Download - DNA Study Guide
DNA Essential Questions:
1) What is DNA and why is it important?
2) What does the structure of DNA look like?
3) How and why does DNA replicate?
4) How is DNA a genetic code?
5) What is protein synthesis?
6) How are genes on the DNA strands used to make proteins in a cell?
Guided Note Packet #1- What is DNA and why is it
important?What does DNA look like?
Guided Note Packet #2-How and why does DNA replicate?
Guided Note Packet #3-What is protein synthesis?How is DNA a genetic code?
What does DNA look like?
DNA Extraction Lab
DNA Extraction Demonstration
What does DNA from a banana look like?
DNA Source: Banana
DNA Soup = 1 c banana, 1 c water, pinch of salt and blended
Why is salt needed?
Why is pineapple juice needed?
Why is liquid soap needed?
Why is alcohol needed?
Procedure:
1. Filter DNA soup into beaker
2. Pour contents into test tube up to 1/3 full
3. Add soap to test tube (10 drops) and swirl
4. Wait 5 minutes
5. Observe everyone else's soup and record in the chart
6. Add 3 drops of pineapple juice
7. Have Ms. Bennett pour in rubbing alcohol
8. Start to see particles of DNA
Cell
Nucleus
Cell Membrane
*Salt and Blender break membrane
*Soap breaks the nuclear membrane
*Enzyme in pineapple juice neutralizes digestive enzymes found in the cell and prevent DNA from being broken apart
*Alcohol allows the DNA to seperate from the cell contents and become visible to us
What is DNA and What does it look like?
Class Notes on DNA
Why are Chromosomes Important?
1. We have mentioned that traits are passed from _______________ to
_______________.
2. Genetic information, or ___________ is located on chromosomes.
3. Chromosomes are made up of _______________.
4. Chromosomes are divided into ________________.
Chromosome
gene gene gene
GCATTAGCTGACTAGGTCAGCAGTCATCATGGGCCATATAAAATTTTGGGCCTGTCTGATCACGTAATCGACTGAT
CCAGTCG TCAGTAGTACCCGGTATATTTTAAAAC
CCGGACAGACTGT
DNA bases
5. A chromosome can have _______________ genes or more.
6. Each gene determines a certain ______________, such as hairline.
7. Scientists usually ________________ the chromosomes in an organism.
8. The only chromosomes that are not numbered are the ____________ chromosomes, they are called X and Y.
9. Chromosomes that are assigned the same number are called
__________________.
Ex: chromosome number 3 from mom is homologous with chromosome number 3 from dad
10. Homologous chromosomes have the same __________ on them.
Ex: In pea plants, the gene for plant height is found on chromosome number 4
12. When an organism produces sex cells (sperm and egg), genes are
mixed up due to crossing over during meiosis, and __________________
____________________ occurs in the offspring.
11. Homologous chromosomes may have different ______________
(dominant or recessive), but the types of genes are the same.
Why is DNA so important?
1. The DNA in genes is the directions or blueprints for making
_______________.
2. Proteins are essential for ______________. They allow us to run, think, digest, etc.
The Structure of DNA
1. We have learned that DNA is a _____________
______________ made up of nucleotides.
2. The DNA in one chromosome can be ______________ of nucleotides long.
3. Because of this, it can hold a lot of _________________.
Nucleotides
1. Nucleotides have three parts: a ____________, a ________________ group,
and a ______________ base.
2. The sugar in DNA is called _________________.
3. The phosphate looks like this:
4. A nucleotide can have 4 different bases: ______, ______, _____, _____
5. The nitrogen bases are what make one nucleotide ______________ from another.
7. We draw it this way as a shortcut:
8. It is sometimes called the _________,
the _________________ pool and the
___________________.
9. When you put many _____________________
together, you get a chain or strand of DNA.
10. The sugars and the phosphates form the
_________________ of the chain and the
bases stick out like ______________
on a ______________.
pool
house
garage
C
T
G
A
6. This is what a nucleotide looks like with all the parts together.
How is DNA a genetic code?
The sequence of bases on a strand of DNA tells us a lot of information. Let's think of the sequence of bases as the DNA alphabet, there are four letters (A, T, C, G). In this alphabet, there are 64 possible words (AAA, TTT, GCG, GTC, etc.) All words have only 3 letters. This is called a CODON. When you put many of these words together, you form a sentence. (AAAGCTCCCGAA). This is known as a gene.
DNA Alphabet
Letters- Nitrogen bases (A,T,C,G)Words- Codons (TTC,TTT,GGG,GCG, etc. up to 64)Sentences- genes (TTCTTTAAAGCGATGCGT)
These letters are specific codes that hold a lot of information:
Codons = particular amino acids
Genes = chains of amino acids, which are proteins and can determine certain traits or characteristics of an organism
What information does this genetic code tell us?
DNARNA
nucleic acid
Uracil
adenineguaninecytosine
single stranded double stranded
sugar = ribose
sugar= deoxyribose
thymine
mRNA = messenger RNAtRNA = transfer RNA