Chromatid (97) – The identical rods of chromatin in chromosomes.
Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that directs the cell’s functions.
DNA NOTESCREATURE DUEPASS BACK TEST
1. DNA is part of our definition of a living organism.
2. DNA is found in all living things.
3. DNA is the “blueprint” of life.
11/12/13…. DNA stands for deoxyribonucleic acid.
FINISH DNA NOTESDNA VOCABULARYDNA PROJECT ASSIGNED DUE: 12/3 GO OVER TESTPASS BACK GRADED WORK
•Sugar + phosphate + base = nucleotide. •The sides of the DNA ladder are made of sugars and phosphate atoms.•A always pairs with T in DNA. •C also pairs with G in DNA.
11/13/13…. DNA stands for deoxyribonucleic acid.
DNA Notes
Using page 131 in your book, complete the Discover Activity (write you answers on your DNA Notes).
Answers: “Where are genes located?” “On chromosomes.”– – – / – • / – • – • / • • • • / • – • / – – – / – – /
– – –/ • • • / – – –/ – –/ • / • • • /
DNA Notes
Genes control protein production in cells.Proteins help determine the size, shape,
color, and many other traits of an organism.
A gene is a section of DNA that contains the information to code for one specific protein.
The structure of DNA is called a double helix.Backbone/Sides
phosphate and sugars
Bases/Rungs 4 different Nitrogen containing bases
Adenine – AThymine – TGuanine – GCytosine - C
Adenine only pairs with ThymineGuanine only pairs with CytosineThe following is an example of a DNA
code. Can you write the matching code? (Remember your pairs!)CGGTAGCCATAATTCGCTCTCCAATAGGCTTCATTAAGCGAGAGGTTATCCGAAGT
Today 11/14
Color the structure of DNA using Mrs. Woods’ Coloring guidelines
Correctly build the structure of DNACorrectly say the word:
De oxy ribo nucleic acid
Chromosome
DNA Molecule
Nitrogen Bases
Chromosome
DNA Molecule
Nitrogen Bases
“This model—the double helix—with its biological implications ranks as the greatest contribution to biology since the work of Darwin and Mendel, something that is obvious enough from the fact that the acronym DNA and the image of the double helix are among the icons of late twentieth-century culture” (17-18, 1999). Collin Patterson
The Structure of DNA
The Backbone & the Bases…..2.28.1953
DNA is the Blueprint of Life
Genetic material is responsible for trait similarities and differences between all organisms.
Nucleic Acids come in two major forms: RNA and DNA. This chemical found in all living things is the blueprint of life.
Mutations
A mutation is any change in a gene or chromosome.
A mutation in a body cell (somatic), such as a skin cell, will not be passed on to the offspring.
A mutation in a sex cell can be passed on to an offspring.
Types of Mutations
One or more base substitutions: Original sequence: ATTCGG Substitution: ATTAGG
One or more bases are deleted: Original sequence: ATTCGG Deletion: ATTGG
Chromosomes fail to separate during meiosis. Too many chromosomes Not enough chromosomes
Effects of mutations
A mutation is harmful if it reduces an organisms chance for survival or reproduction. Ex. Down Syndrome is caused by having 3 chromosomes
instead of 2 in the 21st pair.
A mutation is helpful if it increases an organisms chance of survival or reproduction. Ex. Sickle-cell disease is caused by a codominant allele.
If you get one allele, you are resistant to Malaria.
Some mutations are neutral. Ex. Albinism, caused by a recessive allele, results in
lighter skin and hair pigment.