Association of Human Leukocyte Antigen-G Polymorphisms and Clinical Outcomes Post-
Transplantation
by
Julieta Lazarte
A thesis submitted in conformity with the requirements for the degree of Master of Science
Institute of Medical Science University of Toronto
© Copyright by Julieta Lazarte, 2016
ii
Association of Human Leukocyte Antigen-G Polymorphisms and Clinical Outcomes Post-Transplantation
Julieta Lazarte
Master of Medical Science
Institute of Medical Science University of Toronto
2016
Abstract
Human leukocyte antigen (HLA)-G has been shown to inhibit cardiac cells injury in
vitro, suggestive of protection against cardiac allograft vasculopathy (CAV). The
expression of HLA-G is regulated by single nucleotide polymorphisms (SNPs), and
their association with CAV remains unknown. The objective was to determine the
association between donor and recipient genotypes and diagnosis of CAV. We
retrospectively analyzed 251 heart recipients of whom 196 had their corresponding
donors and the association was evaluated with parametric hazard regression
models. At 10 years after transplantation, freedom from severe CAV,
retransplantation or death was 64% over a mean follow-up of 5.2 ± 3.6 years. In
multivariable analysis, the presence of donor-recipient SNP -201 (CC-CC) matching
was associated with an increased risk of severe CAV. This is the first investigation
to identify an association and it may reveal a pathway to be explored for potential
diagnostic and therapeutic strategies for CAV.
iii
Acknowledgments The present thesis was made possible with the help and support of many individuals. To start, I would like to thank my family for providing me with unconditional support and encouragement; I would not have made it this far along my journey without them.
To the Rao lab, Laura Tumiati, Hiroyuki Kawajiri, Arash Ghashghaia and Liza Grosman-Rimon, thank you all for welcoming me, always helping me and for all the support along the way. Special thanks to collaborators, Swan Cot from Clinical Genomics Centre for genotyping the gene and HLA laboratory staff Dr. Kathryn Tinckam and Ms. Alice Van Oosterwijk for your tremendous support to get approval and retrieve the samples.
To the staff at the Division of Cardiovascular Surgery and Division of Cardiology at the Peter Munk Cardiac Centre, specially to Dr. Livia Goldraich, Dr. Cedric Manlhiot and Dr. Heather Ross, thank you all very much for all your support along the way, for critically evaluating my work, for your continuous guidance and mentorship.
To my committee members, Dr. Fillio Billia, Dr. Candice Silversides and Dr. Seema Mital, a heartfelt thank you for critically evaluating my work, helping me learn along the way, providing a great deal of additional support and for helping me towards my career goals. I appreciate the welcoming environment you provided while challenging my knowledge and ability.
To my supervisor Dr. Vivek Rao and co-supervisor Dr. Delgado, I owe both of you a sincere amount of gratitude for taking me on as a Master’s student. I am grateful of the amazing mentors I had, I learned a great deal from both of you reading the landscape of research and the persistence and patience it takes to sustain being a clinical scientist. I am very appreciative of the opportunities you have encouraged
iv
me to be a part of and all your support and guidance towards my future aspirations. I am truly grateful that I had the opportunity to work under their mentorship.
To my parents, Monica and Alberto, and brother, Franscisco, with love and gratitude.
v
Contributions HLA laboratory staff including Dr. Kathryn Tinckam and Ms. Alice Van Oosterwijk: for helping me retrieve DNA samples from donors and heart transplant patients from the laboratory.
Swan Cot from Clinical Genomics Centre: for your enormous assistance and insight in identifying the SNPs and for genotyping all the samples.
Dr. Manlhiot from CV Data Management Centre for assisting in all of the statistical analysis, drafting and revisions. The project could not have been completed without all your insight.
Dr. Delgado for overseeing all the angiography reports and helping me to categorize all of them to the current international standards.
Dr. Billia, Dr. Ross and Dr. Goldraich provided tremendous support in scientifically evaluating my thesis project, in the drafting and revisions.
Lastly Dr. Rao and Dr. Delgado for their continual guidance on the overall thesis project, drafting and revisions of all the documents I had to submit.
vi
Table of Contents PAGE
ABSTRACT ii
ACKNOWLEDGMENTS iii
CONTRIBUTIONS v
TABLE OF CONTENTS vi
LIST OF TABLES x
LIST OF FIGURES xii
LIST OF APPENDICES xiii
LIST OF ABBREVIATIONS xiv
CHAPTER 1: LITERATURE REVIEW 1
1. Introduction 1
1.1 Overview 1
1.2 Background 2
1.2.1 Immunology Basics 2
1.2.2 Human Leukocyte Antigen-G 3
1.2.3 HLA-G Structure 5
1.3 HLA-G Immune Inhibition 10
1.3.1 HLA-G Receptors 10
vii
1.3.2 Immune Modulation 13
1.4 HLA-G Polymorphisms 16
1.4.1 5’-Upstream Promoter Region 16
1.4.2 3’-Untranslated Region 19
1.4.3 Coding Region 21
1.4.4 Haplotypes 23
1.5 The Role of HLA-G in Pregnancy 25
1.6 The Role of HLA-G in Cancer 27
1.7 The Role of HLA-G in Heart Transplantation 28
1.8 The Role of HLA-G in Lung, Kidney and Liver Transplantation 32
1.9 The Role of HLA-G Polymorphisms in Heart Transplantation 34
1.10 The Role of HLA-G Polymorphisms in Lung, Kidney and Liver 35
Transplantation
1.11 The Role of Donor HLA-G Expression 36
1.12 The Role of Environmental Factors on Expression 38
1.13 The Role of Immunosuppressive Therapy 39
1.14 Heart Transplantation 40
1.14.1 Risk Factors for Survival Post-Transplantation 41
1.15 Rejection Outcomes Post-Transplantation 43
1.15.1 Cellular Mediated Rejection 43
1.15.2 Donor Specific Antibody 44
1.15.3 Cardiac Allograft Vasculopathy 45
CHAPTER 2: RATIONALE AND HYPOTHESIS 47
viii
2. The Association of Donor and Recipient HLA-G Polymorphisms 47
and Cardiac Allograft Vasculopathy
2.1 Summary and Rationale 47
2.2 Hypothesis 49
CHAPTER 3: METHODS 50
3. Study Design 50
3.1 Population of Interest 50
3.2 DNA Collection 51
3.3 HLA-G Polymorphisms 51
3.3.1 SNP Selection 51
3.3.2 RS1233333 52
3.3.3 RS1233334 53
3.3.4 RS41551813 53
3.3.5 RS12722477 54
3.3.6 RS41557518 54
3.3.7 RS12722482 55
3.3.8 RS371194629 55
3.3.9 RS1063320 56
3.3.10 RS9380142 56
3.3.11 SNP Genotyping 56
3.4 Study Outcome 58
3.5 Statistical Analysis 59
ix
CHAPTER 4: RESULTS 62
4. 62
4.1 General Patient, Donor and Pre-transplant Characteristics 62
4.2 Transplant Characteristics, Outcomes and Medical Therapy 66
4.3 Freedom from Mild CAV 69
4.4 Freedom From Severe CAV 71
4.5 HLA-G Polymorphisms 73
4.6 Predictors of Mild Cardiac Allograft Vasculopathy 77
4.7 Predictors of Severe Cardiac Allograft Vasculopathy 85
CHAPTER 5: DISCUSSION AND CONCLUSION 94
5. General Discussion 94
5.1 Research Aims 94
5.2 Proposed Mechanism 98
5.3 Clinical Significance 104
5.4 Limitation 105
5.5 Future Directions 108
5.6 Conclusion 112
REFERENCES 113
COPYRIGHT ACKNOWLEDGMENTS 137
x
List of Tables
TABLE PAGE
1 Recipient, donor and pre-transplant characteristics of the study 62
cohort
2 Transplant characteristics, outcomes and medical therapy of the 66
recipient cohort
3 Frequency of outcomes (Mild CAV, death/re-transplantation and 71
alive no CAV) with 95% confidence interval from competing risk model.
4 Frequency of outcomes (Severe CAV, death/re-transplantation and 73
alive no CAV) with 95% confidence interval from competing risk model.
5 HLA-G polymorphisms genotype, frequency, MAF and HWE for 74
recipients and donors.
6 Distribution (frequency and percentage) of haplotypes in the recipient 76
and donor cohorts.
7 Frequency of match genotypes between donor and recipient 77
8 Univariate analysis risk factors for mild CAV. 77
9 Multivariate model for the diagnosis of mild cardiac allograft 84
vasculopathy.
xi
10 Univariate analysis risk factors for severe CAV. 85
11 Multivariate model for the diagnosis of severe cardiac allograft 91
vasculopathy.
xii
List of Figures FIGURE PAGE
1 HLA-G gene locus and the HLA-G isoforms. 7
2 HLA-G isoforms. 9
3 HLA-G interactions with target receptors and the modulation of 12
immune activity.
4 HLA-G 5’- Upstream promoter region. 15
5 HLA-G 3’-Untranslated region sequence. 19
6 HLA-G extended haplotypes. 23
7 Pathway for the development of CAV. 30
8 Adult heart-transplant relative incidence of leading causes of death. 42
9 Competing outcomes after heart transplantation. 70
10 Competing outcomes after heart transplantation. 72
11 Predicted freedom from CAV from donor-recipient SNP -201 (CC-CC) 93
matching.
12 Proposed mechanism of the role of HLA-G SNPs. 103
xiii
List of Appendices ITEM
1 Permission to Use Material From Copyright Owner
xiv
List of Abbreviations
14bp 14 base pair
AMR Antibody mediated rejection
ART Assisted reproductive techniques
B-cells B-lymphocytes
BMI Body mass index
CAV Cardiac allograft vasculopathy
CHD Congenital heart disease
CMR Cellular mediated rejection
CMV Cytomegavirus
CNI Calcineurin inhibitor
CNS Central nervous system
CRE/TRE cAMP Respond Element/TPA Response element
CsA Cyclosporine
CVA Cerebrovascular accident
DC Dendritic cells
DEL Deletion
DNA Deoxyribonucleic acid
DSA Donor specific antibody
EnhA Enhancer A
HLA Human leukocyte antigen
HLA-G Human Leukocyte Antigen-G
HR Hazard ratio
xv
HWE Hardy-Weinberg equilibrium
IFN Interferon
IL Interleukin
ILT2/ILT4 Immunoglobulin-like transcript-2 or -4
INS Insertion
INDEL Insertion-deletion
ISHLT International Society of Heart and Lung Transplantation
ISRE Interferon-stimulated response element
KIR2DL4 Killer cell immunoglobulin-like receptor 2DL4
kDa kiloDalton
LCL Lower confidence limit
MAF Minor allele frequency
MHC Major Histocompatibility complex
mRNA Messenger ribonucleic acid
MMF Mycophenolate mofetil
MPA Mycophenolic acid analog
NK Natural killer
PRA Panel reactive antibody
PCR Polymerase chain reaction
PSI Proliferation signal inhibitor
RREB1 Ras Responsive Element Binding 1
SAP Shrimp alkaline phosphatase
sHLA-G Soluble Human Leukocyte Antigen-G
SNP Single nucleotide polymorphism
sNTPs Deoxynucleotide triphosphates
xvi
T-cells T-Lymphocytes
T-reg Regulatory T
TGF Transforming growth factor
TNF Tumor necrosis factor
UTR Untranslated region
UCL Upper confidence limit
VAD Ventricular assist device
Excerpts from this chapter are taken from Lazarte, J., Tumiati, L.C., Rao, V. & Delgado, D. (2015) New Developments in HLA-G in Cardiac Transplantation. Human Immunology: HLA-G Special Issue. In Press
- 1 -
Chapter 1
Literature Review
1 Introduction
1.1 Overview
Human Leukocyte Antigen-G (HLA-G) is a non-classical (class Ib) protein found
within the major histocompatibility complex (MHC). It is located on chromosome 6
(6p21.31) (Roitt, 2001). HLA-G interacts with specific receptors on immune cells to
exert its immunosuppressive effects (Rebmann, da Silva Nardi, Wagner, & Horn,
2014). It is upregulated in various pathological situations such as transplantation,
infection, pregnancy and malignancy where it is thought to modulate the immune
response (Donadi et al., 2011). In addition, a number of polymorphisms have been
described that function to regulate HLA-G expression (Carosella, Rouas-Freiss,
Roux, Moreau, & LeMaoult, 2015; Castelli, Veiga-Castelli, Yaghi, Moreau, &
Donadi, 2014).
The ability of HLA-G to inhibit the immune response holds great potential for its
utilization against rejection in the setting of transplantation and could enhance
current diagnostic, preventive and therapeutic strategies.
- 2 -
1.2 Background
1.2.1 Immunology Basics
The human immunologic system encompasses two defense pathways, the innate
and the adaptive pathways (Roitt, 2001). The innate pathway is primitive and non-
specific, and interacts with many different pathogenic cells as it is the first line of
defense the body has (Roitt, 2001). Leukocytes that participate in the innate
response are the phagocytic cells such as the monocytes, macrophages and others.
The adaptive pathway is highly specific to particular pathogens, unlike the innate
response, it can modulate its activity with successive interactions with the same
pathogen (Roitt, 2001). The main cells involved in the adaptive response are
lymphocytes such as T-lymphocytes and B-lymphocytes. There are many activities
that T-lymphocytes undertake such as the control of B-lymphocyte development,
antibody production, interaction with phagocytes and recognition and destruction of
infected cells (Afzali, Lechler, & Hernandez-Fuentes, 2007). T-lymphocytes
recognize antigens only when presented by proteins from the major
histocompatibility complex (MHC) mainly through their T-cell antigen receptor
(Grey, Buus, Colon, Miles, & Sette, 1989; Roitt, 2001; Townsend & McMichael,
1985).
The major histocompatibility complex (MHC) is a gene complex with more than 100
gene loci located in chromosome 6. The main function of the genes in the MHC
(class I and II) is to present antigens that are recognized by T-lymphocytes and
- 3 -
initiate the activation of the immune system (Roitt, 2001). MHC class I genes are
further subdivided into (a) classical and (b) non-classical (Lefranc et al., 2005).
HLA-E, -F, -G and –H genes are part of the non-classical and less polymorphic, in
addition, HLA-E and –G are also uniquely recognized by NK cells (Roitt, 2001). All
the MHC molecules are co-dominantly expressed (Hviid, Moller, Sorensen, &
Morling, 1998).
In transplantation, the immune system recognizes foreign antigens expressed on
the graft resulting in an immune response, either cell-mediated or antibody-
mediated. This immunologic response was first identified by Medawar (1944). The
graft cells and the host cells present antigens and subsequently stimulate T-
lymphocytes (Roitt, 2001). Rejection is a time-dependent event occurring with
decreasing frequency with increasing time from transplant. Hyper acute rejection
occurs immediately after cross clamp removal, acute rejection can occur at any time
post-transplant but is more common in the early weeks. Although, donor and
recipient HLA matching, especially in renal transplantation, has led to a dramatic
decrease in rejection this is not feasible in heart transplantation (Roitt, 2001).
Hence, allograft rejection remains a major survival-limiting factor.
1.2.2 Human Leukocyte Antigen-G
Unlike the other HLA proteins, the major function of HLA-G is to inhibit the
immune cells activity rather than to present peptides (Ishitani et al., 2003). Indeed
HLA-G is limited to the type of peptides it presents, in particular, presented
peptides originate from single cytokine related proteins, histones H2A, nuclear and
- 4 -
ribosomal proteins and cytokine receptors (Diehl et al., 1996; Ishitani et al., 2003;
Lee et al., 1995). Furthermore, HLA-G differs from the rest of the HLA molecules,
with a conserved coding region, limited expression, alternative splicing produces
seven different protein isoforms and, most importantly to transplantation, it
promotes tolerance (Donadi et al., 2011; Kovats et al., 1990b; Paul et al., 2000).
Transcription of HLA-G occurs in all cells, however, translation is restricted to a
few cell types (Carosella et al., 2003). HLA-G was initially identified in the cells
that line the maternal and fetal boundary (Geraghty, Koller, & Orr, 1987) and later
in amnion epithelial cells (Houlihan, Biro, Harper, Jenkinson, & Holmes, 1995),
erythroid progenitor (Menier et al., 2004), endothelial precursors cells (Blaschitz et
al., 1997; Menier et al., 2004), cornea cells (Le Discorde, Moreau, Sabatier, Legeais,
& Carosella, 2003), nail matrix cells (Ito et al., 2005), pancreas cells (Cirulli et al.,
2006) and thymus cells (Crisa, McMaster, Ishii, Fisher, & Salomon, 1997).
Interestingly, HLA-G expression has been shown to be induced post-transplantation
(Lila et al., 2002), in pregnancy complications (Abbas, Tripathi, Naik, & Agrawal,
2004; Goldman-Wohl, Ariel, Greenfield, Hanoch, & Yagel, 2000), viral infections
(LeBouder et al., 2009; Yan, Lin, Chen, & Chen, 2009), inflammatory diseases
(Rizzo et al., 2008) and malignancies (Dias, Castelli, Collares, Moreau, & Donadi,
2015).
Expression of HLA-G is modified by various genetic and environmental factors.
Genetic factors include nucleotide variations that affect the binding of regulatory
factors, microRNAs and DNA methylation and histone modification (Carosella et
al., 2015). On the other hand, environmental inducers of HLA-G expression include
- 5 -
growth factors, anti-inflammatory, pro-inflammatory and hormones such as
progesterone (Sheshgiri, Rao, et al., 2008), interleukin 10 (IL-10) (Moreau et al.,
1999; Rizzo et al., 2005), interferons (IFNs) (Lefebvre et al., 2001), hypoxia
(Nagamatsu et al., 2004) and others (Moreau, Flajollet, & Carosella, 2009). Lastly,
in the settings of transplantation, immunosuppressive therapy has also been
recognized to induce expression (Sheshgiri et al., 2009).
1.2.3 HLA-G Structure
The 39 kilo Dalton (kDa) HLA-G protein is composed of a heavy chain linked to the
β2-microglobulin light chain (Geraghty et al., 1987). The HLA-G gene locus
resembles high degree of similarity to the classical HLA class I genes however
discrepancies remain regarding the location of the initiation of the HLA-G mRNA
transcript, the initiation of the 3’-untranslated region and the nomenclature for the
exons and introns (Carosella et al., 2015). These discrepancies and lack of consensus
are clearly noted in the Immunogenetic Database (IMGT/HLA) and the National
Center for Biotechnology Information (NCBI). According to the IMGT/HLA
database, exon 1 codes the leader peptide, exons 2-4 code the three α domains (α1,
α2, α3) and exon 5 codes the transmembrane domain (Figure 1)(Geraghty et al.,
1987). Exons 6 encodes for the cytoplasmic tail and contains a stop codon that
shortens the final protein product (Carosella et al., 2015).
Alternative splicing of the mRNA creates 7 protein isoforms (Figure 1) (Paul et al.,
2000). These constitute four membrane-bound (HLA-G1 to G4) and three soluble
(HLA-G5 to G7) isoforms (Paul et al., 2000). HLA-G1 and HLA-G5 contain the full-
- 6 -
length protein structure and are composed of a heavy chain of three α globular
domains non-covalently linked to β2 microglobulin and a peptide (Paul et al., 2000).
The HLA-G2 and HLA-G6 isoforms lack the α2 globular domain, HLA-G3 and HLA-
G7 lack the α2 and α3 globular domains and HLA-G4 lacks the α3 globular domain
with no soluble counterpart unlike the other isoforms (Ishitani & Geraghty, 1992;
Kirszenbaum, Moreau, Gluckman, Dausset, & Carosella, 1994; Paul et al., 2000).
- 7 -
Figure 1: HLA-G gene locus and the HLA-G isoforms. The HLA-G gene locus contains 7 introns and 8 exons, typical of HLA class I gene locus. Exon 1 codes the signal peptide, exons 2-4 code three α domains (α1, α2, α3) and exons 5-6 code the transmembrane and cytoplasmic region. Exons 7 and 8 are not coded due to the presence of a stop codon in exon 6. Alternative splicing of the mRNA creates 7 protein isoforms. These constitute four membrane-bound (HLA-G1 to G4) and three soluble (HLA-G5 to G7) isoforms. Adapted from Copyright © The Author(s) 2010 - Donadi et al. (2011).
- 8 -
All the soluble counterparts (HLA-G5, HLA-G6 and HLA-G7) further lose the
transmembrane and cytoplasmic domains due to a stop codon in intron 4 (Fujii,
Ishitani, & Geraghty, 1994; Paul et al., 2000). Lastly, metalloproteases can shed-off
membrane-bound HLA-G1 resulting in a soluble protein (sHLA-G1) (Dong et al.,
2003). Therefore, the HLA-G molecule can be found as 7 different isoforms;
membrane-bound, soluble or shed. In addition, the HLA-G molecule is capable of
dimerization due to the presence of an unpaired cysteine at position 42 in the α1
domain (Figure 2) (Shiroishi, Kuroki, Ose, et al., 2006). A second cysteine in
position 147 in the α3 domain may also be involved in the dimerization although to
a lesser capacity (Boyson et al., 2002). These two cysteine (position 42 and 147) are
in addition to the characteristic ones in α2 and α3 domains of the HLA class I
molecules (Geraghty et al., 1987). Dimerization shifts the binding site to an oblique
orientation, which increases its binding specificity to receptors (Shiroishi, Kuroki,
Ose, et al., 2006). Indeed HLA-G receptors have a higher affinity for dimers as
opposed to the monomer configuration (Shiroishi, Kuroki, Ose, et al., 2006).
Furthermore, the association rate is prolonged with dimerization (Shiroishi, Kuroki,
Ose, et al., 2006). The importance of dimer formation is supported by two
observations. First no allele contains a polymorphism at codon 42 (TGT), therefore,
all isomers can create dimers (Howangyin et al., 2012). Secondly, once a variation is
introduced at codon 42 the activity of the molecule is significantly reduced (Gonen-
Gross et al., 2003). Therefore it was proposed that dimerization is required for
interaction with its receptors (Gonen-Gross et al., 2003). In summary, the HLA-G
molecule can be present in various forms. This feature will become important at a
- 9 -
later time when defining the expression of HLA-G with its associated
polymorphisms and clinical outcomes.
Figure 2: HLA-G isoforms and dimers produced through the unpaired cysteine at position 42 and 147. Adapted from Copyright © 2012 Informa Healthcare USA, Inc. -Gonzalez et al. (2012).
- 10 -
1.3 HLA-G Immune Inhibition
1.3.1 HLA-G Receptors
Several different pathways have been described demonstrating how HLA-G exerts
its protective effect. HLA-G is the main ligand for immunoglobulin-like transcript-2
(ILT2 or LILRB1) and -4 (ILT4 or LILRB2), the killer immunoglobulin-like receptor
(KIR2DL4/CD158d) and CD8 co-receptor (Figure 2)(Colonna et al., 1997; Colonna et
al., 1998; Rajagopalan & Long, 1999; Sanders, Giblin, & Kavathas, 1991). ILT2 and
ILT4 receptors interact with the α3 domain only found in the full-length protein,
HLA-G1, and its soluble counterpart, HLA-G5 (Shiroishi et al., 2003). In addition,
ILT2 recognizes the β2m structure while ILT4 recognizes the free heavy chains
(Gonen-Gross et al., 2005; Shiroishi, Kuroki, Rasubala, et al., 2006). ILT2 receptors
are present in B-lymphocytes (B-cells), T-lymphocytes (T-cells), natural killer (NK)
cells, monocytes, and dendritic cells (DC) (Colonna et al., 1997). ILT4 receptors are
expressed on monocytes, DC and macrophages (Colonna et al., 1998). Indeed, ILT2
and ILT4 receptors have the highest affinity for HLA-G over any other HLA class I
molecules (Shiroishi et al., 2003).
Due to the HLA-G interaction with the KIR2DL4 receptor (found primarily in NK
cells), HLA-G was recognized for protecting the fetus from the mother’s immune
system (Rajagopalan & Long, 1999). The KIR2DL4 receptor only recognized the α1
domain (which all protein isoforms have). However, the function of KIR2DL4, bound
to HLA-G, remains controversial with stimulatory and inhibitory effects described
- 11 -
rather than just inhibitory ones given HLA-G’s known protective effect (Le Page,
Goodridge, John, Christiansen, & Witt, 2014; Rajagopalan & Long, 1999). The CD8
co-receptor is found in activated T-cells and subpopulations of NK cells and
recognizes the α3 domain (Sanders et al., 1991). HLA-G also binds to CD160 found
in CD8+T-cells and NK cells (Contini et al., 2003; Fons et al., 2006). By interacting
with these receptors, HLA-G can exert an immune inhibitory effect. This is
summarized in Figure 3.
- 12 -
Figure 3: Soluble HLA-G interactions with target receptors on various immune cells and the modulation of their immune activity. Adapted from Copyright © 2007 Elsevier Ltd. - Pistoia, Morandi, Wang, and Ferrone (2007).
- 13 -
1.3.2 Immune Modulation
HLA-G creates a time-dependent tolerant environment. This is achieved once HLA-
G binds to the ILT2, ILT4, KIR2DL4, CD8 and CD160 receptors in T-cells, NK cells,
B-cells, monocytes/macrophages and DC cells (Figure 3) (Gonzalez et al., 2012).
Indeed the tolerant effect lasts as long as HLA-G is bound to the aforementioned
receptors. Various investigations describe the response of the immune cells once
HLA-G interacts with their receptors. CD8+ T-cell and CD8+ NK cells undergo
apoptosis (Contini et al., 2003). CD4+ T-cell activity is repressed, regardless of the
presence of CD8+ T-cells (Bainbridge, Ellis, & Sargent, 2000). NK cell-mediated
lysis is suppressed (Rouas-Freiss, Goncalves, Menier, Dausset, & Carosella, 1997).
Dendritic cell maturation is inhibited (Liang et al., 2008). T-cells’ cytotoxic response
of allo-proliferation is inhibited (Riteau et al., 1999). Furthermore, proliferation,
differentiation and antibody secretion in B-cells is suppressed (Naji et al., 2014).
Overall, the binding of HLA-G to its receptors changes the cells’ activity to promote
tolerance.
Long-term modulation by HLA-G involves the formation of regulatory/suppressor
cells that continue inhibiting the immune system, even in the absence of HLA-G
(Gonzalez et al., 2012; Rebmann et al., 2014). Often times, the switch to regulatory
cells is triggered by trogocytosis. Trogocytosis occurs when a portion of the
membrane (with bound HLA-G) is transferred from cell to cell (Caumartin et al.,
2007; LeMaoult et al., 2007). In this process, the recipient cell acquires membrane-
embedded HLA-G molecules from a donor cell and for a brief period can utilize the
- 14 -
HLA-G (Caumartin et al., 2007). Again various investigations highlight HLA-G’s
effect once in contact with the immune cells. T-cells allo-proliferation is inhibited
and the cells switch to a regulatory behavior promoting a tolerogenic behavior onto
other cells (Le Rond et al., 2006). Activation through trogocytosis leads CD4+ and
CD8+ T-cells to become unresponsive over the long-term and switch their phenotype
to regulatory T-cells (LeMaoult et al., 2007; LeMaoult, Krawice-Radanne, Dausset,
& Carosella, 2004). NK cells’ cytotoxic activity is terminated as they change their
behavior to regulatory activity and stimulate other NK cells (Caumartin et al.,
2007). DC cell maturation is terminated. The resulting DC cells then stimulate the
differentiation of T-cells into regulatory T-cells (Liang, Baibakov, & Horuzsko, 2002;
Liang et al., 2008). Altogether, the association of HLA-G with these cells initiates a
cascade effect that promotes long-term tolerance in the environment.
- 15 -
Figure 4: HLA-G 5’- upstream promoter region with the known regulatory elements that bind to the gene and the current polymorphisms identified accordingly to the 1000 Genome data. Adapted from Copyright © 2014 Erick C. Castelli et al. (2014).
- 16 -
1.4 HLA-G Polymorphisms
HLA-G gene expression is co-dominant. In this case, both paternal and maternal
alleles are expressed together and the phenotype is a combination of the two (Hviid
et al., 1998). Unlike HLA class I genes, the HLA-G gene has limited polymorphisms.
The coding region is the most conserved region while the 5’-upstream promoter
region and 3’-untranslated region demonstrate some variability (Castelli et al.,
2014). Due to this particular characteristic, variations in the gene are considered to
be instrumental in generating variable expression among individuals (Castelli et
al., 2014).
1.4.1 5’-Upstream Promoter Region
The 5’-upstream promoter region determines the rate of synthesis of the mRNA by
interacting with transcription factors (Castelli et al., 2014). The region contains two
main regulatory modules, the cis regulatory element, which includes the Enhancer
A with the interferon-stimulated response element (ISRE), and the second
regulatory element is the SXY module (Figure 4) (Castelli et al., 2014). These
regulatory elements are modified in contrast to typical HLA class I promoter
regions (S. J. Gobin & van den Elsen, 2000; Solier et al., 2001). The modifications
render them unresponsive to common HLA modulators such as nuclear factor (NF) -
κB and IFN-y (Castelli et al., 2014; S. J. Gobin, Keijsers, Cheong, van Zutphen, &
Van den Elsen, 1999; S. J. P. Gobin, van Zutphen, Woltman, & van den Elsen, 1999;
van den Elsen, Gobin, van Eggermond, & Peijnenburg, 1998). For instance, the
- 17 -
Enhancer A (EnhA) element only interacts with p50/p50 homodimers in the HLA-G
gene in comparison with the vast array of homo and heterodimer factors that the
HLA class I genes interact with such as p65/p65 homodimers and p65/p50
heterodimers. Furthermore, the p50/p50 homodimers are recognized to be
ineffective promoters of transcription compared to p65/p65 and p65/p50 (Castelli et
al., 2014). Other elements in the promoter region constitute the heat shock element,
progesterone receptor element, hypoxia response element, locus control region
candidate, the CRE/TRE candidate sites (cAMP Respond Element/TPA Response
element), the RREB1 (Ras Responsive Element Binding 1) and GLI-3 repressor (a
signal transducer of the Hedgehog pathway) all which presume to regulate the
expression of HLA-G (Castelli et al., 2014). The heat shock element and hypoxia
response element are unique to the HLA-G gene (Ibrahim, Morange, Dausset,
Carosella, & Paul, 2000; Moreau et al., 2009). Although the heat shock factor
increases the expression of the HLA-G molecule, the functionality of the element is
unknown (Moreau et al., 2009). Indeed, the effect on HLA-G expression varies for
each element. For instance, the Ras Responsive element once activated decreases
HLA-G transcription and subsequent expression (Flajollet, Poras, Carosella, &
Moreau, 2009). While, the presence of progesterone upregulates the expression of
the protein (Yie, Xiao, & Librach, 2006).
Various polymorphisms are present in close proximity to regulatory elements,
modifying their affinity to the gene and subsequently affecting the overall
expression of HLA-G. A number of investigations have identified the role of various
- 18 -
single nucleotide polymorphisms (SNPs) in modulating expression levels of HLA-G
and correlate their role in disease states (Donadi et al., 2011; Hviid, Hylenius,
Rorbye, & Nielsen, 2003; Z. Tan, Shon, & Ober, 2005). The G allele for the SNP-725
has been associated with an increased risk of miscarriages and risk for multiple
sclerosis (Ober, Billstrand, Kuldanek, & Tan, 2006; Wisniewski et al., 2010). Ober
et al. (2006) indicated that the switch of C for G creates a greater chance of
methylation at this SNP that could be inhibiting the transcription and subsequently
lead to lower HLA-G expression (Moreau et al., 2003). SNP-201 is located close to
regulatory elements P50 (a nuclear factor NF- Κ-B p105 subunit), SP1
(Transcription factor specificity protein 1) and hypoxia response element and has
been identified to potentially affect their association to the gene (Moreau et al.,
2009). Lastly, a variation at position -964 has been associated with asthma in
children and their respective mothers potentially because the presence of the A
allele decreases the methylation compared to the G allele (Nicolae et al., 2005; Ober
et al., 2003; Z. Tan et al., 2005).
- 19 -
Figure 5: HLA-G 3’-untranslated region sequence with the location of the polymorphisms bolded. Adapted from Copyright © 2010 Macmillan Publishers Limited - Castelli et al. (2010).
1.4.2 3’-Untranslated Region
The 3’-untranslated region (UTR) establishes the degradation rate of the mRNA
product (Castelli et al., 2014). The 3’-UTR region begins past the stop codon in exon
6, since exon 7 and 8 are not present in the mature mRNA and it contains
regulatory elements such as AU-rich motifs and a poly-A signal (Alvarez, Piedade,
Balseiro, Ribas, & Regateiro, 2009; Geraghty et al., 1987; Kuersten & Goodwin,
2003). In addition, there are binding sites for micro-RNA (Castelli, Moreau,
Chiromatzo, et al., 2009) that down regulate mRNA expression (Gonzalez et al.,
2012; Veit & Chies, 2009). An investigation by Porto et al. (2015) analyzed the
- 20 -
relation between the various microRNAs and the HLA-G polymorphisms. It was
proposed that a panel of microRNAs bind to some of the polymorphisms and may be
therefore be affected by them while others microRNAs bind to the gene
irrespectively of the nucleotide variations (Porto et al., 2015). Therefore in order to
fully predict the expression of HLA-G, besides sequencing the HLA-G gene for
polymorphisms, it was suggested that microRNAs should be profiled separately
since expression of HLA-G is a result of a combination of all these factors
influencing expression (Porto et al., 2015).
Several polymorphisms have been identified to modulate the expression of HLA-G
and are scattered in this region, such as the SNP 3142, SNP 3187, SNP 3196 and
the 14bp insertion-deletion (INDEL) sequence (Figure 5). However, other SNPs
have also been studied and associated to a lesser degree. For instance, the presence
of allele CC at position SNP 3027 was associated with higher soluble HLA-G levels
in a healthy donor population compared to the other alleles in that same position
(Martelli-Palomino et al., 2013). SNP 3142 has been associated with regulating
HLA-G expression. The presence of a GG at this SNP results in lower protein
production in a multiple sclerosis cohort (Rizzo et al., 2012) and may be related to
the fact that this SNP is targeted by micro-RNAs when guanine is present (Z. Tan
et al., 2007; Veit & Chies, 2009). The A allele for SNP 3187 is associated with pre-
eclampsia and AA genotype is associated with increased severity of the disease (Yie,
Li, Xiao, & Librach, 2008). Indeed, it was also observed that the A allele for this
SNP is associated with lower protein expression in vitro through alterations in
mRNA stability (Yie et al., 2008). SNP 3196 is located closed by and to the right of
- 21 -
an AU-rich segment in the HLA-G gene that is affected by microRNAs. Indeed, the
presence of guanine at SNP 3196 position is associated with severe pre-eclampsia in
primiparas (Larsen, Hylenius, Andersen, & Hviid, 2010).
The 14bp INDEL (5’-ATTTGTTCATGCCT-3’) polymorphism has been extensively
studied. Found in the 3’ end of the gene, it spans from position +2961 to +2974
(Harrison, Humphrey, Jakobsen, & Cooper, 1993). Martelli-Palomino et al. (2013)
found that individuals homozygous for the deletion (DEL) allele have significantly
higher HLA-G expression than individuals homozygous for the insertion (INS)
allele. The INS allele is associated with a stable mRNA with lower mRNA
production and subsequently lower expression overall, as compared to the DEL
allele (Hviid et al., 2003).
1.4.3 Coding Region
The HLA-G coding region is known for its low degree of polymorphism, this
characteristic requires a strong selective pressure for invariance. Worldwide, 50
coding region alleles have been identified that have either non-synonymous or
synonymous polymorphisms combining to a total of 16 distinct proteins (G*01:01,
G*01:02, G*01:03, G*01:04, G*01:05N, G*01:06, G*01:07, G*01:08, G*01:09,
G*01:10, G*01:11, G*01:12, G*01:13, G*01:14, G*01:15, G*01:16, G*01:17, G*01:18)
(IMGT/HLA Database version 3.21.0). The most prominent alleles in the worldwide
population are G*01:01, G*01:03, G*01:04 and G*01:06 (Donadi et al., 2011). Two
alleles are associated with partial or no molecule expression. Allele G*01:05N has a
single nucleotide deletion in codon 130 which causes a frame shift and the
- 22 -
formation of a stop codon (Suarez et al., 1997). Partial production of the protein
isoforms is observed with this allele (Suarez et al., 1997). Null allele G*01:13 has a
single nucleotide exchange, which leads to the formation of a stop codon in position
54 (Lajoie, Jeanneau, Faucher, Moreau, & Roger, 2008). No molecule is produced
with this allele (Lajoie et al., 2008).
In general, polymorphisms in the coding region have been found close to the three α-
globular domains regions, where the variations can cause modifications to the
interactions of the protein with the receptors (Donadi et al., 2011). There are 4
mutations in codons 13, 27, 31 and 54 that can affect α1 domain. The α2 domain has
six mutations in codons 100, 104, 105, 110, 130, 159 and 169. And lastly, mutations
on codons 185,189, 219 and 258 can affect the α3 domain (Donadi et al., 2011).
Interestingly, the signal peptide and transmembrane portion remain highly
conserved (Donadi et al., 2011). A few alleles from the coding region have been
associated with modulating protein expression (Rebmann et al., 2001). Rebmann et
al. (2001) was the first investigation to associate alleles in the coding region to
high/low HLA-G expression (Rebmann et al., 2001). The presence of allele G*01:04
was related to higher HLA-G expression, while alleles G*01:05N and G*01:01:03,
with low HLA-G in a healthy cohort (Rebmann et al., 2001). Furthermore, alleles
from the coding region have been associated with detrimental or beneficial
outcomes in various diseases. For instance, G*01:05N, G*01:01:08 and G*01:01:03
were found in higher frequency in a population of women with recurrent
spontaneous abortion compared to a healthy cohort indicating that the alleles may
be detrimental (Abbas et al., 2004). Another investigation identified an increase risk
- 23 -
for miscarriages with alleles G*01:04 or G*01:05N (Aldrich et al., 2001). Lastly
Castelli, Mendes-Junior, Viana de Camargo, and Donadi (2008) recognized allele
G*01:04 to be associated with patients whose tumor had progressed to a higher
grade while allele G*01:03 was associated with high-grade tumors in patients that
reported smoking. Indeed, though limited, the coding region polymorphisms do
appear to have an effect in the HLA-G molecule expression and subsequent disease
outcome.
Figure 6: HLA-G extended haplotypes created with polymorphisms from the 5’-upstream promoter, 3’-untranslated and coding region with their frequency in a healthy volunteer population. Adapted from Copyright © 2012 American Society for Histocompatibility and Immunogenetics - Di Cristofaro et al. (2013).
1.4.4 Haplotypes
Several investigations have identified variations in polymorphisms in the 5’-
upstream promoter region, coding region and 3’-untranslated region, that always
- 24 -
occur together as formed haplotypes, a phenomenon called linkage disequilibrium
(LD) (Castelli et al., 2011). Indeed, it is reasonable to consider that the effect of a
single nucleotide variation is not independent of the rest and that the overall
expression of the HLA-G gene may be better understood once all regions are
considered together. Several SNP variations (from all regions of the gene) were
grouped into 8 different haplotypes and related to levels of HLA-G expression
(Figure 6)(Di Cristofaro et al., 2013). The presence of a single haplotype 5 and
homozygous haplotype 1/haplotype 1 were associated with significantly higher
HLA-G expression compared to other haplotypes (Di Cristofaro et al., 2013). A
single haplotype 5 allele indicates its strong dominant effect (Di Cristofaro et al.,
2013). The haplotype 5 has SNP -725T, -716T, -201G, -56T, INS, 3142G, 3187A,
3196C and G*01:03 (Di Cristofaro et al., 2013). The effect of haplotype 5 may be, in
part, due to SNP -56 and -725, since the T allele for SNP -56 and the T allele for
SNP -725 are only present in haplotype 5 (Di Cristofaro et al., 2013). For haplotype
1, the allele includes SNP -725C, -716T, -201G, -56C, DEL, 3142C, 3187G, 3196C
and G*01:01 (Di Cristofaro et al., 2013). Interestingly, the presence of the INS allele
in haplotype 5 and 1 do not corroborate with low HLA-G levels as seen in previous
investigations (Di Cristofaro et al., 2013). Lastly, patients with haplotype
2/haplotype 2 had significantly lower HLA-G (Di Cristofaro et al., 2013). Haplotype
2 consisted of SNP -725C, -716G, -201A, -56C, INS, 3142G, 3187A, 3196G and
G*01:01/G*01:05N/ G*01:06 (Di Cristofaro et al., 2013). This may indicate that the
presence of GG at SNP 3196 is associated with significantly lower than normal
HLA-G levels, since it only occurs in haplotype 2 (Di Cristofaro et al., 2013). The
- 25 -
remaining haplotypes, which consist of a combination of variations in SNP -725G/C,
-716T/G, -201C/T, DEL/INS, 3142C/G, 3187G/A and G*01:01/G*01:04, had HLA-G
levels in between the high and low category and significantly different from either
(Di Cristofaro et al., 2013). Indeed analyzing haplotypes or SNPs from all the
regions of the gene is currently the most comprehensive way of understanding the
effect of HLA-G polymorphisms compared to investigating a single polymorphisms
because it provides the full picture of the effect of polymorphisms throughout the
gene.
1.5 The Role of HLA-G in Pregnancy
Initially the expression of the HLA-G molecule was found in the trophoblast cells of
the placenta where it was recognized to be a key player in maternal tolerance
(Moreau et al., 1995). Trophoblast cells lack the expression of HLA class I peptides
such as HLA-A and -B on their cell surface but they do have HLA-G, -E –F, and –C
(King et al., 1996; Kovats et al., 1990a). As such, maternal T-cells are unable to
initiate an immune response against the fetus which is in essence a semi allograft
(Ljunggren & Karre, 1990). However, NK cells can stimulate an immune response
by recognizing cells that don’t present antigens (Ljunggren & Karre, 1990). This is
where HLA-G plays a key role in immune tolerance. HLA-G binds specifically to NK
cell inhibitory receptor (KIRKDL4), which in turn terminates the NK cell immune
activation (RouasFreiss, Goncalves, Menier, Dausset, & Carosella, 1997). Indeed
halting HLA-G interaction with the NK cell receptor in vitro, in turn led to an
increase in NK cytotoxic activity demonstrating its inhibitory effect (Sun, Han,
- 26 -
Chen, & Yao, 2008). The interaction of HLA-G with KIRKDL4 receptor protects the
trophoblast cells in the maternal-fetal interface and thus allows for a successful
pregnancy (Roussev & Coulam, 2007).
HLA-G levels increase throughout development starting at the pre-implantation
stage (Shaikly et al., 2008; Yao, Barlow, & Sargent, 2005). Interestingly varying
levels of HLA-G have been associated with different pregnancy outcomes. High
levels of HLA-G pre-implantation are associated with successful pregnancy rates
(Jurisicova, Casper, MacLusky, & Librach, 1996; Yao et al., 2005). Recurrent
spontaneous abortions and pre-eclampsia have been associated with lower levels of
HLA-G, specifically at first week of gestation (Goldman-Wohl, Ariel, Greenfield,
Hanoch, et al., 2000; Goldman-Wohl, Ariel, Greenfield, Hochner-Celnikier, et al.,
2000; Yie, Li, Li, & Librach, 2004). This association indicates that pregnancies with
low HLA-G are at a higher risk of such problems than pregnancies with normal
HLA-G levels (Gonzalez et al., 2012). Women with recurrent spontaneous abortion
had significantly higher frequency of the INS allele for the 14bp INDEL
polymorphisms than healthy control women (Hviid, Hylenius, Lindhard, &
Christiansen, 2004). In fact, low HLA-G expression is linked with the INS allele and
has been associated with pregnancy complications in various investigations (Fan,
Li, Huang, & Chen, 2014; Hviid, Hylenius, et al., 2004; Hviid et al., 2003; Wang,
Jiang, & Zhang, 2013).
Research in the area of Assisted Reproductive Techniques (ART) also corroborates
the importance of HLA-G in pregnancy outcomes. The presence of soluble HLA-G in
- 27 -
the embryo has been found to be crucial for a successful pregnancy. HLA-G presence
increases the chances of a successful pregnancy from 45 to 72% (Dahl & Hviid,
2012; Fuzzi et al., 2002; Rizzo et al., 2007).
1.6 The Role of HLA-G in Cancer
In particularly the field of cancer, HLA-G expression was initially identified in
melanoma cells (Paul et al., 1998) but now it is known that it is expressed on
various tumor cell types (Gonzalez et al., 2012). It is considered a cancer biomarker,
as the expression of HLA-G is significantly higher in cancer patients compared to
healthy individuals (Ibrahim et al., 2004; Rebmann, Wagner, & Grosse-Wilde,
2007). More specifically, it is upregulated in choriocarcinona (Mao, Kurman, Huang,
Lin, & Shih Ie, 2007), breast cancer (He et al., 2010), renal cell cancer (Hanak et al.,
2009), ovarian cancer (Menier, Prevot, Carosella, & Rouas-Freiss, 2009), lung
cancer (Cao et al., 2011), liver cancer (Lin et al., 2010), multiple myeloma (Leleu et
al., 2005) and various other tumors (Dias et al., 2015).
HLA-G is a strong immune inhibitor that terminates T-cells and NK cell cytotoxic
activity allowing the tumour an opportunity to ‘hide’ from the immune system (Dias
et al., 2015). Indeed, across various tumour cell types, there is an association
between high levels of HLA-G and poor prognosis (Dias et al., 2015; He et al., 2010).
Poor prognosis is an umbrella term for detrimental outcomes such as shorter
survival time, higher chances of tumor reoccurrence, metastasis, invasion and
others (Dias et al., 2015).
- 28 -
With the exception of the 14bp INDEL polymorphism, the role of various
polymorphisms has been studied to a lesser extent in relation to cancer outcomes.
To that point a recent breast cancer meta-analysis identified the 14bp INDEL
polymorphism to be an important factor in assessing risk of developing cancer in
the Asian population (Ge et al., 2014). In another investigation, patients with
hepatocellular carcinoma screened for the 14bp INDEL polymorphism were found to
have increased tissue expression of HLA-G when they had the DEL genotype (Jiang
et al., 2011). This suggests a potential detrimental role of the 14bp INDEL
polymorphism in cancer, however further work in this area of study is needed to
clarify inconsistences. In the context of transplantation, immunosuppressive
treatment has increased the likelihood of patients developing cancer post-
transplant (Stehlik et al., 2012). It is unknown however, how HLA-G expression
post-transplant affects the development and diagnosis of cancer.
1.7 The Role of HLA-G in Heart Transplantation
The immune inhibitory activity of HLA-G was first studied in the context of cardiac
transplantation in 2000 (Lila et al., 2000). Sheshgiri, Rouas-Freiss, et al. (2008) was
the first to identify in vitro that myocardial smooth muscle cells and cardiac
endothelial cells can be stimulated to express HLA-G in the presence of increasing
progesterone. These findings prompted the idea of progesterone as a novel
therapeutic treatment to stimulate graft tolerance (Sheshgiri, Rao, et al., 2008).
Indeed, as mention before there is a progesterone receptor element in the 5’-
upstream promoter region and it maybe through it that progesterone affects HLA-G
- 29 -
expression (Castelli et al., 2014). Interestingly, these cells did not respond to other
environmental factors known to modulate HLA-G expression, such as interferon γ
and interleukin 10 (Sheshgiri, Rao, et al., 2008). Continuing with this line of work,
our team has explored the relation and response of human coronary smooth muscle
cells to HLA-G. When these cells were treated with everolimus, a potent
immunosuppressant, they expressed HLA-G (Mociornita et al., 2011). In addition,
expression of HLA-G in these cells led to the inhibition of their proliferative activity,
which was dependent on the concentration of HLA-G (Mociornita, Tumiati,
Papageorgiou, Grosman, et al., 2013). Lastly, HLA-G was shown to inhibit
neutrophil adhesion to injured human coronary artery endothelial cells (as a TNF-α-
induced inflammatory response) (Mociornita, Tumiati, Papageorgiou, Grosman-
Rimon, et al., 2013). In summary, HLA-G inhibitory activity in these observations,
suggests its potential role against crucial pathways in the development of CAV
(Figure 7).
- 30 -
Figure 7: Pathway for the development of CAV starting from various stressors that lead to vascular inflammation followed by smooth muscle cell phenotypic change and their migration and proliferation into the vascular intima. Permission granted from Copyright © 2013 Mociornita, Tumiati, Papageorgiou, Grosman, et al. (2013).
Ischemia-reperfusion
EC injury
Acute rejection
Donor disease
Infection
Metabolic disorders
Hypertension
Donor age
Preservation damage
Immunosuppressants
Vascular inflammation
Proinflammatory cytokines
Adhesion molecules Chemokines
Growth factors
TcellsLeukocytes Macrophages
Phenotypic change
SMC migration into vascular intima and proliferation
CAV
- 31 -
In transplantation, survival is limited by rejection of the allograft, which occurs via
cellular-mediated or antibody-mediated processes, additionally, late term survival is
significantly limited by the development of cardiac allograft vasculopathy; which
involves both immune and non-immune factors (Chih et al., 2012; Lund et al., 2014;
Ramzy et al., 2005). In the clinical setting, 18% of heart transplant patients
expressed HLA-G in endomyocardial biopsy specimens (Lila et al., 2002). When
analyzing the association of HLA-G and outcomes post-transplant, patients with no
soluble HLA-G levels had significantly more episodes of acute cellular rejection than
those with positive levels (Lila et al., 2002). Our team demonstrated a strong benefit
to HLA-G expression, since 86% of those patients had no acute cellular rejection
episodes of Grade ≥ 2R (Sheshgiri, Rouas-Freiss, et al., 2008). This association of
positive expression of HLA-G and lower episodes of rejection was corroborated by
Luque et al. (2006) who concluded that high levels of HLA-G, assessed both pre- and
post-transplant, could be a potential clinical marker indicating favorable transplant
prognosis.
Our team explored the association between HLA-G expression and C4d staining, a
marker of antibody-mediated rejection (Sheshgiri, Rao, Mociornita, Ross, &
Delgado, 2010). The results revealed a negative correlation, suggesting that
increased expression of HLA-G blocked antibody processes as inferred from the
absence of C4d staining on endomyocardial biopsy (Sheshgiri et al., 2010). A recent
investigation has validated this observation by demonstrating that HLA-G has a
powerful role in inhibiting proliferation and antibody production by B-cells (Naji et
- 32 -
al., 2014). However, there is a need for further exploration of the role, if any, of
HLA-G and antibody-mediated rejection events post-transplantation.
In regards to the association of HLA-G and cardiac allograft vasculopathy, patients
with high levels of HLA-G had lower incidence of allograft vasculopathy at 1 year
post-transplant (Blanco-Garcia et al., 2013). This suggests that CAV development
is inhibited by the presence of HLA-G, which was also indirectly suggested by our
team’s in vitro analysis (Mociornita, Tumiati, Papageorgiou, Grosman, et al., 2013).
These results have been observed in another investigation where patients with
positive HLA-G expression had no evidence of cardiac vasculopathy (Lila et al.,
2002). Thus, we conclude that expression of HLA-G is associated with beneficial
outcomes in the heart transplant population by inhibiting the immune system and
promoting allograft tolerance.
1.8 The Role of HLA-G in Lung, Kidney and Liver
Transplantation
In the world of transplant, the relevance of HLA-G expression in allograft protection
has been corroborated. In liver-kidney transplantation, HLA-G expression was
noted in 14 out of 40 liver and 5 out of 9 kidney biopsy specimens (Creput,
Durrbach, et al., 2003). The presence of HLA-G was significantly correlated with
the absence of acute cellular or chronic rejection (Creput, Durrbach, et al., 2003).
HLA-G expression in biopsy specimens of lung, liver and kidney transplant
recipients was associated with a significant decrease in cellular mediated rejection
- 33 -
episodes, suggesting HLA-G’s potential role in the protection of the allograft
(Brugiere et al., 2009; Hu, Wu, Su, Pang, & Zhang, 2014; Xiao et al., 2013). As
previously mentioned, the HLA-G molecule has various isoforms that exist and that
interact with immune cells, however most investigations examine monomers and
only two isoforms (HLA-G1 and HLA-G5) (Carosella et al., 2015). Importantly, there
are differences in the potential effect HLA-G isoforms have; for instance, immune
receptors have higher affinity for dimers over monomers (Shiroishi, Kuroki,
Rasubala, et al., 2006). The first investigation to analyze the association between
HLA-G dimers and outcomes was in a kidney transplant cohort. Dimers in the
plasma were associated with prolonged survival of the allograft (Ezeakile et al.,
2014). These studies demonstrate that there is still much to learn about HLA-G
isoforms and their variable roles with regulating immune cells and receptors.
The effect of HLA-G in antibody-mediated rejection and chronic allograft
dysfunction was also investigated in kidney and lung transplantation. The presence
of HLA-G was related to lower levels of anti-HLA antibodies, indicating an
inhibition of antibody-mediated rejection in a kidney transplant cohort (Qiu et al.,
2006). Furthermore in renal transplants, an inverse relationship between HLA-G
and chronic allograft nephropathy was observed (Crispim, Duarte, et al., 2008). In
lung transplantation, bronchial epithelial cells with presence of HLA-G were
associated with fewer episodes of cellular rejection and bronchiolitis obliterans
syndrome (Brugiere et al., 2009). The same group concluded that early presence of
HLA-G in the lung graft correlated with a better long-term prognosis and less
rejection episodes (Brugiere et al., 2015). Taken all together, these studies indicate
- 34 -
that HLA-G plays a key role in regulation of the immune response and that higher
HLA-G expression is associated with fewer cases of cellular- and/or antibody-
mediated rejection and chronic allograft dysfunction.
1.9 The Role of HLA-G Polymorphisms in Heart
Transplantation
In order to understand what regulates the expression of HLA-G and identify
markers for disease outcomes or stages, nucleotide variations in the gene have been
investigated. Our team analyzed the 14bp INDEL polymorphism and its association
with cellular mediated rejection in a large population of heart transplants recipients
(Twito et al., 2011). A significant correlation between the prevalence of the DEL
allele in the recipients and decreased acute cellular rejection was identified. This is
in line with the findings that the DEL allele is associated with increased levels of
HLA-G and subsequently these high levels of HLA-G inhibit cellular mediated
rejection (Twito et al., 2011). The 14bp INDEL polymorphism could be a useful
clinical marker to identify patients at risk for higher rejection episodes (Twito et al.,
2011). In terms of cardiac allograft vasculopathy, no association was found with the
14bp INDEL polymorphism (Mociornita, Lim-Shon, et al., 2013). However,
analyzing multiple SNPs or haplotypes instead of a single polymorphism may
provide a better understanding of the effect of polymorphisms on HLA-G expression
and their association with outcomes.
- 35 -
1.10 The Role of HLA-G Polymorphisms in Lung, Kidney and
Liver Transplantation
HLA-G polymorphisms were also investigated in lung and kidney transplant
cohorts. Again, the most studied polymorphism has been the 14bp INDEL
polymorphism. The presence of INS allele for the 14bp INDEL polymorphisms was
linked with increased risk for acute cellular rejection in kidney transplants patients
(Crispim, Mendes-Junior, et al., 2008; Misra et al., 2013). However, the findings
with respect to the 14bp INDEL polymorphism have not been consistent across all
organs. Bone marrow transplant patients with the DEL allele had an increased risk
of developing severe graft versus host disease (GvHD), while the INS allele and the
heterozygous allele had low risk of GvHD (La Nasa et al., 2007). Azarpira, Aghdaie,
Kazemi, Geramizadeh, and Darai (2014) in a cohort of liver transplant patients
found no significant association between the 14bp INDEL polymorphism and
rejection. Finally, a kidney transplant meta-analysis suggested no direct association
between the risk of rejection and the 14bp INDEL polymorphism (Hou, Huang, Ji,
& Zhou, 2014).
From the 3’-untranslated region, the GA genotype at SNP 3187 was associated with
increased episodes of acute cellular and chronic rejection and the CC genotype at
SNP 3035 was associated with chronic rejection only in kidney transplant patients
(Ciliao Alves et al., 2012). From the coding region, alleles G*01:01:01:03,
G*01:01:02, G*01:06 and G*01:05N were significantly associated with increased
risk of cellular rejection in kidney transplant patients (Misra et al., 2014). Another
- 36 -
investigation, focusing on coding region alleles, concluded that patients
heterozygous for a synonymous allele (G*01:01) and a non-synonymous allele (for
example G*01:04 or G*01:05N) were at higher risk for episodes of cellular rejection
(Pirri, Contieri, Benvenutti, & Bicalho Mda, 2009). Lastly in the 5’- upstream
regulatory region, increased rejection episodes were linked with allele C for SNP -
725 and allele G for SNP -964 (Misra et al., 2013).
A recent report investigated HLA-G haplotypes and their clinical significance in
transplant outcomes. The investigation concluded that haplotype HLA-
G*01:04~UTR3 was an independent risk factor for a chronic rejection in lung
transplant patients (Di Cristofaro et al., 2015). This haplotype consists of SNP -
725C, -716G, -201A, -56C, DEL, 3142G, 3187A, 3196C and G*01:04 alleles and
patients with the haplotype were found to have significantly lower HLA-G
expression than patients with the other haplotypes (Di Cristofaro et al., 2015).
Interestingly, allele G*01:04 and DEL in this haplotype did not corroborate previous
findings of high HLA-G expression indicating that potentially investigations of
individual polymorphisms may not be comparable with investigations looking at
haplotypes since haplotypes consider the overall effect of various polymorphisms (Di
Cristofaro et al., 2015; Martelli-Palomino et al., 2013; Rebmann et al., 2001).
1.11 The Role of Donor HLA-G Expression
The role that the donor HLA-G genotype plays in regulating the expression of HLA-
G and mediating tolerance has not been investigated thoroughly in the context of
transplantation and rejection outcomes. Sheshgiri, Rouas-Freiss, et al. (2008) and
- 37 -
Mociornita et al. (2011) identified that myocardial cells, cardiac endothelial cells
and human coronary smooth muscle cells are capable of expressing HLA-G. In liver
and kidney allografts, epithelial cells from liver biliary and renal tubular cells
expressed HLA-G (Creput, Durrbach, et al., 2003; Creput, Le Friec, et al., 2003).
Lastly, bronchial epithelial cells from transplanted lungs were also found to express
HLA-G (Brugiere et al., 2009). Undeniably, the expression of HLA-G by the
allograft must be regulated by the genotype of the cells, which are donor-derived
and therefore will express the donor genotype. Therefore, the donor HLA-G
genotype is likely of paramount importance when studying the impact of HLA-G
and outcomes post-transplant. What determines the outcome may be the overall
tolerance produced from the combined expression of the different players (the donor
and the recipient).
To date, the interaction between donor and recipient genotype has not been
extensively investigated. Potentially, a specific combination of genotype from donor
and recipient could result in benefit, detriment or no effect, on the patient’s
rejection outcome. Pirri et al. (2009) explored if matching HLA-G genotypes, from
the coding region only, between the donor and the recipient would increase or
decrease the chances of recurrent rejection in a kidney transplant group. When the
patient and donor alleles both matched there was a lower risk of rejection than
those with one match or zero matches (Pirri et al., 2009). This was the first
investigation to elucidate the role of the donor HLA-G genotype in rejection,
however the findings were limited by the methodology.
- 38 -
1.12 The Role of Environmental Factors on Expression
The expression of HLA-G is modified by various environmental factors. HLA-G
expression is induced and inhibited by growth factors, anti-inflammatory, pro-
inflammatory factors and hormones such as progesterone (Sheshgiri, Rao, et al.,
2008), interleukin 10 (IL-10) (Moreau et al., 1999; Rizzo et al., 2005), interferons
(IFNs) (Lefebvre et al., 2001), hypoxia (Nagamatsu et al., 2004) and others (Moreau
et al., 2009). Progesterone was recognized in vitro to induce the expression of HLA-
G in myocardial smooth muscle cells and cardiac endothelial cells (Sheshgiri, Rao,
et al., 2008). IL-10 is anti-inflammatory and immune inhibitory agent like HLA-G
(Hviid, Rizzo, et al., 2004). IL-10 is known to stimulate expression of HLA-G in
monocytes (Moreau et al., 1999), mesenchymal stem cells (Selmani et al., 2008),
renal carcinoma progenitor cells (Dunker et al., 2008), mononuclear cells (Sebti et
al., 2003), decidua stroma cells (Blanco et al., 2008) and finally in acute
myeloblastic and lymphoblastic leukemia (Blanco et al., 2008). HLA-G was also
observed to induce the expression of IL-10 when HLA-G is expressed in CD4+ T-reg
cells (Pankratz et al., 2014). Interestingly, coronary artery endothelial and smooth
muscle cells did not respond to IL-10 and interferon γ in vitro (Sheshgiri, Rao, et al.,
2008). Although various factors have been recognized to modify the expression of
HLA-G, they appear to be cell type dependent with variable results in different
investigations.
- 39 -
1.13 The Role of Immunosuppressive Therapy
Immunosuppressive therapy is a fundamental part of the patient’s post-transplant
regimen. Few investigations have indicated potential immunosuppressive therapies
that induce HLA-G expression. An investigation by our group on patients treated
with either everolimus or mycophenolate mofetil therapy demonstrated a marked
difference in HLA-G expression among the groups (Sheshgiri et al., 2009). Sheshgiri
et al. (2009) identified high levels of soluble HLA-G in those patients on everolimus
versus mycophenolate mofetil. Furthermore, Mociornita et al. (2011) identified that
everolimus stimulated HLA-G expression in human coronary smooth muscle cells.
Indeed, treatment with rapamycin (a sister drug of everolimus) induced expression
of ILT4 receptors on DC cells and increased the release of soluble HLA-G (Fedoric &
Krishnan, 2008; Stallone et al., 2014). Another investigation found treatment with
belatacept to be associated with stimulating HLA-G expression in kidney transplant
patients (Bahri et al., 2009). Interestingly, therapeutic treatment, such as
cyclosporine (CsA), did not have an effect on HLA-G levels in heart transplant
patients, unlike that seen in a liver transplant cohort (Basturk et al., 2006;
Sheshgiri et al., 2009). Indeed, the possible induction of HLA-G, when patients are
treated with certain immunosuppressive therapies, has to be considered when
analyzing HLA-G expression and genotype in transplant patients to clearly
distinguish the role of HLA-G polymorphisms independently of the
immunosuppressive treatment. Immunosuppressive therapy induction of HLA-G is
a novel area of research and could provide a new direction in treatment that
specifically stimulates the production of this natural immune inhibitor.
- 40 -
1.14 Heart Transplantation
Transplantation is currently the treatment of choice for patients with end-stage
heart failure who are failing optimal medical therapy (Arnold et al., 2007). The
commonest heart diseases requiring transplant are cardiomyopathy and coronary
artery disease (Lund et al., 2014). The 2014 International Society for Heart and
Lung Transplantation (ISHLT) Registry reported the median survival for adult
heart transplant recipients to be 11 years and 14 for those that survived the first
year (Lund et al., 2014). The increase in first year survival seen over the past
decade is likely due to improvements in the selection and matching of recipient and
donors (Lund et al., 2014). The leading causes of death are graft failure, cardiac
allograft vasculopathy, infection, renal failure, multiple organ failure and
malignancy (Figure 8) (Lund et al., 2014). Early morbidity and mortality are due to
graft failure, infection and multi-organ failure (Stehlik et al., 2012). Acute rejection
is directly responsible for 11% of deaths early post-transplant and may also be
linked to deaths categorized as graft failure (Lund et al., 2014). At the 5-year mark,
predictors of mortality include acute rejection, need for dialysis, infection and
cardiac allograft vasculopathy (Lund et al., 2014). Long-term survival is limited by
cardiac allograft vasculopathy, renal failure and malignancy (Lund et al., 2014). By
10 years post transplant, 28% of patients are diagnosed with malignancy, which is
associated with the chronic use of immunosuppressive therapies (Lund et al., 2014;
Stehlik et al., 2012). In conclusion, over the last four decades more than 100,000
heart transplants were done worldwide (Lund et al., 2014). Scarcity of donors and
challenges with long-term survival continue to limit outcomes (Lund et al., 2014).
- 41 -
1.14.1 Risk Factors for Survival Post-Transplantation
Several factors affect survival post-transplantation, including both recipient and
donor factors. Pre-transplant recipient disease etiology and recipient age remain
significant factors for transplant survival (Lund et al., 2014). As recipient age
increases, survival decreases, not in a linear fashion but in a U-shaped relation
(Lund et al., 2014). Younger and older patients have a higher risk of mortality at 1-
year compared to patients in their 40s and 50s (Lund et al., 2014). Recipient gender
also plays a key role, male recipients have lower survival (Lund et al., 2014).
Additionally renal function, measured by recipient serum creatinine, bilirubin pre-
transplantation, and the requirement for mechanical assist device as bridge to
transplantation are factors associated with a greater risk of mortality (Lund et al.,
2014). In 2012, a total of 41% of patients required mechanical assist device (Lund et
al., 2014). Factors that increase risk linearly from the donor and transplantation,
include increasing donor age and ischemic time (past the 200min) (Lund et al.,
2014). In summation, several factors limit long-term survival in the transplant
population.
- 42 -
Figure 8: Adult heart-transplant relative incidence of leading causes of death (censored deaths from January 1994 to June 2013). Adapted from Copyright © 2003 International Society of Heart & Lung Transplantation - Lund et al. (2014).
0
10
20
30
40
50
0-30Days(N=5,609)
31Days– 1Year
(N=4,800)
>1Year– 3Years
(N=3,511)
>3Years– 5Years
(N=3,085)
>5Years–10Years(N=7,117)
>10– 15Years
(N=5,186)
>15Years(N=2,959)
%ofdeaths
CAVAcuteRejectionMalignancy(non-Lymph/PTLD)Infection(non-CMV)GraftFailureMultipleOrganFailure
- 43 -
1.15 Rejection Outcomes Post-Transplantation
1.15.1 Cellular Mediated Rejection
Acute cellular mediated rejection (CMR) is a mononuclear inflammatory response in
which predominantly T-lymphocytes infiltrate the myocardium (Schuurman et al.,
1989; Stewart et al., 2005). The T-lymphocytes are CD4 and CD8 positive and have
a high affinity for interleukin-2 receptors (Schuurman et al., 1989). Acute cellular
mediated rejection is quite common early post-transplant (Kubo et al., 1995).
According to the ISHLT report, 25% of patients had rejection of any type and 13%
had a 2R or 3R rejection in the first year (Lund et al., 2014). Cellular rejection is
associated with increased morbidity and mortality (DePasquale, Schweiger, & Ross,
2014). Fortunately, with the advances in immunosuppressive treatment, episodes of
acute cellular mediated rejection have declined (Lund et al., 2014). Risk factors for
acute rejection are recipient gender (Jarcho et al., 1994; Kubo et al., 1995), donor
gender (Jarcho et al., 1994; Kobashigawa et al., 1993; Kubo et al., 1995), recipient
ethnicity (Jarcho et al., 1994), recipient age (Jarcho et al., 1994; Kobashigawa et al.,
1993; Kubo et al., 1995) and number of HLA mismatches (Jarcho et al., 1994;
Sheldon et al., 1999). The profile of a patient at higher risk for CMR was
determined to be younger, race (non-white, non-Asian), female and HLA
mismatches (Kilic et al., 2012).
- 44 -
1.15.2 Donor Specific Antibody
Donor specific antibodies (DSA) are widely known to be associated with poor
prognosis, antibody mediated rejection and cardiac allograft vasculopathy (Tambur
et al., 2005; Terasaki, Ozawa, & Castro, 2007). They may exist pre- and/or develop
post-transplant (Chih et al., 2012). Their interaction with allograft cells causes
injury and dysfunction by activating the complement cascade (Soleimani, Lechler,
Hornick, & George, 2006; Taylor, Yowell, Kfoury, Hammond, & Renlund, 2000;
Wehner, Morrell, Reynolds, Rodriguez, & Baldwin, 2007). The complement pathway
involves the activation of proteases that once they are cleaved produce C4d and C3d
molecules that bind to target proteins (Wasowska, 2010). C4d staining is associated
with the diagnosis of antibody-mediated rejection (AMR) and the presence of DSA
(Gupta et al., 2009). An even stronger signal is given when C4d coupled with C3d
staining is investigated (Rodriguez et al., 2005; C. D. Tan et al., 2009).
Patients diagnosed with AMR are more likely to have DSA (Nath et al., 2010). This
situation is due to the phenomenon of accommodation (Koch, Khalpey, & Platt,
2004). Interestingly, the presence of DSA does not always infer antibody mediated
injury and the absence of DSA does not mean an absence of AMR, as the antibody
may be bound on the graft (Bocrie et al., 2007; Koch et al., 2004).
Patients with class I DSA have a significantly greater chance of graft failure, and
those with only class II DSA have a higher risk of CAV (Frank et al., 2013; Zhang et
al., 2011). DSA frequency in transplant patients ranges from 4 to more than 50%
(Cardarelli et al., 2005). It is estimated that post-transplant, 31% of patients
developed DSA (Everly et al., 2009). Therapies targeting a reduction in DSA such as
- 45 -
desensitization were associated with a significant improvement in long term
survival, supporting concerns about the detrimental effect of DSA on long term
outcomes (Kimball, Baker, Wagner, & King, 2011).
1.15.3 Cardiac Allograft Vasculopathy
Cardiac allograft vasculopathy (CAV) is a disease of the donor coronary arteries
characterized by intimal hyperplasia, vascular remodeling and stenosis (Ramzy et
al., 2005). Immune and non-immune pathogenic factors are involved in the
development of cardiac allograft vasculopathy (Ramzy et al., 2005). It is one of the
main reasons long-term survival is limited and it is one of the leading causes of
death (Lund et al., 2014). CAV diagnosis at the 1st, 5th and 10th year mark are 8%,
30%, and 50%, respectively (Lund et al., 2014). There has been a statistical
decrease in the incidence of CAV and patient survival (post a diagnosis of CAV) has
improved likely due to new available treatment options (Stehlik et al., 2012).
However, there are significant limitations to the treatment options and thus in
highly selected individuals the optimal treatment when all medication fails remains
retransplantation (Lund et al., 2014).
There are various factors that increase the risk for the development of CAV. Of
those increasing donor age, donor hypertension and certain immunosuppressive
treatment have been identified to predispose the patient to a greater risk of CAV
development (Stehlik et al., 2012). Indeed, hearts from older donors are associated
with higher chances of development of intimal thickness in the first year and the
subsequent progression of CAV (Gao et al., 1997; Kobashigawa et al., 2005).
- 46 -
Additionally, patients with CMV mismatch are at higher risk as well (Stehlik et al.,
2012). However there are also factors associated with lower risk such as the
diagnosis of some etiologies like congenital heart diseases, a female donor and a
female recipient (Stehlik et al., 2012). Certain events post transplantation have also
been associated with increase chances of CAV. Within the first year, recurrent
cellular rejection, donor specific antibodies and cytomegalovirus (CMV) infections
are associated with an increased risk of developing CAV (Kobashigawa et al., 1995;
Michaels et al., 2003; Toyoda et al., 1997). Indeed the presence of class II donor
specific antibodies has been identified as potential risk factor (Frank et al., 2013).
Interestingly a recent meta-analysis of CAV risk factors found them to be
inconsistently associated with CAV development (Braga, Santos, McDonald, Shah,
& Ross, 2012). This supports the need for further research to better understand
cardiac allograft vasculopathy.
- 47 -
Chapter 2
Rationale and Hypothesis
2 The Association of Donor and Recipient HLA-G Polymorphisms and Cardiac Allograft Vasculopathy
2.1 Summary and Rationale
Human Leukocyte Antigen-G (HLA-G) is a naturally occurring immune modulator
(Carosella et al., 2015). Genetic polymorphisms in the HLA-G gene control its
expression and may be associated with different post-transplant outcomes (Castelli
et al., 2014; Donadi et al., 2011). HLA-G has been proven to terminate the cytotoxic
activity of NK cells, cytotoxic T-cells, macrophages and mononuclear cells through
cell-to-cell contact (Rebmann et al., 2014).
In vitro studies by our team demonstrated HLA-G’s cardiac vasculature protection
effect that potentially indicates its role in CAV development. When human coronary
smooth muscle cells were treated with everolimus, a potent immunosuppressant,
they were induced to express HLA-G (Mociornita et al., 2011). The expression of
HLA-G in these cells led to decreased proliferation that was dependent on the
concentration of HLA-G (Mociornita, Tumiati, Papageorgiou, Grosman, et al., 2013).
In addition, HLA-G was shown to inhibit neutrophil adhesion to injured human
coronary artery endothelial cells (as a tumour necrosis factor (TNF)-α-induced
- 48 -
inflammatory response) (Mociornita, Tumiati, Papageorgiou, Grosman-Rimon, et
al., 2013). Clinically, patients with high levels of HLA-G have a lower incidence of
allograft vasculopathy at 1 year post-transplant (Blanco-Garcia et al., 2013).
However, the expression of HLA-G varies among patients indicating that there are
genetic factors that are influencing the expression of this protein. When exploring
the association between the 14bp INDEL polymorphism and cardiac allograft
vasculopathy, we found no correlation with the 14bp INDEL polymorphism
(Mociornita, Lim-Shon, et al., 2013). However, there are several other SNPs in the
gene that could be potential markers for CAV.
The role of the donor HLA-G genotype in regulating the expression of HLA-G and
mediating tolerance has never been investigated. Indeed allograft cells have been
found to express HLA-G (Brugiere et al., 2009; Creput, Durrbach, et al., 2003;
Creput, Le Friec, et al., 2003). Clearly the expression of HLA-G in the donor organ
is regulated by the donor genotype. To that point, the donor HLA-G genotype is of
importance since the overall outcome is determined by the degree of tolerance
produced from the combination the donor and the recipient genotypes. This
relationship has not been extensively investigated.
In one report, Pirri et al. (2009) explored the interaction of donor and recipient
HLA-G genotypes, from the coding region only, in kidney transplant patients. When
the patient and donor alleles both matched there was a lower risk of rejection than
those with one match or zero matches (Pirri et al., 2009). Despite limitations to this
study, the results allude to the potential significant role of the interaction between
the donor-recipient genotype in transplant outcomes. Understanding the association
- 49 -
between polymorphisms and cardiac allograft vasculopathy as evaluated by
coronary angiography may provide valuable knowledge for potential prognosis of
CAV in patients and in tailoring treatment and resources. Therefore, the rationale
for this study was to identify polymorphisms as predictors of CAV outcomes post-
transplantation in heart transplant recipients.
2.2 Hypothesis
We hypothesized that donor and recipient HLA-G polymorphisms are associated
with CAV outcomes in heart transplant recipients.
- 50 -
Chapter 3
Methods
3 Study Design
3.1 Population of Interest
This single center retrospective cohort included patients who underwent
transplantation at Toronto General Hospital and the patient’s corresponding heart
donors between January 2001 and December 2013. The institutional ethics research
board approved the study protocol. DNA was obtained from the institutional
biobank where patients consented pre transplant for their DNA to be stored for use
in future research.
During the study period, there were 287 adults (≥18 years) that received a heart
transplant at Toronto General Hospital from 287 donors and after excluding those
with intraoperative deaths (n=6), those with inadequate DNA to enable SNP
genotyping (n=28) and recipients of multiorgan transplants (n=2), there were 251
heart recipient samples for analysis. Of the 287 heart donors, the exclusion criteria
encompassed inadequate DNA to enable SNP genotyping (n= 55) and donor’s
without their corresponding recipient in the analysis (n=36). In total the cohort
included 251 patients and of those 196 had their corresponding heart donors.
Recipients demographics, clinical data and immunosuppressive treatment were
- 51 -
captured until the end of 2014, unless the patient died or discontinued care at our
institution prior to that date.
Our standard immunosuppressive protocol consists of low dose induction with
thymoglobulin (1 mg/kg for 3 days), prednisone, mycophenolic acid analog and a
calcineurin inhibitor (cyclosporine or tacrolimus). Sirolimus or everolimus are
routinely introduced in cases of CAV, renal failure, malignancy history or recurrent
rejection. Statin is universally prescribed to all recipients, unless otherwise
contraindicated.
3.2 DNA Collection
DNA was stored in the biobank laboratory at -80°C. DNA concentration and purity
(A260/A280 ratio) were determined by the NanoDrop™ Spectrophotometer
(ThermoFisher Scientific, Waltham, MA). Only samples with a DNA concentration
of 15 ng/ul or higher were used for SNP genotyping. For each sample, 30 uL was
aliquoted in 96-well plates.
3.3 HLA-G Polymorphisms
3.3.1 SNP Selection
A literature review of all published research (transplant related or not) with HLA-G
SNPs was performed. SNPs were selected from the 5’-upstream promoter region,
coding region and 3’-untranslated region. We excluded SNPs with minor allele
frequency (MAF) less than 10% except for SNPs from the coding region. Our final
list included 2 SNPs from the 5’-upstream regulatory region (rs1233333 &
- 52 -
rs1233334) and 4 SNPs from the 3’-untranslated region (rs1610696, rs9380142,
rs1063320 & rs66554220). From the coding region 4 SNPs were selected
(rs41551813, rs12722477, rs144244894 & rs12722482). Each individual with a
variation in a SNPs from the coding region were categorized into 6 haplotypes,
individuals with no mutant in any of the SNPs were haplotype 1 (G*01:01/G*01:01).
Those with a mutation in SNP 31 were haplotype 2 (G*01:01/G*01:03), with a
mutation in SNP 110 were haplotype 3 (G*01:01/G*01:04), with a mutation in SNP
130 were haplotypes 4 (G*01:01/G*01:05N), with a mutation in SNP 258 were
haplotype 5 (G*01:01/G*01:06) and lastly individuals with more than one mutation
were categorized to haplotype 6 (G*01:03/ G*0106 or G*01:04/ G*0106 or G*01:04/
G*01:03 or G*01:04/ G*01:04). SNP 3142 was sequenced in only about half of the
recipient (125) and donor (114) cohorts. Lastly, genotype matching between
recipient and donor was investigated. A full match of recipient-donor genotype was
defined as matching of both alleles for a particular SNP (i.e. CC recipient- CC
donor) and mismatch was any other possible combination.
The location of the HLA-G gene is in chromosome 6: 29,794,744-29,798,902 forward
strand. The following polymorphism information was obtained from NCBI website
available from: http://www.ncbi.nlm.nih.gov.
3.3.2 RS1233333
This SNP is located in 5’-upstream promoter region at position -201 of the HLA-G
gene. The ancestral allele is cytosine and the mutation is thymine. The reference
SNP allele is the reverse therefore the MAF is T=0.4972/1082.
- 53 -
Sequence:
AATCCCCAACGCGGGGCCTCCCCAA[C/T]CCATACACCGCCTGTGGGGCCTGAG
This particular SNP is close to regulatory elements such as P50, SP1 and the
hypoxia response (HRE) element therefore variations in this SNP can potentially be
affecting the association of the regulatory elements to the gene (Castelli et al., 2014;
Moreau et al., 2009).
3.3.3 RS1233334
This SNP is located in 5’-upstream promoter region at position -725 of the HLA-G
gene. The ancestral allele is guanine and the mutation is cytosine or adenine since
it is a triallilec. The reference SNP allele is the reverse therefore the MAF is
C=0.0727/364.
Sequence:
AAATGCATCTAAAAGCATTACAACA[A/C/G]GACTCACAAAGCTCTTAAGTTTCA
C
The presence of the guanine allele creates a greater chance of methylation at this
SNP that could be inhibiting the transcription and subsequently lead to lower
expression (Ober et al., 2006).
3.3.4 RS41551813
This SNP is located at codon 31 (position 292) in exon 2 of the coding region of the
HLA-G gene. It defines allele HLA-G*01:03. The ancestral allele is adenine and the
mutation is thymine. It constitutes a synonymous substitution. The MAF is
T:0.0539/270.
- 54 -
Sequence:
CATCGCCATGGGCTACGTGGACGAC[A/T]CGCAGTTCGTGCGGTTCGACAGCGA
Allele HLA-G*01:03 is one of the most common alleles in the worldwide population
(Donadi et al., 2011).
3.3.5 RS12722477
This SNP is located at codon 110 (position 755) in exon 3 of the coding region of the
HLA-G gene. It defines allele HLA-G*01:04. The ancestral allele is cytosine and the
mutation is adenine. The MAF is A=0.2027/1015.
Sequence:
CGACCTGGGGTCCGACGGACGCCTC[A/C]TCCGCGGGTATGAACAGTATGCCTA
This particular SNP was originally identified with higher soluble HLA-G levels by
(Rebmann et al., 2001) in a healthy population. Allele HLA-G*01:04 is one of the
most common alleles in the worldwide population (Donadi et al., 2011).
3.3.6 RS41557518
This SNP is located at codon 130 (position 814) in exon 3 of the coding region of the
HLA-G gene. It defines allele HLA-G*01:05N. The ancestral allele is cytosine and
the mutation is a deletion. The MAF is (-)=0.0284/141. It is a frame shift mutation.
Sequence: AGGATTACCTCGCCCTGAACGAGGA[-
/C]CTGCGCTCCTGGACCGCAGCGGACA
Allele G*01:05N has a single nucleotide deletion in codon 130 which causes a frame
shift and the formation of a stop codon which subsequently produces partial
expression of the protein isoforms (Suarez et al., 1997).
- 55 -
3.3.7 RS12722482
This SNP is located at codon 258 (position 1799) in exon 4 of the coding region of the
HLA-G gene. It defines allele HLA-G*01:06. The ancestral allele was cytosine and
mutation is thymine. The MAF is T=0.0507/254.
Sequence:
CCTTCTGGAGAGGAGCAGAGATACA[C/T]GTGCCATGTGCAGCATGAGGGGCT
G
Allele HLA-G*01:06 is one of the most common alleles in the worldwide population
(Donadi et al., 2011).
3.3.8 RS371194629
This SNP is located in 3’-untranslated region of the HLA-G gene. The ancestral
allele is unknown. The MAF is insertion= 0.3942/1974. It is a deletion/insertion
variation.
Sequence: GCCCTGTGTGGGACTGAGTGGCAAG[ATTTGTTCATGCC[T/-
]TCCCTTTGTGACTTCAAGAACCCTGA
The polymorphism has been associated with variable mRNA production, stability
and subsequently variable protein expression (Hviid et al., 2003). It is also the
target site for various microRNAs (Castelli, Moreau, Oya e Chiromatzo, et al.,
2009).
- 56 -
3.3.9 RS1063320
This SNP is located in 3’-untranslated region at position 3142 of the HLA-G gene.
The ancestral allele is cytosine and the mutation is guanine. The reference SNP
allele is the reverse therefore the MAF is G=0.4020/2013.
Sequence:
TACAGAAGTAAGTTATAGCTCAGTG[C/G]ACCACAAATTTGAGACAGAGACGGA
The presence of a guanine-guanine at this SNP is related with a lower protein
production potentially caused by the increased target of microRNAs when guanine
is present (Rizzo et al., 2012; Z. Tan et al., 2007; Veit & Chies, 2009).
3.3.10 RS9380142
This SNP is located in 3’-untranslated region at position 3187 of the HLA-G gene.
The ancestral allele is adenine and the mutation is guanine. The MAF is
G=0.2582/1293.
Sequence:
TCTGTATTAAAATTAGAATCTGAGT[A/G]TAAATTTACTTTTTCAAATTATTTC
It was also observed that the adenine allele for this SNP is associated with lower
protein expression in vitro because it affects the mRNA stability (Yie et al., 2008).
3.3.11 SNP Genotyping
SNP sequences were retrieved using the Sequenom Online Assay Design Suite
(Agena Bioscience, Inc., San Diego, CA) to generate PCR and extension primers for
the multiplex reaction. The iPLEX assay reaction relies on a single termination mix
- 57 -
and universal reaction conditions for the SNPs selected. This allows for allele
specific differences in mass between extension products.
PCR amplification was carried out using 5-10 ng of template DNA, in 5 ul reactions
containing 1.25X PCR Buffer (Qiagen), 1.625 mM MgCl2 (Qiagen), 500 uM dNTP
mix (Fermentas), 100 nM primer mix (IDT) and 0.5 U Hotstar Taq polymerase
(Qiagen). The reactions were incubated in a standard thermocycler using the
following cycling conditions: initial denaturation at 94°C for 15 minutes, followed
by 45 cycles of 94°C for 20 seconds, 56°C for 30 seconds, 72°C for 1 minute, followed
by a final extension at 72°C for 3 minutes.
Unincorporated deoxynucleotide triphosphates (dNTPs) were dephosphorylated by
treatment with shrimp alkaline phosphatase following PCR. The 5 ul PCR reaction
was incubated with 2 ul of SAP mix (Agena Bioscience, Inc., San Diego, CA),
containing 0.85X SAP buffer and 0.3 U SAP enzyme (Sequenom), in a standard
thermocycler at 37°C for 20 minutes, followed by a 5 minute heat inactivation at
85°C.
Following SAP treatment, 2 ul of iPLEX extension cocktail was added to the PCR
reaction to a final concentration of 0.222X iPLEX buffer, 1X iPLEX termination
mix, 0.625 uM, 0.833 uM, 1.04 uM or 1.25 uM of each primer, and 1X iPLEX
enzyme (Sequenom). The primer concentrations in the multiplex reactions were
adjusted based on the primer mass. A higher concentration (1.04 uM or 1.25 uM)
was used for high mass primers. The reaction conditions for primer extension were
as follows: initial denaturation at 94°C for 30 seconds, followed by a 40 cycle
- 58 -
program consisting of a single denaturation at 94°C for 5 seconds and 5 cycles of
52°C for 5 seconds and 80°C for 5 seconds. A final extension is performed at 72°C
for 3 minutes.
To remove salts from the iPLEX reaction products, the samples were diluted with
16 ul of water and 6 mg of Clean Resin (Sequenom) was added to each reaction. The
reactions were rotated for at least 10 minutes, followed by centrifugation at 5000
rpm for 5 minutes. The reaction products were dispensed onto a 384-element
SpectroCHIP bioarray (Sequenom) using the Sequenom RS-1000 MassARRAY
Nanodispenser and analyzed using the Sequenom MassARRAY Analyzer Compact
(Agena Bioscience, Inc., San Diego, CA). The data was then analyzed using the
Typer 4.0 Software (Agena Bioscience, Inc., San Diego, CA), which identifies SNP
alleles at the expected mass signal peaks according to the molecular weight of the
extension products.
3.4 Study Outcome
As per our Institutional protocol, screening for CAV included coronary angiography
performed at 1, 5 and 10-years post-transplant and on a per cause basis (abnormal
yearly stress test, new onset symptoms or unexplained drop in graft function).
Cardiac allograft vasculopathy (CAV) was classified according to the ISHLT grading
system as CAV 0, 1, 2 or 3 by a physician blinded to the SNP results (Mehra et al.,
2010). For the first model the outcome was the diagnosis of mild CAV, defined as
category CAV 1. For the second model the outcome was the diagnosis of severe CAV,
- 59 -
defined as category CAV 2 or CAV 3. Additionally, for both models a combined
clinical outcome of CAV diagnosis, retransplantation or death was also examined.
3.5 Statistical Analysis
The data reported is described as follows: continuous data are described as mean ±
standard-deviation, medians with interquartile ranges and categorical data are
reported as frequencies throughout the report unless otherwise stated. The first
analysis was to identify the proper amount of patients at-risk of mild CAV and
severe CAV. Thus, a competing risk model was used to account for the concurrent
risk of death, re-transplantation or CAV (mild CAV and severe CAV); this strategy
allowed for proper estimation of patients remaining at-risk of outcomes over time
(McGiffin et al., 1997). Death and re-transplantation were censored since they are
expected outcomes post transplantation. Given the low number of patients
undergoing re-transplantation, re-transplantation and death were modeled
together. Rate of time-related events (mortality, retransplantation, CAV) were
modeled in multiphase parametric hazard models that decompose risk over time in
up to 3 additive, overlapping phases of risk (descriptively labeled as early, constant
and late but actually representing different mathematical functions to model
specific patterns of event distribution over time). This analysis was performed using
the HAZARD procedure for SAS available from:
https://www.lerner.ccf.org/qhs/software/hazard/
Complete mathematical description and validation of the procedure have previously
been published (Blackstone, Naftel, & Turner, 1986).
- 60 -
In regards to the association between HLA-G genotype and mild and severe CAV
outcomes, 3 models were created for each polymorphism: 1) recessive effect
(homozygosity of the minor allele); 2) dominant effect (homozygosity or
heterozygosity of the minor allele), and; 3) allelic effect (number of minor alleles).
With the 3 different models for each polymorphism, a data-driven analysis was
created. For some of the rare genotypes, models with less than 10 events were not
included in the analysis, this applies primarily to SNPs that had a minor allelic
frequency of less than 10%. The model building strategy started with the evaluation
of the association between hazard of mild or severe CAV and clinical and genetic
risk factors in univariable parametric hazard regression models. From there factors
with p-values <0.10 and that were clinically relevant to the investigation were then
included in a multivariable parametric hazard regression model with backward
selection of variables to obtain a multivariable model. The backward selection
strategy allowed the variables in the model to be adjusted for cofounding factors
(which is important for clinical analysis) and subsequently increased the type-2
error chances. Internal validity of multivariable regression models was assessed
using bootstrap resampling (1000 samples) with a minimum threshold of 50%
reliability to remain in the final model. The bootstrap resampling of 1000 samples
repeats the analysis with a subsample of the cohort. By repeating the measurement
multiple times and getting the same result, this decreases the chances type-1 error
and strengthens the validity of each variable in the final model. Bootstrap is not a
direct correction of type-1 error, but decreases the chances of making type-1 error
significantly. For instance, the chances of making a type-1 error are 1/20, if you
- 61 -
repeat the analysis a second time the chances in total are 1/20 x 1/20 so 1/400 and
in this way the chances of getting type-1 error decrease over time. Mean imputation
of variable was used to account for missing values in multivariable regression
models. In conclusion, all statistical analyses were performed using SAS v.9.4 (SAS
Statistical Software, Cary, NC).
- 62 -
Chapter 4
Results
4
4.1 General Patient, Donor and Pre-Transplant
Characteristics
General patient and donor characteristics are shown in Table 1. Mean recipient age
at transplant was 48 ± 12 years, while mean donor age was 35 ± 14 years. Prior to
transplant, 21% of recipients were bridged with ventricular assist device, and 4%
and 2% were highly sensitized (>80%) for PRA class I and II, respectively.
Table 1: Recipient, donor and pre-transplant characteristics of the study cohort
General recipient characteristics N All patients
Sex (male) 251 174 (69%)
Age at transplant (years) 251 48.2 ± 12.1
Height (cm) 246 171.4 ± 10.1
Weight (kg) 247 72.7 ± 16.8
Body mass index (BMI) (kg/m2) 246 24.6 ± 4.7
Primary Diagnosis 251
- 63 -
Congenital Heart Disease 17 (7%)
Idiopathic 114 (45%)
Ischemic 61 (24%)
Other 59 (24%)
Blood group 251
A 112 (45%)
AB 11 (4%)
B 43 (17%)
O 85 (34%)
Race 251
Black 7 (3%)
Caucasian 98 (39%)
Other 14 (6%)
Undisclosed 132 (53%)
General donor characteristics
Donor sex (male) 186 115 (62%)
Age of donor (years) 251 35.5 ± 14.3
Donor height (cm) 249 173 ± 11.5
- 64 -
Donor weight (kg) 250 77.4 ± 18.1
Donor Body Mass Index (kg/m2) 249 25.8 ± 5.8
Blood group of donor 251
A 99 (39%)
AB 3 (1%)
B 38 (15%)
O 111 (44%)
Donor cause of death 249
Anoxia 33 (13%)
CNS tumor 2 (1%)
CVA/stroke 95 (38%)
Head trauma 102 (41%)
Other 17 (7%)
Pre-transplant characteristics
Cancer diagnosis 251 16 (6%)
Induction therapy (basiliximab vs.
thymoglobulin) 251 29 (12%)
Ventricular assist device 251 52 (21%)
CMV recipient positive status 249 151 (61%)
- 65 -
CMV donor positive status 249 111 (45%)
CMV negative status vs. any positive 251 202 (80%)
Panel reactive antibodies (PRA) class I
values
157 0 (0-66)
Not sensitized (0%) 89 (57%)
Mildly sensitized (1-10%) 22 (14%)
Sensitized (11-79%) 40 (25%)
Highly sensitized (80-100%) 6 (4%)
Panel reactive antibodies (PRA) class II
values
157 0 (0-52)
Not sensitized (0%) 124 (79%)
Mildly sensitized (1-10%) 10 (6%)
Sensitized (11-79%) 20 (13%)
Highly sensitized (80-100%) 3 (2%)
Data is described as mean ± standard deviation, median (25th-75th percentiles) and frequencies, as appropriate. Legend: CNS: central nervous system, CVA: cerebrovascular accident, CMV: cytomegalovirus infection.
- 66 -
4.2 Transplant Characteristics, Outcome and Medical
Therapy
Transplant characteristics, outcomes and immunosuppressive therapy are described
in Table 2. Mean ischemic time was 221 ± 66 min. Patients on any proliferation
signal inhibitor for more than 6 months amounted to 51% and of those 82% were on
sirolimus.
Table 2: Transplant characteristics, outcomes and medical therapy of the recipient
cohort
Transplant characteristics and outcomes N All patients
Ischemic time (minutes) 117 221 ± 66
First CAV diagnosis: CAV 1 251 102 (41%)
Remained at CAV1 102 90 (88%)
Progressed to CAV2/3 102 12 (12%)
First CAV diagnosis: CAV 2/3 251 8 (3%)
CAV 2 or 3 end of follow-up 251 20 (8%)
Percutaneous coronary intervention treatment 20 9 (45%)
- 67 -
Re-transplantation 251 1 (0%)
Mortality 251 57 (33%)
Cause of death 57
Cancer 7 (12%)
Graft failure 15 (26%)
Multiple systemic organ failure 13 (23%)
Other 8 (14%)
Rejection/CAV 6 (11%)
Sepsis 8 (14%)
Medical therapy 251
Cyclosporine only 92 (37%)
Tacrolimus only 139 (55%)
None 20 (7%)
Any MPA 251 220 (88%)
MPA within 1 week of transplant 251 158 (63%)
MPA within 1 month of transplant 251 202 (80%)
- 68 -
Any PSI for >6 months 251 127 (51%)
Sirolimus 127 104 (82%)
Everolimus 127 23 (18%)
PSI within 6 months of transplant 251 70 (28%)
PSI within 2 years of transplant 251 96 (38%)
PSI within 6 months of transplant (>6 months
treatment)
251 69 (27%)
PSI within 2 years of transplant (>6 months
treatment)
251 93 (37%)
Any statin 251 224 (89%)
Statin within 1 week of transplant 251 112 (45%)
Statin within 1 month of transplant 251 203 (81%)
Steroids stopped within 2 years of transplant 251 31 (12%)
Data is described as mean ± standard deviation, median (25th-75th percentiles) and frequencies, as appropriate.
Legend: MPA: mycophenolic acid analog, PSI: proliferation signal inhibitor.
- 69 -
4.3 Freedom from Mild CAV
Duration of follow-up was 5.2 ± 3.6 years, with a median of 5.0 years (range 1 days
to 13.2 years). Freedom from mild CAV and death/retransplantation was 26.8% at
10 years after transplantation (Figure 9) (Table 3).
- 70 -
Figure 9. Competing outcomes after heart transplantation. The hazard function for
mortality was characterized by a high early hazard of death or re-transplantation
immediately after transplantation followed by an ongoing constant hazard over
time. The hazard function for mild CAV was characterized by a strong early hazard
with a lower but accelerating increasing hazard over time.
0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5 6 7 8 9 10 11 12
Prop
ortio
nofpatients
Timesincetransplantation(years)
Freefromretransplantation,deathorCAV
CAV
DeathwithoutCAV
- 71 -
Table 3: Frequency of outcomes (Mild CAV, death/re-transplantation and alive no
CAV) with 95% confidence interval from competing risk model.
Time since transplant Mild CAV Death/Re-
transplantation Alive without CAV
1 year 8.5 (5.9-12.2) 12.5 (9.0-17.0) 79.1 (72.0-84.7)
2 years 25.3 (20.2-31.0) 14.0 (10.4-18.7) 60.9 (53.2-68.1)
5 years 38.7 (32.9-44.7) 16.6 (12.5-21.8) 45.0 (37.8-52.4)
8 years 49.4 (42.0-56.7) 18.1 (13.3-24.1) 33.0 (26.1-40.7)
10 years 55.0 (46.3-63.3) 18.7 (13.5-25.4) 26.8 (20.2-34.7)
Data is described as mean ± standard deviation, median (25th-75th percentiles) and frequencies, as appropriate. Legend: CAV: cardiac allograft vasculopathy.
4.4 Freedom from Severe CAV
Duration of follow-up was 5.2 ± 3.6 years, with a median of 5.0 years (range 1 days
to 13.2 years). Freedom from severe CAV and death/retransplantation was 64% at
10 years after transplantation (Figure 10) (Table 4).
- 72 -
Figure 10. Competing outcomes after heart transplantation. The hazard function for
mortality was characterized by a high early hazard of death or re-transplantation
immediately after transplantation followed by an ongoing constant hazard over
time. The hazard function for severe CAV was characterized by a single
progressively increasing hazard over time (late hazard function).
- 73 -
Table 4: Frequency of outcomes (Severe CAV, death/re-transplantation and alive no
CAV) with 95% confidence interval from competing risk model.
Time since transplant Severe CAV Death/Re-
transplantation Alive without CAV
1 year 0.4 (0.1-1.5) 12.5 (9.1-17.1) 87.1 (72.6-94.5)
2 years 1.2 (0.5-3.0) 14.5 (10.8-19.1) 84.3 (73.0-91.5)
5 years 4.9 (2.9-8.0) 18.4 (14.2-23.6) 76.7 (68.1-83.6)
8 years 9.6 (6.2-14.4) 21.2 (16.3-27.0) 69.3 (60.2-77.1)
10 years 13.3 (8.5-20.1) 22.8 (17.4-29.2) 64.1 (53.8-73.2)
Data is described as mean ± standard deviation, median (25th-75th percentiles) and frequencies, as appropriate. Legend: CAV: cardiac allograft vasculopathy.
4.5 HLA-G Polymorphisms
Frequencies of SNPs for recipients and donors are shown in Table 5. The
frequencies and percentages of the haplotypes for recipient and donor are shown in
Table 6. All were in Hardy-Weinberg equilibrium (HWE). Genotype frequencies for
SNP -201 CC, CT and TT were 25%, 51% and 24% for recipients and, 27%, 52% and
22% for donors, respectively. For SNP -201, 68 (35%) of recipients had genotype
matching with their donors. Matching frequencies for CC-CC, CT-CT and TT-TT
- 74 -
were 7%, 28% and 51%, respectively. There were 106 (54%) matches for SNP -725,
84 (43%) for SNP 3196, 94 (48%) for SNP 3187, 38 (33%) for SNP 3142, 80 (41%) for
SNP 14bp and, lastly, 68 (35%) matched haplotype categories.
Table 5: HLA-G polymorphisms genotype, frequency, MAF and HWE for recipients and donors.
SNP Gene Location Major
Genotype
Minor
Genotype
Major
Genotype
Freq.
Heterozygous
Genotype
Freq.
Minor
Genotype
Freq.
MAF HWE
Recipient
201 RS1233333 CC TT 64 (25%) 128 (51%) 59 (24%) 49.0% 0.75
725 RS1233334 GG CC/AA 177 (71%) 46 (18%) 28 (11%) 20.3% -
3196 RS1610696 GG CC 117 (47%) 112 (45%) 22 (9%) 31.1% 0.51
3187 RS9380142 AA GG 131 (52%) 93 (37%) 27 (11%) 29.3% 0.10
3142 RS1063320 CC GG 43 (34%) 61 (49%) 21 (17%) 41.2% 0.94
14bp RS66554220 DEL INS 79 (31%) 126 (50%) 46 (18%) 43.4% 0.73
31 RS41551813 AA TT 234 (93%) 16 (6%) 1 (0%) 3.6% 0.22
110 RS12722477 CC AA 206 (82%) 40 (16%) 5 (2%) 10.0% 0.08
- 75 -
130 RS144244894 CC DEL 243 (97%) 8 (3%) 0 (0%) 1.6% 0.80
258 RS12722482 CC TT 207 (82%) 44 (18%) 0 (0%) 8.8% 0.13
Donor
201 RS1233333 CC TT 52 (26.5%) 101 (51.5%) 43 (22%) 47.7% 0.65
725 RS1233334 GG CC/AA 146 (75%) 36 (18%) 14 (7%) 16.3% -
3196 RS1610696 GG CC 99 (50%) 78 (40%) 19 (10%) 29.6% 0.53
3187 RS9380142 AA GG 90 (46%) 84 (43%) 22 (11%) 32.7% 0.72
3142 RS1063320 CC GG 27 (24%) 62 (54%) 25 (22%) 49.1% 0.35
14bp RS66554220 DEL INS 65 (33%) 97 (50%) 34 (17%) 42.1% 0.83
31 RS41551813 AA TT 181 (92%) 15 (8%) 0 (0%) 3.8% 0.58
110 RS12722477 CC AA 157 (80%) 38 (20%) 1 (0%) 10.2% 0.42
130 RS144244894 CC DEL 190 (97%) 6 (3%) 0 (0%) 1.5% 0.83
258 RS12722482 CC TT 161 (82%) 35 (18%) 0 (0%) 8.9% 0.17
Data is described as mean ± standard deviation, median (25th-75th percentiles) and frequencies, as appropriate.
Legend: SNP: single nucleotide polymorphisms, MAF: minor allele frequency, HWE: Hardy-Weinberg equilibrium.
- 76 -
Table 6: Distribution (frequency and percentage) of haplotypes in the recipient and
donor cohorts.
Recipient Donor
Haplotype
Genotype
Frequency
Genotype
Percent
Genotype
Frequency
Genotype
Percent
G*01:01/G*01:01 147 59 109 56
G*01:01/G*01:03 14 6 11 6
G*01:01/G*01:04 35 14 35 18
G*01:01/G*01:05N 8 3 4 2
G*01:01/G*01:06 37 15 31 16
Other 10 4 6 3
Data is described as mean ± standard deviation, median (25th-75th percentiles) and frequencies, as appropriate.
- 77 -
Table 7: Frequency of match genotypes between donor and recipient for each SNP
and for the haplotypes.
Name SNP N Frequency of Match
201 RS1233333 196 68 (35%)
725 RS1233334 196 106 (54%)
3196 RS1610696 196 84 (43%)
3187 RS9380142 196 94 (48%)
3142 RS1063320 114 38 (33%)
14bp RS66554220 196 80 (41%)
Haplotypes - 196 68 (35%)
4.6 Predictors of Mild Cardiac Allograft Vasculopathy
All variables (SNPs and relevant clinical data) tested in univariable parametric
hazard regression models for the outcome are listed in Table 8. Variables obtained
from the multivariable regression model are listed in Table 9.
Table 8: Univariate analysis risk factors for mild CAV.
General recipient characteristics HR LCL UCL p-value
Sex 0.82 0.55 1.25 0.36
Age at transplant (years) 1.00 0.99 1.02 0.67
- 78 -
Weight (kg) 1.01 1.00 1.02 0.06
BMI (kg/m2) 1.03 0.99 1.07 0.12
Year of transplantation 1.09 1.02 1.16 0.01
Blood group: A 1.21 0.83 1.76 0.32
Blood group: B 0.97 0.59 1.57 0.89
Blood group: O 0.81 0.53 1.23 0.31
Primary diagnosis: CHD 1.19 0.78 1.81 0.42
Primary diagnosis: Idiopathic 1.00 0.69 1.46 0.99
Primary diagnosis: Ischemic 0.54 0.20 1.46 0.22
General donor characteristics
Donor sex 1.06 0.68 1.64 0.80
Age of donor (years) 1.03 1.02 1.04 <0.001
Donor weight (kg) 1.01 1.00 1.02 0.01
Donor BMI (kg/m2) 1.03 1.01 1.06 0.02
Blood group of donor: A 0.99 0.68 1.46 0.97
Blood group of donor: B 0.98 0.60 1.62 0.95
Blood group of donor: O 1.10 0.75 1.61 0.63
Donor cause of death: CVA/stroke 1.44 0.98 2.11 0.06
Donor cause of death: Trauma 1.51 0.21 10.88 0.68
Donor cause of death: Anoxia 0.68 0.37 1.28 0.23
- 79 -
Pre-transplant characteristics
Pre-creatine level (umol/L) 1.00 1.00 1.01 0.67
Pre-bilirubin level (umol/L) 1.00 0.99 1.02 0.80
Pre-transplant diagnosis of cancer 0.24 0.06 1.00 0.05
Pre-transplant use of VAD 0.99 0.60 1.62 0.96
PRA class I 0.99 0.98 1.01 0.27
PRA class II 0.99 0.98 1.01 0.35
Recipient CMV status 0.85 0.58 1.25 0.41
Donor CMV status 0.90 0.62 1.32 0.59
CMV negative status vs. any positive 0.97 0.60 1.57 0.90
Ratio of recipient height over donor height 1.59 0.11 23.62 0.74
Ratio of recipient height over donor height >,< 1 0.98 0.67 1.45 0.94
Transplant characteristics
Induction therapy (basiliximab vs.
thymoglobulin) 0.55 0.29 1.01 0.05
Ischemic time (minutes) 1.00 0.99 1.00 0.55
Post-transplant characteristics
Non-compliance of patient- recorded from chart 0.83 0.49 1.41 0.49
Post-transplant diagnosis of diabetes 0.82 0.55 1.20 0.30
Post-transplant diagnosis of hypertension 1.05 0.68 1.61 0.82
- 80 -
Post-transplant diagnosis of cancer 1.01 0.62 1.64 0.97
Medical therapy
Cyclosporine only 0.85 0.58 1.25 0.40
Tacrolimus only 1.06 0.71 1.58 0.77
Switched between tacrolimus and cyclosporine 1.23 0.74 2.02 0.42
Any MPA 0.63 0.33 1.22 0.17
MPA within 1 week of transplant 0.83 0.56 1.22 0.34
MPA within 1 month of transplant 0.80 0.48 1.33 0.39
Any PSI for >6 months 1.93 1.28 2.89 0.00
Sirolimus 1.59 1.09 2.32 0.02
PSI within 6 months of transplant 1.36 0.92 2.03 0.13
PSI within 6 months of transplant (>6 months
treatment) 1.37 0.92 2.03 0.12
PSI within 2 years of transplant (>6 months
treatment) 1.58 1.08 2.30 0.02
PSI within 2 years of transplant 1.54 1.06 2.24 0.02
Any statin 0.35 0.05 2.67 0.31
Statin within 1 week of transplant 0.68 0.46 1.00 0.05
Statin within 1 month of transplant 1.41 0.80 2.48 0.23
Steroids stopped within 2 years of transplant 0.71 0.40 1.24 0.23
- 81 -
Recipient HLA-G SNPs
SNP -201 allelic effect 1.19 0.90 1.57 0.21
SNP -201 recessive effect 0.91 0.57 1.44 0.68
SNP -201 dominant effect 0.72 0.48 1.08 0.11
SNP -725 allelic effect 0.87 0.68 1.11 0.25
SNP -725 recessive effect 1.13 0.67 1.91 0.64
SNP -725 dominant effect 1.36 0.91 2.04 0.13
SNP 3196 allelic effect 1.23 0.90 1.67 0.20
SNP 3196 recessive effect 0.78 0.36 1.68 0.52
SNP 3196 dominant effect 0.78 0.54 1.14 0.20
SNP 3187 allelic effect 1.05 0.79 1.41 0.71
SNP 3187 recessive effect 1.10 0.60 2.01 0.76
SNP 3187 dominant effect 0.88 0.60 1.28 0.50
SNP 3142 allelic effect 0.81 0.50 1.30 0.38
SNP 3142 recessive effect 1.21 0.50 2.92 0.68
SNP 3142 dominant effect 1.43 0.68 3.00 0.34
14bp allelic effect 1.01 0.76 1.34 0.96
14bp recessive effect 1.25 0.77 2.04 0.37
14bp dominant effect 0.85 0.57 1.27 0.44
SNP 31 dominant effect 1.41 0.68 2.90 0.35
- 82 -
SNP 110 dominant effect 0.72 0.42 1.23 0.23
SNP 130 allelic effect 1.38 0.44 4.35 0.59
SNP 258 allelic effect 0.79 0.50 1.25 0.31
Recipient Haplotypes
G*01:01/G*01:01 0.99 0.67 1.45 0.95
G*01:01/G*01:03 1.54 0.71 3.32 0.27
G*01:01/G*01:04 0.76 0.41 1.38 0.36
G*01:01/G*01:05N 0.73 0.23 2.30 0.59
G*01:01/G*01:06 1.17 0.70 1.93 0.55
Other 1.05 0.43 2.58 0.92
Donor HLA-G SNPs
SNP -201 allelic effect 0.98 0.73 1.33 0.91
SNP -201 recessive effect 0.93 0.56 1.55 0.78
SNP -201 dominant effect 1.12 0.68 1.84 0.65
SNP -725 allelic effect 1.44 0.98 2.13 0.06
SNP -725 recessive effect 0.63 0.27 1.44 0.27
SNP -725 dominant effect 0.56 0.32 0.98 0.04
SNP 3196 allelic effect 1.04 0.75 1.42 0.83
SNP 3196 recessive effect 0.87 0.44 1.75 0.70
SNP 3196 dominant effect 0.99 0.64 1.52 0.96
- 83 -
SNP 3187 allelic effect 0.80 0.59 1.09 0.16
SNP 3187 recessive effect 1.35 0.71 2.55 0.36
SNP 3187 dominant effect 1.33 0.87 2.05 0.19
SNP 3142 allelic effect 0.77 0.46 1.28 0.31
SNP 3142 recessive effect 1.40 0.64 3.02 0.40
SNP 3142 dominant effect 1.44 0.59 3.50 0.42
14bp allelic effect 1.08 0.79 1.46 0.63
14bp recessive effect 0.94 0.54 1.62 0.82
14bp dominant effect 0.88 0.56 1.39 0.59
SNP 31 allelic effect 1.57 0.57 4.32 0.38
SNP 110 recessive effect 1.26 0.74 2.15 0.40
SNP 130 allelic effect 1.08 0.34 3.45 0.89
Donor Haplotypes
G*01:01/G*01:01 1.17 0.81 1.71 0.40
G*01:01/G*01:03 0.22 0.03 1.61 0.14
G*01:01/G*01:04 1.32 0.76 2.29 0.32
G*01:01/G*01:05N 0.97 0.24 3.96 0.97
G*01:01/G*01:06 0.98 0.53 1.84 0.96
Other 1.78 0.65 4.89 0.26
Matched SNPs
- 84 -
SNP -201 1.47 0.95 2.27 0.08
SNP -725 1.09 0.71 1.68 0.68
SNP 3196 0.81 0.52 1.25 0.34
SNP 3187 1.00 0.65 1.53 1.00
SNP 3142 1.00 0.47 2.11 0.99
14bp 1.06 0.68 1.63 0.81
Legend: HR: Hazard ratio, LCL: lower confidence limit; UCL: upper confidence limit, CHD: congenital heart disease, BMI: body mass index, CVA: cerebrovascular accident VAD: ventricular assist device, PRA: panel reactive antibody, CMV: cytomegalovirus infection, MPA: mycophenolic acid analog, PSI: proliferation signal inhibitor, SNP: single nucleotide polymorphism.
Table 9: Multivariate model for the diagnosis of mild cardiac allograft vasculopathy.
Factors Bootstrap
reliability HR LCL UCL p-value
Donor age (per 10-years increase) 98% 1.31 1.14 1.51 <0.001
Any PSI exposure >6 months 93% 1.95 1.27 3.01 0.002
Donor weight (per 5-kg increase) 75% 1.13 1.02 1.26 0.02
Statin treatment started within 1 54% 0.66 0.44 0.99 0.04
- 85 -
week of transplant
Pre-transplant cancer history 93% 0.17 0.04 0.77 0.01
Year of transplantation 100% 1.16 1.09 1.24 <0.001
Data is described as mean ± standard deviation, median (25th-75th percentiles) and frequencies, as appropriate. Legend: SNP: single nucleotide polymorphism, PRA: panel reactive antibody, HR: hazard ratio, LCL: lower confidence limit; UCL: upper confidence limit.
4.7 Predictors of Severe Cardiac Allograft Vasculopathy
All variables (SNPs and relevant clinical data) tested in univariable parametric
hazard regression model for the outcome are listed in Table 10. Variables obtained
from the multivariable regression model are listed in Table 11. Donor-recipient SNP
-201 (CC-CC) genotype matching was identified as an independent predictor of
severe cardiac allograft vasculopathy in the survival analysis (Figure 11).
Table 10: Univariate analysis risk factors for severe CAV.
General recipient characteristics HR LCL UCL p-value
Sex 0.97 0.37 2.54 0.95
Age at transplant (years) 1.02 0.98 1.06 0.39
Weight (kg) 1.03 1.00 1.06 0.02
Year of transplantation 1.11 0.92 1.33 0.27
- 86 -
Blood group: B 1.88 0.72 4.90 0.20
Blood group: O 0.97 0.37 2.54 0.95
Blood group: A 0.86 0.35 2.11 0.74
Primary diagnosis: CHD 0.67 0.22 2.02 0.48
Primary diagnosis: Idiopathic 1.81 0.75 4.39 0.19
General donor characteristics
Donor sex 0.74 0.26 2.14 0.58
Age of donor (years) 1.04 1.01 1.08 0.01
Donor weight (kg) 1.02 1.00 1.05 0.07
Donor BMI (kg/m2) 1.06 1.00 1.12 0.03
Blood group of donor: B 1.60 0.58 4.44 0.36
Blood group of donor: A 0.65 0.25 1.69 0.37
Blood group of donor: O 1.23 0.51 3.02 0.64
Donor cause of death: CVA/stroke 0.96 0.38 2.42 0.93
Donor cause of death: Trauma 12.60 1.62 97.84 0.02
Donor cause of death: Anoxia 0.36 0.05 2.72 0.32
Pre-transplant characteristics
Pre-creatine level (umol/L) 1.01 1.00 1.02 0.08
Pre-bilirubin level (umol/L) 0.99 0.95 1.03 0.58
Pre-transplant use of VAD 1.23 0.41 3.70 0.71
- 87 -
PRA class I 1.02 0.99 1.04 0.14
PRA class II 1.02 1.00 1.04 0.01
Recipient CMV status 1.90 0.68 5.30 0.22
Donor CMV status 0.98 0.40 2.36 0.96
CMV negative status vs. any positive 1.39 0.41 4.78 0.60
Ratio of recipient height over donor height 13.56 0.02 8073.74 0.42
Ratio of recipient height over donor height >,< 1 0.43 0.16 1.17 0.10
Transplant characteristics
Induction therapy (basiliximab vs. thymoglobulin)
1.40 0.48 4.05 0.53
Ischemic time (minutes) 1.00 1.00 1.01 0.35
Post-transplant characteristics
Non-compliance of patient- recorded from chart 0.52 0.12 2.26 0.38
Post-transplant diagnosis of diabetes 0.65 0.25 1.71 0.39
Post-transplant diagnosis of hypertension 0.95 0.34 2.63 0.92
Post-transplant diagnosis of cancer 0.99 0.33 2.97 0.98
Medical therapy
Cyclosporine only 0.49 0.20 1.24 0.13
Tacrolimus only 1.62 0.60 4.36 0.34
Switched between tacrolimus and cyclosporine 1.62 0.58 4.54 0.36
- 88 -
Any MPA 1.54 0.20 11.78 0.68
MPA within 1 week of transplant 0.80 0.33 1.94 0.62
MPA within 1 month of transplant 3.50 0.46 26.42 0.22
Any PSI for >6 months 1.73 0.62 4.78 0.29
Sirolimus 2.27 0.87 5.93 0.09
PSI within 6 months of transplant 1.56 0.63 3.87 0.34
PSI within 2 years of transplant (>6 months treatment)
1.52 0.62 3.70 0.36
PSI within 6 months of transplant (>6 months treatment)
1.56 0.63 3.87 0.34
PSI within 2 years of transplant 1.41 0.58 3.43 0.45
Statin within 1 week of transplant 0.57 0.21 1.50 0.25
Recipient HLA-G SNPs
SNP -201 allelic effect 1.06 0.56 2.00 0.87
SNP -201 recessive effect 1.30 0.47 3.60 0.61
SNP -201 dominant effect 0.72 0.28 1.80 0.47
SNP -725 allelic effect 1.50 0.72 3.14 0.28
SNP -725 recessive effect 0.27 0.04 2.03 0.20
SNP -725 dominant effect 0.67 0.22 2.00 0.47
SNP 3196 allelic effect 1.69 0.76 3.74 0.20
- 89 -
SNP 3196 recessive effect 0.67 0.09 5.04 0.70
SNP 3196 dominant effect 0.52 0.21 1.30 0.16
SNP 3187 allelic effect 0.74 0.40 1.36 0.33
SNP 3187 recessive effect 1.26 0.37 4.31 0.71
SNP 3187 dominant effect 1.67 0.66 4.20 0.28
SNP 3142 allelic effect 0.90 0.29 2.83 0.86
SNP 3142 recessive effect 1.09 0.13 9.46 0.93
SNP 3142 dominant effect 1.19 0.22 6.53 0.84
14bp allelic effect 0.97 0.51 1.85 0.92
14bp recessive effect 1.47 0.49 4.43 0.49
14bp dominant effect 0.84 0.34 2.08 0.71
SNP 31 dominant effect 2.42 0.56 10.54 0.24
SNP 110 dominant effect 1.52 0.55 4.18 0.42
SNP 258 allelic effect 4.71 0.62 35.48 0.13
Recipient Haplotypes
G*01:01/G*01:01 1.23 0.49 3.09 0.66
G*01:01/G*01:03 3.03 0.70 13.17 0.14
G*01:01/G*01:04 1.76 0.58 5.29 0.32
Other 1.03 0.14 7.74 0.98
Donor HLA-G SNPs
- 90 -
SNP -201 allelic effect 4.40 1.78 10.86 0.00
SNP -201 dominant effect 0.20 0.07 0.55 0.00
SNP -725 allelic effect 0.96 0.47 1.96 0.91
SNP -725 recessive effect 0.52 0.07 3.98 0.53
SNP -725 dominant effect 1.42 0.49 4.10 0.52
SNP 3196 allelic effect 2.85 1.04 7.84 0.04
SNP 3196 dominant effect 0.33 0.11 1.04 0.06
SNP 3187 allelic effect 0.27 0.13 0.55 0.00
SNP 3187 recessive effect 5.62 2.02 15.67 0.00
SNP 3187 dominant effect 6.74 1.53 29.82 0.01
SNP 3142 allelic effect 0.10 0.01 0.80 0.03
SNP 3142 recessive effect 13.14 1.46 118.28 0.02
14bp allelic effect 3.48 1.43 8.47 0.01
14bp dominant effect 0.27 0.10 0.74 0.01
SNP 110 dominant effect 0.35 0.05 2.65 0.31
Donor Haplotypes
G*01:01/G*01:01 2.40 0.95 6.06 0.06
G*01:01/G*01:04 0.49 0.06 3.65 0.48
G*01:01/G*01:06 1.03 0.24 4.44 0.97
Matched SNPs
- 91 -
SNP -201 4.46 1.55 12.90 0.01
SNP -725 1.08 0.40 2.91 0.88
SNP 3196 2.87 0.99 8.30 0.05
SNP 3187 2.03 0.70 5.88 0.19
SNP 3142 0.56 0.06 5.02 0.60
14bp 1.53 0.57 4.08 0.40
Legend: HR: Hazard ratio, LCL: lower confidence limit; UCL: upper confidence limit, CHD: congenital heart disease, BMI: body mass index, CVA: cerebrovascular accident VAD: ventricular assist device, PRA: panel reactive antibody, CMV: cytomegalovirus infection, MPA: mycophenolic acid analog, PSI: proliferation signal inhibitor, SNP: single nucleotide polymorphism.
Table 11: Multivariate model for the diagnosis of severe cardiac allograft
vasculopathy.
Factors Bootstrap
reliability HR LCL UCL p-value
Donor-recipient SNP -201 (CC-CC) matching 100% 11.85 4.27 32.94 <.001
Level of pre-transplant PRA II (per 10%-
increase) 69% 1.40 1.09 1.81 0.009
Donor age (per 10-year increase) 77% 1.38 1.01 1.88 0.04
- 92 -
Recipient weight (per 5-kg increase) 74% 1.15 1.00 1.34 0.05
Data is described as mean ± standard deviation, median (25th-75th percentiles) and frequencies, as appropriate. Legend: SNP: single nucleotide polymorphism, PRA: panel reactive antibody, HR: hazard ratio, LCL: lower confidence limit; UCL: upper confidence limit.
- 93 -
Figure 11. Predicted freedom from CAV from donor-recipient SNP -201 (CC-CC) matching. In this analysis, the hazard function obtained from the parametric hazard regression model for severe CAV over time was resolved according to SNP-201 donor-recipient matching status.
- 94 -
Chapter 5
Discussion and Conclusion
5 General Discussion
5.1 Research Aims
The relevance of HLA-G in transplantation is attributed to its immune inhibitory
activity. Differences in expression of HLA-G are associated with variable protection
against allograft rejection (Lila et al., 2002). The varying expression levels seen in
patients are potentially prompted by the few nucleotide variations in the conserved
gene sequence (Castelli et al., 2014). With this in mind, we investigated the role of
HLA-G SNPs (from recipient and donor) on CAV diagnosis.
We identified donor-recipient SNP -201 (CC-CC) genotype matching to be an
independent risk factor for severe CAV diagnosis. The other polymorphisms
investigated were not associated with severe CAV even though previous
investigations suggested their role in determining transplant outcome or in
modifying expression such as the 14bp INDEL polymorphisms (Misra et al., 2014;
Twito et al., 2011). Though immunosuppressive therapy has been recognized to
induce expression of HLA-G, in this analysis, variations in the immunosuppressive
regimen did not emerge to be a significant factor for severe CAV (Basturk et al.,
2006; Sheshgiri et al., 2009). We reasoned that probably the therapy levels that
induced higher expression levels are significantly higher than the therapy doses
- 95 -
given in practice as it was observed in the in vitro analysis of Mociornita et al.
(2011).
No HLA-G polymorphism was identified as a predictor for diagnosis of mild CAV.
Patients with mild CAV were diagnosed within the first year with the majority
remaining CAV 1 over the follow-up period except for 8 patients who progressed to
severe CAV. Factors identified in the model to be predictors for mild CAV were
immunosuppression therapy and donor factors. We hypothesize that the CAV 1
diagnosis in this cohort is attributed to donor transmitted coronary disease rather
than CAV, though we are limited by the lack of baseline angiography. Medical
therapy, specifically PSI prescribed for > 6 months may be in part responsible for
the stability of mild CAV seen during follow-up given its anti-proliferative effects.
The matching of SNP -201 was identified as a risk factor in the second model. SNP -
201 is located in 5’- upstream promoter region at position -201. The 5’-regulatory
region contains two main regulatory modules, the cis regulatory element, which
includes the Enhancer A with the interferon-stimulated response element (ISRE),
and the second regulatory element is the SXY module (Castelli et al., 2014). These
regulatory elements are modified in contrast to typical HLA class I promoter
regions and the modifications render them unresponsive to common HLA
modulators such as nuclear factor (NF) - κB and interferon-γ (Castelli et al., 2014).
Other elements in the promoter region constitute the heat shock element, hypoxia
response element, and others, all which are presumed to regulate the expression of
HLA-G (Castelli et al., 2014). The heat shock element and hypoxia response
element are unique to the HLA-G gene (Ibrahim et al., 2000; Moreau et al., 2009).
- 96 -
SNP -201 is particularly adjacent to Enhancer A element where p50 and the
hypoxia response (HRE) element bind therefore variations in this SNP can
potentially be affecting the association of the regulatory elements to the gene
(Castelli et al., 2014; Moreau et al., 2009). Interestingly, Enhancer A (EnhA)
element, only interacts with p50/p50 homodimers in the HLA-G gene in comparison
with the vast array of homo and heterodimer factors that the HLA class I genes
interact with (p65-p50 or p65-p65). In addition, the p50/p50 homodimers do not
have a transactivator therefore cannot activate transcription (Castelli et al., 2014).
The heat shock element appears to be unique to the HLA-G gene and binds between
-242 and -238. Although the heat shock element increases the expression of the
HLA-G molecule, the functionality of the element is unknown (Moreau et al., 2009).
Besides the location and potential effect SNP -201 could have in expression, it has,
thus far, never been found individually associated with expression levels or
transplant outcomes or any disease outcome. However the SNP has been
investigated as part of a group in formed haplotypes. A recent investigation by Di
Cristofaro et al. (2015) found the CC genotype was protective and instead genotype
TT was a risk factor for chronic lung rejection. Indeed, our analysis is significantly
different from this haplotype investigation in that we analyzed the effect of the
donor and considered the SNP individually, all which affected our final model.
Certainly, the one drawback of analyzing haplotypes is that the effect of individual
SNPs can be masked by the effect of other SNPs. Thus, certainly more needs to be
understood of HLA-G genetics and polymorphisms, in particular, SNP -201
biological mechanism.
- 97 -
The findings of the donor-recipient SNP -201 (CC-CC) genotype matching as a risk
factor for severe CAV corroborate the potential role for HLA-G in the development
of CAV, as suggested in previous investigations. In vitro studies by our group
identified that expression of HLA-G in human coronary smooth muscle cells led to
the inhibition of proliferative activity and the inhibition was dependent on the
concentration of HLA-G (Mociornita, Tumiati, Papageorgiou, Grosman, et al., 2013).
Lastly, HLA-G was shown to inhibit neutrophil adhesion to injured human coronary
artery endothelial cells (as a TNF-α-induced inflammatory response) (Mociornita,
Tumiati, Papageorgiou, Grosman-Rimon, et al., 2013). The inhibitory effect of HLA-
G demonstrated in these in vitro analyses highlights its postulated role in the
development of CAV. Additionally Mociornita, Tumiati, Papageorgiou, Grosman, et
al. (2013) demonstrated the crucial importance of HLA-G’s concentration in
determining the final outcome. Smooth muscle cell proliferation was significantly
inhibited once HLA-G levels reached a specific concentration, anything below that
level did not modify their behaviour (Mociornita, Tumiati, Papageorgiou, Grosman,
et al., 2013). This observation demonstrates the intricacy of HLA-G’s effect, which is
suggestive of HLA-G possible role in CAV process. Lastly, two clinical investigations
in the heart transplant population demonstrated how higher HLA-G levels were
always associated with no or low incidence of CAV diagnosis, once again linking the
potential protective effect of HLA-G to CAV (Blanco-Garcia et al., 2013; Lila et al.,
2002).
- 98 -
5.2 Proposed Mechanism
This investigation identified a novel association of the combination of donor-
recipient HLA-G genotypes in the development of CAV. Intuitively we propose a
mechanism for the association of donor-recipient SNP -201 (CC-CC) genotype
matching. Polymorphisms throughout the gene influence the expression of HLA-G
along with other factors, leading to high, medium or low expression levels (Di
Cristofaro et al., 2013; Rebmann et al., 2001). The donor genotype regulates
expression of HLA-G in allograft cells, while the recipient genotype controls the host
immune cell’s HLA-G expression (Carosella et al., 2015). Combined expression of
HLA-G in their respective cells, creates a “protective shield” at the primary target
site (Carosella et al., 2015). If the combined donor and recipient genotypes do not
produce enough HLA-G for the allograft to be protected, this might hinder HLA-G’s
inhibitory role because the less HLA-G molecules are available to interact with the
immune receptors, the immune inhibitory effect is lessened (Carosella et al., 2015;
Mociornita, Tumiati, Papageorgiou, Grosman, et al., 2013). Hindering HLA-G’s
protective role might leave the allograft susceptible to rejection and long-term
development of CAV (Blanco-Garcia et al., 2013). Thus, both recipient and donor
genotypes are equally important to understand the overall environmental tolerance
produced by HLA-G.
The rationale for the proposed mechanism is based on three important results
identified in the literature. Specifically heart and allograft cells express HLA-G,
variations in soluble HLA-G levels determine patient’s outcomes and variations are
- 99 -
caused in part by SNPs in the HLA-G gene. Numerous investigations highlighted
that heart and graft cells express HLA-G. Sheshgiri, Rouas-Freiss, et al. (2008) and
Mociornita et al. (2011) identified myocardial cells, cardiac endothelial cells and
human coronary smooth muscle cells to be induced by environmental factors to
express HLA-G. These findings demonstrated how medical therapy and
progesterone can induce HLA-G expression in cells not normally known for
expressing it. In liver and kidney allografts, epithelial cells from liver, biliary and
renal tubular cells were identified to express HLA-G (Creput, Durrbach, et al.,
2003; Creput, Le Friec, et al., 2003). Lastly, bronchial epithelial cells from allograft
lungs were also found to express HLA-G (Brugiere et al., 2009). Again,
demonstrating the significant expression of HLA-G in cells not known for its
expression. If the allograft organ expresses HLA-G, it is reasonable to suspect that
the donor genotype may be dictating the expression levels (in addition to
environmental factors) and thus ultimately participating in the graft tolerance.
Thus far, only one other investigation has explored the effect of donor and recipient
matching of HLA-G in transplant outcomes. The analysis explored whether
compatibility of HLA-G loci alleles was important, specifically HLA-A, –B and –DR
loci compatibility (Pirri et al., 2009). Patient and donor matching coding region
alleles were at a lower risk of rejection than those patients that did not match HLA-
G loci in the kidney cohort (Pirri et al., 2009). This was the first investigation to
ever consider genotyping the donor for HLA-G however not with the same
reasoning. Indeed, it was the first indication that considering combined genotype
may play a crucial role in cellular rejection incidence. However, there were several
- 100 -
limitations with the analysis that limit the findings. First, the sample size of the
cohort was quite small thus limiting the strength of the results. In addition, the
study was restricted by only analyzing coding region alleles and not looking at
polymorphisms in the 5’-upstream promoter region and 3’-untranslated regions of
the gene, which are also known for influencing expression levels and associated
with outcomes (Castelli et al., 2014). Although, our analysis identify that matching
of SNP -201 was detrimental (the opposite to the investigation), our model did
consider the effect of coding region alleles and coding region matching and not
matching and still did not find either as a factor for severe CAV. Possible reasoning
for the different findings is that, Pirri et al. (2009) analyzed different outcomes from
our analysis, cellular rejection versus CAV, and that in itself may influence the
findings. In summary, donor genotype not previously considered of importance in
transplantation, appears to be a key player in HLA-G expression and should be
considered in transplant investigations.
Secondly, varying levels of HLA-G are associated with variable outcomes. When
analyzing the association of HLA-G and outcomes post-transplant, patients with no
HLA-G expression had significantly more episodes of acute cellular rejection than
those with positive levels (Lila et al., 2002). We have shown a strong benefit in
expressing HLA-G, since 86% of those patients had no acute cellular rejection
episodes Grade≥2R (Sheshgiri, Rouas-Freiss, et al., 2008). This association of HLA-
G and lower episodes of rejection was further corroborated in liver, and kidney
transplant recipients, were the presence of HLA-G was significantly correlated with
absence of acute cellular or chronic rejection (Creput, Durrbach, et al., 2003).
- 101 -
Indeed, HLA-G expression in biopsy specimens of lung, liver and kidney allografts
were associated with a significant decrease in cellular-mediated rejection episodes,
indicating HLA-G protection of the allograft (Brugiere et al., 2009; Hu et al., 2014;
Xiao et al., 2013). Particular to our outcome, heart and lung transplant patients
with high expression of HLA-G had significantly lower incidence of allograft
vasculopathy (Blanco-Garcia et al., 2013; Brugiere et al., 2015). Again, suggesting
that HLA-G’s levels determine rejection incidence. Low expression of HLA-G
diminishes graft tolerance given that HLA-G inhibitory activity is surpassed by the
number of immune cells generating an immune response.
The final piece of evidence for the proposed mechanism is that production and
degradation of the HLA-G protein is modified by polymorphisms that are close to or
where regulatory elements bind to the gene (Donadi et al., 2011). It is important to
clarify that expression is not only influenced by nucleotide variations but also by
microRNAs and epigenetics (DNA methylation and histone modification) (Carosella
et al., 2015). Indeed the effect is reciprocal since microRNAs and DNA methylation
is also influenced by SNPs variations (Carosella et al., 2015). For instance, an
investigation by Ober et al. (2006) indicated that the switch of C for G for SNP -725
increases the chances of the SNP to be methylated which inhibits transcription and
subsequently leads to lower expression of the molecule (Moreau et al., 2003). In the
3’-untranslated region of the gene, Martelli-Palomino et al. (2013) found that
individuals homozygous for the DEL allele, in the 14bp INDEL polymorphism, had
significantly higher HLA-G expression than individuals homozygous for the INS
allele. The INS allele was associated with decreased mRNA production compared to
- 102 -
the DEL allele possibly due to the effect of various microRNAs that bind around
that region (Hviid et al., 2003). Lastly, in a healthy population, the presence of
allele G*01:04 from the coding region was associated with higher HLA-G levels
while allele G*01:05N and G*01:01:03 with low (Rebmann et al., 2001). These
observations demonstrate how variations in the gene can ultimately affect the
expression levels of the molecule.
- 103 -
Figure 12: Proposed mechanism of the role of HLA-G SNPs from the recipient and donor in the expression of HLA-G and subsequently how lower expression diminishes the potential inhibitory role of HLA-G in process such as smooth muscle
Ischemia-reperfusion
EC injury
Acute rejection
Donor disease
Infection
Metabolic disorders
Hypertension
Donor age
Preservation damage
Immunosuppressants
Vascular inflammation
Proinflammatory cytokines
Adhesion molecules Chemokines
Growth factors
TcellsLeukocytes Macrophages
Phenotypic change
SMC migration into vascular intima and proliferation
CAV
ê HLA-G
DONOR SNPs
RECIPIENT SNPs
- 104 -
cell proliferation that suggest HLA-G’s potential role in CAV development. Adapted with permission granted from Copyright © 2013 Mociornita, Tumiati, Papageorgiou, Grosman, et al. (2013).
5.3 Clinical Significance
The work described herein identified two clinically relevant findings. Firstly, there
is a novel role for the donor HLA-G genotype in CAV outcomes. This is the first
investigation to analyze the HLA-G donor genotype with the understanding that the
donor genotype controls the expression of HLA-G in the allograft cells.
Furthermore, HLA-G SNP matching between the recipient and donor is an
independent risk factor, which proves our hypothesis that both recipient and donor
are involved in HLA-G’s tolerance role. This underscores previous studies that may
have missed tolerance effectors by not adjusting for donor HLA-G genotype. We
anticipate that our analysis will prompt other investigators to consider donor
genotype when investigating the effect of HLA-G polymorphisms and transplant
outcomes. There is a definite need for more comprehensive investigations in this
field in order to draw meaningful conclusions.
Secondly, the finding of the crucial role of donor-recipient SNP -201 (CC-CC)
genotype matching proves the important role of polymorphisms on disease outcome
and expression. This SNP is located close to regulatory factors and potential
variation in this SNP could influence the binding of regulatory elements to the
gene. The CC genotype is the ancestral allele. We hypothesize that the ancestral
- 105 -
allele role is not to stimulate the binding of regulatory factors such as p50-p50 to
the gene for the purpose to maintain low transcription levels. As previously
mentioned, expressing low HLA-G renders the molecule’s immune inhibiting
activity ineffective against the vast amount of activated immune cells. It is
reasonable to believe that the ancestral genotype would not stimulate for mRNA
production since naturally this molecule is not expressed in the vast majority of
cells (Carosella et al., 2003). However, this is speculation and further
investigations are needed to draw meaningful conclusions.
5.4 Limitation
There were several limitations in this investigation. For the first model of mild
CAV, the main limitation to the findings was the lack of baseline angiography done
4-6 weeks post transplant that would determine if the mild disease observed a year
later is truly donor disease. Of course it would have strengthened the analysis if
HLA-G expression had been measured to corroborate if the levels vary between the
mild CAV cohort and the no CAV cohort.
For the severe CAV model, inability to measure HLA-G levels, due to the
retrospective nature of the study, limits the ability to corroborate our proposed
mechanism. It would have strengthened the final outcome, if patients with donor-
recipient SNP -201 (CC-CC) genotype matching had significantly lower levels of
HLA-G than the rest of the cohort. However, current laboratory techniques and
commercially available tests to measure expression of HLA-G are neither optimized
nor standardized providing narrow results. As previously mentioned, HLA-G
- 106 -
molecule has 7 different isoforms, which can be found shed, soluble and membrane-
bound, and in addition as a homo and/or hetero-dimers (Carosella et al., 2015). To
that point, there is no current standard for HLA-G measuring techniques and some
techniques available only measure a few of the HLA-G variants (Carosella et al.,
2015). For instance, majority of investigations use enzyme-linked immunosorbent
assay that measures only HLA-G1 and HLA-G5 variants and only monomers,
however, a current investigation by Ezeakile et al. (2014) identified that dimers
have a crucial role in transplant tolerance in a kidney cohort over monomers.
Therefore it appears that the role of the HLA-G isoforms vary in the context of the
disease investigated. We could infer that potentially the levels of HLA-G are
underreported but there is a lot that needs to be further investigated about HLA-G
expression levels to potentially state that. For instance, a recent report by Di
Cristofaro et al. (2015) concluded that haplotype 3 was a significant risk factor for
the diagnosis of CLAD post lung transplantation. In addition, this haplotype was
associated with lower HLA-G levels (Di Cristofaro et al., 2015). However, two alleles
that compose haplotype 3 are DEL allele for 14bp INDEL polymorphism and
G*01:04 from the coding region and they had been previously associated with
significantly high HLA-G expression in numerous investigations (Di Cristofaro et
al., 2015; Rebmann et al., 2001; Twito et al., 2011). Indeed, a lot more needs to be
investigated about the expression of the HLA-G.
As for the genetic section, thus far there is a bulk of investigations that either focus
on a single polymorphisms like the 14bp INDEL polymorphism or on a specific
region of the gene. The current line of thinking identifies such analysis as missing
- 107 -
the full picture and rightly so, because the expression of HLA-G is influenced by the
effect of all the SNPs in its gene combined given that the polymorphisms are not
independent of each other (Castelli et al., 2014). Currently several important SNPs
(the majority investigated in this analysis) were grouped together to form 8
different haplotypes. Thus far, one study has categorized the haplotypes into high,
low and normal expression levels (Di Cristofaro et al., 2013). Investigating the role
of polymorphisms combined into haplotypes has advantages and disadvantages. The
advantage is that the analysis is closer to understanding the overall effect of the
genetics on the expression of HLA-G. The disadvantage surfaces from the
limitations in the statistics since sometimes, depending the outcome investigated,
haplotypes do not give enough power to draw meaningful conclusions. For this
analysis, we did not group the SNPs into defined haplotypes by Di Cristofaro et al.
(2013) for that same reason since it was better to investigate each SNP individually.
Indeed, a recent investigation identified haplotype HLA-G*01:04~UTR3 as
independent risk factor (HR 3.39) for chronic lung rejection (CLAD) (Di Cristofaro et
al., 2015). However, the investigation did not analyze the genotype of the donor,
which we identified to be an important factor in the determination of rejection
outcomes. Therefore the findings are unadjusted for the effect of the donor genotype
and could be missing an important signal. In particular given that HLA-G
expression was identified in bronchial epithelial cells on transplanted lungs, clearly
indicating that allograft tissue expresses HLA-G (Brugiere et al., 2009).
Two other important factors of a genetic investigation are adjusting for ethnicity of
the cohort and replicating the investigation in another cohort. Indeed, ethnicity of
- 108 -
the studied cohort is primordial since it is known that there are variations in the
frequency of the SNPs depending the ethnicity of the group studied (Donadi et al.,
2011). However, we were not able to obtain the ethnicity of the donors since it is not
disclosed by the hospital. As for the patients we had 50% unknowns since it is a
choice for the patient to disclose their ethnicity. This is a clear limitation to the
analysis since we won’t know if the frequencies observed in our cohort were linked
to a specific ethnicity. The second factor is the lack of a replication analysis. A
replication cohort gives validity to the investigation by demonstrating that the
identified signal is reproducible in cohorts in other centers. We were not able to
complete a replication cohort analysis for this Master’s thesis but we are
considering it as a future analysis.
The final limitation to this investigation was that the mechanistic pathway of SNP -
201 has not been extensively investigated. SNP-201 is located beside regulatory
elements such as P50, SP1 and the hypoxia response element (HRE), which are
known to regulate HLA-G expression (Castelli et al., 2014; Moreau et al., 2009).
However, there is currently no investigation that suggests the potential effects of a
nucleotide variation in this SNP in terms of the binding of the regulatory elements
to the gene and the effects to the expression levels.
5.5 Future Directions
Future directions for research in HLA-G are required to translate this molecule to
clinical significance and utilization. A lot still needs to be investigated about HLA-
G, which will be delineated in the next few paragraphs. Indeed, investigations are
- 109 -
warranted to identify the biological mechanism by which SNP -201 might influence
the severity of CAV. Furthermore, expression levels of SNP -201 variants need to be
investigated to corroborate the proposed mechanism. In summation, SNP -201
must be further investigated to understand the missing piece in this analysis.
Indeed in vitro and in vivo analysis would most certainly provide the answer to our
questions. An investigation on various heart cell lines such as human coronary
smooth muscle cells and endothelial cells may help us finally understand the effect
of the nucleotide variation on expression of the molecule. Initially, the exploration of
the phenotype of each genotype in the various heart cell lines is significant to
corroborate our analysis. If our hypothesis is correct, then cell lines with the CC
genotype should produce significantly lower HLA-G than those with CT/TT. Since
potentially, the heart cells would have to be stimulated to express HLA-G
(potentially with immunosuppressive therapy or hormones such as progesterone),
various control groups would be needed. Once it is established in the in vitro
analysis, the next step would be to do in vivo analysis in a mouse or rat line
(modified to express HLA-G). The in vivo analysis would consist of transplanting
the mouse/rat with a known genotype and creating the CC-CC donor-recipient
group, and the various other groups. Measuring of HLA-G would be primordial were
the donor heart and recipient tissue are in contact and it should be done at various
time points post-transplant. Experiments such as the discussed above would clarify
the role of HLA-G and its significance in allograft tolerance.
Given HLA-G’s diverse forms and a recent finding indicating that dimers are key
players in the transplant tolerance process, previous investigations (limited by
- 110 -
techniques and tests) may have under reported HLA-G expression (Carosella et al.,
2015; Ezeakile et al., 2014). Therefore, the techniques to measure expression need
to be improved and standardized to subsequently enhance our understanding of the
role of HLA-G expression in influencing transplant outcomes (Carosella et al.,
2015). This will be an ongoing limitation in most investigations of HLA-G until it
gets resolved. Indeed, I would suggest to rely less on soluble and membrane
measurements in the next few years and concentrate on the genetics of the HLA-G
molecule.
Lastly, for HLA-G immune inhibitory activity to be translated to clinical practice,
future investigations must be more comprehensive and include in the analysis the
donor genotype and adjust for the immunosuppressive therapy of the patients.
Clearly our analysis demonstrated the crucial role the donor genotype has in
outcome determination and it is known from previous investigations that HLA-G
expression can be influenced by immunosuppressive therapy. Furthermore, if
looking at the genetics of the molecule, future investigation would be more
comprehensive if either analyzed previously identified SNPs from all regions of the
gene or considered the formed haplotypes. It no longer makes sense to investigate a
single SNP since it is known that many of the HLA-G SNPs are in linkage
equilibrium. Indeed, considering more than one SNP provides a more
comprehensive picture of the real effect (Castelli et al., 2014). In summation, HLA-
G and transplant outcomes investigations have advanced in the last few years
however, for this molecule to progress to clinical practice, more investigations are
warranted. Therefore I would propose to repeat the same study in a lung transplant
- 111 -
cohort to validate our findings. The investigation would be clinical, retrospective
and single-centered to replicate what was undertook in the cardiac study. The
purpose would be to validate our findings in another population and highlight HLA-
G relevance in transplantation. Chronic rejection (chronic allograft lung
dysfunction) would be the study outcome since it is the equivalent of cardiac
allograft vasculopathy for the lung transplant patients. Given the incidence of
chronic rejection in lung transplantation, the study does not need to go further than
5 years back to actually get an incidence of 40% in the cohort. In addition with the
number of patients transplanted and the relatively high incidence of the disease, in
this project the effect of haplotypes could also be investigated. Haplotypes could not
be investigated in the cardiac project however it is very important to understand
what is the effect of all the polymorphisms combined. In summation, repeating the
project in the lung population, would potentially validate our findings and allow for
the investigation of haplotypes and donor genotype not previously investigated.
As for me, my careers goals are to work as a physician-scientist in the future, thus I
plan to do medical school and complete a PhD degree. Indeed for this year, I plan to
undergo the same investigation I did but in a lung transplant cohort for the purpose
to answer some of the questions raised in my heart project and validate our
findings. Validating the findings is a very important step to potentially move HLA-
G to a clinical significance especially in genetics studies since it is important to
make sure the factor identified is important in different cohorts/samples. Within the
next years, I plan to further my education by completing a PhD degree, hopefully
continuing in the field of HLA-G since there is so much potential with this molecule.
- 112 -
5.6 Conclusion
In this investigation, the diagnosis of mild CAV was not associated with HLA-G
polymorphisms. The major factor that may explain the lack of association between
HLA-G SNPs and mild CAV in our model was the inability to distinguish mild CAV
from donor transmitted disease. Donor-recipient SNP -201 (CC-CC) genotype
matching is an independent risk factor, which proves our hypothesis that both
recipient and donor are involved in HLA-G’s tolerance role and appears to have a
significant association with the development of severe CAV. Our investigation
identifies the potential novel role of donor HLA-G genotype in influencing
transplant outcomes and the interaction of donor-recipient SNP -201 (CC-CC)
genotype matching has not yet been described. Indeed, these findings may help to
tailor care for this subset of patients potentially mitigating the high risk of
developing severe CAV.
- 113 -
References Abbas, A., Tripathi, P., Naik, S., & Agrawal, S. (2004). Analysis of human leukocyte
antigen (HLA)-G polymorphism in normal women and in women with recurrent spontaneous abortions. Eur J Immunogenet, 31(6), 275-278. doi:10.1111/j.1365-2370.2004.00487.x
Afzali, B., Lechler, R. I., & Hernandez-Fuentes, M. P. (2007). Allorecognition and the alloresponse: clinical implications. Tissue Antigens, 69(6), 545-556. doi:10.1111/j.1399-0039.2007.00834.x
Aldrich, C. L., Stephenson, M. D., Karrison, T., Odem, R. R., Branch, D. W., Scott, J. R., . . . Ober, C. (2001). HLA-G genotypes and pregnancy outcome in couples with unexplained recurrent miscarriage. Molecular Human Reproduction, 7(12), 1167-1172. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11719594
Alvarez, M., Piedade, J., Balseiro, S., Ribas, G., & Regateiro, F. (2009). HLA-G 3'-UTR SNP and 14-bp deletion polymorphisms in Portuguese and Guinea-Bissau populations. Int J Immunogenet, 36(6), 361-366. doi:10.1111/j.1744-313X.2009.00875.x
Arnold, J. M., Howlett, J. G., Dorian, P., Ducharme, A., Giannetti, N., Haddad, H., . . . White, M. (2007). Canadian Cardiovascular Society Consensus Conference recommendations on heart failure update 2007: Prevention, management during intercurrent illness or acute decompensation, and use of biomarkers. Can J Cardiol, 23(1), 21-45. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/17245481
Azarpira, N., Aghdaie, M. H., Kazemi, K., Geramizadeh, B., & Darai, M. (2014). HLA-G polymorphism (rs16375) and acute rejection in liver transplant recipients. Dis Markers, 2014, 814182. doi:10.1155/2014/814182
Bahri, R., Naji, A., Menier, C., Charpentier, B., Carosella, E. D., Rouas-Freiss, N., & Durrbach, A. (2009). Dendritic cells secrete the immunosuppressive HLA-G molecule upon CTLA4-Ig treatment: implication in human renal transplant acceptance. J Immunol, 183(11), 7054-7062. doi:10.4049/jimmunol.0803054
Bainbridge, D. R., Ellis, S. A., & Sargent, I. L. (2000). HLA-G suppresses proliferation of CD4(+) T-lymphocytes. Journal of Reproductive Immunology, 48(1), 17-26. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10996380
Basturk, B., Karakayali, F., Emiroglu, R., Sozer, O., Haberal, A., Bal, D., & Haberal, M. (2006). Human leukocyte antigen-G, a new parameter in the follow-up of liver transplantation. Transplant Proc, 38(2), 571-574. doi:10.1016/j.transproceed.2005.12.108
- 114 -
Blackstone, E. H., Naftel, D. C., & Turner, M. E. (1986). The Decomposition of Time-Varying Hazard into Phases, Each Incorporating a Separate Stream of Concomitant Information. Journal of the American Statistical Association, 81(395), 615-624. doi:Doi 10.2307/2288989
Blanco, O., Tirado, I., Munoz-Fernandez, R., Abadia-Molina, A. C., Garcia-Pacheco, J. M., Pena, J., & Olivares, E. G. (2008). Human decidual stromal cells express HLA-G: Effects of cytokines and decidualization. Hum Reprod, 23(1), 144-152. doi:10.1093/humrep/dem326
Blanco-Garcia, R. M., Lopez-Alvarez, M. R., Garrido, I. P., Salgado-Cecilia, G., Campillo, J. A., Bolarin, J. M., . . . Minguela, A. (2013). Post-transplant increase in soluble human leukocyte antigen-G associated with non-severe cardiac allograft vasculopathy. Hum Immunol, 74(3), 318-324. doi:10.1016/j.humimm.2012.12.001
Blaschitz, A., Lenfant, F., Mallet, V., Hartmann, M., Bensussan, A., Geraghty, D. E., . . . Dohr, G. (1997). Endothelial cells in chorionic fetal vessels of first trimester placenta express HLA-G. European Journal of Immunology, 27(12), 3380-3388. doi:10.1002/eji.1830271237
Bocrie, O., Hussein Aly, A. A., Guignier, F., Funes de la Vega, M., Rifle, G., Mousson, C., & Martin, L. (2007). Distribution of donor-specific antibodies in the cortex and the medulla of renal transplants with chronic allograft nephropathy. Transpl Immunol, 17(3), 227-229. doi:10.1016/j.trim.2007.01.001
Boyson, J. E., Erskine, R., Whitman, M. C., Chiu, M., Lau, J. M., Koopman, L. A., . . . Strominger, J. L. (2002). Disulfide bond-mediated dimerization of HLA-G on the cell surface. Proc Natl Acad Sci U S A, 99(25), 16180-16185. doi:10.1073/pnas.212643199
Braga, J. R., Santos, I. S., McDonald, M., Shah, P. S., & Ross, H. J. (2012). Factors associated with the development of cardiac allograft vasculopathy--a systematic review of observational studies. Clin Transplant, 26(2), E111-124. doi:10.1111/j.1399-0012.2011.01565.x
Brugiere, O., Thabut, G., Krawice-Radanne, I., Rizzo, R., Dauriat, G., Danel, C., . . . Rouas-Freiss, N. (2015). Role of HLA-G as a predictive marker of low risk of chronic rejection in lung transplant recipients: a clinical prospective study. Am J Transplant, 15(2), 461-471. doi:10.1111/ajt.12977
Brugiere, O., Thabut, G., Pretolani, M., Krawice-Radanne, I., Dill, C., Herbreteau, A., . . . Rouas-Freiss, N. (2009). Immunohistochemical study of HLA-G expression in lung transplant recipients. Am J Transplant, 9(6), 1427-1438. doi:10.1111/j.1600-6143.2009.02650.x
- 115 -
Cao, M., Yie, S. M., Liu, J., Ye, S. R., Xia, D., & Gao, E. (2011). Plasma soluble HLA-G is a potential biomarker for diagnosis of colorectal, gastric, esophageal and lung cancer. Tissue Antigens, 78(2), 120-128. doi:10.1111/j.1399-0039.2011.01716.x
Cardarelli, F., Pascual, M., Tolkoff-Rubin, N., Delmonico, F. L., Wong, W., Schoenfeld, D. A., . . . Saidman, S. L. (2005). Prevalence and significance of anti-HLA and donor-specific antibodies long-term after renal transplantation. Transpl Int, 18(5), 532-540. doi:10.1111/j.1432-2277.2005.00085.x
Carosella, E. D., Moreau, P., Le Maoult, J., Le Discorde, M., Dausset, J., & Rouas-Freiss, N. (2003). HLA-G molecules: from maternal-fetal tolerance to tissue acceptance. Adv Immunol, 81, 199-252. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/14711057
Carosella, E. D., Rouas-Freiss, N., Roux, D. T., Moreau, P., & LeMaoult, J. (2015). HLA-G: An Immune Checkpoint Molecule. Adv Immunol, 127, 33-144. doi:10.1016/bs.ai.2015.04.001
Castelli, E. C., Mendes-Junior, C. T., Deghaide, N. H., de Albuquerque, R. S., Muniz, Y. C., Simoes, R. T., . . . Donadi, E. A. (2010). The genetic structure of 3'untranslated region of the HLA-G gene: polymorphisms and haplotypes. Genes Immun, 11(2), 134-141. doi:10.1038/gene.2009.74
Castelli, E. C., Mendes-Junior, C. T., Veiga-Castelli, L. C., Roger, M., Moreau, P., & Donadi, E. A. (2011). A comprehensive study of polymorphic sites along the HLA-G gene: implication for gene regulation and evolution. Mol Biol Evol, 28(11), 3069-3086. doi:10.1093/molbev/msr138
Castelli, E. C., Mendes-Junior, C. T., Viana de Camargo, J. L., & Donadi, E. A. (2008). HLA-G polymorphism and transitional cell carcinoma of the bladder in a Brazilian population. Tissue Antigens, 72(2), 149-157. doi:10.1111/j.1399-0039.2008.01091.x
Castelli, E. C., Moreau, P., Chiromatzo, A. O. E., Mendes, C. T., Veiga-Castelli, L. C., Yaghi, L., . . . Donadi, E. A. (2009). In silico analysis of microRNAS targeting the HLA-G 3 ' untranslated region alleles and haplotypes. Human Immunology, 70(12), 1020-1025. doi:DOI 10.1016/j.humimm.2009.07.028
Castelli, E. C., Moreau, P., Oya e Chiromatzo, A., Mendes-Junior, C. T., Veiga-Castelli, L. C., Yaghi, L., . . . Donadi, E. A. (2009). In silico analysis of microRNAS targeting the HLA-G 3' untranslated region alleles and haplotypes. Hum Immunol, 70(12), 1020-1025. doi:10.1016/j.humimm.2009.07.028
- 116 -
Castelli, E. C., Veiga-Castelli, L. C., Yaghi, L., Moreau, P., & Donadi, E. A. (2014). Transcriptional and posttranscriptional regulations of the HLA-G gene. J Immunol Res, 2014, 734068. doi:10.1155/2014/734068
Caumartin, J., Favier, B., Daouya, M., Guillard, C., Moreau, P., Carosella, E. D., & LeMaoult, J. (2007). Trogocytosis-based generation of suppressive NK cells. EMBO J, 26(5), 1423-1433. doi:10.1038/sj.emboj.7601570
Chih, S., Chruscinski, A., Ross, H. J., Tinckam, K., Butany, J., & Rao, V. (2012). Antibody-mediated rejection: an evolving entity in heart transplantation. J Transplant, 2012, 210210. doi:10.1155/2012/210210
Ciliao Alves, D. C., de Oliveira Crispim, J. C., Castelli, E. C., Mendes-Junior, C. T., Deghaide, N. H., Barros Silva, G. E., . . . Donadi, E. A. (2012). Human leukocyte antigen-G 3' untranslated region polymorphisms are associated with better kidney allograft acceptance. Hum Immunol, 73(1), 52-59. doi:10.1016/j.humimm.2011.10.007
Cirulli, V., Zalatan, J., McMaster, M., Prinsen, R., Salomon, D. R., Ricordi, C., . . . Crisa, L. (2006). The class I HLA repertoire of pancreatic islets comprises the nonclassical class Ib antigen HLA-G. Diabetes, 55(5), 1214-1222. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16644675
Colonna, M., Navarro, F., Bellon, T., Llano, M., Garcia, P., Samaridis, J., . . . Lopez-Botet, M. (1997). A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J Exp Med, 186(11), 1809-1818. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9382880
Colonna, M., Samaridis, J., Cella, M., Angman, L., Allen, R. L., O'Callaghan, C. A., . . . Rolink, A. (1998). Human myelomonocytic cells express an inhibitory receptor for classical and nonclassical MHC class I molecules. J Immunol, 160(7), 3096-3100. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9531263
Contini, P., Ghio, M., Poggi, A., Filaci, G., Indiveri, F., Ferrone, S., & Puppo, F. (2003). Soluble HLA-A,-B,-C and -G molecules induce apoptosis in T and NK CD8+ cells and inhibit cytotoxic T cell activity through CD8 ligation. European Journal of Immunology, 33(1), 125-134. doi:10.1002/immu.200390015
Creput, C., Durrbach, A., Menier, C., Guettier, C., Samuel, D., Dausset, J., . . . Rouas-Freiss, N. (2003). Human leukocyte antigen-G (HLA-G) expression in biliary epithelial cells is associated with allograft acceptance in liver-kidney transplantation. J Hepatol, 39(4), 587-594. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12971970
- 117 -
Creput, C., Le Friec, G., Bahri, R., Amiot, L., Charpentier, B., Carosella, E., . . . Durrbach, A. (2003). Detection of HLA-G in serum and graft biopsy associated with fewer acute rejections following combined liver-kidney transplantation: possible implications for monitoring patients. Hum Immunol, 64(11), 1033-1038. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/14602232
http://ac.els-cdn.com/S0198885903005445/1-s2.0-S0198885903005445-main.pdf?_tid=44656864-362b-11e5-84f1-00000aacb35d&acdnat=1438199696_14e1a7370775e6725b3c274aceb86369
Crisa, L., McMaster, M. T., Ishii, J. K., Fisher, S. J., & Salomon, D. R. (1997). Identification of a thymic epithelial cell subset sharing expression of the class Ib HLA-G molecule with fetal trophoblasts. J Exp Med, 186(2), 289-298. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9221758
Crispim, J. C., Duarte, R. A., Soares, C. P., Costa, R., Silva, J. S., Mendes-Junior, C. T., . . . Donadi, E. A. (2008). Human leukocyte antigen-G expression after kidney transplantation is associated with a reduced incidence of rejection. Transpl Immunol, 18(4), 361-367. doi:10.1016/j.trim.2007.10.010
Crispim, J. C., Mendes-Junior, C. T., Wastowski, I. J., Costa, R., Castelli, E. C., Saber, L. T., & Donadi, E. A. (2008). Frequency of insertion/deletion polymorphism in exon 8 of HLA-G and kidney allograft outcome. Tissue Antigens, 71(1), 35-41. doi:10.1111/j.1399-0039.2007.00961.x
Dahl, M., & Hviid, T. V. (2012). Human leucocyte antigen class Ib molecules in pregnancy success and early pregnancy loss. Hum Reprod Update, 18(1), 92-109. doi:10.1093/humupd/dmr043
DePasquale, E. C., Schweiger, M., & Ross, H. J. (2014). A contemporary review of adult heart transplantation: 2012 to 2013. J Heart Lung Transplant, 33(8), 775-784. doi:10.1016/j.healun.2014.04.019
Di Cristofaro, J., El Moujally, D., Agnel, A., Mazieres, S., Cortey, M., Basire, A., . . . Picard, C. (2013). HLA-G haplotype structure shows good conservation between different populations and good correlation with high, normal and low soluble HLA-G expression. Hum Immunol, 74(2), 203-206. doi:10.1016/j.humimm.2012.10.027
Di Cristofaro, J., Reynaud-Gaubert, M., Carlini, F., Roubertoux, P., Loundou, A., Basire, A., . . . Picard, C. (2015). HLA-G*01:04 approximately UTR3 Recipient Correlates With Lower Survival and Higher Frequency of Chronic Rejection After Lung Transplantation. Am J Transplant. doi:10.1111/ajt.13305
- 118 -
Dias, F. C., Castelli, E. C., Collares, C. V., Moreau, P., & Donadi, E. A. (2015). The Role of HLA-G Molecule and HLA-G Gene Polymorphisms in Tumors, Viral Hepatitis, and Parasitic Diseases. Front Immunol, 6, 9. doi:10.3389/fimmu.2015.00009
Diehl, M., Munz, C., Keilholz, W., Stevanovic, S., Holmes, N., Loke, Y. W., & Rammensee, H. G. (1996). Nonclassical HLA-G molecules are classical peptide presenters. Curr Biol, 6(3), 305-314. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8805247
Donadi, E. A., Castelli, E. C., Arnaiz-Villena, A., Roger, M., Rey, D., & Moreau, P. (2011). Implications of the polymorphism of HLA-G on its function, regulation, evolution and disease association. Cell Mol Life Sci, 68(3), 369-395. doi:10.1007/s00018-010-0580-7
Dong, Y., Lieskovska, J., Kedrin, D., Porcelli, S., Mandelboim, O., & Bushkin, Y. (2003). Soluble nonclassical HLA generated by the metalloproteinase pathway. Hum Immunol, 64(8), 802-810. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12878359
Dunker, K., Schlaf, G., Bukur, J., Altermann, W. W., Handke, D., & Seliger, B. (2008). Expression and regulation of non-classical HLA-G in renal cell carcinoma. Tissue Antigens, 72(2), 137-148. doi:10.1111/j.1399-0039.2008.01090.x
Everly, M. J., Everly, J. J., Arend, L. J., Brailey, P., Susskind, B., Govil, A., . . . Woodle, E. S. (2009). Reducing de novo donor-specific antibody levels during acute rejection diminishes renal allograft loss. Am J Transplant, 9(5), 1063-1071. doi:10.1111/j.1600-6143.2009.02577.x
Ezeakile, M., Portik-Dobos, V., Wu, J., Horuzsko, D. D., Kapoor, R., Jagadeesan, M., . . . Horuzsko, A. (2014). HLA-G dimers in the prolongation of kidney allograft survival. J Immunol Res, 2014, 153981. doi:10.1155/2014/153981
Fan, W., Li, S., Huang, Z., & Chen, Q. (2014). Relationship between HLA-G polymorphism and susceptibility to recurrent miscarriage: a meta-analysis of non-family-based studies. J Assist Reprod Genet, 31(2), 173-184. doi:10.1007/s10815-013-0155-2
Fedoric, B., & Krishnan, R. (2008). Rapamycin downregulates the inhibitory receptors ILT2, ILT3, ILT4 on human dendritic cells and yet induces T cell hyporesponsiveness independent of FoxP3 induction. Immunol Lett, 120(1-2), 49-56. doi:10.1016/j.imlet.2008.06.009
Flajollet, S., Poras, I., Carosella, E. D., & Moreau, P. (2009). RREB-1 is a transcriptional repressor of HLA-G. J Immunol, 183(11), 6948-6959. doi:10.4049/jimmunol.0902053
- 119 -
Fons, P., Chabot, S., Cartwright, J. E., Lenfant, F., L'Faqihi, F., Giustiniani, J., . . . Le Bouteiller, P. (2006). Soluble HLA-G1 inhibits angiogenesis through an apoptotic pathway and by direct binding to CD160 receptor expressed by endothelial cells. Blood, 108(8), 2608-2615. doi:10.1182/blood-2005-12-019919
Frank, R., Molina, M. R., Wald, J. W., Goldberg, L. R., Kamoun, M., & Lal, P. (2013). Correlation of circulating donor-specific anti-HLA antibodies and presence of C4d in endomyocardial biopsy with heart allograft outcomes: a single-center, retrospective study. J Heart Lung Transplant, 32(4), 410-417. doi:10.1016/j.healun.2012.12.005
Fujii, T., Ishitani, A., & Geraghty, D. E. (1994). A soluble form of the HLA-G antigen is encoded by a messenger ribonucleic acid containing intron 4. J Immunol, 153(12), 5516-5524. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7989753
Fuzzi, B., Rizzo, R., Criscuoli, L., Noci, I., Melchiorri, L., Scarselli, B., . . . Baricordi, O. R. (2002). HLA-G expression in early embryos is a fundamental prerequisite for the obtainment of pregnancy. European Journal of Immunology, 32(2), 311-315. doi:Doi 10.1002/1521-4141(200202)32:2<311::Aid-Immu311>3.3.Co;2-#
Gao, H. Z., Hunt, S. A., Alderman, E. L., Liang, D., Yeung, A. C., & Schroeder, J. S. (1997). Relation of donor age and preexisting coronary artery disease on angiography and intracoronary ultrasound to later development of accelerated allograft coronary artery disease. J Am Coll Cardiol, 29(3), 623-629. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9060902
Ge, Y. Z., Ge, Q., Li, M. H., Shi, G. M., Xu, X., Xu, L. W., . . . Jia, R. P. (2014). Association between human leukocyte antigen-G 14-bp insertion/deletion polymorphism and cancer risk: a meta-analysis and systematic review. Hum Immunol, 75(8), 827-832. doi:10.1016/j.humimm.2014.06.004
Geraghty, D. E., Koller, B. H., & Orr, H. T. (1987). A human major histocompatibility complex class I gene that encodes a protein with a shortened cytoplasmic segment. Proc Natl Acad Sci U S A, 84(24), 9145-9149. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/3480534
Gobin, S. J., Keijsers, V., Cheong, C., van Zutphen, M., & Van den Elsen, P. J. (1999). Transcriptional regulation of HLA-G. Transplant Proc, 31(4), 1857-1859. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10371973
Gobin, S. J., & van den Elsen, P. J. (2000). Transcriptional regulation of the MHC class Ib genes HLA-E, HLA-F, and HLA-G. Hum Immunol, 61(11), 1102-1107. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11137213
- 120 -
Gobin, S. J. P., van Zutphen, M., Woltman, A. M., & van den Elsen, P. J. (1999). Transactivation of classical and nonclassical HLA class I genes through the IFN-stimulated response element. Journal of Immunology, 163(3), 1428-1434. Retrieved from <Go to ISI>://WOS:000081640000043
Goldman-Wohl, D. S., Ariel, I., Greenfield, C., Hanoch, J., & Yagel, S. (2000). HLA-G expression in extravillous trophoblasts is an intrinsic property of cell differentiation: a lesson learned from ectopic pregnancies. Molecular Human Reproduction, 6(6), 535-540. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10825371
Goldman-Wohl, D. S., Ariel, I., Greenfield, C., Hochner-Celnikier, D., Cross, J., Fisher, S., & Yagel, S. (2000). Lack of human leukocyte antigen-G expression in extravillous trophoblasts is associated with pre-eclampsia. Molecular Human Reproduction, 6(1), 88-95. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10611266
Gonen-Gross, T., Achdout, H., Arnon, T. I., Gazit, R., Stern, N., Horejsi, V., . . . Mandelboim, O. (2005). The CD85J/leukocyte inhibitory receptor-1 distinguishes between conformed and beta 2-microglobulin-free HLA-G molecules. J Immunol, 175(8), 4866-4874. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16210588
Gonen-Gross, T., Achdout, H., Gazit, R., Hanna, J., Mizrahi, S., Markel, G., . . . Mandelboim, O. (2003). Complexes of HLA-G protein on the cell surface are important for leukocyte Ig-like receptor-1 function. J Immunol, 171(3), 1343-1351. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12874224
Gonzalez, A., Rebmann, V., LeMaoult, J., Horn, P. A., Carosella, E. D., & Alegre, E. (2012). The immunosuppressive molecule HLA-G and its clinical implications. Crit Rev Clin Lab Sci, 49(3), 63-84. doi:10.3109/10408363.2012.677947
Grey, H. M., Buus, S., Colon, S., Miles, C., & Sette, A. (1989). Structural requirements and biological significance of interactions between peptides and the major histocompatibility complex. Philos Trans R Soc Lond B Biol Sci, 323(1217), 545-552. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/2569210
Gupta, S., Mitchell, J. D., Lavingia, B., Ewing, G. E., Feliciano, M. N., Kaiser, P. A., . . . Drazner, M. H. (2009). Utility of routine immunofluorescence staining for C4d in cardiac transplant recipients. J Heart Lung Transplant, 28(8), 776-780. doi:10.1016/j.healun.2009.05.007
Hanak, L., Slaby, O., Lauerova, L., Kren, L., Nenutil, R., & Michalek, J. (2009). Expression pattern of HLA class I antigens in renal cell carcinoma and primary cell line cultures: methodological implications for immunotherapy.
- 121 -
Med Sci Monit, 15(12), CR638-643. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/19946235
Harrison, G. A., Humphrey, K. E., Jakobsen, I. B., & Cooper, D. W. (1993). A 14 bp deletion polymorphism in the HLA-G gene. Hum Mol Genet, 2(12), 2200. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8111399
He, X., Dong, D. D., Yie, S. M., Yang, H., Cao, M., Ye, S. R., . . . Chen, J. (2010). HLA-G expression in human breast cancer: implications for diagnosis and prognosis, and effect on allocytotoxic lymphocyte response after hormone treatment in vitro. Ann Surg Oncol, 17(5), 1459-1469. doi:10.1245/s10434-009-0891-9
Hou, W., Huang, Z., Ji, Z., & Zhou, J. (2014). Human leukocyte antigen-G-14-base-pair-insertion/deletion polymorphism and graft survival in kidney transplant recipients. Exp Clin Transplant, 12(2), 89-94. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/24702138
Houlihan, J. M., Biro, P. A., Harper, H. M., Jenkinson, H. J., & Holmes, C. H. (1995). The human amnion is a site of MHC class Ib expression: evidence for the expression of HLA-E and HLA-G. J Immunol, 154(11), 5665-5674. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7751618
Howangyin, K. Y., Loustau, M., Wu, J., Alegre, E., Daouya, M., Caumartin, J., . . . Lemaoult, J. (2012). Multimeric structures of HLA-G isoforms function through differential binding to LILRB receptors. Cell Mol Life Sci. doi:10.1007/s00018-012-1069-3
Hu, W. Y., Wu, L. Q., Su, Z., Pang, X. F., & Zhang, B. (2014). Expression of human leukocyte antigen-G and acute rejection in patients following liver transplantation. Exp Ther Med, 8(4), 1291-1295. doi:10.3892/etm.2014.1917
Hviid, T. V., Hylenius, S., Lindhard, A., & Christiansen, O. B. (2004). Association between human leukocyte antigen-G genotype and success of in vitro fertilization and pregnancy outcome. Tissue Antigens, 64(1), 66-69. doi:10.1111/j.1399-0039.2004.00239.x
Hviid, T. V., Hylenius, S., Rorbye, C., & Nielsen, L. G. (2003). HLA-G allelic variants are associated with differences in the HLA-G mRNA isoform profile and HLA-G mRNA levels. Immunogenetics, 55(2), 63-79. doi:10.1007/s00251-003-0547-z
Hviid, T. V., Moller, C., Sorensen, S., & Morling, N. (1998). Co-dominant expression of the HLA-G gene and various forms of alternatively spliced HLA-G mRNA in human first trimester trophoblast. Hum Immunol, 59(2), 87-98. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9536431
- 122 -
Hviid, T. V., Rizzo, R., Christiansen, O. B., Melchiorri, L., Lindhard, A., & Baricordi, O. R. (2004). HLA-G and IL-10 in serum in relation to HLA-G genotype and polymorphisms. Immunogenetics, 56(3), 135-141. doi:10.1007/s00251-004-0673-2
Ibrahim, E. C., Aractingi, S., Allory, Y., Borrini, F., Dupuy, A., Duvillard, P., . . . Paul, P. (2004). Analysis of HLA antigen expression in benign and malignant melanocytic lesions reveals that upregulation of HLA-G expression correlates with malignant transformation, high inflammatory infiltration and HLA-A1 genotype. Int J Cancer, 108(2), 243-250. doi:10.1002/ijc.11456
Ibrahim, E. C., Morange, M., Dausset, J., Carosella, E. D., & Paul, P. (2000). Heat shock and arsenite induce expression of the nonclassical class I histocompatibility HLA-G gene in tumor cell lines. Cell Stress & Chaperones, 5(3), 207-218. doi:Doi 10.1379/1466-1268(2000)005<0207:Hsaaie>2.0.Co;2
Ishitani, A., & Geraghty, D. E. (1992). Alternative Splicing of Hla-G Transcripts Yields Proteins with Primary Structures Resembling Both Class-I and Class-Ii Antigens. Proceedings of the National Academy of Sciences of the United States of America, 89(9), 3947-3951. doi:DOI 10.1073/pnas.89.9.3947
Ishitani, A., Sageshima, N., Lee, N., Dorofeeva, N., Hatake, K., Marquardt, H., & Geraghty, D. E. (2003). Protein expression and peptide binding suggest unique and interacting functional roles for HLA-E, F, and G in maternal-placental immune recognition. J Immunol, 171(3), 1376-1384. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12874228
Ito, T., Ito, N., Saathoff, M., Stampachiacchiere, B., Bettermann, A., Bulfone-Paus, S., . . . Paus, R. (2005). Immunology of the human nail apparatus: the nail matrix is a site of relative immune privilege. J Invest Dermatol, 125(6), 1139-1148. doi:10.1111/j.0022-202X.2005.23927.x
Jarcho, J., Naftel, D. C., Shroyer, T. W., Kirklin, J. K., Bourge, R. C., Barr, M. L., . . . Starling, R. C. (1994). Influence of HLA mismatch on rejection after heart transplantation: a multiinstitutional study. The Cardiac Transplant Research Database Group. J Heart Lung Transplant, 13(4), 583-595; discussion 595-586. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7947874
Jiang, Y., Chen, S., Jia, S., Zhu, Z., Gao, X., Dong, D., & Gao, Y. (2011). Association of HLA-G 3' UTR 14-bp insertion/deletion polymorphism with hepatocellular carcinoma susceptibility in a Chinese population. DNA Cell Biol, 30(12), 1027-1032. doi:10.1089/dna.2011.1238
Jurisicova, A., Casper, R. F., MacLusky, N. J., & Librach, C. L. (1996). Embryonic human leukocyte antigen-G expression: possible implications for human
- 123 -
preimplantation development. Fertil Steril, 65(5), 997-1002. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8612864
Kilic, A., Weiss, E. S., Allen, J. G., Conte, J. V., Shah, A. S., Baumgartner, W. A., & Yuh, D. D. (2012). Simple score to assess the risk of rejection after orthotopic heart transplantation. Circulation, 125(24), 3013-3021. doi:10.1161/CIRCULATIONAHA.111.066431
Kimball, P. M., Baker, M. A., Wagner, M. B., & King, A. (2011). Surveillance of alloantibodies after transplantation identifies the risk of chronic rejection. Kidney Int, 79(10), 1131-1137. doi:10.1038/ki.2010.556
King, A., Boocock, C., Sharkey, A. M., Gardner, L., Beretta, A., Siccardi, A. G., & Loke, Y. W. (1996). Evidence for the expression of HLAA-C class I mRNA and protein by human first trimester trophoblast. J Immunol, 156(6), 2068-2076. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8690894
Kirszenbaum, M., Moreau, P., Gluckman, E., Dausset, J., & Carosella, E. (1994). An alternatively spliced form of HLA-G mRNA in human trophoblasts and evidence for the presence of HLA-G transcript in adult lymphocytes. Proc Natl Acad Sci U S A, 91(10), 4209-4213. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8183892
Kobashigawa, J. A., Kirklin, J. K., Naftel, D. C., Bourge, R. C., Ventura, H. O., Mohanty, P. K., . . . Bhat, G. (1993). Pretransplantation risk factors for acute rejection after heart transplantation: a multiinstitutional study. The Transplant Cardiologists Research Database Group. J Heart Lung Transplant, 12(3), 355-366. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8329404
Kobashigawa, J. A., Miller, L., Yeung, A., Hauptman, P., Ventura, H., Wilensky, R., . . . Wiedermann, J. (1995). Does acute rejection correlate with the development of transplant coronary artery disease? A multicenter study using intravascular ultrasound. Sandoz/CVIS Investigators. J Heart Lung Transplant, 14(6 Pt 2), S221-226. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8719490
Kobashigawa, J. A., Tobis, J. M., Starling, R. C., Tuzcu, E. M., Smith, A. L., Valantine, H. A., . . . Cretin, N. (2005). Multicenter intravascular ultrasound validation study among heart transplant recipients: outcomes after five years. J Am Coll Cardiol, 45(9), 1532-1537. doi:10.1016/j.jacc.2005.02.035
Koch, C. A., Khalpey, Z. I., & Platt, J. L. (2004). Accommodation: preventing injury in transplantation and disease. J Immunol, 172(9), 5143-5148. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/15100249
- 124 -
Kovats, S., Main, E. K., Librach, C., Stubblebine, M., Fisher, S. J., & DeMars, R. (1990a). A class I antigen, HLA-G, expressed in human trophoblasts. Science, 248(4952), 220-223. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/2326636
Kovats, S., Main, E. K., Librach, C., Stubblebine, M., Fisher, S. J., & Demars, R. (1990b). A Class-I Antigen, Hla-G, Expressed in Human Trophoblasts. Science, 248(4952), 220-223. doi:DOI 10.1126/science.2326636
Kubo, S. H., Naftel, D. C., Mills, R. M., Jr., O'Donnell, J., Rodeheffer, R. J., Cintron, G. B., . . . Kirklin, J. K. (1995). Risk factors for late recurrent rejection after heart transplantation: a multiinstitutional, multivariable analysis. Cardiac Transplant Research Database Group. J Heart Lung Transplant, 14(3), 409-418. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7654724
Kuersten, S., & Goodwin, E. B. (2003). The power of the 3' UTR: translational control and development. Nat Rev Genet, 4(8), 626-637. doi:10.1038/nrg1125
La Nasa, G., Littera, R., Locatelli, F., Lai, S., Alba, F., Caocci, G., . . . Carcassi, C. (2007). The human leucocyte antigen-G 14-basepair polymorphism correlates with graft-versus-host disease in unrelated bone marrow transplantation for thalassaemia. Br J Haematol, 139(2), 284-288. doi:10.1111/j.1365-2141.2007.06779.x
Lajoie, J., Jeanneau, A., Faucher, M. C., Moreau, P., & Roger, M. (2008). Characterisation of five novel HLA-G alleles with coding DNA base changes. Tissue Antigens, 72(5), 502-504. doi:10.1111/j.1399-0039.2008.01130.x
Larsen, M. H., Hylenius, S., Andersen, A. M., & Hviid, T. V. (2010). The 3'-untranslated region of the HLA-G gene in relation to pre-eclampsia: revisited. Tissue Antigens, 75(3), 253-261. doi:10.1111/j.1399-0039.2009.01435.x
Lazarte, J., Tumiati, L.C., Rao, V. & Delgado, D. (2015) New Developments in HLA-G in Cardiac Transplantation. Human Immunology: HLA-G Special Issue. In Press
Le Discorde, M., Moreau, P., Sabatier, P., Legeais, J. M., & Carosella, E. D. (2003). Expression of HLA-G in human cornea, an immune-privileged tissue. Hum Immunol, 64(11), 1039-1044. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/14602233
Le Page, M. E., Goodridge, J. P., John, E., Christiansen, F. T., & Witt, C. S. (2014). Killer Ig-like receptor 2DL4 does not mediate NK cell IFN-gamma responses to soluble HLA-G preparations. J Immunol, 192(2), 732-740. doi:10.4049/jimmunol.1301748
- 125 -
Le Rond, S., Azema, C., Krawice-Radanne, I., Durrbach, A., Guettier, C., Carosella, E. D., & Rouas-Freiss, N. (2006). Evidence to support the role of HLA-G5 in allograft acceptance through induction of immunosuppressive/ regulatory T cells. J Immunol, 176(5), 3266-3276. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16493088
LeBouder, F., Khoufache, K., Menier, C., Mandouri, Y., Keffous, M., Lejal, N., . . . Riteau, B. (2009). Immunosuppressive HLA-G molecule is upregulated in alveolar epithelial cells after influenza A virus infection. Hum Immunol, 70(12), 1016-1019. doi:10.1016/j.humimm.2009.07.026
Lee, N., Malacko, A. R., Ishitani, A., Chen, M. C., Bajorath, J., Marquardt, H., & Geraghty, D. E. (1995). The membrane-bound and soluble forms of HLA-G bind identical sets of endogenous peptides but differ with respect to TAP association. Immunity, 3(5), 591-600. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7584149
Lefebvre, S., Berrih-Aknin, S., Adrian, F., Moreau, P., Poea, S., Gourand, L., . . . Paul, P. (2001). A specific interferon (IFN)-stimulated response element of the distal HLA-G promoter binds IFN-regulatory factor 1 and mediates enhancement of this nonclassical class I gene by IFN-beta. J Biol Chem, 276(9), 6133-6139. doi:10.1074/jbc.M008496200
Lefranc, M. P., Duprat, E., Kaas, Q., Tranne, M., Thiriot, A., & Lefranc, G. (2005). IMGT unique numbering for MHC groove G-DOMAIN and MHC superfamily (MhcSF) G-LIKE-DOMAIN. Dev Comp Immunol, 29(11), 917-938. doi:10.1016/j.dci.2005.03.003
Leleu, X., Le Friec, G., Facon, T., Amiot, L., Fauchet, R., Hennache, B., . . . Intergroupe Francophone du, M. (2005). Total soluble HLA class I and soluble HLA-G in multiple myeloma and monoclonal gammopathy of undetermined significance. Clin Cancer Res, 11(20), 7297-7303. doi:10.1158/1078-0432.CCR-05-0456
LeMaoult, J., Caumartin, J., Daouya, M., Favier, B., Le Rond, S., Gonzalez, A., & Carosella, E. D. (2007). Immune regulation by pretenders: cell-to-cell transfers of HLA-G make effector T cells act as regulatory cells. Blood, 109(5), 2040-2048. doi:10.1182/blood-2006-05-024547
LeMaoult, J., Krawice-Radanne, I., Dausset, J., & Carosella, E. D. (2004). HLA-G1-expressing antigen-presenting cells induce immunosuppressive CD4+ T cells. Proc Natl Acad Sci U S A, 101(18), 7064-7069. doi:10.1073/pnas.0401922101
Liang, S., Baibakov, B., & Horuzsko, A. (2002). HLA-G inhibits the functions of murine dendritic cells via the PIR-B immune inhibitory receptor. European Journal of Immunology, 32(9), 2418-2426. doi:10.1002/1521-4141(200209)32:9<2418::AID-IMMU2418>3.0.CO;2-L
- 126 -
Liang, S., Ristich, V., Arase, H., Dausset, J., Carosella, E. D., & Horuzsko, A. (2008). Modulation of dendritic cell differentiation by HLA-G and ILT4 requires the IL-6--STAT3 signaling pathway. Proc Natl Acad Sci U S A, 105(24), 8357-8362. doi:10.1073/pnas.0803341105
Lila, N., Amrein, C., Guillemain, R., Chevalier, P., Latremouille, C., Fabiani, J. N., . . . Carpentier, A. (2002). Human leukocyte antigen-G expression after heart transplantation is associated with a reduced incidence of rejection. Circulation, 105(16), 1949-1954. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11997282
Lila, N., Carpentier, A., Amrein, C., Khalil-Daher, I., Dausset, J., & Carosella, E. D. (2000). Implication of HLA-G molecule in heart-graft acceptance. Lancet, 355(9221), 2138. doi:10.1016/S0140-6736(00)02386-2
Lin, A., Chen, H. X., Zhu, C. C., Zhang, X., Xu, H. H., Zhang, J. G., . . . Yan, W. H. (2010). Aberrant human leucocyte antigen-G expression and its clinical relevance in hepatocellular carcinoma. J Cell Mol Med, 14(8), 2162-2171. doi:10.1111/j.1582-4934.2009.00917.x
Ljunggren, H. G., & Karre, K. (1990). In search of the 'missing self': MHC molecules and NK cell recognition. Immunol Today, 11(7), 237-244. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/2201309
Lund, L. H., Edwards, L. B., Kucheryavaya, A. Y., Benden, C., Christie, J. D., Dipchand, A. I., . . . Lung, T. (2014). The registry of the International Society for Heart and Lung Transplantation: thirty-first official adult heart transplant report--2014; focus theme: retransplantation. J Heart Lung Transplant, 33(10), 996-1008. doi:10.1016/j.healun.2014.08.003
Luque, J., Torres, M. I., Aumente, M. D., Lozano, J. M., Garcia-Jurado, G., Gonzalez, R., . . . Pena, J. (2006). sHLA-G levels in the monitoring of immunosuppressive therapy and rejection following heart transplantation. Transpl Immunol, 17(1), 70-73. doi:10.1016/j.trim.2006.09.009
Mao, T. L., Kurman, R. J., Huang, C. C., Lin, M. C., & Shih Ie, M. (2007). Immunohistochemistry of choriocarcinoma: an aid in differential diagnosis and in elucidating pathogenesis. Am J Surg Pathol, 31(11), 1726-1732. doi:10.1097/PAS.0b013e318058a529
Martelli-Palomino, G., Pancotto, J. A., Muniz, Y. C., Mendes-Junior, C. T., Castelli, E. C., Massaro, J. D., . . . Donadi, E. A. (2013). Polymorphic sites at the 3' untranslated region of the HLA-G gene are associated with differential hla-g soluble levels in the Brazilian and French population. PLoS One, 8(10), e71742. doi:10.1371/journal.pone.0071742
- 127 -
McGiffin, D. C., Naftel, D. C., Kirklin, J. K., Morrow, W. R., Towbin, J., Shaddy, R., . . . Rossi, A. (1997). Predicting outcome after listing for heart transplantation in children: comparison of Kaplan-Meier and parametric competing risk analysis. Pediatric Heart Transplant Study Group. J Heart Lung Transplant, 16(7), 713-722. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9257253
Medawar, P. B. (1944). The behaviour and fate of skin autografts and skin homografts in rabbits: A report to the War Wounds Committee of the Medical Research Council. J Anat, 78(Pt 5), 176-199. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/17104960
Mehra, M. R., Crespo-Leiro, M. G., Dipchand, A., Ensminger, S. M., Hiemann, N. E., Kobashigawa, J. A., . . . Uber, P. A. (2010). International Society for Heart and Lung Transplantation working formulation of a standardized nomenclature for cardiac allograft vasculopathy-2010. J Heart Lung Transplant, 29(7), 717-727. doi:10.1016/j.healun.2010.05.017
Menier, C., Prevot, S., Carosella, E. D., & Rouas-Freiss, N. (2009). Human leukocyte antigen-G is expressed in advanced-stage ovarian carcinoma of high-grade histology. Hum Immunol, 70(12), 1006-1009. doi:10.1016/j.humimm.2009.07.021
Menier, C., Rabreau, M., Challier, J. C., Le Discorde, M., Carosella, E. D., & Rouas-Freiss, N. (2004). Erythroblasts secrete the nonclassical HLA-G molecule from primitive to definitive hematopoiesis. Blood, 104(10), 3153-3160. doi:10.1182/blood-2004-03-0809
Michaels, P. J., Espejo, M. L., Kobashigawa, J., Alejos, J. C., Burch, C., Takemoto, S., . . . Fishbein, M. C. (2003). Humoral rejection in cardiac transplantation: risk factors, hemodynamic consequences and relationship to transplant coronary artery disease. J Heart Lung Transplant, 22(1), 58-69. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12531414
Misra, M. K., Pandey, S. K., Kapoor, R., Sharma, R. K., Kapoor, R., Prakash, S., & Agrawal, S. (2014). HLA-G gene expression influenced at allelic level in association with end stage renal disease and acute allograft rejection. Hum Immunol, 75(8), 833-839. doi:10.1016/j.humimm.2014.06.005
Misra, M. K., Prakash, S., Kapoor, R., Pandey, S. K., Sharma, R. K., & Agrawal, S. (2013). Association of HLA-G promoter and 14-bp insertion-deletion variants with acute allograft rejection and end-stage renal disease. Tissue Antigens, 82(5), 317-326. doi:10.1111/tan.12210
Mociornita, A. G., Lim-Shon, J., Joseph, J. M., Ross, H. J., Rao, V., & Delgado, D. H. (2013). Can HLA-G polymorphisms predict the development of cardiac allograft vasculopathy? Hum Immunol, 74(4), 464-467. doi:10.1016/j.humimm.2012.12.014
- 128 -
Mociornita, A. G., Tumiati, L., Joseph, J. M., Grosman-Rimon, L., Ross, H. J., Delgado, D. H., & Vivek, R. (2011). Everolimus Induces Human Leukocyte Antigen-G Expression In Human Coronary Artery Smooth Muscle Cells: Impact on Graft Rejection and Cardiac Allograft Vasculopathy. Circulation, 124(21). Retrieved from <Go to ISI>://WOS:000299738705079
Mociornita, A. G., Tumiati, L. C., Papageorgiou, P. C., Grosman, L., Ghashghai, A., Ross, H. J., . . . Rao, V. (2013). Human Leukocyte Antigen-G Inhibits Human Coronary Artery Smooth Muscle Cell Proliferation. Journal of Heart and Lung Transplantation, 32(4), S298-S298. Retrieved from <Go to ISI>://WOS:000316712100828
Mociornita, A. G., Tumiati, L. C., Papageorgiou, P. C., Grosman-Rimon, L., Ghashghai, A., Ross, H. J., . . . Rao, V. (2013). Human Leukocyte Antigen-G Inhibits Neutrophil Adhesion to Coronary Artery Endothelial Cells Injured by Tumor Necrosis Factor Alpha. Journal of Heart and Lung Transplantation, 32(4), S300-S300. Retrieved from <Go to ISI>://WOS:000316712100835
Moreau, P., Adrian-Cabestre, F., Menier, C., Guiard, V., Gourand, L., Dausset, J., . . . Paul, P. (1999). IL-10 selectively induces HLA-G expression in human trophoblasts and monocytes. Int Immunol, 11(5), 803-811. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10330285
Moreau, P., Carosella, E., Gluckman, E., Gourand, L., Prost, S., Dausset, J., & Kirszenbaum, M. (1995). [Alternative transcripts of the MHC of the non-classical class I HLA-G gene in the in trophoblast during the first pregnancy trimester and in the placenta at term]. C R Acad Sci III, 318(8), 837-842. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7583772
Moreau, P., Flajollet, S., & Carosella, E. D. (2009). Non-classical transcriptional regulation of HLA-G: an update. J Cell Mol Med, 13(9B), 2973-2989. doi:10.1111/j.1582-4934.2009.00800.x
Moreau, P., Mouillot, G., Rousseau, P., Marcou, C., Dausset, J., & Carosella, E. D. (2003). HLA-G gene repression is reversed by demethylation. Proc Natl Acad Sci U S A, 100(3), 1191-1196. doi:10.1073/pnas.0337539100
Nagamatsu, T., Fujii, T., Yamashita, T., Miki, A., Kanai, T., Kusumi, M., . . . Taketani, Y. (2004). Hypoxia does not reduce HLA-G expression on extravillous cytotrophoblasts. Journal of Reproductive Immunology, 63(2), 85-95. doi:10.1016/j.jri.2004.07.001
Naji, A., Menier, C., Morandi, F., Agaugue, S., Maki, G., Ferretti, E., . . . Rouas-Freiss, N. (2014). Binding of HLA-G to ITIM-bearing Ig-like transcript 2 receptor suppresses B cell responses. J Immunol, 192(4), 1536-1546. doi:10.4049/jimmunol.1300438
- 129 -
Nath, D. S., Angaswamy, N., Basha, H. I., Phelan, D., Moazami, N., Ewald, G. A., & Mohanakumar, T. (2010). Donor-specific antibodies to human leukocyte antigens are associated with and precede antibodies to major histocompatibility complex class I-related chain A in antibody-mediated rejection and cardiac allograft vasculopathy after human cardiac transplantation. Hum Immunol, 71(12), 1191-1196. doi:10.1016/j.humimm.2010.09.012
Nicolae, D., Cox, N. J., Lester, L. A., Schneider, D., Tan, Z., Billstrand, C., . . . Ober, C. (2005). Fine mapping and positional candidate studies identify HLA-G as an asthma susceptibility gene on chromosome 6p21. American Journal of Human Genetics, 76(2), 349-357. doi:Doi 10.1086/427763
Ober, C., Aldrich, C. L., Chervoneva, I., Billstrand, C., Rahimov, F., Gray, H. L., & Hyslop, T. (2003). Variation in the HLA-G promoter region influences miscarriage rates. American Journal of Human Genetics, 72(6), 1425-1435. doi:10.1086/375501
Ober, C., Billstrand, C., Kuldanek, S., & Tan, Z. (2006). The miscarriage-associated HLA-G -725G allele influences transcription rates in JEG-3 cells. Hum Reprod, 21(7), 1743-1748. doi:10.1093/humrep/del036
Pankratz, S., Bittner, S., Herrmann, A. M., Schuhmann, M. K., Ruck, T., Meuth, S. G., & Wiendl, H. (2014). Human CD4+ HLA-G+ regulatory T cells are potent suppressors of graft-versus-host disease in vivo. FASEB J, 28(8), 3435-3445. doi:10.1096/fj.14-251074
Paul, P., Cabestre, F. A., Ibrahim, E. C., Lefebvre, S., Khalil-Daher, I., Vazeux, G., . . . Carosella, E. D. (2000). Identification of HLA-G7 as a new splice variant of the HLA-G mRNA and expression of soluble HLA-G5, -G6, and -G7 transcripts in human transfected cells. Hum Immunol, 61(11), 1138-1149. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11137219
Paul, P., Rouas-Freiss, N., Khalil-Daher, I., Moreau, P., Riteau, B., Le Gal, F. A., . . . Carosella, E. D. (1998). HLA-G expression in melanoma: a way for tumor cells to escape from immunosurveillance. Proc Natl Acad Sci U S A, 95(8), 4510-4515. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9539768
Pirri, A., Contieri, F. C., Benvenutti, R., & Bicalho Mda, G. (2009). A study of HLA-G polymorphism and linkage disequilibrium in renal transplant patients and their donors. Transpl Immunol, 20(3), 143-149. doi:10.1016/j.trim.2008.09.012
Pistoia, V., Morandi, F., Wang, X., & Ferrone, S. (2007). Soluble HLA-G: Are they clinically relevant? Seminars in Cancer Biology, 17(6), 469-479. doi:10.1016/j.semcancer.2007.07.004
- 130 -
Porto, I. O., Mendes-Junior, C. T., Felicio, L. P., Georg, R. C., Moreau, P., Donadi, E. A., . . . Castelli, E. C. (2015). MicroRNAs targeting the immunomodulatory HLA-G gene: a new survey searching for microRNAs with potential to regulate HLA-G. Mol Immunol, 65(2), 230-241. doi:10.1016/j.molimm.2015.01.030
Qiu, J., Terasaki, P. I., Miller, J., Mizutani, K., Cai, J., & Carosella, E. D. (2006). Soluble HLA-G expression and renal graft acceptance. Am J Transplant, 6(9), 2152-2156. doi:10.1111/j.1600-6143.2006.01417.x
Rajagopalan, S., & Long, E. O. (1999). A human histocompatibility leukocyte antigen (HLA)-G-specific receptor expressed on all natural killer cells. J Exp Med, 189(7), 1093-1100. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10190900
Ramzy, D., Rao, V., Brahm, J., Miriuka, S., Delgado, D., & Ross, H. J. (2005). Cardiac allograft vasculopathy: a review. Can J Surg, 48(4), 319-327. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16149368
Rebmann, V., da Silva Nardi, F., Wagner, B., & Horn, P. A. (2014). HLA-G as a tolerogenic molecule in transplantation and pregnancy. J Immunol Res, 2014, 297073. doi:10.1155/2014/297073
Rebmann, V., van der Ven, K., Passler, M., Pfeiffer, K., Krebs, D., & Grosse-Wilde, H. (2001). Association of soluble HLA-G plasma levels with HLA-G alleles. Tissue Antigens, 57(1), 15-21. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11169254
Rebmann, V., Wagner, S., & Grosse-Wilde, H. (2007). HLA-G expression in malignant melanoma. Seminars in Cancer Biology, 17(6), 422-429. doi:10.1016/j.semcancer.2007.06.010
Riteau, B., Menier, C., Khalil-Daher, I., Sedlik, C., Dausset, J., Rouas-Freiss, N., & Carosella, E. D. (1999). HLA-G inhibits the allogeneic proliferative response. Journal of Reproductive Immunology, 43(2), 203-211. doi:Doi 10.1016/S0165-0378(99)00034-0
Rizzo, R., Bortolotti, D., Ben Fredj, N., Rotola, A., Cura, F., Castellazzi, M., . . . Fainardi, E. (2012). Role of HLA-G 14bp deletion/insertion and +3142C > G polymorphisms in the production of sHLA-G molecules in relapsing-remitting multiple sclerosis. Human Immunology, 73(11), 1140-1146. doi:DOI 10.1016/j.humimm.2012.08.005
Rizzo, R., Fuzzi, B., Stignani, M., Criscuoli, L., Melchiorri, L., Dabizzi, S., . . . Baricordi, O. R. (2007). Soluble HLA-G molecules in follicular fluid: A tool for oocyte selection in IVF? Journal of Reproductive Immunology, 74(1-2), 133-142. doi:DOI 10.1016/j.jri.2007.02.005
- 131 -
Rizzo, R., Hviid, T. V., Govoni, M., Padovan, M., Rubini, M., Melchiorri, L., . . . Baricordi, O. R. (2008). HLA-G genotype and HLA-G expression in systemic lupus erythematosus: HLA-G as a putative susceptibility gene in systemic lupus erythematosus. Tissue Antigens, 71(6), 520-529. doi:10.1111/j.1399-0039.2008.01037.x
Rizzo, R., Hviid, T. V., Stignani, M., Balboni, A., Grappa, M. T., Melchiorri, L., & Baricordi, O. R. (2005). The HLA-G genotype is associated with IL-10 levels in activated PBMCs. Immunogenetics, 57(3-4), 172-181. doi:10.1007/s00251-005-0788-0
Rodriguez, E. R., Skojec, D. V., Tan, C. D., Zachary, A. A., Kasper, E. K., Conte, J. V., & Baldwin, W. M., 3rd. (2005). Antibody-mediated rejection in human cardiac allografts: evaluation of immunoglobulins and complement activation products C4d and C3d as markers. Am J Transplant, 5(11), 2778-2785. doi:10.1111/j.1600-6143.2005.01074.x
Roitt, I., Brostoff, J.,Male, D. (2001). Immunology: Harcourt Publishers Limited.
Rouas-Freiss, N., Goncalves, R. M., Menier, C., Dausset, J., & Carosella, E. D. (1997). Direct evidence to support the role of HLA-G in protecting the fetus from maternal uterine natural killer cytolysis. Proc Natl Acad Sci U S A, 94(21), 11520-11525. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9326642
RouasFreiss, N., Goncalves, R. M. B., Menier, C., Dausset, J., & Carosella, E. D. (1997). Direct evidence to support the role of HLA-G in protecting the fetus from maternal uterine natural killer cytolysis. Proceedings of the National Academy of Sciences of the United States of America, 94(21), 11520-11525. doi:DOI 10.1073/pnas.94.21.11520
Roussev, R. G., & Coulam, C. B. (2007). HLA-G and its role in implantation (review). J Assist Reprod Genet, 24(7), 288-295. doi:10.1007/s10815-007-9148-3
Sanders, S. K., Giblin, P. A., & Kavathas, P. (1991). Cell-cell adhesion mediated by CD8 and human histocompatibility leukocyte antigen G, a nonclassical major histocompatibility complex class 1 molecule on cytotrophoblasts. J Exp Med, 174(3), 737-740. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/1908512
Schuurman, H. J., Gmelig Meyling, F. H., Wijngaard, P. L., Van der Meulen, A., Slootweg, P. J., & Jambroes, G. (1989). Lymphocyte status in endomyocardial biopsies and blood after heart transplantation. J Pathol, 159(3), 197-203. doi:10.1002/path.1711590305
- 132 -
Sebti, Y., Le Friec, G., Pangault, C., Gros, F., Drenou, B., Guilloux, V., . . . Amiot, L. (2003). Soluble HLA-G molecules are increased in lymphoproliferative disorders. Hum Immunol, 64(11), 1093-1101. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/14602240
Selmani, Z., Naji, A., Zidi, I., Favier, B., Gaiffe, E., Obert, L., . . . Deschaseaux, F. (2008). Human leukocyte antigen-G5 secretion by human mesenchymal stem cells is required to suppress T lymphocyte and natural killer function and to induce CD4+CD25highFOXP3+ regulatory T cells. Stem Cells, 26(1), 212-222. doi:10.1634/stemcells.2007-0554
Shaikly, V. R., Morrison, I. E., Taranissi, M., Noble, C. V., Withey, A. D., Cherry, R. J., . . . Fernandez, N. (2008). Analysis of HLA-G in maternal plasma, follicular fluid, and preimplantation embryos reveal an asymmetric pattern of expression. J Immunol, 180(6), 4330-4337. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/18322247
Sheldon, S., Yonan, N. A., Aziz, T. N., Hasleton, P. S., Rahman, A. N., Deiraniya, A. K., . . . Dyer, P. A. (1999). The influence of histocompatibility on graft rejection and graft survival within a single center population of heart transplant recipients. Transplantation, 68(4), 515-519. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10480409
Sheshgiri, R., Gustafsson, F., Sheedy, J., Rao, V., Ross, H. J., & Delgado, D. H. (2009). Everolimus but not mycophenolate mofetil therapy is associated with soluble HLA-G expression in heart transplant patients. J Heart Lung Transplant, 28(11), 1193-1197. doi:10.1016/j.healun.2009.07.009
Sheshgiri, R., Rao, V., Mociornita, A., Ross, H. J., & Delgado, D. H. (2010). Association between HLA-G expression and C4d staining in cardiac transplantation. Transplantation, 89(4), 480-481. doi:10.1097/TP.0b013e3181ca88d5
Sheshgiri, R., Rao, V., Tumiati, L. C., Xiao, R., Prodger, J. L., Badiwala, M., . . . Delgado, D. H. (2008). Progesterone induces human leukocyte antigen-g expression in vascular endothelial and smooth muscle cells. Circulation, 118(14 Suppl), S58-64. doi:10.1161/CIRCULATIONAHA.107.757781
Sheshgiri, R., Rouas-Freiss, N., Rao, V., Butany, J., Ramzy, D., Krawice-Radanne, I., . . . Delgado, D. H. (2008). Myocardial HLA-G reliably indicates a low risk of acute cellular rejection in heart transplant recipients. J Heart Lung Transplant, 27(5), 522-527. doi:10.1016/j.healun.2008.02.004
Shiroishi, M., Kuroki, K., Ose, T., Rasubala, L., Shiratori, I., Arase, H., . . . Maenaka, K. (2006). Efficient leukocyte Ig-like receptor signaling and crystal structure of disulfide-linked HLA-G dimer. J Biol Chem, 281(15), 10439-10447. doi:10.1074/jbc.M512305200
- 133 -
Shiroishi, M., Kuroki, K., Rasubala, L., Tsumoto, K., Kumagai, I., Kurimoto, E., . . . Maenaka, K. (2006). Structural basis for recognition of the nonclassical MHC molecule HLA-G by the leukocyte Ig-like receptor B2 (LILRB2/LIR2/ILT4/CD85d). Proc Natl Acad Sci U S A, 103(44), 16412-16417. doi:10.1073/pnas.0605228103
Shiroishi, M., Tsumoto, K., Amano, K., Shirakihara, Y., Colonna, M., Braud, V. M., . . . Maenaka, K. (2003). Human inhibitory receptors Ig-like transcript 2 (ILT2) and ILT4 compete with CD8 for MHC class I binding and bind preferentially to HLA-G. Proc Natl Acad Sci U S A, 100(15), 8856-8861. doi:10.1073/pnas.1431057100
Soleimani, B., Lechler, R. I., Hornick, P. I., & George, A. J. (2006). Role of alloantibodies in the pathogenesis of graft arteriosclerosis in cardiac transplantation. Am J Transplant, 6(8), 1781-1785. doi:10.1111/j.1600-6143.2006.01401.x
Solier, C., Mallet, V., Lenfant, F., Bertrand, A., Huchenq, A., & Le Bouteiller, P. (2001). HLA-G unique promoter region: functional implications. Immunogenetics, 53(8), 617-625. doi:10.1007/s00251-001-0373-0
Stallone, G., Pontrelli, P., Infante, B., Gigante, M., Netti, G. S., Ranieri, E., . . . Gesualdo, L. (2014). Rapamycin induces ILT3(high)ILT4(high) dendritic cells promoting a new immunoregulatory pathway. Kidney Int, 85(4), 888-897. doi:10.1038/ki.2013.337
Stehlik, J., Edwards, L. B., Kucheryavaya, A. Y., Benden, C., Christie, J. D., Dipchand, A. I., . . . Lung, T. (2012). The Registry of the International Society for Heart and Lung Transplantation: 29th official adult heart transplant report--2012. J Heart Lung Transplant, 31(10), 1052-1064. doi:10.1016/j.healun.2012.08.002
Stewart, S., Winters, G. L., Fishbein, M. C., Tazelaar, H. D., Kobashigawa, J., Abrams, J., . . . Billingham, M. E. (2005). Revision of the 1990 working formulation for the standardization of nomenclature in the diagnosis of heart rejection. J Heart Lung Transplant, 24(11), 1710-1720. doi:10.1016/j.healun.2005.03.019
Suarez, M. B., Morales, P., Castro, M. J., Fernandez, V., Varela, P., Alvarez, M., . . . Arnaiz-Villena, A. (1997). A new HLA-G allele (HLA-G*0105N) and its distribution in the Spanish population. Immunogenetics, 45(6), 464-465. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9089111
Sun, L. L., Han, Y., Chen, J. H., & Yao, Y. Q. (2008). Down-regulation of HLA-G boosted natural killer cell-mediated cytolysis in JEG-3 cells cultured in vitro. Fertil Steril, 90(6), 2398-2405. doi:10.1016/j.fertnstert.2007.10.076
- 134 -
Tambur, A. R., Pamboukian, S. V., Costanzo, M. R., Herrera, N. D., Dunlap, S., Montpetit, M., & Heroux, A. (2005). The presence of HLA-directed antibodies after heart transplantation is associated with poor allograft outcome. Transplantation, 80(8), 1019-1025. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16278580
Tan, C. D., Sokos, G. G., Pidwell, D. J., Smedira, N. G., Gonzalez-Stawinski, G. V., Taylor, D. O., . . . Rodriguez, E. R. (2009). Correlation of donor-specific antibodies, complement and its regulators with graft dysfunction in cardiac antibody-mediated rejection. Am J Transplant, 9(9), 2075-2084. doi:10.1111/j.1600-6143.2009.02748.x
Tan, Z., Randall, G., Fan, J., Camoretti-Mercado, B., Brockman-Schneider, R., Pan, L., . . . Ober, C. (2007). Allele-specific targeting of microRNAs to HLA-G and risk of asthma. American Journal of Human Genetics, 81(4), 829-834. doi:Doi 10.1086/521200
Tan, Z., Shon, A. M., & Ober, C. (2005). Evidence of balancing selection at the HLA-G promoter region. Hum Mol Genet, 14(23), 3619-3628. doi:10.1093/hmg/ddi389
Taylor, D. O., Yowell, R. L., Kfoury, A. G., Hammond, E. H., & Renlund, D. G. (2000). Allograft coronary artery disease: clinical correlations with circulating anti-HLA antibodies and the immunohistopathologic pattern of vascular rejection. J Heart Lung Transplant, 19(6), 518-521. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10867330
Terasaki, P. I., Ozawa, M., & Castro, R. (2007). Four-year follow-up of a prospective trial of HLA and MICA antibodies on kidney graft survival. Am J Transplant, 7(2), 408-415. doi:10.1111/j.1600-6143.2006.01644.x
Townsend, A. R., & McMichael, A. J. (1985). Specificity of cytotoxic T lymphocytes stimulated with influenza virus. Studies in mice and humans. Prog Allergy, 36, 10-43. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/3881777
Toyoda, M., Galfayan, K., Galera, O. A., Petrosian, A., Czer, L. S., & Jordan, S. C. (1997). Cytomegalovirus infection induces anti-endothelial cell antibodies in cardiac and renal allograft recipients. Transpl Immunol, 5(2), 104-111. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9269032
Twito, T., Joseph, J., Mociornita, A., Rao, V., Ross, H., & Delgado, D. H. (2011). The 14-bp deletion in the HLA-G gene indicates a low risk for acute cellular rejection in heart transplant recipients. J Heart Lung Transplant, 30(7), 778-782. doi:10.1016/j.healun.2011.01.726
van den Elsen, P. J., Gobin, S. J. P., van Eggermond, M. C. J. A., & Peijnenburg, A. (1998). Regulation of MHC class I and II gene transcription: differences and
- 135 -
similarities. Immunogenetics, 48(3), 208-221. doi:DOI 10.1007/s002510050425
Veit, T. D., & Chies, J. A. (2009). Tolerance versus immune response -- microRNAs as important elements in the regulation of the HLA-G gene expression. Transpl Immunol, 20(4), 229-231. doi:10.1016/j.trim.2008.11.001
Wang, X., Jiang, W., & Zhang, D. (2013). Association of 14-bp insertion/deletion polymorphism of HLA-G gene with unexplained recurrent spontaneous abortion: a meta-analysis. Tissue Antigens, 81(2), 108-115. doi:10.1111/tan.12056
Wasowska, B. A. (2010). Mechanisms involved in antibody- and complement-mediated allograft rejection. Immunol Res, 47(1-3), 25-44. doi:10.1007/s12026-009-8136-3
Wehner, J., Morrell, C. N., Reynolds, T., Rodriguez, E. R., & Baldwin, W. M., 3rd. (2007). Antibody and complement in transplant vasculopathy. Circ Res, 100(2), 191-203. doi:10.1161/01.RES.0000255032.33661.88
Wisniewski, A., Bilinska, M., Klimczak, A., Wagner, M., Majorczyk, E., Nowak, I., . . . Kusnierczyk, P. (2010). Association of the HLA-G gene polymorphism with multiple sclerosis in a Polish population. Int J Immunogenet, 37(4), 307-311. doi:10.1111/j.1744-313X.2010.00926.x
Xiao, L., Zhou, W. Q., Shi, B. Y., Feng, K., He, X. Y., Wei, Y. X., . . . Xiao, W. (2013). HLA-G expression in the peripheral blood of live kidney transplant recipients. Chin Med J (Engl), 126(14), 2652-2655. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/23876890
Yan, W. H., Lin, A., Chen, B. G., & Chen, S. Y. (2009). Induction of both membrane-bound and soluble HLA-G expression in active human cytomegalovirus infection. J Infect Dis, 200(5), 820-826. doi:10.1086/604733
Yao, Y. Q., Barlow, D. H., & Sargent, I. L. (2005). Differential expression of alternatively spliced transcripts of HLA-G in human preimplantation embryos and inner cell masses. J Immunol, 175(12), 8379-8385. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16339579
Yie, S. M., Li, L. H., Li, Y. M., & Librach, C. (2004). HLA-G protein concentrations in maternal serum and placental tissue are decreased in preeclampsia. Am J Obstet Gynecol, 191(2), 525-529. doi:10.1016/j.ajog.2004.01.033
Yie, S. M., Li, L. H., Xiao, R., & Librach, C. L. (2008). A single base-pair mutation in the 3'-untranslated region of HLA-G mRNA is associated with pre-eclampsia. Molecular Human Reproduction, 14(11), 649-653. doi:DOI 10.1093/molehr/gan059
- 136 -
Yie, S. M., Xiao, R., & Librach, C. L. (2006). Progesterone regulates HLA-G gene expression through a novel progesterone response element. Hum Reprod, 21(10), 2538-2544. doi:10.1093/humrep/del126
Zhang, Q., Cecka, J. M., Gjertson, D. W., Ge, P., Rose, M. L., Patel, J. K., . . . Reed, E. F. (2011). HLA and MICA: targets of antibody-mediated rejection in heart transplantation. Transplantation, 91(10), 1153-1158. doi:10.1097/TP.0b013e3182157d60
- 137 -
Appendices Permission to Use Material From Copyright Owner: Figure 6, 5, 1 and 3:
Figure 2:
- 138 -
Figure 4:
Figure 8:
- 139 -
Figure 7 and 12: Dear Ms. Lazarte, You have my permission to use the material described below in your Master's thesis. Sincerely, Amelia Mociornita Sent from Yahoo Mail on Android
From: “Julieta Lazarte" <[email protected]> Date:Fri, Sep 25, 2015 at 1:26 PM Subject:Permision to Use Material From Copyright Owner Date: Friday September 25th, 2015 Re: Permission to Use Copyrighted Material in a Master’s Thesis Dear Ms. Mociornita, I am a University of Toronto graduate student completing my Master’s thesis entitled " Association of Human Leukocyte Antigen-G Polymorphisms and Clinical Outcomes Post-Transplantation”. My thesis will be available in full text on the internet for reference, study and / or copy. Except in situations where a thesis is under embargo or restriction, the electronic version will be accessible
- 140 -
through the U of T Libraries we pages, the Library’s web catalogue, and also through web search engines. I will also be granting Library and Archives Canada and Proquest/UMI a non-exclusive license to reproduce, loan, distribute, or sell single copies of my thesis by any means or any form or format. These rights will in no way restrict re-publication of the material in any other form by you or by others authorized by you. I would like permission to allow inclusion of the following material in my thesis: Figure 2 Mechanism of CAV. in Mociornita, A.G. (2013) thesis entitled: The Role of Human Leukocyte Antigen-G in Cardiac Allograft Vasculopathy. This material will be attributed through a citation. Please confirm in by email that these arrangements with your approval. Sincerely, Julieta Lazarte