BIOTECHNOLOGYAKA DNA TECHNOLOGY
Biotechnology
Often referred to as genetic engineering, it’s basically how scientist and researchers manipulate genes.
Recall, DNA is the genetic material of all living organisms that carry genetic code that may code for proteins.
Genes from one kind of organism can be transcribed and translated (protein synthesis!) when put into another kind of organism.
For example, human and other genes are routinely put into bacteria in order to synthesize products for medical treatment and commercial use. Human insulin, human growth hormone, and vaccines are produced by bacteria.
First, What is………………• Recombinant DNA DNA from different sources sliced then
spliced together.• Called transgenic
• Plasmid Vector Circular, double-stranded DNA used to transfer genes into a host bacterial
• Viral Vector Harmless virus typically used in gene therapy
• Bacterial Transformation The host bacterium, such as E. coli, takes up the plasmid, which includes the foreign gene. Bacteria will replicate the foreign DNA along with their own DNA producing wanted protein such as human insulin
• Restriction Enzymes proteins that digest DNA at specific regions for preparation of bacterial transformation
Recombinant DNA– Insertion of a Functional gene from one organism into Bacterial Plasmid Transformation
*This process is pretty involved but here’s the basic idea
*Recombinant DNA Technology – Bacterial Transformation and Cloning of a target gene
*Insulin is created this way
First Step – “cut” DNA OF PLASMID VECTOR AND HUMAN (IN THE CASE OF INSULIN GENE) WITH THE
SAME ENZYME
EcoRI
** These enzymes, CALLED RESTRICTION ENZYMES, recognize a very specific, single palindrome nucleotide sequence.
** Palindromes are sequences that are the same forwards as they are backwards…like the word racecar
CTTAAG Backwards
CTTAAG Forwards
Step 1: A Restriction Enzyme Cleave DNA of Vector and Foreign
DNA Restriction enzyme (green guy called
EcoRI) recognizes nucleotide sequence specific to that enzyme
When it recognizes the palindrome, it cuts the DNA
ATTCGCGGAATTCATTACGCATCGTAAGCGCCTTAAGTAATGCGTAGC
ATTCGCGGTAAGCGCCTTAA
AATTCATTACGCATCG GTAATGCGTAGC
Restriction Enzyme
EcoRI
**The black letters represent the palindrome recognition site
** “Sticky” ends are created (the black letters) that stick out. This allows a gene, or other segment of DNA, to be inserted by base-pairing
Step 2. Inserting the Gene Into Bacterial Plasmid
Vector The human insulin gene is inserted at the “Sticky” ends of the plasmid at the palindrome through base-pairing
Another enzyme “glues” (ligates) them together
GAATTGCTAACTTACGCATGGCAATTCCTTAACGATTGAATGCGTACCGTTAAG
ATTCGCGGTAAGCGCCTTAA
AATTCATTACGCATCG GTAATGCGTAGC
Ligase
**The black letters represent the binding site of the plasmid
**The yellow letters represent the gene for human insulin (of course it is much larger than this, you get the idea!). The white letters are just the restriction site.
Step 3. Host Cell (E. coli here) Takes Up The Plasmid Vector
*NOTICE…Plasmid vector also carries a gene that makes them resistant to ampicillin, an antibiotic that kills bacteria!! This is important in the next step, cloning and the production of insulin!!
Step 4. Bacteria Growth ??
**Bacteria are spread out on petri dishes that contain a medium (food) and ampicillin. (or other antibiotic) They grow, creating clones of themselves.
**No growth..bacteria were killed by ampicillin thus contained NO vector and NO insulin gene
**Growth!! Bacteria were ampicillin resistant thus contained the vector that carried the insulin gene!!
Step 5. Collecting Cloned Product
**Those colonies that contain plasmid vector are allowed to grow, cloning themselves. As they do so, the gene for insulin is expressed (protein synthesis!!!) thus the protein is produced. Eventually, the crude protein can be extracted, purified and you’ve got insulin!
**This is done on a much wider scale than we’ve learned here. Pharmaceutical companies produce enough insulin for millions of Americans who have insulin-dependent diabetes.
In Summary……
** “Slice” a gene from a donor and “Splice” it into the vector…bacteria in this illustration, but viruses can be used too!!
PCR – Performed before gel electrophoresis
Artificial “cloning” of DNA strands in a machine called a thermocycler
Heat separates the DNA strands from each other
Nucleotides (A,G,T,C) are added in reaction tubes Put into a PCR machine called a thermal cycler Added nucleotides find their compliments, and
millions of strands of DNA are cloned
GEL ELECTROPHORESIS
What is it?
Simply put, gel electrophoresis is a technique used to separate molecules such a DNA, RNA and proteins according to size (number of bases) Requires an electric current as these
molecules are negatively charged We’ll be looking at separating DNA
into strands of varying sizes to determine the sequence of a DNA fragment as well as determining DNA fingerprints
First, DNA is Extracted The same DNA is found in the nucleus of nearly all of
your cells (mature red blood cells have no nucleus). Mitochondrion have a totally different set of genes than what is in the
nucleus. You inherit them from your mother! Many studies use this DNA to determine how closely related different species of organisms are!
Nuclear DNA can be extracted from blood, cheek cells, hair follicles, tooth pulp or mostly any other tissue
There are quite a few protocols that use a variety of chemicals and buffers to isolate ONLY DNA and get rid of everything else
Restriction Enzymes
Long strands of DNA, restriction enzymes
Each enzyme recognizes different sites to cut
This results in many fragments of different sizes (number of bases long)
Prepare for gel electrophoresis
Power supply
Gel Chamber with buffer
After the gel cools and becomes jelly-
like, the comb is removed and is
placed in the chamber filled with
buffer
A compound called agarose is melted in a
buffer, poured into a mold and a tooth comb inserted
to create wells
Loading An Electrophoresis Gel
“running a gel”A loading dye (seen in
blue) is mixed with DNA sample and loaded into
a well
Electrical supply is turned on…DNA
fragments run through the gel from the
negative electrodes toward the positive
DNA Ladder (or size standard) is also loaded. This lets allows you to determine how
long each fragment is (in
kilobases)
The gel is stained and examined. The
smallest (shortest) fragments travel the farthest down the gel
DNA Sequencing in a Nutshell
DNA Sequencer (I used this one in grad school)
Reading an Electrophoresis Gel….DNA Sequence
Determine the sequence of bases in a gene, or DNA fragment…read from top to bottom
**This particular sequence is: ATGCTTCGGCAAGACTCAAAAAATA
**Notice it’s one stranded!
Longer Fragments at the Top, Smaller Fragment as the bottom
DNA FINGERPRINTS ARE UNIQUE TO EACH PERSON
Sequences That are Non-Coding
Can Be Used to Produce a DNA Fingerprint
ID of individuals ID of parents Crime scene applications
**Restriction enzymes cut DNA , fragments that contain repeats such as AGGTAGGTAGGT, over and over but the number of repeats differ among individuals. We can run these on a gel (CSI stuff) and see their DNA fingerprint!
Example of Fingerprint (Remember, these are not
genes)**Suspect 3’s Fingerprint is a perfect match of the blood stain!!!
Gel Electrophoresis uses an electric current. DNA fragments that have been cut by enzymes separate by size. The pattern gives you a “fingerprint”
+
-
ATTCGCGGTAAGCGCCTTAA
AATTCATTACGCATCG GTAATGCGTAGC
Largest Fragments
Smallest Fragments
Paternity A person should have ½ of their DNA fragments that match their mother, and ½ that match their father.
-
+
Mom
Child
AF1 AF3AF2The child received these fragments from its mother…
..which means that they must have received these from the father…
…so, which alleged father has the same size fragments as the child at these positions???
…So Alleged Father #2 is the father of the child.
Implications of Biotechnology
Lab Animals
• Mouse chromosomes are similar to humans’ chromosomes and used in many studies
Lab Organisms
• The roundworm Caenorhabditis elegans is another organism with well-understood genetics that is used for transgenic studies.
Lab Orgsanisms
• A third animal commonly used for transgenic studies is the fruit fly, Drosophila melanagaster
• Plants and animals that contain FUNCTIONAL foreign DNA from another organism are known as transgenic organisms
• Such as E. coli bacteria plasmid that contains the gene for human insulin.
Genetically Engineered (slice and splice) Transgenic Organisms Contain
Recombinant DNA
Genetically Engineered (slice and splice) Transgenic Organisms Contain
Recombinant DNA
Genetically Modified Foods
• Crops have been developed that are better tasting, stay fresh longer, and are protected from disease and insect infestations.
• Soybeans that contain a component that helps lower cholesterol
• Alfalfa that’s resistant to herbicides
Pros and Cons Pros:*More nutritious food*Tastier food*Disease- and drought-resistant plants that require fewer environmental *resources (water, fertilizer, etc.)*Decreased use of pesticides*Increased supply of food with reduced cost and longer shelf life*Faster growing plants and animals*Food with more desirable traits, such as potatoes that absorb less fat when fried*Medicinal foods that could be used as vaccines or other medications
Cons:*Modified plants or animals may have genetic changes that are unexpected and harmful.*Modified organisms may interbreed with natural organisms and out-compete them, leading to extinction of the original organism or to other unpredictable environmental effects.*Plants may be less resistant to some pests and more susceptible to others.
In Medicine
Transgenic bacterial used to produce insulin, hormones, antibodies, enzymes, vaccines…It’s crazy!
I Gots me a big ole rooster….
names Jethro
Other Genetically Modified Organisms (GMOs)
Transgenic Animals
Transgenic cattle were created to produce milk containing proteins that aid in the treatment of emphysema.
Transgenic Horses were once created to produce human insulin for diabetics; Now we us E. Coli
Mice that Glow
** insertion of a gene taken from coral and inserted it into the mouse genome
Mouse Growing a Human Ear
Meathead Salmon!!!
Featherless Chickens…No Plucking Necessary
Sheep Milk That Contains a Clotting Protein that is Isolated for People
with Hemophilia
Other Transgenics
Transgenic cattle were created to produce milk containing proteins that aid in the treatment of emphysema.
Transgenic Horses were once created to produce human insulin for diabetics; Now we us E. Coli
Hybrid Animals – Genetically Modified but
not Transgenic
Lion and Tiger hybrid
CLONING
Recall Bacterial Transformation
Transformed bacteria that contain a functional gene replicate creating millions of clones thus a lot of product (whatever the gene codes for)
Cloning of Entire Organisms
A clone is basically a copy of an organism that contains the same DNA…but, since the clone is carried by a surrogate organism, it won’t be exactly the same…
Dolly the sheep is the most famous cloned animal…although it took numerous tries!
What are the ethical aspects of cloning??
How it works…..
The Human Genome Project
Guide to Your Genome
Your genome consists of all of your DNA, collectively, found in most of your cells. We call this genomic DNA
Recall the mitochondria has its on Genes!!!
Consists of between 20-30 thousand genes
3 Billion bases!! (A, G, T and C)
Genome Project Uses
• Helped to create linkage maps shows relative location of genes
• DNA segments near each other on a chromosome tend to be inherited together
Prenatal diagnosis of human genetic disorders using amniocentesis (fluid drawn from pregnant female), use of gene therapy, vaccines, and development of new methods of crime detection
PCR, Gel electrophoresis, screening for drug resistance and diseases
Applications of the Human Genome Project
Genetic Disorder Diagnosis From the affected person, cells are
grown in a cell culture so that enough DNA can be obtained to run the necessary tests
Gene Therapy
The insertion of normal genes into an affected person in an attempt to correct genetic disorders
Gene Therapy of SCID, Severe Combined Immunodeficiency
syndrome Cell culture flask
Bone marrow cells
Bone marrow cell with integrated gene
Add virus with functioning SCID gene
Gene
Hip Bone