hemojuvelin 3 G99R

D Pakistan 23 Hemojuvelin 3 P192L

E Pakistan 32 Hemojuvelin 3 L194P

F Sri Lanka 17 Hemojuvelin 4 A343fsX23

G Pakistan 21 Hepcidin 2 R42Sfs

H Thailand 38 Ferroportin 7 C326Y

Lok et al. Blood 2009; 114: 20-5.

Page 20: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Hemochromatosis in India: Summary

• Iron overload Occasional

• C282Y mutation Very infrequent

• C282Y HFE disease Extremely rare


Top Related