Download - Dna computing
![Page 1: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/1.jpg)
DNA COMPUTING
Ch. Subba Rayudu
3rd CSE
12711A052
NEC::NELLORE
![Page 2: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/2.jpg)
Overview
• Introduction to DNA
• What is DNA computing
• Adleman’s Hamiltonian path problem.
• Cutting Edge Technologies
• Pros and Cons
• DNA Vs Electronic Computers
• Conclusion
![Page 3: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/3.jpg)
What is DNA?
• DNA stands for Deoxyribonucleic Acid
• DNA represents the genetic blueprint of living
creatures
• DNA contains “instructions” for assembling
cells
• Every cell in human body has a complete set
of DNA
• DNA is unique for each individual
![Page 4: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/4.jpg)
Double Helix
• “Sides”
Sugar-phosphate backbones
• “ladders”
complementary base pairs
Adenine & Thymine
Guanine & Cytosine
• Two strands are held together by
weak hydrogen bonds between the
complementary base pairs
![Page 5: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/5.jpg)
Uniqueness of DNA
Why is DNA a Unique Computational Element???
• Extremely dense information storage.
• Enormous parallelism.
• Extraordinary energy efficiency.
![Page 6: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/6.jpg)
Dense Information Storage
This image shows 1 gram of DNA on a CD. The CD can hold 800 MB of data.
The 1 gram of DNA can hold about 1x1014 MB of data.
The number of CDs required to hold this amount of information, lined up edge to edge, would circle the Earth 375 times, and would take 163,000 centuries to listen to.
![Page 7: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/7.jpg)
How enormous is the parallelism?
• A test tube of DNA can contain trillions of strands. Each operation on a test tube of DNA is carried out on all strands in the tube in parallel !
• Check this out……. We Typically use
![Page 8: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/8.jpg)
How extraordinary is the energy efficiency?
• Adleman figured his computer was running
2 x 1019 operations per joule.
![Page 9: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/9.jpg)
Instructions in DNA
• Instructions are coded in a sequence of the DNA
bases
• A segment of DNA is exposed, transcribed and
translated to carry out instructions
Sequence to indicate the start of an instruction
Instruction that triggersHormone injection
Instruction for hair cells
………
![Page 10: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/10.jpg)
A Little More………
Basic suite of operations: AND,OR,NOT & NOR in CPU while cutting, linking, pasting, amplifying and many others in DNA.
Complementarity makes DNA unique.
![Page 11: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/11.jpg)
Can DNA compute?
•DNA itself does not carry out any computation. It rather acts as a massive memory.
•BUT, the way complementary bases react with each other can be used to compute things.
•Proposed by Adelman in 1994
![Page 12: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/12.jpg)
Why do we investigate about “other” computers?
•Certain types of problems (learning, patternrecognition, fault-tolerant system, large set searches, cost optimization) are intrinsically very difficult to solvewith current computers and algorithms
•NP problems: We do not know any algorithm thatsolves them in a polynomial time all of the currentsolutions run in a amount of time proportional to anexponential function of the size of the problem
12
![Page 13: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/13.jpg)
Adleman’s solution of the Hamiltonian Directed Path Problem(HDPP).
I believe things like DNA computing will eventuallylead the way to a “molecular revolution,” which ultimately will have a very dramatic effect on the world. – L. Adleman
![Page 14: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/14.jpg)
14
An example of NP-problem: the Traveling
Salesman Problem
TSP: A salesman must go from the city A to the city
Z, visiting other cities in the meantime. Some of the
cities are linked by plane. Is it any path from A to Z
only visiting each city once?
![Page 15: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/15.jpg)
Coding the paths
1, Atlanta – Boston:
ACTTGCAGTCGGACTG
||||||||
CGTCAGCC
R:(GCAGTCGG)
2,(A+B)+Chicago:
ACTTGCAGTCGGACTGGGCTATGT
||||||||
TGACCCGA R:(ACTGGGCT) 15
Solution A+B+C+D:
ACTTGCAGTCGGACTGGGCTATGTCCGAGCAA
(Hybridization and ligation between city molecules and intercity link molecules)
![Page 16: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/16.jpg)
Algorithm
1.Generate Random paths
2.From all paths created in step 1, keep only those that start at s and end at t.
3.From all remaining paths, keep only those that visit exactly n vertices.
4.From all remaining paths, keep only those that visit each vertex at least once.
5.if any path remains, return “yes”;otherwise, return “no”.
16
![Page 17: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/17.jpg)
THE FUTURE!
Algorithm used by Adleman for the traveling salesman problem was simple. As technology becomes more refined, more efficient algorithms may be discovered.
DNA Manipulation technology has rapidly improved in recent years, and future advances may make DNA computers more efficient.
The University of Wisconsin is experimenting with chip-based DNA computers.
![Page 18: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/18.jpg)
DNA computers are unlikely to feature word processing, emailing and solitaire programs.
Instead, their powerful computing power will be used for areas of encryption, genetic programming, language systems, and algorithms or by airlines wanting to map more efficient routes. Hence better applicable in only some promising areas.
![Page 19: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/19.jpg)
DNA Chip
![Page 20: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/20.jpg)
The Smallest Computer
• The smallest programmable DNA computer was developed at Weizmann Institute in Israel by Prof. Ehud Shapiro last year
• It uses enzymes as a program that processes on 0n the input data (DNA molecules).
![Page 21: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/21.jpg)
DNA Vs Electronic computers
At Present, NOT competitive with the state-of-the-art algorithms on electronic computers
Only small instances of HDPP can be solved. Reason?..for n vertices, we require 2^n molecules.
Time consuming laboratory procedures.
Good computer programs that can solve HSP for 100 vertices in a matter of minutes.
No universal method of data representation.
![Page 22: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/22.jpg)
22
Advantages
Ample supply of raw materials.
No toxic by-products.
Smaller compared to silicon chips.
Efficiency in parallel computation.
![Page 23: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/23.jpg)
Disadvantages
Time consuming.
Occasionally slower.
Reliability.
Human Assistance.
![Page 24: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/24.jpg)
24
Error Restrictions
DNA computing involves a relatively large
amount of error.
As size of problem grows, probability of
receiving incorrect answer eventually
becomes greater than probability of receiving
correct answer
![Page 25: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/25.jpg)
25
Applications
Satisfiability and Boolean Operations
Finite State Machines
Road Coloring
DNA Chip
Solving NP-hard problems
Turing Machine
Boolean Circuits
![Page 26: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/26.jpg)
Conclusion
• Many issues to be overcome to produce a
useful DNA computer.
• It will not replace the current computers
because it is application specific, but has a
potential to replace the high-end research
oriented computers in future.
![Page 27: Dna computing](https://reader033.vdocuments.mx/reader033/viewer/2022042615/55a68a381a28ab3f1e8b48be/html5/thumbnails/27.jpg)
Thank you
Any Queries Please