Cavitary Pulmonary Zygomycosis Caused by Rhizopus homothallicus 1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
Short title: Zygomycosis due to Rhizopus homothallicus
Arunaloke Chakrabarti,1 * Rungmei S. K. Marak, 4 M. R. Shivaprakash,1 Sunita
Gupta,1 Rajiv Garg, 5 V. Sakhuja,2 Sanjay,5 Abhishek Baghela,1
Ajai Dixit,4 M. K. Garg,3 and Arvind A. Padhye6
Department of Medical Microbiology,1 Nephrology,2 Radiology,3 Postgraduate Institute
of Medical Education and Research, Chandigarh 160012, India; Department of
Microbiology,4 Sanjay Gandhi Postgraduate Institute of Medical Sciences,
Lucknow 226014, India; and mycotic Diseases Branch, Centers for Disease Control and
Prevention, Atlanta, Georgia 30333, U.S.A.6
____________
1 Corresponding author: Dr. Arunaloke Chakrabarti, Department of Microbiology,
Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh
160012, India, Phone: + 91 172 2755156, Fax: +91 172 2744401, E-mail:
1
Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.01272-09 JCM Accepts, published online ahead of print on 10 March 2010
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
2
We report the first two proven cases of cavitary pulmonary zygomycosis caused by 24
Rhizopus homothallicus. Diagnosis in each case was based on histology, culture of the 25
causal agent, and nucleotide sequence of the D1/D2 region of 28S rDNA. 26
Key words: pulmonary zygomycosis, Rhizopus homothallicus 27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
3
Case Reports 47
Case 1: A 47-year-old male with a history of type II diabetes mellitus for 13 years 48
developed diabetic nephropathy leading to the end stage renal disease. He had undergone 49
renal transplantation and was on triple drug immunosuppression (cyclosporine, 50
azathioprine, and prednisolone). One month post-transplant, he developed intermittent 51
fever with chills and pleuritic chest pain. Chest X-ray revealed cavitary lesion in the right 52
upper lobe with bilateral nodular infiltrates for which he was treated with primary drug 53
regimen of anti-tuberculous therapy (ATT), though multiple sputum examinations were 54
negative for acid-fast bacilli. The patient did not respond to the ATT and was referred to 55
our institute (Postgraduate Institute of Medical Education and Research (PGIMER), 56
Chandigarh, India). At our institute, contrast enhanced computed tomography (CECT) of 57
thorax revealed thick, smooth-walled, cavitary lesion on posterior segment of right upper 58
lobe and multiple nodules in both lungs (Fig. 1). No pleural effusion was noticed. 59
Echocardiography ruled out endocarditis. His blood sugar ranged between 153-60
226mg/dL. While he was at the hospital he was treated with human insulin therapy. ATT 61
was continued along with vancomycin and tazobactam. An ultrasound–guided fine needle 62
aspiration from the cavitary lesion of the lung was performed. Aspirated fluid was 63
examined by direct microscopic examination of calcofluor white-stained mounts of the 64
aspirated fluid. A part of the fluid was cultured on Sabouraud dextrose agar (SDA) and 65
brain heart infusion (BHI) agar (HiMedia, Mumbai, India). Direct microscopy of the 66
aspirated fluid did not reveal any fungal elements nor the cultures yield any fungal 67
colonies until the end of 4 weeks incubation. As the patient did not improve until 20th 68
day of hospital stay, open lung biopsy was performed. It revealed pus in the pleural 69
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
4
cavity with large cavitary lesion in right upper lobe. No apparent mass was noticed. 70
Wedge-shaped biopsy was taken from the site of the lesion. Tissue slides stained by 71
haemotoxylin and eosin, and periodic acid Schiff’s procedures showed dense acute 72
inflammatory infiltrates across the interstitial septa, a dense fibrosis surrounding the 73
alveoli, extensive necrosis with nuclear debris and broad, aseptate, ribbon-like, hyphae 74
(Fig.2). The causal fungus was observed invading the vessel wall. Culture of the biopsy 75
tissue on SDA (HiMedia, Mumbai, India) grew a fast-growing, floccose white colony 76
turning grayish in color. Microscopic examination of the colony showed broad aseptate 77
hyphae with lateral not well-developed sporangiophores bearing globose sporangia 78
containing a small number of sporangiospores. In addition, a large number of golden-79
brown zygospores with stellate walls and with unequal suspensor cells were observed. 80
The isolate was presumptively identified as Rhizopus homothallicus Hesseltine and Ellis 81
(8). Liposomal amphotericin B (Fungisome R, Lifecare innovations, India) was given at a 82
dose of 1.5 mg/kg of body weight/day. Follow up after cumulative dose of 5.0 gm of 83
liposomal amphotericin B therapy showed striking improvement of the patient both 84
clinically and on radiological investigations. No relapse or recurrence of the infection 85
was noticed until 5 months of follow-up after recovery. 86
Case 2: A 70-yr-old male presented at the King George Medical University Hospital, 87
Lucknow, India, with a history of fever, cough, chest pain mucopurulent expectoration, 88
and recurrent haemoptysis of 25 days duration. On general examination, he had signs of 89
glossitis and stomatitis. Examination of respiratory system revealed bronchial breath 90
sound over left mammary area and rest of the physical examination was unremarkable. 91
Chest radiograph revealed the presence of air space consolidation with eccentric 92
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
5
cavitation in mid zone of the left lung. Computed tomography of thorax revealed a large 93
thick-walled cavity in the left upper lobe abutting chest wall and encroaching towards 94
arch of aorta. On routine investigations, uncontrolled blood sugar levels (range 232-95
360mg/dL) were noted. Sputum examination did not reveal acid-fast bacilli. The patient 96
was treated with oral antibiotics (amoxicillin–clavulainic acid 625 mg twice daily and 97
clindamycin 150 mg four times a day for 2 weeks). He did not show clinical or 98
radiological improvement. The patient refused to undergo bronchoscopy. Transthoracic 99
needle aspiration from the left cavitary lesion revealed ribbon-like, broad, coenocytic 100
hyphae on direct KOH examination as well as smears stained by periodic acid Schiff’s 101
stain and Gomori’s methenamine silver stain procedures. Fungal culture of the aspirate 102
on SDA (HiMedia, Mumbai, India) grew white, cottony, colonies. Direct examination of 103
a teased mount of the colony stained by lactophenol cotton blue showed numerous 104
golden-brown globose, spiny, zygospores with suspensor cells. The isolate was 105
tentatively identified as R. homothallicus. The patient was treated with injectable insulin 106
for glycemic control, and intravenous conventional amphotericin B (50mg/day) for 15 107
days. After a cumulative dose of 750 mg. of amphotericin B, the patient developed acute 108
renal failure. After the withdrawal of amphotericin B, his renal function improved 109
rapidly. However, he refused subsequent treatment with amphotericin B and left the 110
hospital against medical advice. He returned after 3 months with massive haemoptysis 111
and succumbed to his illness rapidly before any treatment with antifungal agents could be 112
initiated. 113
Colonies of both isolates on SDA were fast growing, white, floccose devoid of 114
pigmentation on the reverse of the colonies. Within 10-14 days of incubation at 28°-115
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
6
30°C, colonies turned grayish. Slide culture mounts of the isolate from Case 1 stained by 116
lactophenol cotton blue [PGIMER MCCL (Mycology Culture Collection laboratory, No. 117
710076)] on SDA incubated at 30°C for 10 days showed broad, hyaline, aseptate, 118
branching hyphae producing very few sporangiophores opposite poorly developed 119
rhizoids. Sporangiophores measured 5-27µm in diameter and 50-150µm in length bearing 120
globose to sub-globose sporangia measuring 50-150µm in diameter. Sporangiospores 121
were angular-globose, grayish, 3.5-5.0µm in length and 4.0-6.5µm in width. The striking 122
feature was abundant number of homothallic, thick-walled zygospores, reddish brown in 123
color measuring 40-100µm in diameter including stellate spines. Suspensor cells were 124
uneven in size, the larger being globose (Fig.3). 125
The isolate from Case 2 (MCCL 710099) was studied at the CDC. Slide cultures 126
on potato dextrose agar and malt extract agar after 2 weeks at 25°C did not show any 127
fertile sporangia containing sporangiospores. Sprongiophores were poorly developed 128
opposite poorly developed rhizoids in tufts of 2-5 at several locations. Due to lack of any 129
sporulation, agar blocks (2 x 2 cm) with mycelial growth from the culture plates were 130
transferred aseptically to a plate containing 20ml of sterilized distilled water to which 3-5 131
drops of 15% filter sterilized yeast extract solution was added. After 5 days of incubation 132
at 37°C, examination of growth over the surface of water showed abundant globose, 133
golden brown, spiny zygospores supported by uneven size suspensor cells. Both isolates 134
were thermotolerant and grew at 46°-48°C. Both isolates were identified as Rhizopus 135
homothallicus Hesseltine and Ellis (8). 136
The identity of both isolates was further confirmed by nucleotide sequence of 28S 137
ribosomal region. Whole cell DNA from the isolates was extracted using a slightly 138
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
7
modified protocol of small-scale fungal DNA extraction method described by Lee and 139
Taylor (10). Briefly, pure cultures of the isolates were grown in Sabouraud dextrose broth 140
(HiMedia, Mumbai, India) and incubated at 37°C on a rotary shaker (HT Infors, 141
Germany) at 120 rpm for 3 to 5 days. The mycelial mat (04-0.5gm) was prepared and 142
crushed to fine powder in a pestal and mortar in the presence of liquid nitrogen and lysis 143
buffer. The DNA was extracted using standard phenol:chloroform (25:24) extraction 144
method. DNA precipitation was carried out using 2 volume of chilled absolute alcohol 145
and 1/5th volume of 10M-ammonium acetate, followed by washing with 70% alcohol. 146
The DNA pellet was dissolved in 100 µl of TE buffer. DNA preparations were stored at 147
-20°C till use. PCR was performed in a reaction mixture of 10µl containing 2mM MgCl2, 148
200µM of each dNTP (Bangalore Genie, Bangalore, India), 0.25µm of each primer 149
(Integrated DNA Technologies, Inc., Coralville, Iowa). NL1 150
(GCATATCAATAAGCGGAGGAAAAG) and NL4 (GGTCCGTGTTTCAAGACGG), 151
0.25U of Taq polymerase (Bangalore, Genie), and 10ng of fungal genomic DNA. The 152
amplification reactions were performed in Eppendorff Mastercycler (Hamburg, 153
Germany). The amplification was performed for 36 PCR cycles with annealing at 52°C, 154
extension at 72°C for 2 min, and denaturation at 94°C for 1min. PCR products were 155
purified using gel extraction kit (Qiagen Hilden, Germany), and both the strands were 156
sequenced by the Big Dye terminator cycle sequencing ready reaction kit, version 3.1 157
(Applied Biosystems, Foster City, CA) with the primers NL1 and NL4. The reaction 158
products were analyzed on Genetic Analyzer 3130 (Applied Biosystems). Basic local 159
alignment search tool (BLAST) was used to compare the sequences obtained with those 160
in the GenBank database and to see the similarity of both isolates. The sequences of both 161
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
8
isolates gave 99% identity with each other and 98% identity with the ex-type strain of 162
Rhizopus homothallicus (AB 250198, NRRL 2538 = CBS 336.62). Sequence data of the 163
Indian isolates (MCCL 71006 and MCCL 710099) were submitted to the GenBank 164
(Accession No. EU 128745 and EU 491016). The two Indian isolates have been 165
deposited in the CBS Fungal Biodiversity Centre, Utrecht, The Netherlands, with the 166
following accession numbers: (MCCL 71006 = CBS 125071 and MCCL 710099 = CBS 167
125072). 168
The antifungal susceptibility testing of both isolates was performed by micro-169
dilution broth technique following the protocol of Clinical Laboratory Standard Institute 170
(CLSI) document M-38A (5). The minimum inhibitory concentration (MIC) of both 171
isolates were similar: amphotericin B – 0.5µg/ml; flucytosine - >64.0 µg/ml; fluconazole 172
– 64.0 µg/ml; itraconazole - >16.0 µg/ml; voriconazole – 4.0 µg/ml; and caspofungin – 173
16 µg/ml. 174
175
Among the different agents of zygomycosis, Rhizopus spp. are the most 176
commonly implicated agents causing human infections, and R. oryzae is the most 177
predominant species implicated in 90% of cases of invasive zygomycosis (3,4,17). The 178
other Rhizopus spp. less commonly reported as causal agents are R. microsporus (16), R. 179
azygosporus (6), R. schipperae (2), and R. stolonifer (7). To our knowledge, the present 180
report describes the first two cases of invasive zygomycosis caused by R. homothallicus. 181
Hesseltine and Ellis described R. homothallicus in 1961 based on ex-type (NRRL 2538) 182
isolated from a soil sample from Guatemala in 1956 (8). Subsequently, the species had 183
been isolated in India from soil samples from several areas, from dung, stored grains of 184
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
9
Triticum sp. (http://www.cabri.org/HyperCat/fun/all102646.htm). When isolated from 185
soil or other environmental sources, R. homothallicus closely resembles R. microsporus 186
in general morphology especially asexual sporangiophores, sporangia, sporangiospores, 187
and maximum growth temperatures (19). However, strains maintained under laboratory 188
conditions often loose their sporulation ability including ability to form zygospores. 189
According to Schipper and Stalpers, the ex-type strain of R. homothallicus (NRRL 2538 190
= CBS 336.62) no longer produces zygospores (19). In 1970, Scholer attempted to 191
produce experimental infection in mice using R. homothallicus but was not successful. 192
The reason of failure was considered to be due to insufficient number of sporangiospores 193
in the inoculum, and failure to inject large size zygospores intravenously (20). 194
Schipper (18) classified Rhizopus spp. into three groups; namely, R. stolonifer 195
group, R. oryzae group, and R. microsporus group based on phenotypic characters and 196
maximum growth temperatures (18,19). Recent studies by Abe et al. (1) based molecular 197
phylogeny of Rhizopus spp. have also concurred with Schipper’s treatment of Rhizopus 198
spp. groups. 199
Earlier observations by Scholer (20) and recent observations by Jennessen (9) 200
have stressed that in R. homothallicus rhizoids, sporangiophores, sporangia, and 201
sporangiospores are often poorly developed. We also observed similar findings in our 202
two isolates. Production of abundant zygospores was the main phenotypic character that 203
was helpful in the identification of isolate from Case 1. The isolate from Case 2 failed to 204
produce zygospores when grown on routinely used potato dextrose agar and malt extract 205
agar. A low nutritional medium had to be used to induce zygospore production (14). 206
Rhizopus homothallicus can also be confused with another homothallic species, namely, 207
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
10
R. sexualis, which also produces abundant zygospores. However, R. homothallicus grows 208
at temperatures as high as 46°C-48°C, while R. sexualis does not grow at 37°C. 209
Given the limitation of phenotypic identification methods, ribosomal DNA 210
(rDNA) based gene sequences have been used extensively for molecular identification of 211
fungi including zygomycetes (1, 11, 23). The rDNA comprise of small subunit gene 212
(18s), large subunit gene (28s), and internal transcribed regions (ITS1 and ITS2). The ITS 213
region is generally used for the species identification of fungi as the sequences can be 214
aligned with confidence between closely related taxa. To obtain similar resolution with 215
18s and 28s genes, a large portion of the molecule must be sequenced. In the present 216
study, many attempts to sequence the ITS region of rDNA failed (results not shown). 217
Hence the sequencing of the D1/D2 region of the 28s rDNA was performed. The failure 218
to obtain pure sequence of the ITS region may be attributed to the homothallic nature of 219
the fungal species understudy, which led to multiple distinct ITS regions in a single 220
strain. The presence of multiple bands did not allow proper analysis of the sequences. 221
The presence of multiple distinct ITS regions had been described earlier with another 222
homothallic Rhizopus species, R. sexualis. Therefore, sequencing of D1/D2 region of 28s 223
rDNA may be more useful and easy method for the identification of homothallic R. 224
homothallicus (1, 11, 23). 225
Pulmonary zygomycosis is considered second in frequency after rhino-orbital-226
cerebral type among different categories of zygomycosis and has rarely been reported 227
without any predisposing factor. Cough, fever, and pleuritic chest pain are the common 228
presenting symptoms in patients with pulmonary zygomycosis (22). Pulmonary 229
zygomycosis may have a wide variety of lesions including isolated solitary nodule, lobar 230
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
11
involvement, cavitary or disseminated lesions (13, 15, 22). Pulmonary consolidation, 231
cavitation or an effusion is less frequently seen (13, 22). Both patients in the present 232
report had cavitary lesions. Tedder et al. (22) in a review of 156 cases of pulmonary 233
zygomycosis observed only 6.0% had radiographic findings of cavitation of the lung. In 234
our earlier two series of reports on zygomycosis from PGIMER, 25 patients had 235
pulmonary zygomycosis and none had cavitory lesions (3,4), though contrasting claim of 236
approximately 40% cavitary lesions among patients with pulmonary zygomycosis had 237
been made (12). However, it is not clear whether the type of lesion depends on virulence 238
of the causal agent or host immune status or both. It was suggested that such cavities 239
represent liquefaction of pulmonary infarcts (13). The correlation between the type of 240
fungi of Mucorales isolated from the pulmonary lesion and the type of lesion has never 241
been established. Interestingly, few species like R. stolonifer (7) and Cunninghamella 242
bertholletiae (24) have been isolated from patients with cavitary lesions. 243
Haemoptysis in patients with zygomycosis may be fatal and may occur due to 244
erosion of the cavitary lesion into bronchus (23). The patient from Case 2 had similar 245
fate. Sputum or broncho-alveolar lavage analysis, though frequently employed, rarely 246
leads to confirmation of diagnosis. Procedures such as open lung biopsy, surgical 247
extirpation, transthoracic needle aspiration provide better samples for diagnosis (22). In 248
the present two cases, invasive procedures helped in the definitive diagnosis. 249
Without prompt therapeutic management, invasive zygomycosis invariably proves 250
fatal. Aggressive surgical treatment combined with appropriate medical therapy as well 251
as controlling predisposing factors are of vital importance to treat such cases (3). 252
Amphotericin B is the first line of drug of choice for most of the cases of zygomycosis. In 253
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
12
both cases presented here, patients were treated with amphotericin B using either 254
conventional or liposomal formulation. The patient from Case 1 responded well to the 255
therapy. The second patient succumbed to the infection possibly due to inadequate 256
treatment. Both isolates of R. homothallicus had MICs of 0.5µg/ml against amphotericin 257
B. The MIC patterns observed with the two isolates of R. homothallicus were consistent 258
with those reported for other Rhizopus species (21). 259
Nucleotide sequence accession numbers: Nucleotide sequences data of 28s rDNA 260
region of both isolates were submitted to the GenBank (Accession No. EU128745 – 261
MCCL 710076, EU491016 – MCCL 710099) 262
263
Acknowledgment 264
We wish thank Indian Council of Medical Research, New Delhi, India, for their 265
support in purchasing the sequencer for the ‘Centre of Advance Research in Medical 266
Mycology’. 267
Conflict of interest: None of the authors have an association that might pose a conflict 268
of interest in relevance with the manuscript. 269
270
271
272
273
274
275
276
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
13
REFERENCES 277
1. Abe, A., Y. Oda, K. Asano, T. Sone. 2006. The molecular phylogeny of genus 278
Rhizopus based on rDNA sequences. Biosci. Biotechnol. Biochem. 70:2387-279
2393. 280
2. Anstead, G. M., D. A. Sutton, E. H. Thompson, I. Weitzman, R. A. Otto, and 281
S. K. Ahuja. 1999. Disseminated zygomycosis due to Rhizopus schipperae after 282
heat stroke. 37:2656-2662. 283
3. Chakrabarti, A., A. Das, A. Sharma, N. Panda, S. Das, K. L. Gupta, and V. 284
Sakhuja. 2001. Ten years’ experience in zygomycosis at a tertiary care cenre in 285
India. J. Infect. 42:261-266. 286
4. Chakrabarti, A., A. Das, J. Mandal, M. R. Shivprakash, V. K. George, B. 287
Tarai, P. Rao, N. Panda, S. C. Verma, and V. Sakhuja. 2006. The rising trend 288
of invasive zygomycosis in patients with uncontrolled diabetes mellitus. Med. 289
Mycol. 44:335-342. 290
5. Clinical and Laboratory Standards Institute. 2002. Reference method for 291
broth dilution susceptibility testing of filamentous fungi: Approved standard M-292
38A. Clinical Laboratory Institute, Wayne, PA. 293
6. Fujimoto, A., K. Nagoa, K. Tanaka, J. Yamagni, S. J. Udagawa, and M. 294
Sagiara. 2005. The first case of cutaneous mucormycosis by Rhizopus 295
azygosporus. Br. J. Dermatol. 154:428-430. 296
7. Gilman, A. L., A. Serrano, J. Skelley, and D. Zwiek. 2006. Successful 297
treatment of pulmonary zygomycosis with posaconazole in a recipient of a 298
haploidentical donor stem cell transplant. Pediatr. Blood Cancer 47:959-963. 299
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
14
8. Hesseltine, C. W., and J. J. Ellis. 1961. Notes on mucorales, especially Absidia. 300
Mycologia 53:406-425. 301
9. Jenessen, J., J. Schnurer, J. Olsson, R. A. Samson, and J. Dijksterhuis. 2008. 302
Morphological characteristics of sporangiospores of Tempe fungus Rhizopus 303
oligosporus differentiate it from other taxa of the R. microsporus group. Mycol. 304
Res. 112:547-563. 305
10. Lee, S. B., and J. W. Taylor. 1990. Isolation of DNA from fungal mycelia and 306
single spores. In: PCR protocols, a guide to methods and applications. Eds. M. A. 307
Innis, D. H. Gelfand, J. J. Sninsky, T. J. White. Academic Press, San Diego, pp. 308
282-287. 309
11. Liou, G. Y., S. R. Chen, Y. A. Wei, F. L. Lee, H. M. Fu, G. F. Yuan, and J. 310
A. Staplers. 2007. Polyphasic approach of the taxonomy of the Rhizopus 311
stolonifer group. Mycol. Res. 111:196-203. 312
12. McAdams, H. P., M. Rosado de Christenson, D. C. Strollo, and E. F. Patz Jr. 313
1997. Pulmonary mucormycosis: radiologic findings in 32 cases. Am. J. 314
Roentgenol. 168:1541-1548. 315
13. Parfrey, N. A. 1985. Improved diagnosis and prognosis of mucormycosis. 316
Medicine 65:113-123. 317
14. Padhye, A. A., and L. Ajello. 1988. Simple method of inducing sporulation by 318
Apophysomyces elegans and Saksenaea vasiformis. J. Clin. Microbiol. 26:1861-319
1863. 320
15. 15.Pagano, L., P. Ricci, A. Nosari, A. Tonso, M. Buelli, M. Montillo, L. 321
Cudillo, A. Cenacchi, C. Savignana, L. Melillo, A. Chierichini, R. Marra, G. 322
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
15
Bucaneve, G. Leone, and A. Del Favero. 1995. Fatal haemoptysis in pulmonary 323
filamentous mycosis: an under evaluated cause of death in patients with acute 324
leukemia in haematological complete remission. A retrospective study and 325
review of the literature. Brit. J. Haematol. 89:500-505. 326
16. Ribes, J. A. , C. L. Vanover-Sams, and D. J. Baker. 2000. Zygomycetes in 327
human disease. Clin. Microbiol. Rev. 13:236-301. 328
17. Roden, M. M., T. E. Zaoutis, W. L. Buchanan, T. A. Knudsen, T. A. 329
Sarkisova, R. L. Schaufele, M. Sein, C. C. Chiou, J. H. Chu, D. P. 330
Kontoyiannis, and T. J. Walsh. 2005. Epidemiology and outcome of 331
zygomycosis: a review of 929 reported cases. Clin. Infect. Dis. 41:634-653. 332
18. Schipper, M. A. A. 1984. A revision of the genus Rhizopus. 1. The Rhizopus 333
stolonifer group and R. oryzae. Studies in Mycology 25:1-19. 334
19. Schipper, M.A. A., and J. A. Stalpers. 1984. A revision of the genus Rhizopus 335
II. The Rhizopus microsporus group. Studies in Mycology 25:20-34. 336
20. Scholer, H. J. 1970. Mucormykosen bei Mensch und Tier. Taxonomic der 337
Erreger. Chemotherapie im Tiereexperiment und in der Klinik. 338
Habilitationsschrift, Med. Faculty, University of Basel. 339
21. Sun, Q. N., A. N. Fothergill, D. I. McCarthy, M. G. Rinaldi, and J. R. 340
Graybill. 2002. In vitro activities of posaconazole, itraconazole, voriconazole, 341
amphotericin B, and fluconazole against 37 clinical isolates of Zygomycetes. 342
Antimicrobiol. Agents Chemother. 46:1581-1582. 343
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
16
22. Tedder, M., J. A. Spratt, M. P. Anstadt, S. S. Hegde, S. D. Tedder, and J. E. 344
Lowe. 1994. Pulmonary mucormycosis: results of medical and surgical therapy. 345
Ann. Thorac. Surg. 57:1044-1050. 346
23. Voigt, K., E. Cigelnik, K. O’Donnell. 1999. Phylogeny and PCR identification 347
of clinically important zygomycetes based on nuclear ribosomal-DNA sequence 348
data. J. Clin. Microbiol. 37:3957-3964. 349
24. Yagi, S., N. Miyashita, M. Fukuda, Y. Obase, K. Yoshida, A. Miyauchi, K. 350
Kawasaki, H. Soda, and M. Oka. 2008. Pulmonary mucormycosis 351
(Cunninghamella bertholletiae) with cavitation diagnosed using ultra-thin fibre-352
optic bronchoscopy. Respirology 13: 312-314. 353
354
355
356
357
358
359
360
361
362
363
364
365
366
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
17
Explanation of Figures 367
Figure 1: Axial contrast enhanced CT sections of the chest - mediastinal window (Fig. 368
1A) and lung window (Fig. 1B), revealing a thick-walled cavity in the posterior segment 369
of right upper lobe (white arrow) with multiple irregular septations within it. Also seen 370
are a few lymph nodes in the pretracheal location. 371
Figure 2: Periodic acid Schiff’s stained lung tissue section showing dense, acute 372
inflammatory infiltrates, fibrosis, necrosis, and aseptate, hyphal elements (Case 1) X 100 373
Figure 3: Lactophenol cotton blue mount of R. homothallicus (MCCL 710076) showing 374
numerous golden-brown, globose zygospores with stellate spines X 200 (insetX400) 375
on May 11, 2020 by guest
http://jcm.asm
.org/D
ownloaded from