Transcript
Page 1: AMA 2012 Post Awards Supplement

October 2012

Page 2: AMA 2012 Post Awards Supplement

Recognizing product and service excellence

in the manufacturing industry

It was a glittering gala dinner replete with fine wine, good food and soothing live music. And, of course, not forgetting the 31 awards that were

given out during the course of the evening of September 27 at the Asian Manufacturing Awards 2012.

Conceived back in January by the Manufacturing Group at business-to-business publishing group Contineo Media, the Asian Manufacturing Awards (AMA) was established to recognize those companies that are enabling excellence in manufacturing performance in the region through the provision of superior products, solutions and services.

The award categories themselves were selected to reflect the portfolio of publications within Contineo Media’s Manufacturing Group, namely Asia Food Journal, Control Engineering Asia, Logistics Insight Asia, Packaging Asia and PharmaAsia.

The awards process was based on companies being invited and encouraged to submit nominations for one or more relevant categories. The nominations were then analyzed and ranked by an independent judging panel in order to come up with a winner for each category.

And the 16 Asian Manufacturing Awards judges hailed from literally right across the world – Asia, Africa, Australia, Europe, and North America. As independent experts and practitioners, they were selected for their specific industry knowledge and ability to rigorously assess all the nominations received.

Asian Manufacturing Awards 2012Companies from the industrial automation, software, pharmaceutical, packaging, food & beverage, and logistics sectors were honored at the inaugural Asian Manufacturing Awards event in Singapore. Bob Gill reports.

Providing recognition

The evening began with a cocktail reception outside the ballroom of the Shangri-La Hotel in Singapore. As guests began to arrive after no doubt another busy day at work, the room was soon filled up with the sound of clinking glasses and lively chatter as familiar faces were recognized and new contacts made.

A special photo-wall backdrop proved a popular draw for guests to have their pictures taken with work colleagues as well as acquaintances across the various industries represented at the Awards.

“Good evening and a very warm welcome to the inaugural Asian Manufacturing Awards 2012,” said Contineo Media CEO Raymond Wong to the assembled guests now comfortably seated at their diner tables and all ready to find out which companies were about to be invited up on stage to receive each of the 31 awards on offer.

“Manufacturers today face constant pressure to ramp up productivity, improve quality, new regulatory requirements, demanding customer service standards, and still be socially and environmentally responsible members of their communities,” continued Wong.

“The mission of the Asian Manufacturing Awards is to provide recognition for the companies that provide industrial technology solutions and value-added services to enable these manufacturers to reach and sustain the required levels of world-class performance. Indeed, with Asia rapidly moving on from being a low-cost production center for the

West to a huge consumer market in its own right with increasing demands for everything from cars to frozen food and safe drugs, it is companies like the ones represented and recognized here tonight that are playing an increasingly important role in this transformation of the region’s manufacturing capabilities.”

Winning sentiments

There were nine awards up for grabs in the Control & Automation category. Among the winners: Cognex for Best Machine Vision Provider; Mitsubishi Electric Asia for Best Programmable Control Systems Provider; Emerson Process Management for Best Process Instrumentation Provider; Siemens for Best Process Safety Systems Provider; Yokogawa Engineering Asia for Best Process Control Systems Provider.

“Mitsubishi Electric Asia is very honored and encouraged to receive this award,” said director C H Tan. “We will continue to provide quality products and solutions to meet the growing demands of the market.”

Accepting the award for Siemens was Markus Lade, head of center of competence chemical, petrochemical, pharma, solar & glass, who noted, “The PCS 7 process safety system is a great product and I am happy that the judges share my opinion!”

Meanwhile, in his acceptance speech, Masatoshi Nakahara, managing director, Yokogawa Engineering Asia, lauded the company’s regional customers and employees. “I would like to express my sincere gratitude to all our customers

Page 3: AMA 2012 Post Awards Supplement

LOGISTICS & SUPPLY CHAINBest Third Party Logistics (3PL) ProviderAPL Logistics

Best Bar Code TechnologyDatamax-O’Neil

Best Material Handling Equipment ProviderSchaefer Systems InternationalPte Ltd

Best RFID TechnologyIntermec Technologies

Best Supply Chain SoftwareProviderJDA Software

CONTROL & AUTOMATIONBest Industrial Network ProviderPhoenix Contact (SEA) Pte Ltd

Best in Industrial WirelessBelden Singapore Pte Ltd

Best in Power Quality & ProtectionSchneider Electric

Best Machine Vision ProviderCognex Corporation

Best Programmable Control Systems ProviderMitsubishi Electric Asia Pte Ltd

Best Process Control Systems ProviderYokogawa Engineering Asia

Best Process Instrumentation ProviderEmerson Process ManagementAsia Pacific Pte Ltd

Best Process Safety Systems ProviderSiemens Pte Ltd

Best Robotics Provider Epson Southeast Asia

MANUFACTURING SOFTWAREBest CAD Systems ProviderDASSAULT SYSTEMES

Best CAM Systems ProviderSiemens PLM Software

Best ERP Systems Provider Epicor Software

Best PLM Systems ProviderSiemens PLM Software

FOOD & BEVERAGE INDUSTRYBest in Food Processing Equipment Urschel Asia Pacific Pte Ltd

Best in Food Safety Intralox L.L.C.

Innovative Food Ingredient Beneo Asia Pacific Pte Ltd

PACKAGING INDUSTRYInnovative Packaging Machinery MULTIVAC PTE LTD

Innovative Packaging DesignKrones AG

Innovative Packaging SolutionPAYNE

PHARMACEUTICAL INDUSTRYBest Healthcare Logistics Provider Korean Air Cargo

Best Pharma Clinical Trials Service ProviderICON Plc

Best Pharma Production Technology Provider Spraying Systems Co. (S) Pte Ltd

CORPORATE SOCIAL RESPONSIBILITYBest Energy Management TechnologyYokogawa Electric International

Best Solutions for SustainabilityAgility

Excellence in Human Resources National Instruments (S) Pte Ltd

EDITOR’S CHOICE AWARDBest Technology InnovationBeckhoff Automation

Recognizing product and service excellence

in the manufacturing industry

without whom this award would not have been possible. And I dedicate this award to the several thousand Yokogawa staff who serve our customers every day.”

In the Manufacturing Software category, Dassault Systemes and Siemens PLM Software were in the frame for three out of the four awards. Keith Tan, director, PLM value solutions – Asean, picked up a trophy for Dassault, which won out for Best CAD Systems Provider, with one of the judges citing its 3D Experience capability as “simply amazing”. And for Siemens PLM, Rajiv Ghatikar, vice president and general manager, Asean and Australasia, took to the stage twice to receive the honors for Best CAM Provider and Best PLM Provider.

The remaining award in this category, Best ERP Systems Provider, went to Epicor Software. In a statement after the event, Craig Charlton, senior vice president and general manager, Asia Pacific, said, “It is a great achievement to be recognized by an international panel of expert judges at the inaugural Asian Manufacturing Awards. Our innovative Next-Generation ERP software solution offers leading functionality for manufacturers across Asia. Epicor continues to invest in the region and we look forward to taking part in next year’s Asian Manufacturing Awards.”

Winners in the Logistics & Supply Chain segment included Schaefer Systems International for Best Material Handling Equipment Provider, and Intermec Technologies for Best RFID Technology.

“Schaefer’s philosophy is to help the industry take costs out of the supply chain. The introduction of integrated storage solutions serves to improve productivity and efficiency in the warehouse,” noted Brian Miles, managing director, Schaefer Systems International, in his acceptance speech.

And Intermec’s John Fogarasi, general manager, Asean, said: “We are very proud as Intermec Technologies to be able to provide rugged mobile solutions to the people who are delivering products and services to their customers.”

Notable winners in the Pharmaceuticals, Food & Beverage, Packaging category: Icon for Best Pharma Clinical Trials Service Provider; Intralox for Best in Food Safety; and Multivac for Innovative Packaging Machinery. For the latter award, Multivac was recognized for developing a novel machine concept for packing sensitive pharmaceutical and biotech products

Meanwhile, a special Editor’s Choice award for Best Technology Innovation recognized the XTS Extended Transport System, which was revealed by Beckhoff Automation at April’s Hannover Fair. The new drive system for machines is based on

a linear motor that is uniquely able to move in a circle. And combining the advantages of rotary and linear drives makes it possible to develop entirely new machine concepts.

“As a German company, we never believe in lowest cost. So we have to be good in technology,” said David Chia, managing director, Beckhoff Singapore, who collected the trophy.

After the final award of the evening, Best Solutions for Sustainability, which went to

Agility for its efforts in building greener supply chains for its customers, the music resumed. The sound of Dawn Ho’s jazzy vocals were soon mixed in with the cheersof congratulations and more lively interaction as the guests and staff of Contineo Media made the most of the final opportunity to mingle and finish off the fine red wine and salute the conclusion of a very successful inaugural Asian Manufacturing Awards.

Page 4: AMA 2012 Post Awards Supplement
Page 5: AMA 2012 Post Awards Supplement

WHATEVER YOU MAKE, MAKE IT RIGHT, WITH COGNEX VISION

For more information, please visit www.cognex.com.sg or email us at [email protected] and quote “AMA12”You can also call us at +65 6325 5708

BestMachine Vision

Provider

Recognizing product and service excellence

in the manufacturing industry

Page 6: AMA 2012 Post Awards Supplement

Recognizing product and service excellence

in the manufacturing industry

P: +65//6/68638636363 010101010 686868686E: [email protected]

www.ssi-schaefeefer-ar-asias .commmmm

AcAcAcAcAchihihihihiihihieving ggg gg gg efefefefefefeeffififificiccc eneee cycccc wittttttthhhhhh lolololooowewwwwww rrr rrrr costtttttInInnnInnttetetetetegrgrg atatededededdedd ssssssttotottt raragege sssssssolutuuutuu ioionsn cccaanaaaaa help takkkkekkk costttt t t t ouoououo t t t tt t t ffrfrf omomm yyyyyyour rr rrsusususuuuppppppppppp lylylylylyy ccccccchahaaaaaahaaininininnninnniinn. . . .. WiWiWiWithththth aaaaaaan efeeeeefee fefeectctctctiviiveee eeeee warehoussssse deeeesssisisisis gngngngngngngngn,, itititttt iimpmmpprrooroorovesssssssprppprprpprprprrprp ododoododucuucuccuucu tititivivivivivivivivitytytytytytyy and effffffff icieieieieiencncncncy yy ininininnn yyyyyyyyyoouooo r warehooooooususssuusususe.e.e...e CCCCCCCCCoononononono tatatatatatatatactctctt uuuus,s,s,,, weeeeeeewiwwiwiiwiiiw lllllllllll ssssssshohohooow wwwwww yoyoyoyou how wwwwww to bbbbbbbbececececeecomomomomommme ee ee faffafafafafaast, flexibleeee aaaaaaaaannndn efficient.

BestMaterial Handling

Equipment Provider

Page 7: AMA 2012 Post Awards Supplement

Recognizing product and service excellence

in the manufacturing industry

BestSolutions forSustainability


Top Related