![Page 1: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/1.jpg)
- 1 -
- CONTENTS -
Abbreviation ................................................................................................................... 4
Acknowledgements ......................................................................................................... 5
1 Introduction .............................................................................................................. 6
1.1 Progress Report II: Rational and Purposes ........................................................... 6
1.2 Background to the SMASSE INSET MALAWI ................................................... 7
2 Review Of The Activities Before Joint Workshop In April ............................ 10
2.1 Summary of Major Activities during Oct. 2002- Mar. 2003 .............................. 10
2.2 Outcome and Remaining Issues through the Activities
(Aug. 2002 – Dec. 2002) .................................................................................................... 12
2.2.1 Third Country Training Programme .................................................................. 12
2.2.2 The 1st Stakeholders’ Meeting ........................................................................... 13
2.2.3 Needs Assessment Study ................................................................................... 14
2.2.4 The 2nd Stakeholders’ Meeting .......................................................................... 14
2.3 Coordination in the Ministry on TOR (Jan. 2003 – Mar. 2003) ........................ 15
2.4 WSSD Follow-Up Meeting (Mar. 2003) ............................................................... 15
2.4.1 Observations ...................................................................................................... 16
2.4.2 Recommendations ............................................................................................. 17
3 National Trainers’ Training – Malawi-Kenya Joint Wo rkshop .................... 18
3.1. Workshop Objectives ............................................................................................. 18
3.2. Workshop Participants .......................................................................................... 18
3.3. Preliminary Presentation - Formal Curriculum Design in Malawi - ................ 20
3.3.1 Some Definitions of Curriculum ....................................................................... 20
3.3.2. Images of Curriculum ........................................................................................ 21
3.3.3. Cyclic and Dynamic Interaction Curriculum Development Models ................. 21
3.3.4. Malawian Curriculum Development Model ...................................................... 22
3.4. Principle of ASEI/PDSI Lesson ............................................................................. 23
3.5. Lesson Presentations .............................................................................................. 29
3.5.1. Mathematics Lesson Presentation from Malawi ............................................... 29
3.5.2. Mathematics Lesson Presentation from Kenya ................................................. 33
![Page 2: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/2.jpg)
- 2 -
3.5.3. Biology Lesson Presentation from Malawi ....................................................... 35
3.5.4. Biology Lesson Presentation from Kenya ......................................................... 38
3.5.5. Chemistry Lesson Presentation from Kenya ..................................................... 45
3.5.6. Physics Lesson Presentation from Kenya .......................................................... 47
3.5.7. Integrated Science Lesson Presentation from Malawi ...................................... 53
3.5.8. Biotechnology Lesson Presentation from Malawi............................................. 55
3.5.9. Human Ecology Lesson Presentation from Malawi .......................................... 57
3.5.10. Physical Science Lesson Presentation from Malawi ......................................... 61
3.6. Secondary School Visit........................................................................................... 63
3.6.1. Songani CDSS ...................................................................................................... 63
3.6.2. Saint Mary’s Secondary School ........................................................................ 65
3.7. Major Issues in INSET Curriculum Development for Malawi.......................... 67
3.8. Action Plan for the Next Stage .............................................................................. 70
4 ACHIVEMENTS AND ISSUES THROUGH THE JOINT WORKSHOP W ITH
KENYA .......................................................................................................................... 72
4.1. ACHIEVEMENTS .................................................................................................... 72
4.1.1. Common Consensus for Sustainable Development .............................................. 72
4.1.2. Formulation of the Structure for SMASSE Activities .......................................... 72
4.1.3. Budget Securing .................................................................................................... 73
4.1.4. Involvement of Secondary Teachers ..................................................................... 73
4.1.5. Collaboration with CIDA SSTEP Project ............................................................. 74
4.1.6. Restructuring Domasi College of Education ........................................................ 74
4.2. Issues ........................................................................................................................... 75
4.2.1. When will Restructuring Be Done? ...................................................................... 75
4.2.2. Is the Restructuring DCE a Panacea for Filling the Gap? .................................... 75
4.2.3. How Much will really be Disbursed for INSET Activities? ................................. 75
4.2.4. How Can the Continuity Maintain at the Policy Level? ....................................... 75
5 SMASSE INSET MALAWI AND ITS FUTURE ............................................ 76
5.1. Scope of Technical Assistance .................................................................................. 76
5.2. Proposals for Technical Cooperation–Minimum Requirement But Wider
Approach- ......................................................................................................................... 77
5.2.1. Supports to Education Sector by Other Development Partners ............................ 77
![Page 3: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/3.jpg)
- 3 -
5.2.2. Issues of Supporting Education Sector ................................................................. 78
5.2.3. Supports to Education Sector by Japan ................................................................. 80
5.2.4. Proposed Schedule for Transforming into Programme-Based Support ................ 83
5.3. Outline of the Proposed Programme ....................................................................... 85
5.3.1. Component 1 – SMASSE INSET Malawi – ......................................................... 85
5.3.2. Component 2 – Administrative Capacity Building in Education – ...................... 88
<Table & Figure>
Table 1: Summary of Major Activities during Oct. 2002-March 2003 ....................... 10
Table 2: National Trainers’ Training Malawi-Kenya Joint Workshop Participants ............ 19
Table 3: Curriculum Development Model ............................................. 21
Table 4: Action Plan for Trial INSET ................................................ 71
Table 5: Comparative table of BLA and TCP .......................................... 76
Table 6: Budget Allocation for each sub-sector ........................................ 78
Table 7: Proposed Time Schedule for Transforming into Programme-based Support ......... 83
Table 8: Assessment of each Scenario ................................................ 84
Figure 1: Main Activities and their Objectives ......................................... 11
Figure 2: Curriculum Development Flow Chart adapted from (Kaperemera, 1990) ............ 22
Figure 3: Effects of ASEI & PDSI ................................................... 24
Figure 4: Concept of Programme Support to Education Sector in Malawi ................... 81
![Page 4: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/4.jpg)
- 4 -
AABBBBRREEVVII AATTII OONN
AfDB African Development Bank
ASEI Activity, Student-centred, Experiment and Improvisation)
BLA Budget for Promoting Local Activities
CDSS Community Day Secondary Schools
CIDA Canada International Development Agency
DECs Distance Education Centres
DEPs District Education Plans
DFID Department for International Development
DTED Department of Teacher Education and Development
EMAS Education Methods Advisory Services
FPE Free Primary Education
GTZ Gesellschaft Technischer Zussammenarbeit
INSET In-Service Education and Training
JICA Japan International Cooperation Agency
KSTC Kenya Science Teachers’ College
MoEST Ministry of Education, Science and Technology, Malawi
MPRSP Malawi Poverty Reduction Strategy Paper
OPC Office for Presidency and Cabinet
PIF Policy Investment and Framework
PS Permanent Secretary
SMASSE Strengthening Mathematics and Science in Secondary
Education
SMASSE-ECSA Strengthening Mathematics and Science in Secondary
Education – Eastern, Central and Southern Africa
SMASSE-WECSA Strengthening Mathematics and Science in Secondary
Education -Western, Eastern, Central and Southern Africa
SSTEP Secondary School Teacher Education Project
SWAp Sector Wide Approaches
TCP Technical Cooperation Project
TOR Terms of References
TOT Trainers of Training
UNFPA United Nations Population Fund
![Page 5: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/5.jpg)
- 5 -
UNICEF United Nations Children’s Fund
USAID United States Agency for International Development
WB World Bank
WSSD World Summit for Sustainable Development
AACCKKNNOOWWLLEEDDGGEEMMEENNTTSS
We would like to thank the Government of Malawi, through the Ministry of Education,
Science and Technology (MoEST) for the support rendered to SMASSE activities in
Malawi.
We also sincerely thank JICA-Malawi for the moral, material and financial support
rendered to us throughout previous SMASSE activities until now. In particular, we are
grateful to Mrs. K. Yamamoto, Senior Volunteer (Domasi College of Education) and Mr. S.
Nkoka, Aid Coordinator, (JICA-Malawi),
We also feel equally indebted to JICA-Kenya and SMASSE-Kenya for the technical
advice rendered to us before and during the Trainers of Trainers workshop.
We would like to thank Management of Domasi College of Education for accepting to
conduct SMASSE activities at DCE. To all Faculty of Science members, especially, Mr.
Chimenya and Mr. Phaundi Shonga for their dedicated support, we are grateful for
professionally conducting themselves during the workshop.
We are also very thankful to Management of the South East Education Division (SEED)
and the five schools within, namely, Zomba Catholic, Saint Mary’s, Mulunguzi, Likangala
and Malosa for accepting to release their teachers who are part of the Trainers of Trainers in
this pilot project.
Yoshihito NAKAYAMA
Education Planning Adviser
Ministry of Education, Science and Technology, Malawi /Japan International Cooperation Agency
![Page 6: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/6.jpg)
- 6 -
11111111 IIIIIIIINNNNNNNNTTTTTTTTRRRRRRRROOOOOOOODDDDDDDDUUUUUUUUCCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN
1.1 Progress Report II: Rational and Purposes
Since mid 1990s, we have witnessed that the phrase of “capacity building for sustainable
development” obtains the civil right among all development partners who are involved in
social and economic development in Africa. One of the trials to realise this development
goal is the Pilot Programme for establishment of SMASSE INSET Malawi. This is a
preliminary stage in order to launch and institutionalise the system in which the sustainable
in-service training system for secondary teachers, especially strengthening mathematics and
science subjects in Malawi will be established. Main activities have started in 2002 followed
by conceptualisation and planning of the programme.
The report titled “SMASSE INSET Malawi Pilot Project – its position and possibility –”
and the PROGRESS REPORT I were published in December 2002 and in February 2003
respectively. The former report shows the situation analysis in secondary education and
development after looking at the overview of education sector in Malawi and proposes
programme-typed technical cooperation by JICA to support the institutionalisation of
in-service training system for secondary education. The latter contributes to demonstrate the
results of the 1st Needs Assessment Survey, the 1st and 2nd Stakeholders’ Meeting conducted
during October to December 2002. Although part of the programme design has already
proposed in the above two reports, reviewing the past activities and re-conceptualising the
programme schedule or input for the effective management are surely worthwhile. Therefore,
the rationales of this PROGRESS REPORT II are to:
![Page 7: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/7.jpg)
- 7 -
� Review main activities between August and December 2002 to understand their
outcomes and impact on the programme;
� Report the “Malawi-Kenya Joint Workshop for National INSET Trainers of Trainers”
conducted in March/April 2003 at Domasi College of Education;
� Re-conceptualise SMASSE INSET Malawi Pilot Programme by process and
management resource analysis; and
� Recommend appropriate remedial action for the programme components for the way
forward.
1.2 Background to the SMASSE INSET MALAWI
In February 2000, the SMASSE Kenya Team conducted a regional study in Tanzania,
Malawi and Zambia to see the possibility of regional cooperation targeting on the capacity
building for science and mathematics education at secondary level. As outputs through this
study, the dissemination of experiences of SMASSE Kenya towards other neighbouring
countries by combination of the third country counterpart training and in-country training
was proposed in the mid-/long-term support. In August same year, JICA Education
Planning Adviser, two officers from the Ministry (Principal Education Methods Adviser in
the Headquarter and Senior Education Methods Adviser in South East Education Divisional
Office) and the Head of Science Faculty at Domasi College of Education participated in the
2nd National SMASSE INSET to learn SMASSE activities in Kenya.
In February of the following year, 2001, the 1st SMASSE-ECSA Regional Conference
was held in Nairobi in which 11 countries1 were invited to discuss about the issues that each
1 11 countries are Kenya, Uganda, Lesotho, Malawi, Mozambique, Rwanda, South Africa, Swaziland, Tanzania, Zambia and Zimbabwe.
Delegates at the 2nd Regional conference in June 2002, changed the name of the Association from SMASSE-ECSA to SMASSE-WECSA,
(Strengthening Mathematics and Science in Secondary Education in Western, Eastern, Central, And Southern Africa), to reflect the
inclusion of Ghana representing West Africa.
![Page 8: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/8.jpg)
- 8 -
country was facing in secondary education. At the end of the conference, it was agreed to
formulate the regional network to elaborate the cooperation to improve secondary education,
especially, mathematics and science.
On the process of discussions for the regional cooperation with SMASSE Kenya, it was
proposed that in Malawi, from the aspects of the necessity for urgent supports with
immediate effectiveness and efficiency, establishing sustainable INSET system collaborated
with the experience and know-how of SMASSE Kenya project but it would be applied in the
context of Malawi’s conditions of existing teacher training system, contents of INSET and
needs for training was assessed as effective. With this appraisal, the JICA Education
Planning Adviser in Malawi visited the 3rd SMASSE National INSET in August 2001 to
make plan for the Kenya-Malawi Joint SMASSE Workshop for the sensitisation of
SMASSE approach to Malawi counterparts.
In January 2002, Kenya-Malawi Joint SMASSE Workshop was organised at Domasi
College of Education in which ASEI (Activity, Student-centred, Experiment and
Improvisation) approach, the features of SMASSE teaching methodology, was demonstrated
in Malawi for the fist time. Through this workshop, the importance and necessity to
establish SMASSE-typed INSET were addressed and be shared among the Malawian
counterparts. And March of the same year, the overall action plan to support in-service
training system for secondary mathematics and science education in Malawi with special
emphasis on regional cooperation was formulated under the tripartite agreement among
Kenya Science Teachers’ College (KSTC: the implementing organisation of SMASSE
Kenya), JICA Malawi and JICA Kenya Office. Based on this tripartite agreement, between
August and November 2003, two counterparts from Malawi (Mrs. Soko, Principle Education
![Page 9: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/9.jpg)
- 9 -
Methods Adviser and Mrs. Sineta, Senior Education Methods Adviser2) were participated in
the 4th SMASSE NATIONAL INSET and the 2nd SMASSE DISTRICT INSET in Kenya in
order to learn INSET management skills such as planning, implementing, monitoring,
evaluating and financial management. With these counterparts, JICA Education Planning
Adviser based on Lilongwe and Science Education Adviser in Domasi, Malawi visited
Nairobi to make detailed schedule and action plan based on the original made in March.
Having followed the action plan, stakeholders’ meeting and needs assessment survey were
conducted in 2002.
2 Job titles for two counterparts are as of August 2003.
![Page 10: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/10.jpg)
- 10 -
22222222 RRRRRRRREEEEEEEEVVVVVVVVIIIIIIIIEEEEEEEEWWWWWWWW OOOOOOOOFFFFFFFF TTTTTTTTHHHHHHHHEEEEEEEE AAAAAAAACCCCCCCCTTTTTTTTIIIIIIIIVVVVVVVVIIIIIIIITTTTTTTTIIIIIIIIEEEEEEEESSSSSSSS BBBBBBBBEEEEEEEEFFFFFFFFOOOOOOOORRRRRRRREEEEEEEE JJJJJJJJOOOOOOOOIIIIIIIINNNNNNNNTTTTTTTT WWWWWWWWOOOOOOOORRRRRRRRKKKKKKKKSSSSSSSSHHHHHHHHOOOOOOOOPPPPPPPP IIIIIIIINNNNNNNN
AAAAAAAAPPPPPPPPRRRRRRRRIIIIIIIILLLLLLLL
2.1 Summary of Major Activities during Aug. 2002- Mar. 2003
Since the tripartite agreement was exchanged in March 2002 for the promotion of
regional cooperation to support SMASSE INSET Malawi, several activities have been
conducted. The table and figure below summarises main activities and their objectives
during August 2002 and March 2003.
Table 1: Summary of Major Activities during Oct. 2002-March 2003
Year/Month
Activities
2002 2003
8 9 10 11 12 1 2 3 4
1 Third Country Training Programme
2 The 1st Stakeholders’ Meeting ★
3 Needs Assessment Study
4 The 2nd Stakeholders’ Meeting ★
5 Coordination in the Ministry on TOR (especially with the New SEST)
6 WSSD Follow-up Meeting ★
7 National Trainers’ Training (Malawi-Kenya Joint Workshop)
![Page 11: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/11.jpg)
- 11 -
Figure 1: Main Activities and their Objectives
COORDINATION IN THE MINISTRY ON TOR: January – April 2003
<Objectives> - Revise the TOR originally made in October 2002 to be approved by the Ministry - Identify the list of members of steering committee and technical committee for the programme
Activity 5
THE 2nd STAKEHOLDERS’ MEETING: 7 December 2002
<Objectives> - Receive and discuss a report on the Needs Assessment Survey for the pilot project (baseline
study data) and suggest the way forward - Approve ToRs and working schedule for the INSET programme for each stakeholder - Formulate the Steering and Technical committee for the project
Activity 4
NEEDS ASSESSMENT STUDY:
21-25 October, 4-8 November, 23 November-6 December 2002
<Objectives> - Identify the issues of teaching and learning science and mathematics in secondary education; - Identify difficult areas/topics in science and mathematics that need to strengthen/improve
teaching and learning methodology through INSET - Study on relevance between study purposes for each topics and their teaching methodology;
Activity 3
THE 1st STAKEHOLDERS’ MEETING: 24 October 2002
<Objectives> - Sensitise stakeholders on the need for INSET provision and the INSET Pilot project in SEED; - Build the common consensus about the roles of each stakeholder in the INSET pilot phase; - Introduce the need for cost sharing during INSET activities; - Develop a sustainable model for the institutionalisation and regularization of the SMASSE
INSET in Malawi.
Activity 2
THIRD COUNTRY TRAINING PROGRAMME: 11 August – 7 November 2002
<Objectives> - Upgrade knowledge and capability in the management of In-service training and apply the
same to actual educational situations in Malawi.
Activity 1
![Page 12: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/12.jpg)
- 12 -
2.2 Outcome and Remaining Issues through the Activities
(Aug. 2002 – Dec. 2002)
As Figure 1 shows, we have actively preceded several activities to support the
institutionalisation of INSET for secondary education, especially for Mathematics and
Science in Malawi. The followings are summaries of outcomes and remaining issues
through them.
2.2.1 Third Country Training Programme
<Outcome>
� Two ministry officers, one is working for the headquarter and the other is for divisional
education office, were trained in INSET management and became core facilitators of
the programme;
� Questionnaires for Needs Assessment Study was developed as the output of training;
� The draft of Action Plan was made.
NATIONAL TRAINERS’ TRAINING – MALAWI-KENYA JOINT WO RKSHOP –
30 March – 4 April 2003
<Objectives> - Receive and discuss a report on the Needs Assessment Survey for the pilot project (baseline
study data) and suggest the way forward - Approve TORs and working schedule for the INSET programme for each stakeholder - Formulate the Steering and Technical committee for the project
Activity 7
WSSD FOLLOW-UP MEETING: 30 March – 4 April 2003
<Objectives> - Receive and discuss a report on the Needs Assessment Survey for the pilot project (baseline
study data) and suggest the way forward - Approve ToRs and working schedule for the INSET programme for each stakeholder - Formulate the Steering and Technical committee for the project
Activity 6
![Page 13: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/13.jpg)
- 13 -
<Issues>
� Although the counterparts who participated training programme could obtain the
knowledge of INSET management, the impact through their job positions (Principal and
Senior Education Methods Adviser) were not strong enough to influence the dicision
making process in the Ministry;
� Building the common consensus on policy for INSET programme in the Ministry is
identified crutial matter for making progress of the programme;
� Having compared with the the case of SMASSE Kenya, the capacity at Domasi College
of Edcuation has been facing less full-time staff beloging to INSET programme only;
� A colaboration with other development partners, especially CIDA which has been
conducting SSTEP project at Domasi College of Education is still under discussion.
2.2.2 The 1st Stakeholders’ Meeting
<Outcome>
� The key principle of SMASSE INSET Malawi and basic policy to support from JICA
were formally informed and sensitized to the
� Four key areas, 1) financial, 2) management and organization, 3) INSET policy, and 4)
participation, were identified and recommendations were set; (each are listed in
<Issues> below);
<Issues>
� MoEST needs to prepare SMASSE-INSET budget and incorporate it into the National
Budget;
� The way of cost sharing between the school level, divisional level and the ministry level
is still unclear;
� The resistance based on ‘allowance syndrome’ is still not overcome;
� The perspective of INSET is not decided yet, in other words, how extend this
programme can be targeting, only mathematics and science or covering all other
subjects is not clear;
� Strengthening the network system with other stakeholders is necessary.
![Page 14: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/14.jpg)
- 14 -
2.2.3 Needs Assessment Study
<Outcome>
� Staffs of Domasi College of Education (DCE) were given a research opportunity so that
it strengthened their research ability;
� By inviting counterparts from SMASSE Kenya to support data analysis, the regional
cooperation was promoted;
The following baseline data was collected;
� General information such as teacher qualification, experience, specialization and
subjects actually teaching;
� Teachers’ and students’ attitude in Mathematics and Sciences towards new curriculum,
assessment and teaching methodology;
� Topics that teachers and students find difficult;
� The factors which make students like/dislike Mathematics and Sciences;
� Possible ways of improving performance in Mathematics and Science.
<Issues>
� Although the data collected was good as the first study, it was not enough to support the
development of INSET curriculum so that the futher study is prerequisit for the next
step;
� Analytical tools and a logical framework need to be improved;
2.2.4 The 2nd Stakeholders’ Meeting
<Outcome>
� The identified issues of mathematics and science in secondary education through Needs
Assessment Study were reported and shared with stakeholders;
� Through the discussion among stakeholders on the draft of Terms of References (TOR)
(See Annex 1) in which overall programme design was specified, a sense of ownership
and commitment were promoted;
<Issues>
� The draft of TOR was not approved and constituted by stakeholders due to the lack of
authority to commit issues at policy level;
![Page 15: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/15.jpg)
- 15 -
2.3 Coordination in the Ministry on TOR (Jan. 2003 – Mar. 2003)
The Ministry welcomed the new Secretary of Education, Science and Technology
(SEST), Mr. Zanga Chikhosi, in December 2002 just after the Joint Sector Review Meeting.
His former serving organisation was Ministry of Agriculture so that during the period
between January and March was spent to discuss about the situations and challenges,
especially on mathematics and science education with Mr. Chikhosi to share ideas and views
for the mutual cooperation.
The Ministry understands that the improvement of the quality in secondary education is
crucial matter for the effective development of human resources and moreover the
enhancement of mathematics and science ability is expected to be a key factor to attain
economic development. We have reached common understandings, overall framework of
the strategy for the way forward. Mr. Chikhosi took initiatives to review and revise the
original TOR for the SMASSE INSET Malawi programme (See Annex 2). Based on the
discussions with the Ministry, the Steering Committee is expected to be held by the
initiative of the Ministry.
2.4 WSSD Follow-Up Meeting (Mar. 2003)
During the World Summit for Sustainable Development (WSSD) held in 2002 in
South Africa, JICA registered “Capacity Development for Mathematics and Science
Education in Africa” with the United Nations (UN) under type 2 initiative. Under this
initiative, JICA tries to seek for strengthening and expanding the SMASSE-WECSA
association.
![Page 16: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/16.jpg)
- 16 -
As a follow up to WSSD, the SMASSE-WECSA Secretariat in Nairobi Kenya
organised a conference in order to chart out the way forward. The conference’s theme was
strengthening and expanding the Network for “Enhancement of Mathematics and Science
Education in Africa”. The main objectives of the conference were for;
� consensus building between SMASSE-WECSA member countries and JICA on the
activities of the association
� drawing an action plan for the activities
� identifying strategies to achieve the targets.
Malawi, as one of the founders and members of the association was invited to attend
the conference in addition to 10 other countries. Two officers from the Ministry, Mr. R.
Agabu (Deputy Director of Education Methods Advisory Services: EMAS) and Mr. A.
Mwanza (Deputy Principal of Domasi College of Education) attended the conference. The
summary of their observations and recommendations submitted to the Ministry are as
follows.
2.4.1 Observations
� The team observed that the 11 African countries represented at the conference
worked as a team and very hard towards a common goal.
� The Japanese counterparts also worked very hard and cooperatively throughout the
conference deliberations.
� Among the 11 countries, Malawi was rated as one the few countries implementing
most of the recommendations of the two regional conferences.
� Malawi has not yet paid its membership fees: Registration fee of US $100 and an
annual subscription fee of US $300. The deadline was by December, 2002.
� The SMASSE-WECSA/JICA five-year work plan formulated at the conference was
realistic, achievable and a step towards improving the quality of Maths and Science
Education in Africa.
![Page 17: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/17.jpg)
- 17 -
� Ghana would be hosting the 2003 Regional SMASSE-WECSA conference in June.
All identified participants will be sponsored by SMASSE-WECSA secretariat.
� Malawi may be hosting the 2004 Regional SMASSE-WECSA conference.
� In-service training of teachers (INSET) is vital tool in a world undergoing rapid
changes and developments. Malawi’s efforts towards establishing an INSET system
for secondary education were commended.
� A joint meeting/workshop between Domasi College of Education and
SMASSE-WECSA Secretariat to design the curriculum for the pilot INSET system
has been scheduled for March 30-April 4, 2003.
� Some activities identified for the SMASSE-WECSA/JICA cooperation work plan
will be supported by either the SMASSE-WECSA or in-country JICA offices.
2.4.2 Recommendations
The team recommends that:
� Malawi’s membership to the regional body is considered as another way forward
towards improving the quality of maths and science education at secondary level.
� Malawi, through MoEST, quickly develops a five-year work plan to fit into the
SMASSE-WECSA/JICA operational plan, which was adopted at the conference.
� Malawi, one of the founding members of the association, quickly pays both the
registration and annual subscription fees now totalling US $400.
� Malawi continues working very hard towards institutionalising and regularizing
INSET for Maths and Science (The SMASSE Chapter in Malawi).
� Malawi prepares fully for the 2003 Regional SMASSE-WECSA conference to be
held in Ghana.
� MoEST –Malawi and DCE prepare fully for the joint DCE/SMASSE-WECSA
workshop.
� MoEST/DCE to take advantage of the available/pledged support by JICA-Malawi
office.
![Page 18: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/18.jpg)
- 18 -
33333333 NNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL TTTTTTTTRRRRRRRRAAAAAAAAIIIIIIIINNNNNNNNEEEEEEEERRRRRRRRSSSSSSSS ’’’’’’’’ TTTTTTTTRRRRRRRRAAAAAAAAIIIIIIIINNNNNNNNIIIIIIIINNNNNNNNGGGGGGGG –––––––– MMMMMMMMAAAAAAAALLLLLLLLAAAAAAAAWWWWWWWWIIIIIIII--------KKKKKKKKEEEEEEEENNNNNNNNYYYYYYYYAAAAAAAA JJJJJJJJOOOOOOOOIIIIIIIINNNNNNNNTTTTTTTT
WWWWWWWWOOOOOOOORRRRRRRRKKKKKKKKSSSSSSSSHHHHHHHHOOOOOOOOPPPPPPPP
Between 30 March and 4 April 2003, the National Trainers’ Training Workshop with
SMASSE Kenya Team was held at Domasi College of Education (DCE). This was the
second joint workshop that both Malawian and Kenyan Team gathered to expose their
teaching methodologies in mathematics and science. Moreover, this joint workshop had
been taken for not only “continuous workshop to promote mutual relationships with Kenya”
but also “the opportunity to appraise the REAL OWNERSHIP to precede SMASSE INSET
Malawi”.
3.1. Workshop Objectives
Objectives of the workshop were;
� To sensitise and practice ASEI/PDSI based lessons among core trainers in Malawi;
� To exchange teaching methodologies between Malawi and Kenya;
� To develop a draft curriculum for INSET for prioritised topics as identified from the
needs assessment survey for each subject;
� To train Malawian core trainers of trainers in INSET curriculum development.
3.2. Workshop Participants
Workshop participants were from Malawi and Kenya. The Malawian team comprised of
lecturers from the Faculty of Science, Domasi College of Education, Mathematics and
Science teachers from schools in the South East Education Division, Ministry of Education
![Page 19: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/19.jpg)
- 19 -
Science and Technology MoEST) representatives and Field Supervisors for the Secondary
School Teacher Education Project (SSTEP). Table 2 below were detailed.
Table 2: National Trainers’ Training Malawi-Kenya Joint Workshop Participants
Kenyan Team Mr. Bernard Njuguna Head, SMASSE INSET Unit, KSTC Mr. Michael Waititu Subject Administrator, Physics Dpt,
SMASSE Mrs. Peula Lelei Subject Administrator, Biology Dpt,
SMASSE Mr. Ndelela Masoka National Trainer, Chemistry Dpt, SMASSE Mr. John Muiruri National Trainer, Mathematics Dpt,
SMASSE Mr. Tomoki Tokuda JICA expert, Mathetica Dpt, SMASSE Malawian Team Mr. M.C. Chimenya Biology DCE Mr. P.R.F. Phwetekere Biology Zomba Catholic Mr. Sanudi Biology DCE Mr. Macocho Biology DCE Mr. P. Shonga P/Science DCE Ms. K. Yamamoto P/Science DCE Mrs. E. Meke HEC DCE Mr. W. Navicha HEC DCE Mrs. A Kayuni HEC Likangala Mrs. Kamala HEC St. Mary’s Mr. M. January Maths DCE Mr. S. Mkandawire Maths DCE Mr. A. Msekandiana Maths St. Mary’s Mrs. C. Soko Maths MoEST Mr. G. Chikwezga Sce/Tech DCE Mr. E. Kuzemba Sce/Tech Mulunguzi Mr. P. Ndolo Sce/Tech Malosa Mr. C. Mataya-Phili CIDA SSTEP Project Field Supervisor Mr. R.S.K Vakusi CIDA SSTEP Project Field Supervisor Mr. I.K. Lisimba CIDA SSTEP Project Field Supervisor Mrs. C. Ziba CIDA SSTEP Project Field Supervisor Mrs. Sineta PEMA South East Division Office
![Page 20: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/20.jpg)
- 20 -
3.3. Preliminary Presentation - Formal Curriculum Design in Malawi -
Mr. Chimenya, Biology Lecture at DCE, gave a brief synopsis of curriculum
development in general and for Malawi in particular. His presentation was based on;
� An exploration of various definitions of curriculum as offered by several leading
scholars in education cues;
� A critique of curriculum development models vis-à-vis cyclic and dynamic models ;
� The Malawi curriculum development model as cited from Kaperemera (1990).
Mr. Chimenya further challenged the participants with three key questions pertaining
to the attainment of objectives for Trainers of Trainers (TOT) INSET workshop; namely:
� At what stage in the SMASSE INSET curriculum development was Malawi?
� With reference to the Dynamic model, where did the SMASSE-INSET curriculum
development for Malawi start?
� In the current TOT INSET Workshop, who was a trainer? Who was a trainee?
His presentation was concluded by calling upon the Malawi core trainers to be as
interactive as possible with the Kenya-team in order to benefit fully from the Kenyan
experience. The presentation took the following pattern.
3.3.1 Some Definitions of Curriculum
� All the learning which is planned and guided by the school…John Kerr (1968)
� “A plan for learning.” Taba (1962)
� “Formal and informal content and process by which learners gain knowledge.” Doll
(1978)
� “All learning opportunities provided by the school.” Tyler and Alexander (1966)
� “The educational programme of the school.” Oliver (1977)
� “A plan, a system and a field of study.” Beauchamp (1968)
![Page 21: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/21.jpg)
- 21 -
3.3.2. Images of Curriculum
William Schurbert (1986)
� Content or subject matter (subjects focused)
� Programme of planned activities (course of school events)
� Intended learning outcomes (objective focused)
� Cultural reproduction (knowledge values for posterity)
� Experience (experiences by individual child)
� Discrete tasks and concepts (set of tasks to be mastered)
� An agenda for social reconstruction (knowledge and skills to improve society)
3.3.3.3.3.3.3.3.3.3.3.3. Cyclic and Dynamic Interaction Curriculum Development Models
Cyclic Models Dynamic/Interaction Model
Characteristics
-Continuous endless process
-Interrelated /interdependent etc.
-Situation analysis vital (responds to needs
of standard plus society)
Characteristics
-Begins with any level and direction
-Beliefs etc serve as base
-Interaction emphasized
Advantages
-Logical/Sequential/easy
-Situation analysis provides baseline
data that enable objective formulation
Advantages
-Flexible-start at any pt.
-Realistic and allows creativity
Disadvantages.
-Situation analysis is time consuming and
expensive
Disadvantages.
Non-systematic and down plays role of
objectives
Example
Wheeler’s Curriculum Development
Model
Example
Walker’s Curriculum Development Model
Table 3: Curriculum Development Model
Adapted from Tyler, Hilda Taba, Wheeler, Oliva and Walker curriculum development models
![Page 22: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/22.jpg)
- 22 -
3.3.4. Malawian Curriculum Development Model
Figure 2: Curriculum Development Flow Chart adapted from (Kaperemera, 1990)
Situation Analysis
Formulation of national goals of education
Determination of Primary Education Objectives
Determination of Primary Education Matrix
Articulation of Individual Subject Objectives
Selection of Learning Experiences And Contents
Development of Scope and Sequence Chart
Organisation of learning experiences and contents
Preparation of Instructional Material
Evaluation of Instructional Materials
Printing and Distribution
Implementation
Monitoring and Quality Control
![Page 23: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/23.jpg)
- 23 -
3.4. Principle of ASEI/PDSI Lesson
Mr. Waititu’s from Kenya presented an exposition on ASEI / PDSI based lessons
centred on the following key issue;
� What ASEI was;
� Why ASEI;
� Benefit of ASEI lesson presentation;
� What PDSI was;
� Why PDSI;
� Benefits of PDSI lesson preparation;
The summary of his presentation is as follows.
Why ASEI
Baseline findings indicated many issues that hampered realisation of good
performance in Science and mathematics. Among these many issues was the nature of
teaching that was taking place in science and mathematics classrooms. What are the findings
on this aspect?
� Teaching was knowledge based. The emphasis was to memorise facts, with
little concern for understanding, expecting students to regurgitate the facts at
examinations.
� Teaching methodology was basically chalk and talk. There were very few
instances where teaching made use of variety of activities, leave alone adequate
numbers of activities for a lesson.
� Experimental work whenever/wherever conducted was for occupying students.
Teachers tended to disrespect preparation of experiments and they expressed
that it was the wok of technicians.
� Poor mobilisation of available T/L materials The tendency of teachers in this
aspect was to use recipe type experiments where there is little or no effort to
modify/simplify experiments for enhancement of understanding; using T/L
materials in a very uneconomical way; failing to make use of materials and
examples available in students’ world of life.
![Page 24: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/24.jpg)
- 24 -
Figure 3: Effects of ASEI & PDSI
What is ASEI?
After careful analysis of this situation, SMASSE project developed an intervention
measure in the name of ASEI movement. ASEI is an acronym that stands for Activity,
Student, Experiment and Improvisation.
Activity
The lesson to have adequate Activities for achievement of lesson objectives. Such
activities are: Demonstrations, class experiments, making models, games, drills, exercises,
discussions, etc.
Pre-ASEI Condition
After SMASSE
Project
(ASEI condition)
During SMASSE Project
� Student-centeredness
� Activity-based � Experiment and
research � Small scale
experiment and improvisation
� Knowledge based � Teacher-centeredness � Chalk and talk � Full scale experiments
Resources mostly towards Non academic
activities
Inadequate inspection
� Attitude change � PDSI � Methods � Material production � Capacity building � INSET
institutionalisation
Mobilisation and Rationalisation of Resources towards Academic Activities
Prudent, frequent and regular inspection
![Page 25: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/25.jpg)
- 25 -
Student-participation
Students are encouraged to give their:
� prior experiences and explain their ideas related to the content;
� own hypotheses/predictions and helped to discuss how they differed from
those held by others and to verify them through experiments, facts, etc.;
� own observations/results in the experiment and to discuss how they differed
from those of others;
� students were involved in practical work.
Experiment(s)/practical work
Experiments’ effectiveness in achievement of the lesson objective(s):
� Enhancing their understanding of concepts;
� Development of process skills;
� Verifying students’ hypotheses/predictions;
� Solving problems;
� Stimulating and sustaining students’ interest in the lesson;
� Developing scientific attitude.
Improvisation
Improvisation is evident in the lesson through:
� Economical use of materials: Scaling down materials for experiments e.g.
diluting chemicals to suitable levels and use of small quantities of chemicals
(economical use of materials);
� Teacher utilized available materials in the students’ immediate environment
to raise interest and curiosity teacher produced and/or utilized improvised
equipment;
� Modified/simplified experiment(s);
� Use of a non-conventional apparatus in lesson delivery.
Benefits of ASEI lesson presentation
In Science education the ASEI lesson presentation is the type of lesson presentation
that every trained teacher has at the back of his/her mind. In this type of lesson presentation,
the students are provided with meaningful learning activities, the meaningfulness of these
![Page 26: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/26.jpg)
- 26 -
activities being discerned from extent of achievement of lesson objectives. ASEI based
lessons would help students to:
� generate and sustain learner’s interest in mathematics and science. This will
lead to positive attitude towards these subjects;
� enjoy the lessons;
� increase understanding, retention and application of mathematics and
scientific concepts;
� make mathematics and science concepts real life experiences to the learners;
� arouse curiosity;
� develop cognitive growth “minds on” activities;
� develop communication skills “minds on, mouth on” activities;
� develop psychomotor skills “hands on”;
� develop process skills such as, observation, record, analysis and
interpretation of data;
� develop affective skills “hearts on” activities.
Plan, Do, See, Improve (PDSI): The vehicle to ASEI condition
Why PDSI?
Baseline studies established that there was very poor or no planning at all for lessons.
In many instances teachers used notes that were as old as the teachers years in the
profession.
The baseline studies also found that many of the teachers were using inappropriate
methodologies in teaching. These teachers were used to delivering their lessons by
continuously applying the lecture method (i.e. chalk and talk). This method was very
popular since it requires very little planning and preparation. The students were relegated
to the peripheral in the learning, and the only learning activity was copying notes without
any clear understanding. Teachers hardly or poorly evaluated progress of learners’
understanding. In conduct of practical work learners in many of the schools surveyed were
![Page 27: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/27.jpg)
- 27 -
rarely exposed to practical work and in a number of others laboratories were only accessible
to those students in the upper grades.
What is PDSI?
With this kind of situation, of course very little learning took place in the Science
and Mathematics lessons. The SMASE project then realised that in order to achieve the
ASEI condition in T/L there was need to emphasise use of PDSI. PDSI stands for Plan, Do,
See and Improve.
Plan
1) The lesson plan to take into account students’ backgrounds such as learning
difficulties, their needs/interests/misconceptions, growth of experimental skills and
previous experience in relation to the topic;
2) The lesson plan be appropriate and realistic in the light of the lesson content and
students’ abilities/skills/interest;
3) Teacher prepare appropriate and adequate materials for students’ use.
Do (teaching)
Introduction
� Introduction to incorporate previous knowledge/skills/everyday experience and
linked them to the new topic
� Introduction be clear on what the teacher wanted the students to learn
� Introduction be stimulating enough to arouse the interest and curiosity of the students
Development
� Lesson to encourage students to express their prior experiences and explain their
ideas related to the content;
� Lesson to encourage students to give their own hypotheses/predictions and helped to
discuss how they differed from those held by others and to verify them through
experiments, facts, etc.;
� Lesson to encourage students to give their own observations/results in the
experiment and to discuss how they differed from those of others;
� Lesson to facilitate growth of process skills such as observing, measuring,
identifying variables planning experiments, etc.;
![Page 28: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/28.jpg)
- 28 -
� Teacher to deal with students’ questions, misconceptions and reinforced learning at
each step;
� The lesson to encourage active participation of students in the main teaching steps.
Conclusion
� Lesson to encourage students to draw conclusions;
� Lesson be well summarized and follow-up activities be given;
� The lesson to assist learners to view the content in relation to what they come across
in the society;
� Checking of accuracy, correctness, depth and appropriateness of the content through
question and answer techniques well conducted;
Class management
� Teacher to organise and conduct lesson taking into account the individual differences
in student capability
� Instructional materials/media well managed
� Instructional materials/media effectively made use of
See: Evaluating lesson
� Pausing to check students’ feeling (keeping good eye contact with learners)
� Asking questions
� Inviting questions
Improvement:
Improvement evident in the way teacher responded to emerging issues in the lesson
Adjustments to delivery plan
Rephrasing questions/instructional statements accordingly
Benefits of PDSI
PDSI ensures lesson is delivered to the satisfaction of both the teacher and the
learners because of:
1. Considerations made of learning ability of learners
2. Appropriate utilisation of time available
3. Teachers’ confidence in direction of lesson flow
4. Enhanced teachers’ competence in content/skills after trying out lesson activities
![Page 29: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/29.jpg)
- 29 -
3.5. Lesson Presentations
3.5.1. Mathematics Lesson Presentation from Malawi
Demonstration and discussions on Classroom Teaching in Malawi (JCE
Mathematics) by Mr. S. Mkandawire on the Lesson: Drawing linear graphs.
Mathematics Lesson plan
SCHOOL: Domasi Demonstration S.S. FORM: 2B
SUBJECT: Mathematics NO. OF PUPILS: 40
TOPIC: Linear Graphs (Drawing Linear Graphs) TIME : 40 min
AIM OF THE LESSON :
To enable pupils to appreciate and recognize the straight line graphs.
SPECIFIC OBJECTIVES :
By the end of this lesson pupils should be able to;
(i) Find the corresponding values of x and y for the relation y = mx +c.
(ii) Use the correct scale when drawing the Cartesian plane.
(iii) Plot points on the Cartesian plane.
(iv) Draw a straight line joining the points on the Cartesian plane.
TEACHING AND LEARNING MATERIALS :
� Graph board, graph paper, chalkboard ruler, chalk, pencil, eraser, Kenya Institute of
Education, Math’s Pupils Book 1, pp 222-227.
TEACHING METHODOLOGY :
� Question and Answer.
� Demonstration.
PREREQUISITE KNOWLEDGE :
� Pupils already know
• x-axis, y-axis, plotting coordinates, four quadrants, origin of the axes, scale.
![Page 30: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/30.jpg)
- 30 -
PRESENTATION TIME TEACHER ACTIVITY PUPIL ACTIVITY 3 min INTRODUCTION
� Draws the Cartesian plane on the chalkboard and asks one pupil to locate the x and y-axes.
� Asks a pupil to locate the point P (2,3) on the Cartesian
plane.
� Asks pupils what 2 stand for and 3 stands for.
⇒ Locate the x and
y-axes ⇒ Locates the point P
(2,3) on the Cartesian plane.
⇒ Answer 2 stands for
x-coordinate and 3 for y-coordinate.
10 min
DEVELOPMENT
Step 1 � Writes the lesson title (Drawing linear graphs) on the
chalkboard. � Writes the linear equation 53 += xy and the table of
corresponding x and y values. x -2 -1 0 1 2 3 4 y -1 8
� Demonstrates how to find the corresponding values in
the 1st and 4th columns. � Tells pupils that y is dependent value and x is
independent value.
� Ask pupils to find the corresponding values of y in the remaining columns.
x -2 -1 0 1 2 3 4 y -1 2 5 8 11 14 17
Step 2 � Draws the Cartesian plane taking 1cm to represent 1unit
on the x-axis and 1cm to represent 2 units on the y-axis. � Ask pupils to locate points on the Cartesian plane. � Asks a pupil to state the trend of the points. (Are they in
a straight line or scattered) � Asks one pupil to join all the points with a straight line.
y-axis y =3x +5 5
-1.6 0 x-axis
� Ask the pupils if they have any questions
⇒ Listening. ⇒ Listening. ⇒ Come forward to fill
the value of y in the column by demonstrating how he/she got the value.
⇒ Locating the points on
the Cartesian plane. ⇒ Answer orally (they
are in straight line) ⇒ One pupil come
forward and joins the points with a straight line.
⇒ Asking questions.
![Page 31: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/31.jpg)
- 31 -
12 min
Step 3
� Gives the pupils a practice exercise to answer in groups of eight.
� For the linear equation y =4x+3 copy and complete the table and draw the graph taking 1cm to represent 1unit on the x-axis and 1cm to represent 2 units on the y-axis.
x -2 -1 0 1 2 3 y
� Moves around to supervise the groups work.
Solution
x -2 -1 0 1 2 3 y -5 -1 3 7 11 15
y-axis y =4x+3 3 -0.75 x-axis
⇒ Pupils in groups of
eight copy and complete the table and then draw the linear graph on the graph paper provided.
3 min CONCLUSION � Teacher summarizes the lesson by reminding the pupil
what they have learnt • axes • scale • coordinates • need at least 3 points to draw linear graph • join the points with straight line • linear graph (because the highest power of x is 1).
� Gives the pupils an assignment
• For the linear equation 3x+2y = 4 copy and complete the table and plot the graph.
x -1 0 1 2 3 4 y 2
⇒ Listening and taking
down short notes. ⇒ Copying the
assignment.
![Page 32: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/32.jpg)
- 32 -
The following comments were made on the lesson:
� The teacher was strong in the areas of content, use of names of pupils where calling on
them to answer question and questioning techniques.
However, a couple of areas needed to be
improved. The teacher needed to improve
on the following:
� Eye contact with the class
� Follow-up wrong answers from pupils,
rather than just ignore them in preference
of pupils giving correct answers.
� Reflect questions from pupils back to the
pupils; a practice which is both refreshing and illuminative as it tends to give the teacher
new perspectives
� Involve pupils more in doing work individually and also work in groups. The teacher
overdid pupil involvement by asking many pupils to come to the board to show how to
do some sums.
� Explain why the chosen scale was used. Preferably, it would have been better to let the
students use any scale of their choice. This frees the students from the misconception
that the scale is always 1 to 2.
� Define and explain Cartesian plane plus other technical terms.
� Point out errors identified from any group to the rest of the class for the benefit of the
class without embarrassing the group.
� It was not necessary to have three points in order to draw the straight line graph as it was
further pointed out that the third point was only necessary for checking.
Generally, it was pointed out that most teachers often lose pupils while teaching. It
was thus felt that it was important for teachers to think about the pupils before going to class.
Teachers ought to balance teaching for understanding and meeting requirements for
examination. In this regard, it was felt that pupils needed an explanation or practical
application of drawing linear graphs.
![Page 33: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/33.jpg)
- 33 -
3.5.2. Mathematics Lesson Presentation from Kenya
TOPIC: Circle theorem
SUBTOPIC: Chord properties of a circle
CLASS: Form 3
DURATION: 40 Minutes
OBJECTIVE:
The pupils should be able to generalise: equal chords are equidistant from centre of
the circle.
PREREQUISITE KNOWLEDGE:
Geometrical constructions, Mensuration and Simple loci
RATIONALE: The distance between the centre and the chord is required in the calculation
of area of segments.
REFERENCE: Junior Secondary Mathematics for Malawi, Exploring Mathematics, Book
2, by A. M. S. Chirwa and A. E. Mogha
Mathematics for Teacher Training by J. L. Martin,
MATERIALS: Pair of compasses ruler and pair of scissors
STEP 1. (HANDS-ON ACTIVITIES)
Pupils are asked to draw circle each of a specific radius. They should then draw a chord of
their choice and measure and record the sizes of the chord and the distance they are from the
centre of the circle.
Size of the chord
Distance from the centre of circle
STEP 2. (MINDS-ON ACTIVITIES)
What conclusion can you make from the groups’ finding?
STEP 3. (HANDS-ON ACTIVITIES)
Draw and cut out a circle of a specific radius. Mark the centre
of the circle. Draw a chord of a specific size on the cut circle.
Fold the paper along the chord. Fold the resulting segment into two equal halves. Measure
and record the distance of the chord from the centre.
![Page 34: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/34.jpg)
- 34 -
STEP 4. (MINDS-ON ACTIVITIES)
What do you discover?
STEP 5. (HANDS-ON ACTIVITIES)
Draw a circle of any radius and draw two equal chords on the circle. Determine the distance
of each from the centre of the circle.
STEP 6. (MINDS-ON ACTIVITIES)
What conclusion can you make?
STEP 7. (HANDS-ON ACTIVITIES)
On the circle, join the ends of each chord to the centre of the
circle.
STEP 8. (MINDS-ON ACTIVITIES)
Study the triangles formed and establish their relationships. Give reasons to your answer.
Objective of practical work:
Through the hands-on activity, the students find the mathematical property inductively. This
makes it easy for students to reach the property deductively in Step 2, 4, 6and 8, because it
gives them the direction of reasoning to reach the property.
Bridges:
Step 2, 4, 6 and 8 helps the pupils to bridge the activities with the content.
The exposition was on the teaching of Circle Theorem and Logarithms
Mr. Muiruri emphasized that during planning, it is important to plan an activity for more
than one objective. This was ably demonstrated in the exposition.
He highlighted the following points:
� demonstrations start off the learning progress in students, and can be used in
teaching Mathematics;
� activities planned for the students must enhance skills of observation and
communication;
� activities must challenge the students and stimulate to think beyond the
computations in the given activities.
![Page 35: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/35.jpg)
- 35 -
Comments
The lesson was well received and enjoyed by the group. It was also learn from Mr.
Muiruri that the activities in the lessons are sometimes adapted from school textbooks work.
However, in SMASSE, it is envisaged and compulsory for the teacher to spend a lot of time,
thinking and trying out several things in order to generate activities for use in class. He
emphasized that It is was not magic.
3.5.3. Biology Lesson Presentation from Malawi
Demonstration and discussion on classroom teaching in Malawi (JCE Biology) by Mr.
Chikwezga
Lesson: How urine is formed in Humans.
Biology Lesson plan
SCHOOL: Domasi Demonstration S.S. FORM: 2
SUBJECT: Biology NO. OF PUPILS: 40
TOPIC: Excretion TIME : 40 min
AIM OF THE LESSON :
Students know the process of urine formation in human
SPECIFIC OBJECTIVES :
By the end of this lesson pupils should be able to;
� By the end of this lesson students should be able to :-
� Name parts of the excretory system of human
� Identify internal parts of a kidney using a diagram
� Label parts of a nephron
� Describe formation of urine
� Explain adaptations of a nephron for the process of urine formation
TEACHING AND LEARNING MATERIALS :
� Charts showing the excretory system of human and internal parts of a kidney
� A fresh kidney
� Hose pipe of running water
� Potassium permanganate and a beaker of water
![Page 36: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/36.jpg)
- 36 -
PREREQUISITE KNOWLEDGE :
� Blood contents
� Blood circulation
� Movement of mineral salts and water through diffusion and osmosis
PRESENTATION
Stages Teacher activity Students activity
Introduction Ask questions: 1 name the substances found in blood plasma,
2 which blood
vessels transport
oxygenated blood
from aorta to the
kidney?
Answer the questions
Step 1 Explain the structure and function of the parts of the excretory
system of human
Give the students a blank chart showing the human
circulatory system
Label parts of the
excretory system
based on the teachers
explanation
Step2 Explain the structure and function of the kidney
Give the students a fully labeled diagram of a kidney and
fresh dissected kidney
Identify parts of a
fresh kidney
specimen compared
to the diagram
Step3 Explain the function of the different parts of a nephron Label parts of a
nephron from a blank
diagram
Step4
Describe the process of urine formation in human
Demonstrate diffusion and the effect of lumen diameter of a
hose pipe on pressure
Describe the
adaptations of a
nephron to the
process of urine
formation based on
the demonstrations
Conclusion Teacher summaries the lesson (stating parts of the excretory
system in human parts and function of the kidney and
adaptations of a nephron for urine formation)
![Page 37: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/37.jpg)
- 37 -
Ask summative questions
eg. What is the function of the following Ureter? Glomerulus?
Collecting duct?
After the lesson the following comments were made and the strong points of the teacher
were:
� He quickly changed the use of beaker to petridish to hold the specimen (kidney of goat)
� He maintained fine eye contact with the class.
� He was able to answer most questions from the class despite being asked very difficult
questions.
� He got feedback from groups.
However, the class needed improvement in the
following areas:
� The teacher over planned
� Dwelt too much on introduction which was
not exciting either. It was felt the teacher
could have used some contemporary issues
to those pupils interest, eg. issues
surrounding kidney transplants.
� Should have set time for pupils to do the
group work and report back to the class. Instead group work was done very quickly.
� Should not have labeled the diagram of the kidney on the board, and then ask pupils to
do the same on paper.
� Should have paid more attention to the drawing made which were not good because they
were not accurate, they were not presentable and no scale was given.
� It was felt important that diagrams must not misrepresent structures/organs they intend
to represent.
� Should have given ample time to give information on the lesson of the day and not
structure.
� With respect to handling questions from pupils, the group felt that teachers ought to
admit ignorance of something if it need be so, and to desist from ridiculing pupils
questions.
![Page 38: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/38.jpg)
- 38 -
3.5.4. Biology Lesson Presentation from Kenya
ASEI/PDSI Lesson exposition in (Biology JC) by Lelei, a Kenyan
Class: Form 2 Time: 40 minutes
Topic: Excretion in Mammals Sub-topic: Structure of mammalian
Kidney
Rationale: Excretion is a very important process in that waste products must be eliminated
as soon as they are formed. If allowed to accumulate they become toxic to the body. In
mammals, one of the organs, which perform this process, is the kidney. The purpose of this
lesson is to enable the learners to study the structure of the kidney.
Objectives: By the end of the lesson, the learners will be able to:
Describe the external structure of mammalian kidney
Identify various parts of the internal structure of mammalian kidney
State the functions of each of the parts
Define a nephron
Previous knowledge:
Meaning of excretion
Excretory organs in a mammal
Mammalian excretory products
Materials:
Mammalian Kidney (fresh), Scalpel blade/knife, hand lens, dissecting board
References. Secondary biology and Biological Sciences Pupils’ Book 2. K.I.E, page 96 -
100
Practical biology for schools, R .W. Mwangi, George A. O. Seko, page 117
Principles of Biology, Vol 1, P.M. Muchiri, page 239-242 Step and Time Teaching/Learning Activities Remarks Introduction (5 min)
Teacher reviews the previous lesson by asking the following questions;
• Define excretion (Separation and elimination of waste products of metabolism from the body)
• Where does excretion take place in mammalian body?
(Kidney, skin, lungs, liver) • Give examples of mammalian
excretory products
![Page 39: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/39.jpg)
- 39 -
(Carbondoixide, urea, excess water, excess mineral ions,)
Lesson development Step 1 (4 min) Step 2 (15 min) Step 3 (10 min)
Learners form groups. Teacher provides worksheet and the materials and gives brief instructions Learners perform the activity in their groups and fill the worksheet as the teacher supervises and guides them Learners give their observations and discusses them with the teacher
Lesson Conclusion (3 min)
Teacher and Learners consolidate the main points of the lesson on external and internal structure of the kidney through question /answer 1. Describe the external structure of mammalian kidney 2. Describe the internal structure of mammalian kidney 3. Define a nephron
Assignment (1min)
Teacher gives an assignment
Lesson evaluation (2 minutes)
The teacher gives the learners evaluation sheet to assess the teaching /learning process
![Page 40: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/40.jpg)
- 40 -
STUDENT WORKSHEET (Teachers copy) Name: Class: Date: Time: Topic: Excretion Sub-topic: Structure of mammalian kidney Materials and apparatus: Mammalian Kidney (fresh), Scalpel blade, hand lens, dissecting board Experimental procedure Observation
(Sample results) Activity 1
1. Place the mammalian kidney provided on a dissecting tray
2. Examine it carefully and record your observations
3. Make a labelled drawing of the kidney Question 1. State the function of renal artery, renal vein and ureter 2. Describe the external structure of mammalian Kidney
- dark red - bean shaped - convex side - concave side - depression (hilum) through which renal artery and vein enter and leave and ureter leave the kidney
Activity 2 1. Slice the kidney vertically from the convex side
with a scalpel blade to make two equal halves 2. Using a hand lens, examine the section and
record your observations
3. Make a labelled drawing of the longitudinal
section of the kidney Question
Describe the internal structure of mammalian Kidney
- Darker region towards the outside (cortex) - lighter region toward the inside (medulla) - lighter region ends with conical structure (pyramid) - innermost white structure (pelvis)
![Page 41: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/41.jpg)
- 41 -
Activity 3 You are provided with a diagram showing a magnified portion of a section of the kidney. Study it and describe your observations
- coiled tubules forming loops extending from the cortex to medulla - blood vessels - Collecting duct (Each of the tubules is called a nephron. A nephron is the functional unit of the kidney. Each human kidney has about 5million nephrons. A nephron has two main parts, a renal tubule and a glomerulus. The process of excretion takes place in three steps: Filtration at the bowmans capsule, reabsorption at the renal tubule and removal by the collecting duct)
![Page 42: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/42.jpg)
- 42 -
STUDENT WORKSHEET Name: Class: Date: Time: Topic: Excretion Sub-topic: Structure of mammalian kidney Materials and apparatus: Mammalian Kidney (fresh), Scalpel blade, hand lens, dissecting board Experimental procedure Observation
Activity 1
1. Place the mammalian kidney provided on a dissecting tray
2. Examine it carefully and record your observations
3. Make a labelled drawing of the kidney
3.5.4.1.1. Question
1. State the function of renal artery, renal vein and ureter 2. Describe the external structure of mammalian Kidney
Activity 2
4. Slice the kidney vertically from the convex side with a scalpel blade to make two equal halves
5. Using a hand lens, examine the section and record your observations
6. Make a labelled drawing of the longitudinal section of the kidney
Question Describe the internal structure of mammalian Kidney
Activity 3 You are provided with a diagram showing a magnified portion of a section of the kidney. Study it and describe your observations
![Page 43: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/43.jpg)
- 43 -
Assignment
Name: Class: Date: Time: 40 minutes Topic: Topic: Excretion in Mammals Sub-topic: Structure of mammalian Kidney 1. Draw and label the structure of a nephron 2. What substances does the kidney excrete? Lesson Evaluation Sheet. Class: form 2 Date: Time: Topic: Excretion in Mammals Sub-topic: Structure of mammalian Kidney 1. What part of the lesson didn’t you understand and why? 2. Which part of the lesson did you find most interesting and why? 3. How did you participate in the lesson? 4. What do you think should have been done differently to make the lesson better? Activity to illustrate Excretion in a unicellular organism Student Worksheet (teachers copy) Aim: To demonstrate excretion in unicellular organisms (e.g. amoeba and paramecium) Materials and apparatus: Beaker, water, Visking tubing, coloured solution (iodine solution) and cotton thread Procedure Sample results
1. Tie visking tubing on one end using some cotton thread 2. Add some coloured solution into the visking tubing and
tie the open end as before 3. Place the visking tubing in a beaker of water. 4. Predict what would happen 5. Leave the set up for 3-5minutes 6. Note and record your observations
Q 1. Assuming that the colored solution represents excretory material produced by a named unicellular organism, account for the observations made Q 2. What does the visking tubing in this experiment represent?
- Water in the beaker turns brown - The coloured solution in the visking tubing moved out of the visking tubing by diffusion - cell membrane/unicellular organism
Activity to illustrate Excretion in a unicellular organism
![Page 44: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/44.jpg)
- 44 -
Student Worksheet Aim: To demonstrate excretion in unicellular organisms (e.g. amoeba and paramecium) Materials and apparatus: Beaker, water, Visking tubing, coloured solution (iodine solution) and cotton thread Procedure Sample results
1. Tie visking tubing on one end using some cotton thread 2. Add some coloured solution into the visking tubing and
tie the open end as before 3. Place the visking tubing in a beaker of water. 4. Predict what would happen 5. Leave the set up for 3-5minutes 6. Note and record your observations
Q 1. Assuming that the colored solution represents excretory material produced by a named unicellular organism, account for the observations made Q 2. What does the visking tubing in this experiment represent?
Lesson: Excretion in humans.
The exposition was about showing simple activity in a lesson on human excretion and
demonstration on excretion in unicellular organisms using diffusion using a visking tubing
as semi permeable membrane.
Comments
The exposition revealed that activity is not always experiments; it can take any form and
that many activities on the same subject / topic do not necessarily retard progress in class,
rather they enhance understanding and pupils’ perspectives on topics
The groups also felt that worksheets could be substituted by use of blackboard. It was also
mentioned that in activities, pupils ought to be used to clear the room, after the lesson is
over.
![Page 45: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/45.jpg)
- 45 -
3.5.5. Chemistry Lesson Presentation from Kenya
ASEI / PDSI lesson exposition in Chemistry (JC / MSCE) by Mr Masoka, a Kenyan
DEVELOPED AND FACILITATED BY NDELELA MASOKA
Topic Matter Sub-topic Chemical Reactions
Class F2N Duration 40 minutes
Rationale: Chemical reactions are extremely important in our daily lives since they have
many uses. Lighting a fire, cooking, making medicinal concoctions, biological processes
explosives e.t.c. are just a but few of the many examples. It is therefore important we have a
close study of what constitute chemical reactions.
Objectives: By the end of the lesson the learners should be able to:
Explain the term chemical reaction
State ways of effecting a chemical reactions
Write word equations for chemical reactions
Materials and apparatus:
5 Matchboxes, 10g Ammonium nitrite, 10gassium Dichromate, 10g Copper(ii) sulphate, 5
pkt Andrews Liver salt ( or Eno) salt, 5ml Dilute Hydrochloric acid, 5g Sodium Chloride,
5g Lead (ii)Nitrate, 5g Iron fillings, 5g Sulphur and 10ml Distilled Water
Reference:
“Strides in Integrated Science Form 2” by A.S.Mhlanga, P Ndolo and N.M. Mbano
“Chemistry for Today and Tomorrow” by M.A. Atherton and J.K. Lawrence
Background knowledge: Physical and Chemical changes, Elements, compounds, Burning
substances in air
![Page 46: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/46.jpg)
- 46 -
Teaching/Learning activities/Steps Teaching Points Remarks Introduction: 5 MINUTES Review of previous lesson through question and answer method: What are the characteristics of a physical and chemical change? Give examples of each case
Characteristics of Physical change Easy to revert back to original state No new substance(s) formed Characteristic of a chemical change It is usually very difficult to change back into the original substance New substance formed. Examples to be given by the students
Development: Step 1. (10 MINUTES) Demonstration of chemical a reaction; -Teacher demonstration by igniting a mixture of ammonium nitrite and Potassium dichromate. Students observe as they answer posed questions. Students are supplied with matchboxes and are told to ignite and make observations How did you ignite the matchstick? (ACTION) What did you observe as the matchstick was burning? (REACTION) Is the burning a physical or chemical change? Explain. Q. From what you have observed above what do you think is meant by the terms chemical reaction? Step 2. 10 MINUTES Teacher uses students to demonstrate ways of effecting chemical reactions. Students watch and record their observations: T/S discussion to explain what happened, leading to introduction of chemical (word) equation, using the following examples Burning a piece of magnesium ribbon in air. Heating copper(ii) sulphate. Mixing Heath salt with water Zinc granules with dilute hydrochloric acid Sodium chloride and Lead (ii) nitrate solutions Heating mixture of Iron fillings and sulphur powder.
A chemical reaction brings about a chemical change. New words: Reactants Products Thermal Decomposition Ways of effecting chemical reactions By direct Heating (burning of substances) By indirect Heating (heating in a container) By mixing substances By mixing and heating directly or indirectly
![Page 47: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/47.jpg)
- 47 -
Discussions. 10 MINUTES Representing the above reactions by using word equations
- A chemical equation is a short way of representing a chemical reaction by using words or symbols.
- It shows the substances taking part and those formed when a chemical reaction takes place.
Examples: Magnesium + Oxygen Magnesium oxide Zinc + Dilute hydrochloric acid Zinc chloride +hydrogen
Summary/Conclusion: 3 MINUTES Q/A method to summarize and evaluate the lesson
Evaluation: 2 MINUTES Students to give own opinions concerning the lesson
Comments
The group were refreshed by manner in which the exposition was handled, and simply
thanked the Mr. Masoka.
3.5.6. Physics Lesson Presentation from Kenya
ASEI / PDSI – Lesson exposition in Physics (MSCE) by Mr. Waititu
Background knowledge:
Measurements and definitions of quantities
Ask students to explain what is meant by measurement
In measurement, we answer the question “How much/many is there of a given quantity?”
This description is adequate with a statement of magnitude of the quantity and for some
other quantities, the description requires measure of angle of deviation of the quantity from
a specified reference.
The terms scalar and vector
Those quantities whose description of measurement is adequate with a statement of
magnitude only are called scalar quantities while those whose measurement is stated in
terms of magnitude and direction (angle of deviation from a specified reference) are called
![Page 48: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/48.jpg)
- 48 -
vector quantities. Most measurements in science are classed as either scalar or vector
quantities.
A scalar quantity is one that has magnitude (size) only
A vector quantity is one that has magnitude as well as direction Scalars Vectors Distance (extent of length) Displacement Time (extent of duration) Speed = Distance moved/time taken Velocity = displacement/time taken Acceleration Mass of an object (amount of substance) Weight of an object Force applied 200 books on the selves (number of pieces) 50 litres of petrol (amount of volume) Temperature (extent of hotness or coldness) Volume (amount of space) Money (number of pieces) Density (Quantity of matter in unit volume)
Dealing with measurements of a scalar quantity
Background knowledge
Ability to carry out ordinary arithmetic
Arithmetic of scalar quantities
Consider 5 pieces of stones and 3 pieces of stones. The scalar quantity is number of the
pieces.
In adding together these pieces we get 8 pieces. Now if we remove (subtract) 3 pieces of
stones from the 5 pieces, the remainder is 2 pieces of stones. Thus in addition or
subtraction of scalar quantities, we only do the ordinary arithmetic. The number of pieces
has no direction.
Dealing with measurements of a vector quantity
Distinguishing between scalar and vector quantities: distance and displacement
Let one participant stand in front of the class. Ask the other learners to close the eyes and
listen to the count of steps up to 10 that the learner in front of class makes.
Question to students
Where is the learner who was walking in the class?
![Page 49: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/49.jpg)
- 49 -
There is no answer. The person could have moved 10 steps in any direction or even in a
circle. To predict the position of the learner after making the 10 steps, it is necessary to
know the direction of movement.
Numbers of steps, meters, kilometres etc are scalar measures of distance (extent of length).
In order to describe fully where the learner is we would give the extent of length (distance)
from the starting position, and also give direction of his/her position from a specified
reference.
If you are told that a person has moved a distance of 1 kilometre from a particular spot and
then you are asked to try to answer the question “where is the person?” Again this
question has no particular answer. To give an answer to this question, specification of
direction of movement is necessary
Consider these
other examples
I travelled a
distance of 20km
on foot. The distance 20km is a scalar measure.
My school is 50km south of Zomba. The displacement of 50km to the south
from the reference point is a vector quantity (with magnitude of extent of
length and direction)
This kind of description of extent of length (distance) in specified direction is
called ‘Displacement’. Displacement is distance moved in a particular
direction. Displacement is an example of a Vector quantity
Combining of vectors
Let us now study how to combine vectors. There are two methods of combining vectors:
graphical method and analytical method.
20km
Terminal Starting point
Fig. 1
N
School
Zomba
50km
Fig. 2
![Page 50: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/50.jpg)
- 50 -
Graphical method of combining vectors
Background knowledge/skill
Drawing and interpretation of scale representations; meaning of parallelogram
In graphical method a vector can be represented by a line drawn to scale that shows both
size (magnitude) and direction. The length of the line represents the magnitude of the
quantity and its direction gives the line of effect. In this section we will study examples of
vectors combinations for displacements, velocities and forces.
Combining vectors applies the parallelogram law which ensures that their directions as well
as their magnitudes are considered. The parallelogram law of adding vectors states that:
If two vectors are represented in size and direction by sides of a parallelogram drawn from
their point of effect, their resultant is represented in size and direction by the diagonal of the
parallelogram drawn from the point
Combinations of displacements
Example
A girl was sent to the shops, 150m away from their house
to buy some cooking fat. A return to the house would
have made her to cover 300m. However, her
displacement would zero since she would end up where she
started – at home.
Fig. 3 shows location of house of the girl’s friend where
she decided to pass by before going back home
How far is the friend’s house from the girl’s house?
Students’ activity
Draw to scale a line to represent displacement from the house to the shop. At the head of
this line draw another one to represent displacement from the shop to the friend’s house.
Draw another line joining the tail of the first to the head of the latter. Now measure
distance to the friend’s house from the girl’s house and direction (say angle between line
joining the shop and the line joining the friend’s house from the girl’s house)
150m
Girl’s
house
Girl friend’s
house Shop 50m
Fig. 3
![Page 51: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/51.jpg)
- 51 -
Combinations of velocities
Background knowledge: meaning of Speed and velocity
In ordinary conversation the term velocity is used interchangeably with speed. In science,
however, these terms have specific meanings. Velocity is the rate of change of
displacement with time, while speed is the rate of change of distance with time. Velocity is
therefore a vector quantity whereas speed is a scalar quantity. For instance, a bus may be
observed to travel at a steady speed of 20km/h along a straight stretch of road in a direction
300 east of south, the velocity is 20km/h 300 east of south. If the bus rounds a bend at the
same speed, the direction of motion would be changing continuously and therefore its
velocity would be continuously changing, as the speed remains constant.
Addition of velocities
Combinations of forces
Students’ activities
Forces of 2N and 3N acting in the same direction add up to give a resultant force of 5N
Forces of 2N and 4N acting in opposite directions add up to a resultant of 2N.
RIVER CHILE
Ve
locity of bo
at, ν1 =
4.0
m/s
Velocity of water, ν2 = 3.0
Ans. νR = 5m/s, 53.10 clockwise from direction of river
Fig 4
Fig 6
4N 2N
Fig 5
5N 2N 3N
![Page 52: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/52.jpg)
- 52 -
3m
4m
5m
θ
Fig 9
Forces of 3N and 3N acting in opposite directions give a zero resultant force.
In examples 2 and 3 consider the case of ‘tag of war’.
Forces at an angle
Arrange two springs (P and Q) and a weight (W) on a vertical
board as in Fig. 3 with a sheet of paper behind them. Take
readings of springs P and Q. Trace on the paper the directions
of P, Q and W along the strings. Remove the paper and using
a scale of 1cm to represent 1N, draw lines to represent the three
forces P, Q and W respectively, which act at point O.
P and Q are balanced by W. Draw a parallelogram to show how the forces are interacting
and determine the weight W.
Exercise: Worked out examples + supervised
practice
Analytical method of combining vectors
Background knowledge: Pythagoras theorem
and trigonometric ratios
In analytical method of combining vectors, we
use ratios of sides of triangle, which are called
trigonometric ratios. Ratio of the adjacent side of an angle to the hypotenuse of a right
angled triangle is called Cosine while that of opposite side of an angle to the hypotenuse of
the triangle is called Sine. Ratio of opposite to the adjacent sides is called Tangent.
Example
A student walks 4m eastward and then 3m southward. How far is
the student from the starting point?
The triangle formed is a right-angled triangle. Therefore using
Pythagoras theorem we get the direct distance from the start to the
finish is 5m. Direction of the student at the finish from the starting point is given by
tan θ = ¾
3N 3N
Fig 7
![Page 53: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/53.jpg)
- 53 -
⇒ θ = 36.90
Therefore the position of the student at the finish from the start is 5m, 36.90 s
Comments
Again the group focused on how these Kenya-SMASSE colleagues come up with such
stimulating activities that both enthuse students and facilitate their learning in a challenging
way. Hard work and time were cited as some elements needed for one to become adapted
at generating appropriate activities for lessons.
3.5.7. Integrated Science Lesson Presentation from Malawi
NO OF PUPILS: 40 FORM: 1N TIME: 40 MINS
TOPIC : ELEMENTS AND COMPOUNDS
OBJECTIVES : By the end of this lesson pupils should be able to
-Define Elements and Compounds
-Identify Elements and Compounds
PREREQUISITE : Knowledge of atoms and molecules and their symbols and
formulae respectively.
TEACHING AND LEARNING AIDS :
List of some elements and their symbols.
List of some molecules and their formulas
Bottle tops labeled inside.
![Page 54: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/54.jpg)
- 54 -
PRESENTATION :
INTRODUCTION
TEACHER ACTIVITY PUPIL ACTIVITY
-Revise previous lesson -Respond to questions.
on atoms and molecules by asking -Identify atoms and molecules from chart.
questions.
-Use charts to identify atoms
DEVELOPMENT
TEACHER ACTIVITY PUPIL ACTIVITY
-Introduce lessons topic by coming with different combinations
Putting the pupils in 5 groups and give of atoms to form molecules.
them the labeled bottle tops.
-Using chart on the board ask pupils to Coming up with comments on the
come up with different combinations of combinations.
atoms to form molecules.
-Explain these differences and define
Elements and compounds
CONCLUSION: .
Discuss the different combinations made.
Give a summary of the major points.
Emphasize that atoms must be chemically joined to form elements and compounds.
Comments
The exposition was good. Suggested improvements included the following:
Coloured beads, or small card board papers could also be used.
The term ‘chemically joined’ was not appropriate as it implies use of chemical to join atoms
If possible combinations of elements and compounds generated by the students should be
examined and together with the students cross out all the impossible.
![Page 55: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/55.jpg)
- 55 -
Those combinations not consistent with valency of the atoms involved. This progress of
crossing out impossible combinations immediately was very important as it would present
the situation where learners have to un-learn wrong ideas.
3.5.8. Biotechnology Lesson Presentation from Malawi
by Mr. Chikwezga
Subject: Science and Technology Class: Form 3
Topic: Biotechnology Time: 40 mins
Subtopic:Agricultural biotechnology No. of pupils: 40
Aim:
To enable students to appreciate the application of biotechnology in agriculture.
Specific Objectives:
By the end of the lesson students should be able to :
.identify examples of agricultural biotechnology
.explain the principle of selective breeding as applied to agricultural
biotechnology
.assess the impact of agricultural biotechnologies on the well being of man.
Prerequisite Knowledge
.definition of biotechnology
.types of biotechnologies
.microorganisms
.plant and animal pests and diseases
.cell biology
.gene concept
Teaching and Learning Aids
.charts of animals ( cattle, chicken, pests ) and maize
.maize cobs, seeds of different varieties
![Page 56: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/56.jpg)
- 56 -
PRESENTATION
Teacher activity Pupil activity
Introduction (5mins)
. ask pupils to discuss the desirable
characteristics in cattle kept for meat
.respond.
. ask the desirable characteristics in maize . respond
. comment / verify the responses using cattle
charts and maize cobs / seeds.
. listen, observe, take notes and ask
questions
Development
.explain the concept of genetic influence on
the desirable characteristics of cattle and
maize using cattle / chicken
. listen, observe, take notes
charts and maize cobs / seeds notes and ask questions
asks the importance of genetic manipulation
with reference to the charts, materials etc.
.respond, ask questions
. explain other arising biotechnologies in
agriculture
.respond.
Conclusion
.summarise the key points of the lesson . listen, take notes
.invites questions from pupils requiring
clarifications on misconceptions,
misunderstandings etc.
. copy the activity
. ask pupils to explain the importance of
agricultural biotechnology to an individual as
a follow-up activity
Comments
It was felt very strongly that the lesson exposition was not what the participants expected.
The participants hard expected a sample of the ideal situation on which they could give
constructive criticism. Some of the comments were:-
� It was also pointed out that the lesson prepared for this exercise (see appendix) was
far superior to the one presented. This departure from workshop objectives was
severely reprimanded, since the results of the baseline study already revealed this.
The teacher defended his departure to reflect a typical situation in schools resulting
from lack of lesson preparation, which in the pre-ASEI condition.
![Page 57: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/57.jpg)
- 57 -
� Otherwise on the actual lesson presented, participants had the following comments:
� It did not draw on the current issues of GMO (genetically modified organisms) to
arose controversy and interest in learners
� It lacked specimens of biotechnology such as hybrids of animals such as chickens eg
a six week old hybrid and local (non-hybrid) chicken for comparison.
� It dwelt more on introducing the term biotechnology as though it was being taught
for the first time. Rather, the introduction have dwelt on environmental technology
3.5.9. Human Ecology Lesson Presentation from Malawi
ASEI/PDSI Lesson in MSCE Human Ecology by Mr. B. Navicha
DATE: April, 2003
TIME: 40 minutes
CLASS: Form 1
NUMBER OF PUPILS: 20
TOPIC: Fibres
CONCEPT: Fabric tests
SUBCONCEPT: Burning test
AIM: Pupils should understand the procedure and results of burning test
to identify fibre content in fabrics
SPECIFIC OBJECTIVES : By the end of the lesson pupils should be able to
-mention at least four fabric tests
-explain the procedure for the burning test
-analyse results of the burning test
-use the burning test to identify fabrics
TEACHING AND LEARNING AIDS:
-candles, tins, fabrics (cotton, wool, poyester,nylon),
matches, tongs, aluminium plates
PREVIOUS KNOWLEDGE :
-pupils already know types of fibres ,their characteristics, sources and processing
![Page 58: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/58.jpg)
- 58 -
INTRODUCTION Time Teacher’s Activity Pupil’s Activities Resources
5minutes . Asks pupils to define fibres, yarns and fabrics . Asks pupils to give types of fibres and their sources .Tells pupils that they are going to learn about fabric tests with special emphasis on burning test
. Answer orally . Answer orally . Listen
- - -
DEVELOPMENT
Time Teacher’s Activities Pupil’s Activities Resources 10minutes 5minutes 15 minutes
.Asks pupils if they know any fabric test Mentions and writes examples of different fabric tests as below -microscope -burning -strength -absorbency - elasticity - crease resistance - alkali - acid - acetone . Describes the procedure for the burning test ..Explain what to observe during fabric tests like colour of smoke, how fabric flares up, smell produced, whether it melts, whether it produces ashes . Demonstrates the burning test on cotton and wool . Asks pupils to explain what they observed . Asks pupils to conduct fabric
. Answer orally . Listen . Write notes . Listen . Write notes .Listen .Take notes . Observe . Write notes . Explain their observations
chalk board candle cotton fabric matches tin woolen cloth burning candle tongs aluminium plate Their experiences on the burning wool
![Page 59: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/59.jpg)
- 59 -
tests on polyester and nylon in their groups .Asks pupils to explain what they observed during fabric tests on polyester and nylon
. Conduct burning tests on polyester and nylon .Write down their observations .Answer orally
and cotton burning candles tins polyester and nylon fabrics tongs Their experiences on the burning polyester and nylon fabrics
CONCLUSION
Time Teacher’s Activities Pupil’s Activities Resources 5minutes Asks pulpils to
. mention four types of fabric tests
. explain results of fabric tests on cotton, polyester, nylon .Summarises on the results of the burning tests .Gives pupils an assignment in which they should identify fibres in unknown fabrics before the next lesson .Tells pupils that in the next lesson they will conduct burning tests on other fabrics like rayon acetate, acrylic modacrcylic,spandex
.Answer .Listen .Listen .Collect materials .Listen
.Pieces of fabric
Comments
The lesson was good. However, the following issues were raised, that:
Students were given less time to do the activity (burning test) because the teacher spent a lot
of time explaining and demonstrating the burning test. It was not necessary to demonstrate
and explain the burning test, rather, the teacher allowing the students to do the test on their
own, and discuss the results afterwards highlighting the essential points.
![Page 60: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/60.jpg)
- 60 -
Students could also have been given the opportunity to decide on the materials to use and
the procedure to follow. The teacher should have highlighted the unique characteristics of
fabrics that could be used to identify the fabrics. This could have better been done during the
discussion of the results.
![Page 61: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/61.jpg)
- 61 -
3.5.10. Physical Science Lesson Presentation from Malawi
SUBJECT : Physical Science FORM : 1
TOPIC : Magnets TIME : 40minutes
SUB-TOPIC: Properties of magnets
SPECIFIC OBJECTIVES:
� Identify magnetic poles
� Describe behaviour of poles when
brought closer together
� Identify parts of magnet that exerts
strongest force
PREVIOUS KNOWLEDGE:
� Attraction between magnets and magnetic
materials.
� Cardinal points.
TEACHING AND LEARNING MATERIALS
� Magnets, string, paper, iron filings, pencil or ball pen
INTRODUCTION
Review of previous work. What happens when magnets and magnetic materials are
brought closer? Answer: Materials are attracted to the magnet.
DEVELOPMENT
Activity 1:
Suspend a magnet on the pencil/ball pen with a string.
Swing it and let it settle.
Repeat step 2, at least three times, and write your observations.
Observation: Settles in N-S direction.
Repeat step 2, at least three times, and mark part pointing north – N and south – S.
Result: Part pointing north, always points north. Similarly part pointing south, always
points south.
Conclusion : - A suspended magnet settles in N-S direction. Part pointing north, always
points north and one pointing south points south.
- The part of magnet that points north is called north seeking pole and one
pointing south, south seeking pole.
![Page 62: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/62.jpg)
- 62 -
Activity 2:
Bring like poles closer and write your observation.
Repeat step 1 with unlike poles.
Observation: Like poles repel, unlike poles attract.
Activity 3:
Put a paper on a magnet. Spread iron filings on the paper and write your observation.
Observation : More iron filings are attracted on the poles.
Conclusion : Magnets have strongest force on the poles.
CONCLUSION
Ask students to mention properties of magnets they have learnt.
Answers: 1. A suspended magnet settles in N-S direction. Part pointing
north, always points north and one pointing south points south.
The part of magnet that points north is called north seeking pole and
one pointing south, south seeking pole.
2. Like poles repel, unlike poles attract.
3. Magnets have strongest force on the poles
STUDENT ACTIVITY SHEET
Activity 1:
Suspend a magnet on pencil/ ball pen with a string.
Swing it and let it settle.
Repeat step 2, at least three times, and write your observations.
Repeat step 2, at least three times, and mark part pointing north – N and south – S.
Activity 2:
Bring like poles closer and write your observation.
Repeat step 1 with unlike poles.
Activity 3:
Put a paper on a magnet.
Spread iron filings on the paper and write your observation.
Comments
Following the fair presentation, the participants wondered why this topic was perceived as
difficult. Some speculated that the non-contact nature of the magnetic force is what baffles
many students.
![Page 63: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/63.jpg)
- 63 -
It was also indicated that it was possible to make magnets locally in schools. The groups
also felt that things that were obvious may not be that obvious to students and after all, they
are the ones that pause as serious difficulties in learning. Due too this fact, it was
recommended that the teacher ought to do a lot of background reading. For instance, why
do magnets don’t point in the W-E position? This would explain why a freely suspended
magnet always settles in a N-S direction.
3.6. Secondary School Visit
3.6.1. Songani CDSS
Observation of a Mathematics lesson by Mr. Katangwa
Lesson presented: Long division of polynomials (MSCE)
Below was a brief outline of the progress of the lesson:
He told them what they were going to learn in the lesson and wrote the topic on
chalk board. He defined polynomials and explained / defined degrees with respect to
expressions. He revised long division as done in Arithmetic
He demonstrated long division of polynomials that give remainders:
Such as 3 95273+ +−+x xxx
Immediately he called upon students by
name to answer questions He related this division
of a polynomial to that in arithmetic.
He asked the class for any questions after he had
finished the demonstration and upon receiving no
questions, he proceeded to give the class an
exercise to do individually.
Advised the students to discuss the questions but not cop each other’s work.
He walked around marking the pupils work; usually without commenting on their work.
![Page 64: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/64.jpg)
- 64 -
Finally, he solved the sums himself on the chalkboard, with students calling out answers to
various stages as teacher solved the questions. He then invited questions from the class after
the going through all the questions. Upon receiving no questions, he ended the lesson.
COMMENTS
The teacher, plus a colleague a Diploma teacher, joined the participants to DCE
where the lesson analysis was done.
After receiving a few comments on what went well and more on what could be
improved, it transpired that this evaluation exercise was not going to help the teacher
concerned and the participants. It was then resolved to adopt a new strategy in analysing the
lesson. The participants were then asked to come up with alternative ways of teaching the
lesson by improving on the observed lesson.
Little did the participants realise what a
hectic learning experience this would be! Three
different alternative lesson plans with little
differences between them were produced from the
groups made.
Each alternative lesson plan aroused heated debate. Many searching questions were
asked and were not answered. What was even more striking was the sharp difference
between nature of lesson plans generated by the groups.
While groups dominated by Malawians produced more of teacher centred lesson
plans; the group with more of Kenyans, produced a more pupil activity oriented lesson plan
consistent with the ASEI/PDSI philosophy being advocated.
![Page 65: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/65.jpg)
- 65 -
LESSONS LEARNT FROM THIS EXERCISE
The topic polynomials were difficult to teach. It required a lot of planning to make
the abstract nature of polynomials become easily understood and appreciated by the students.
It required some higher degree of content mastery by the teacher for the topic to be taught
competently.
3.6.2. Saint Mary’s Secondary School
Lesson presented: Protein foods – eggs
The teacher progressed with the lesson this way:
� Reviewed previous lesson on cooking foods
Introduced new lesson;
� Elicited sources of eggs from pupils;
� Presented a diagram of an egg on chart;
� labeled diagram herself, somewhere students
calling out the names of parts of an egg;
� Told the class the nutritional composition of
different parts of the egg;
� Explained why an egg is called an economical source of food;
� Divided the class into groups to do some group work;
� Handed out pieces of paper to the groups containing the task for that group to discuss
ways of testing for the freshness of an egg and discuss way of storing eggs;
� Asked group secretaries to go to the front of the class and report their findings to the
class;
� Summarised group reports verbally, asked for clarification in some reports;
� Explained effect of heat on eggs;
� Called for ‘any questions’, and asked whether they were together;
� Gave an exercise for class to do individually (The questions were based on the lesson
and activity done);
� Walked around the class, marking and clarifying some pupils responses;
� Ended the lesson by introducing the subject of the next lesson: ways of cooking eggs.
![Page 66: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/66.jpg)
- 66 -
OMMENTS:
It was felt the following issues could be addressed in
the lesson:
� Lack of activity involving the eggs: a boiled
egg cut in half (vertically) would have
sufficed for teaching structure of the egg;
� Bad eggs (rotten) and good fresh eggs could
have helped in the group activity;
� Actual heating of the eggs to show effect of
heating could have been done
OTHER CONCERNS INCLUDED:
� Absence of note making by students during the lesson. This made the team suspect;
� Pupils were given well prepared notes by the teacher to copy at an opportune time;
� A practice that was not consistent with ASEI/PDSI approach, which encouraged
pupils rote learning;
� Notes should be taken as the lesson progresses;
� Teacher should have explored why a bad egg floats; why a bad egg produces sound
when shaken;
� The teacher did not explain some terms; eg. Coagulation;
� The teacher should have asked pupils what nutrients could be obtained from eggs;
draw features of eggs they know. The teacher over planned her work.
![Page 67: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/67.jpg)
- 67 -
3.7. Major Issues in INSET Curriculum Development for Malawi
� INSET Cycles, (1st to 4th cycles)
� Capacity Building (trainer of trainers, training of teachers, stakeholders workshop,
training of inspectors, training of principals and regional trainer of trainers)
� INSET Curriculum (baseline findings, written curriculum, training curriculum,
monitoring and evaluation and attained curriculum)
� Under baseline findings, the issues targeted included needs assessment, emerging issues,
pedagogy, practical work, attitude of teachers, managers and students, content mastery
by both teachers and students and resource utilization; which include development of
teaching and learning materials, and prioritisation of resources
THE WRITTEN CURRICULUM
Mr. Waititu said it was necessary that Malawi identify her own philosophy similar to
ASEI/PDSI in Kenya and went on to say that if its pleased Malawians, they could as well
embrace the Kenyan ASEI/PDSI philosophy. With respect to issues emerging from the
study, it was important to decide how much time would be needed to deal with each of the
issues. For instance would the tackling of sensitisation be a continuous process or not?
Written curriculum is important as it ensures continuity beyond project period. Themes for
each set of interaction during (INSET cycles) would probably follow a format described
below:
1st theme: Attitude
This is primary and critical to enable us to succeed in our endevours. Unless all
stakeholders develop a positive attitude to the ASEI/PDSI philosophy, we are not going to
succeed in the project.
2nd cycle: Hands on activities
![Page 68: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/68.jpg)
- 68 -
In here, the focus is on directing teachers energy to hands on activities. While
dealing with this, we continue focusing on attitude as well since it takes a long time to effect
an change in attitude. Mr. Waititu reported of a sit-in teachers organized during a 2nd cycle
of INSET in Kenya. In this instance, SMASSE-Kenya made it very clear to the teachers the
importance of upholding the ASEI/PDSI philosophy and asked them to leave for their
homes if they found the philosophy not welcome. As turned out, the teachers decided to stay
on, and today they talk of the success story.
3rd cycle: Operationalsing ASEI
4th cycle: Transferability of ASEI/PDSI to the rest of the teachers
Training Curriculum by identifying topics, and sequence of coverage during INSET,
determining the slope of the curriculum, determining objectives related to the baseline study
finding for each INSET. The INSET session plan or programme must ensure a good show to
occupy the participants meaningfully. Developing training manuals and teaching materials
embracing cardinal ideas and concepts
Monitoring and Evaluation Scheme that comprised checking of progress of achievement
of objectives, checking the efficiency of utilization of resources (materials and time),
checking on sustainability mechanisms, to see if continuity of the project is ensured ever in
the event of donors pulling out of the project and quality control
Attained curriculum that comprised the extent of capacity development in teachers and
all stakeholders involved in the INSET.
Concluding remarks on Mr. Waititu’s presentation included the following:
� Attitude was very important indeed, and critical to the project’s development;
![Page 69: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/69.jpg)
- 69 -
� This project (SMASSE-Malawi) was our (core trainers) responsibility. We could kill
it or build it;
� Partnership between the core team was very important. It was very important to
desist;
� From slave-master relationship;
� That all in core team share experiences and not that some supervises, or advises
anyone;
� As in Kenya, it was important to develop a working relationship where all seen as
equals;
� That DCE must have resources open to all core team all the time;
� That Ms. Yamamoto must find space beside the table; get involved in activities of
SMASSE; and not only Mr. Nakayama who is the preacher and financier for
SMASSE-Malawi;
� The project, teachers, Ministry Hqs (MoEST) JICA, and students expect a lot from
the core team;
� Core team members were expected to live consistently with the philosophy that was
preached;
� It is important to answer and explain all whys, by the core team?
� Any complaints within the core team must not spill over to the rest of the teachers;
� As much as possible, the team must portray unity all the time.
Comments:
That baseline study had not revealed all information needed. Hence, there was need
to identify key issues which Malawi would like to focus on. The evaluation from Kenya
would be used as guide for Malawi too and that there was need to list all cross cutting issues
that make a teacher a professional.
Issues for INSET:
Comments on issues were raised as follows:
� That the information collected so far from baseline study, can be used in selecting
learning experiences and content;
� That there was still a need to go back to the field to pin down on the real issues to
put in the INSET curriculum to make it relevant to the needs of the teachers.
![Page 70: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/70.jpg)
- 70 -
Prioritisation Of Problems Identified In The Baseline Study:
The group (core team) was divided into 4 subject teams to prioritise the problematic
topics. The participants identified and prioritised the way forward. People responsible for
each of the tasks to be done before the September Trial INSET were identified (see way
forward).
3.8. Action Plan for the Next Stage
At the end of the workshop, Malawian members took an initiative to draw the action plan
for the way forward. All participants witnessed that Malawi SMASSE INSET Team had
strong ownership to hold the “Trial INSET” in this coming September 2003, in which draft
of INSET curriculum and teaching materials will be practiced and examined to test their
feasibility and appropriateness.
![Page 71: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/71.jpg)
- 71 -
When (Time schedule) 2003 Remarks
By whom (responsible persons) 4 5 6 7 8 9
What ( Activities) 1 Set up College Based INSET Committee Mr. Chimenya 2 Further Baseline Study Mr. Phaundi-Shonga 3 Finalise INSET Curriculum Mr. Mkandawire 4 Develop INSET Modalities (prior + sept) Mr. Ndolo
5 Subject Group Meeting
Ms. Meke (HEC) Mr. Kuzemga (Physical Science) Mr. Msekandiana (Math) Mr. Phwetekere (Bio)
6 Develop Training Manuals Mrs. Yamamoto 7 Plan Lessons (resources) All TOTs
8 Procurement of Materials
Ms. Meke (HEC) Mr. Kuzemga (Physical Science) Mr. Msekandiana (Math) Mr. Phwetekere (Bio)
9 Peer Teaching Among Core Trainers All TOTs 10 INSET Programme Mr. Chimenya
11 Identify Trainers from Secondary Schools
All TOTs
12 Invitation of Trainers Mr. Chimenya 13 Conduct INSET All TOTs
* Detailed time schedule for each activity shall be drawn by the responsible person and be aware among all TOTs.
Table 4: Action Plan for Trial INSET
![Page 72: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/72.jpg)
- 72 -
44444444 AAAAAAAACCCCCCCCHHHHHHHHIIIIIIIIVVVVVVVVEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS AAAAAAAANNNNNNNNDDDDDDDD IIIIIIIISSSSSSSSSSSSSSSSUUUUUUUUEEEEEEEESSSSSSSS TTTTTTTTHHHHHHHHRRRRRRRROOOOOOOOUUUUUUUUGGGGGGGGHHHHHHHH TTTTTTTTHHHHHHHHEEEEEEEE JJJJJJJJOOOOOOOOIIIIIIIINNNNNNNNTTTTTTTT
WWWWWWWWOOOOOOOORRRRRRRRKKKKKKKKSSSSSSSSHHHHHHHHOOOOOOOOPPPPPPPP WWWWWWWWIIIIIIIITTTTTTTTHHHHHHHH KKKKKKKKEEEEEEEENNNNNNNNYYYYYYYYAAAAAAAA
4.1. ACHIEVEMENTS
4.1.1. Common Consensus for Sustainable Development
The one of the major purposes to conduct some activities such as stakeholders’
meeting, joint workshop since the preliminary stage of this programme is to sensitise all
players that our final goal is to institutionalise INSET system for secondary education.
INSET is nothing new in Malawi. Several types of INSET appeared in the past and
disappeared. Do we really satisfy the educational system that has not provided regular
training opportunities to teachers in order to upgrade their subject knowledge and
teaching methodology under this rapid change of society? Can we relax to oversee the
situation where school children are taught in an effective or sometimes wrong way for
better understanding? This is a fundamental question why all of us are making efforts
for this programme. “INSTITUTIONALISATION for sustainable development of
INSET”, that should be our common goal to share with.
Therefore, it is crucial for this programme to observe visible ownership from
Malawi side, in which management expenses for activities are expected to be
institutionalised in the public budget of education sector so that INSET activities can be
secured in the long run.
This joint workshop confirmed that the terms, institutionalisation, sustainability of
INSET is becoming common consensus among stakeholders with Domasi College of
Education, implementing agency and the centre of the programme.
4.1.2. Formulation of the Structure for SMASSE Activities
In December 2002, the Ministry welcomed the new Secretary for Education,
Science and Technology (SEST), which was used to be called Principal Permanent
Secretary (PS). With some time for the new SEST to comprehensive understanding
![Page 73: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/73.jpg)
- 73 -
about the status quo and issues in the education sector, the supporting structure from
policy side toward Malawi SMASSE INSET has being arranged based on his strong
leadership. By which, the Terms of References (TOR) was revised (See Annex 2). This
extends the first draft (Annex 1) to identify the roles of the Steering Committee, the
Technical committee and their memberships. These two committees are expected to
manage, supervise, monitor and evaluate each activity for SMASSE INSET.
4.1.3. Budget Securing
As the above 4.1.1. mentioned, the final goal we are targeting at, is to
institutionalise INSET so that it is critical issue for the sustainable programme to ensure
undertakings of management costs by Malawian side. The Divisional Education
Manager and the Education Methods Adviser in South East Division have been
involved in the programme by participating workshops, stakeholders’ and taskforce
meeting from the beginning. With their dedicated contributions and understandings on
institutionalising, management costs for SMASSE INSET Malawi have been
appropriated in the Division Office and DCE for the budget in the next fiscal year which
is going to be effective from July 2003. It can be seen as the realisation that real
ownership has grown up at the ground level for INSET in secondary education.
4.1.4. Involvement of Secondary Teachers
The staff shortage at DCE is the largest “Achilles’ Heel” for the implementation of
the programme (See the report “Y. Nakayama (2002) SMASSE INSET Malawi - its
possibility and issue -”). Most of staffs at DCE are engaged in pre-courses that require
them to undertake lectures at regular basis so that the activities for INSET end in
sidelines. This situation refers that restricting core trainers (who is expected to train
secondary teachers in INSET system) to DCE staffs is not realistic. Therefore, it is
necessary to extend DCE to capable secondary teachers, for example from conventional
secondary schools in the pilot area.
Based on this recognition, personal contacts with secondary science and
mathematics teachers were conducted in the fist Needs Assessment Survey, which was
carried out from November to December in 2002. Then those who showed strong
![Page 74: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/74.jpg)
- 74 -
interest on the programme were asked to be involved positively in the process of
preparation for the joint workshop with SMASSE Kenya. Not only be a part of
members, but they played an important role in the workshop. Hereafter they became
members of taskforce team organised at DCE and to be in course of enhancing the
activities of the programme.
4.1.5. Collaboration with CIDA SSTEP Project
CIDA has been supporting DCE through SSTEP project in which upgrading
teachers for those who are under qualified is conducted by distance mode. SMASSE
INSET is also originated in the problem of quality of education at secondary level,
especially from teaching methodological perspective. Therefore, collaborating with
SSTEP project is critical for the maximum effects under restricted resources.
Through the discussions with Dr Novak, the SSTEP project manager, on the
preparation for the joint workshop, we reached the consensus that SSTEP and SMASSE
are supplementary relations in which SSTEP is knowledge-based and SMASSE is
teaching methodology-based support for unqualified secondary teachers. And we have
agreed to interchange in each steering or technical committee to cooperate together.
In this collaborative manner, three subject supervisors for SSTEP projects
participated in the joint workshop and built mutual understandings on the effectiveness
and importance of SMASSE INSET.
4.1.6. Restructuring Domasi College of Education
At the beginning of the year 2003, the Office for Presidency and Cabinet (OPC)
conducted the survey in DCE on human resources development and management. DCE
pointed out the structural problems of staff shortage and proposed the establishment of
new faculty named “Faculty of Distance and Continuing Education”. According to
this proposal, the Department of Distance Education and the Department of In-Service
Education and Training (INSET) shall stand at parallel. With the support from SSTEP
and SMASSE for each department and establishing the new independent faculty,
ensuring the staffs and budgets for each activity can be expected.
![Page 75: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/75.jpg)
- 75 -
If this plan became true, the institutionalisation of INSET would be visible in
staffing, budgeting and structuring for the future sustainability.
4.2. Issues
4.2.1. When will Restructuring Be Done?
The proposal to establish the new faculty as 4.1.6. mentioned above is a critical
point for the sustainable INSET system. However, it is still unclear when and what kind
of shape that will be.
4.2.2. Is the Restructuring DCE a Panacea for Filling the Gap?
The vacancies of the established posts are not something new to anywhere in the
government. This problem of shortage of human resources is a national matter and
permanent so that only restructuring DCE cannot simply solve the problem.
4.2.3. How Much will really be Disbursed for INSET Activities?
The planning the budget for INSET activities is one thing, but the disbursement is
another. Even though the South East Division and DCE planed to reserve for the next
fiscal year, nobody knows how much really can be down to each level and how much
can be used for. About 80% of the proposed budget is the actual one so putting it in
place for INSET activities as one of priorities’ area is important.
4.2.4. How Can the Continuity Maintain at the Policy Level?
The Ministry often finds it difficult to coordinate the matter, which relates to several
divisions such as Planning, Secondary Education and Education Methods Advisory
Services (EMAS). The SMASSE INSET is a type of this matter. On the other hand, if
the programme relies on a strong leadership, it might be exposed to the political
influence such as so quick turnover of high level officers. Therefore, it is a question of
continuity of the policy in INSET system.
![Page 76: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/76.jpg)
- 76 -
55555555 SSSSSSSSMMMMMMMMAAAAAAAASSSSSSSSSSSSSSSSEEEEEEEE IIIIIIIINNNNNNNNSSSSSSSSEEEEEEEETTTTTTTT MMMMMMMMAAAAAAAALLLLLLLLAAAAAAAAWWWWWWWWIIIIIIII AAAAAAAANNNNNNNNDDDDDDDD IIIIIIIITTTTTTTTSSSSSSSS FFFFFFFFUUUUUUUUTTTTTTTTUUUUUUUURRRRRRRREEEEEEEE
5.1. Scope of Technical Assistance
JICA has been providing technical supports for the establishment of SMASSE
INSET Malawi system with the cooperation from SMASSE Kenya and the regional
association for strengthening mathematics and science in secondary education. These
supports have been small-scale but flexible since the funding resource is based on the
budget for promoting local activities (BLA) by the Education Planning Adviser who is
based on the Ministry of Education, Lilongwe. There are two approaches to be
considered for bordering the scope of technical cooperation as follows;
1) Continuing the support by BLA (as we are undertaking);
2) Extending it into “Technical Cooperation Project (TCP)” type support in which
the organised technical cooperation and the clear expected output are expected.
The table below is the comparison, advantages and disadvantages between two
approaches.
Table 5: Comparative table of BLA and TCP
Advantage Disadvantage/Killer Assumption
BLA
① Supports can be possible based on the minimum required capacity to implement the programme and self-reliance from Malawi side.
② Too much input that exceeds the capacity to receive is avoidable.
① Contents and scope of supports will be restricted.
② Possibly the supports such as regional cooperation and in-country workshops end in single not holistic and effective.
TCP
① Technical Cooperation at Domasi will be organised strengthen.
② The procurement of equipment enhances the implementing capacity of INSET activities.
③ Comprehensive collaboration with NIPDEP (targeting on the capacity building at district educational administration) can be possible.
④ The regional cooperation under SMASSE-WECSA will be promoted and can visualise.
① The capacity to cover management costs by Malawi side is questionable.
② The policy incentives to motivate serving teachers to participate in INSET activities have not put in place.
③ Needs for strong leadership, in other words, the programme might be influenced by turnover of high level officers in the Ministry.
![Page 77: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/77.jpg)
- 77 -
5.2. Proposals for Technical Cooperation–Minimum Requirement
But Wider Approach-
5.2.1. Supports to Education Sector by Other Development
Partners
Based on the Policy Investment and Framework (PIF) that was officially legislated
in September 2000 as the highest sector policy paper, the assistance to education sector
in Malawi has been conducted in the framework of Sector Wide Approaches (SWAp).
The main development partners in education sector are DFID, USAID, GTZ, WB,
UNICEF, AfDB, UNFPA and JICA. Among these partners, the regular meeting is held
once in a month. In that meeting, the progress of support activities, policy issues, the
schedule for the future are reported or discussed. And the Joint Sector Review Meeting
is held every year from 2000 in which all activities in the year are reviewed. The year,
2002, discussed about the theme of funding education sector in November.
Figure 4 demonstrates the situation analysis of assistance to education sector by
development partners. This tells us that most of the supports are concentrating on the
primary sub-sector due to the urgent issues of the rapid expansion of enrolments at that
level, the necessity to develop more teachers, the improvement for relevant curriculum,
and the equipment of the facilities, learning materials after Free Primary Education
(FPE) policy in 1994. For the primary sub-sector, the positive support has been
provided by USAID, DFID, CIDA, GTZ and UNICEF.
On the other hand, the few development partners are offering supports to the
vocational, secondary and teacher development education. This overemphasis of
primary education support can be observed in the budget allocation as well. Table 6
shows the budget planning of each education sub-sector approved by the Ministry of
Finance for 2002/03 fiscal year3. It proves that 76% of the budget is shared by the
primary education, and only 13% and 7% for secondary and teacher development
education respectively.
3 The budget for higher and vocational education has not been approved.
![Page 78: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/78.jpg)
- 78 -
Table 6: Budget Allocation for each sub-sector (Unit:MK;Malawi Kwacha、1$=90MK April 2003) Source: MoEST(2002) Understanding Education Budget, P13.
5.2.2. Issues of Supporting Education Sector
The overemphasis on the primary sub-sector in both financing and the level of
commitments by development partners can be observed as mentioned above. This is the
result of coping with the improvement of access, quality and management at school
level in that sub-sector as the emergent issues after 1994. And that has been always
given the first priority in the Malawi Poverty Reduction Strategy Paper (MPRSP) and
PIF. This effort brought tremendous achievements in the development of primary
education to some extent even though issues are still remaining.
However, nine years have passed since FPE. Another wave by the population group,
which was expanded primary enrolments at that time, is surging to secondary sub-sector.
Though the Distance Education Centres (DECs) were transformed, in order to absorb it,
into Community Day Secondary Schools (CDSS) as institutions to provide secondary
education in 1998, the quality of their facilities is not satisfied enough to conduct that
level. Moreover, most of teachers at CDSS are under qualified, which means they have
only certified as primary teachers, so that nominally CDSS are “secondary school” but
there is little capacity to deal with providing education of that level.
Having faced with this situation, the supporting structure to education sector in
Malawi lacks appropriate balance in each sub-sector. Hereafter, reconsiderations on
teacher education and development to ensure the quality for basic education is the
critical issue.
Sub-Sector Budget (MK) Share out of the Total (%) Administration and Management 206,095,600 4.1
Primary 3,827,576,100 75.8Secondary 667,266,000 13.2
Teacher Education and Development 350,983,000 6.9Total 5,051,920,700 100.0
![Page 79: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/79.jpg)
- 79 -
Primary
Secondary
Vocationally
Tertiary
Teacher Dev.& Edu.
Non Formal Education(HIV/AIDS Edu.,Civic Edu.)
Formal Education
Education Administration (Ministry, Division, District)
USAID - GABLE,(UPIC, ICET) - QUEST (SMC-EQ, IEQ).
DFID – ESSP, PCAR CIDA – GSES GTZ – MIITEP UNICEF – Basic Education Programme
WB: SEP, PHRD
1) Primary:DFID, USAID, GTZ 2) Secondary:CIDA: SSTEP
GTZ: MIITEP WB: SEP
UNICEF: HIV/AIDS Club, Girls’ Education, Education for out-of-school children NGO: - CRECCOM - Save the Children (UK,US) - Africare etc.
ECCD
All Development Partners: Technical Advice and Capacity Building on Policy Planning, Management, Monitoring and Evaluation
Figure 4: Assistance for Education Sector in Malawi
Development Study:NIPDEP JICA Expert:Education Planning Adviser
Grant Aid: The Project for Domasi College of Education SV:Science Education Methods Adviser
Expert Local Activity: The Project for St John’s Primary School
JOCV: Science and Mathematics Teacher
Other Development Partners
Assistance by Japan
![Page 80: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/80.jpg)
- 80 -
5.2.3. Supports to Education Sector by Japan
The supports to education sector in Malawi by Japan can be expressed as “marking
points” through technical support of planning and implementing the projects in each
scheme of “Development Study4” and “Grant Aid5”, by the displacement of the
“Education Planning Adviser” in the Ministry of Education, Science and Technology
(See Figure 4).
The support for education development needs multidimensional approaches.,
Several dimensional approaches, for example, in order to enhance the quality of
education, not only the improvement of facilities but training teachers with providing
effective learning materials, sensitising in the community on understanding of education
and capacity building at administrative level are necessary. For that reason, Japan is
required to take the program approach, which promotes to relate on-going supports
which marked as “a point” in order to transform them into “holistic or comprehensive”
technical assistance in the future. In other words, it is important to support education
sector in Malawi as an organic/strategic programme in which each project would be
integrated to supplement each other under the overall programme.
Moreover, with looking at the supports by other development partners on primary
education, it is strongly recommendable to commit the secondary education and teacher
education so that the well-balanced support in education sector as a whole could be
achieved and the relative advantage in assisting the development at that level of
education by the maximum usage of experiences and know-how in Asian countries such
as Philippine, Cambodia or other African countries such as Ghana, Kenya and South
Africa could be applied.
Figure 5 demonstrates the concept of programme support to education sector in
Malawi by integrating on-going projects.
4 2000-02: National School Mapping and Micro-planning, 2002-04: National Implementation Programme for District Education Plans 5 2003: The basic design study for the project for the improvement at Domasi College of Education
![Page 81: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/81.jpg)
- 81 -
Figure 5: Concept of Programme Support to Education Sector in Malawi
Three strata can be considered in the framework to support education sector in
Malawi in the future.
The first stratum is the support to establish SMASSE INSET Malawi based on DCE.
This is targeting at under qualified teachers, especially at DCSS in the South East
Capacity Building in Educational Administration : NIPDEP Pilot Areas
Secondary & Teacher Development
SMASSE INSET Malawi
South East Division
Domasi College of Education (DCE)
Grant Aid for strengthening the
capacity of facilities
SMSSE WECSA NETWORK Africa Regional Cooperation
Support
3rd Stratum
1st Stratum
2nd Stratum
![Page 82: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/82.jpg)
- 82 -
Division as the pilot area where DCE is also located. The SSTEP project by CIDA is
strengthening the subject knowledge to upgrade their certificates from primary to
secondary level and the SMASSE INSET Malawi is expected to strengthen how that
knowledge can be transferred to students in the class, in other words, empowering
teaching methodologies of teachers. Besides, the secondary demonstration school is on
the plan through the grant aid project, at which INSET workshop will be implemented
to embody the harmonisation hardware supports with software ones.
The second stratum is the support for capacity building for education administrators
through the Development Study, NIPDEP. At present, NIPDEP is under going to
strengthen the administrative capacity and to promote decentralisation in education
through the implementation of District Education Plans made in micro-planning phase I.
This stratum is playing an important role to assist the secondary and teacher
development education that is the first stratum from administrative perspectives. The
effects of the support for teaching/learning materials and teacher development would be
decreased if the administrative supporting system were vulnerable. Therefore, for the
effective support to enhance the implementation of education development policy, the
collaborative matching the first stratum with the second is critically important.
The third stratum is the support through regional cooperation in Africa. SMASSE
INSET Malawi, the first stratum, has been conducting the preparatory stage through
technical exchanges or tripartite counterpart trainings since 2001. The more the regional
network on secondary mathematics and science education under the umbrella of
SMASSE-WECSA is strengthen, the more SMASSE INSET Malawi will be
empowered through sharing and exchanging the experiences and knowledge in the
African region.
As mentioned above, the approach how Japan supports the education sector in
Malawi is not “point marking” but “comprehensive and holistic”. Three strata, which
have been built by the assistance in the past, should be integrated to encourage synergy
effects in which each support can be interrelated in an effective manner.
![Page 83: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/83.jpg)
- 83 -
5.2.4. Proposed Schedule6 for Transforming into
Programme-Based Support
The Table 7 shows the time framework for each on-going projects.
With this given schedule, three scenarios can be considered for the transforming the
existing projects into programme-based supports as the following.
A) Dec. 2003 / Jan. 2004 ~: The point when the Stage 27 of SMASSE INSET
Malawi preparatory programme finishes
B) Apr/May. 2004~ : The point when the Pilot Project 1 of NIPDEP
finishes
C) Dec. 2004 /Jan. 2005~ : The point when the Stage 3 of SMASSE INSET
Malawi Preparatory programme finishes
Year 2003 2004 2005
Fiscal Year
2003 2004 05
Month 6 7 8 9 10 11 12 1 2 3 4 5 6 7 8 9 10 11 12 1 2 3 4
NIPDEP Pilot Project 1 Pilot Project 2
Grant Aid
at DCE Basic Design Study
Implementation (construction & procurement)
expected
SMASSE STAGE 2 STAGE 3
scenario (A)▲ (B)▲ (C)▲
Table 7:::: Proposed Time Schedule for Transforming into Programme-based Support
In order to examine the appropriateness of each scenario, we try to adopt six
indicators below in this paper.
(a) Contribution to each
project:
An indicator to assess how impact on each
project it can be expected
(b) Effectiveness for the
integration:
An indicator to assess how appropriate of the
timing for the integration of each project
6 For the detailed information about the schedule of each project, see Annex 3 (NIPDEP) and Annex 4 (SMASSE INSET Malawi). 7 See Annex 5 for the expected purposes and activities for each stage of the preparatory stage of SMASSE INSET Malawi system
![Page 84: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/84.jpg)
- 84 -
(c) Cost-efficiency on the
procedure:
An indicator to assess how cost-effective for the
transition into programme-based support
(d) Ownership of the
programme:
An indicator to assess when the sense of
ownership can sustain
(e) Budget undertakings
from Malawi:
An indicator to assess how budget commitment
from Malawi side can be secured
(f) Sustainability: An indicator to assess when is appropriate to
ensure the sustainability of the programme
Table 8: Assessment of each Scenario
The table 8 is presenting the impact assessment of each scenario.
In terms of the extent of Contribution, the earlier the integrated programme starts,
the more on-going projects could benefits, especially, SMASSE INSET Malawi could
expect organised and effective technical supports from it.
On Effectiveness for integrating each project, the scenario B would be the most
ideal since if we look at NIPDEP to absorb in the programme, seeing the progress of the
pilot project 1 would give us some ideas for the plan to integrate those projects.
However, after completing pilot project 2 might be late for combining several projects.
It would be better to start one of these then involve the other afterward.
From the perspective of Cost-efficiency, the scenario C would be the best for both
preparatory stage of SMASSE INSET and NIPDEP will be finished and can start the
new programme at the same time.
For Ownership and Sustainability, no difference can be seen in all three scenarios
so far. If we assume that the level of ownership and sustainability can be assessed by 1)
a strong political will or commitment, 2) a proper budget/human resources allocation
and 3) an organising structure to support the activities, Malawi gets clear about all these
factors as of May 2003 with the conditions that the budget reserved in planning for
Indicators Scenario
(a) (b) (c) (d) (e) (f) Total
Evaluation
A ◎ ○ ○ ○ ○ ○ 1
B ○ ◎ ○ ○ △ ○ 2
C △ △ ◎ ○ △ ○ 3
![Page 85: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/85.jpg)
- 85 -
supporting SMASSE INSET would be disbursed on proper time and place. That is why
the Budgeting factor is the question in scenario B and C. The fiscal calendar of Malawi
is from July to next June. On the condition that the budget for SMASSE is secured at
the beginning of the 2003/04 fiscal year, around the time that scenario A proposes is
more favourable than B and C because on the earlier of the fiscal year is, the more
possible to disburse budget to specific activities. And the budget planning for the next
fiscal year is not fixed yet.
In conclusion, the scenario A or B is recommendable for the timing to transform
project-based support into an integrated programme.
5.3. Outline of the Proposed Programme
This Progress Report II on the Pilot Programme for Establishment of SMASSE
INSET Malawi would like to conclude by proposing the outline of the programme for
the future cooperation between Malawi and Japan in education sector. There are
twofold; 1) component 1 for supporting SMASSE INSET Malawi and 2) component 2
for supporting for institutional capacity building at central, divisional and district level.
5.3.1. Component 1 – SMASSE INSET Malawi –
Through this component 1, the sustainable In-service training (INSET) system for
secondary teachers will be established.
Implementation Period: 5 years (60 months)
Overall Goals The sustainable INSET system (SMASSE INSET Malawi) for especially mathematics and science teachers is institutionalised in Malawi.
Project Purposes 1) The INSET system is institutionalised in the South East Division, the pilot area.
2) Quality of education in mathematics and science at secondary level is enhanced through INSET of teachers in the pilot area.
Expected Outputs 1) The sustainable system of training for divisional trainers in the pilot area in mathematics and science is established at Domasi College of Education (DCE)
2) The sustainable system of INSET in mathematics and
![Page 86: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/86.jpg)
- 86 -
science is established in the pilot area. 3) Capacity in teaching methodologies of mathematics and
science among teachers in the pilot are improved 4) The roles of DCE as resource centre in implementing
INSET is strengthen Major Activities 1-1: To select divisional trainers in the pilot area
1-2: To train divisional trainers for the pilot area at DCE 1-3: To conduct monitoring/evaluation in are of
effectiveness of INSET 1-4: To support INSET through follow-up activities 2-1: To select trainees and schools for INSET in the pilot
area 2-2: To improve teaching and learning conditions in
mathematics and science at the selected schools in the pilot area
2-3: To implement INSET at DCE 2-4: To promote secondary educational management courses
for relevant officers at MoEST and school managers in the pilot area
3-1: To study, analyse and evaluate the present situation, problems and needs in mathematics and science education at secondary level in the pilot area
3-2: To conduct the study in subject teaching methodology and contents of pre-service teaching manuals in mathematics and science
3-3: To upgrade the capacity of counterparts in managing the projects
3-4: To develop and produce syllabi/curricula for INSET on the mathematics and science subjects
3-5: To develop and produce training materials for INSET on the mathematics and science subjects
3-6: To develop and produce teachers’ guides and manuals for experiments which are based on the maximum usage of local resources and situations
3-7: To develop and produce manuals for management of teaching/learning resources
4-1: To establish and promote to exchange information on subject matters among secondary school teachers when need arises
4-2: To promote and practice mathematics and science activities when need arises
Project Areas South East Division Target Groups
Secondary teachers in mathematics and science (including Home Economics) who are under-qualified
Inputs 1. Malawian side: a) Offering offices and other necessary facilities b) Assignment of Malawian counterparts at DCE
![Page 87: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/87.jpg)
- 87 -
c) Assignment of administrative counterparts at MoEST d) Expenses necessary for the implementation of the
activities e) A certain percentage of expenses for mathematics and
science teachers to attend INSET at DCE in the pilot area
2. Japanese side*: a) Dispatch of long-term technical experts b) Dispatch of short-term technical experts c) Provision of counterpart training d) Provision of equipment
Supervising Agency Ministry of Education, Science and Technology Implementing Agency Domasi College of Education
* Proposed Input from Japanese side:
Assigned/Distributed Organisation No. Purposes
Technical Cooperation Experts
DCE 2~3 Technical support on implementing
INSET Department of Teacher
Education and Development (DTED)/
Education Methods Advisory Services (EMAS)
1 Technical support on planning,
monitoring and evaluating the
development of secondary
education teacher education in the
Ministry
Planning Department� (Team Leader) 1
Support of Equipment
Vehicle DCE 1~2 Implementing/M
onitoring INSET activities South East Divisional
Office 1
Office Equipment
DCE South East Divisional
Office Core Secondary Schools
S/A
For effective office work in development learning materials or logistical matter
� The technical adviser dispatched to Planning Department in the Ministry is expected to be a team leader and to hold the post of adviser for Administrative Capacity Building, component 2 in the programme support.
![Page 88: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/88.jpg)
- 88 -
Reference books DCE S/A
For developing teaching and
learning materials
Counterpart Training
Japan/ SMASSE-WECSA
Kenya SMASSE/Ghana SMC
10-30/year
Strengthening capacity in
INSET management
* S/A: Situational Assessment is necessary
5.3.2. Component 2 – Administrative Capacity Building in
Education –
Overall Goals The institutional capacity at the central and local administrative system in the primary and secondary education is strengthen in Malawi.
Project Purposes The administrative system to implement District Education Plans (DEPs) is established at central and district level in the pilot areas.
Expected Outputs 1) The sustainable system of updating DEPs in each district is established.
2) The sustainable system of training for divisional and district education officers in administrative and financial management is established.
3) Capacity in planning, implementing, monitoring and evaluating the activities in education sector is improved
4) The collaborative implementation of activities between the central and district education offices is strengthen
Major Activities 1-1: To identify trainers at central, divisional and district level
1-2: To train trainers in updating data of DEPs 1-3: To develop a schedule and roles of officers at each
administrative level for updating DEPs 1-4: To strengthen funding management 2-1: To develop guidelines of carrier development through
training in administrative management 2-2: To conduct training workshop/seminar for educational
management 2-3: To develop guidelines of performance assessment for
individual personnel and each education offices 2-4: To implement workshop and seminars at each
administrative level 3-1: To study, analyse and evaluate the present situation,
problems and needs in education policy management at each administrative level
3-2: To upgrade the capacity of counterparts/trainees in managing the projects
3-5: To develop and produce training materials for
![Page 89: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/89.jpg)
- 89 -
administrative personnel at each level 3-7: To develop and produce manuals for management of
educational offices at each level 4-1: To establish and promote effective information flow
between central offices and district level 4-2: To promote and practice educational activities in
administration when need arises Project Areas Whole nation Target Groups Ministry officers at Central, divisional and district level Inputs 3. Malawian side:
a) Offering offices and other necessary facilities b) Assignment of Malawian counterparts in the Ministry
at Lilongwe, Mzuzu and Blantyre c) Assignment of administrative counterparts at MoEST d) Expenses necessary for the implementation of the
activities e) A certain percentage of expenses for manageing
activities 4. Japanese side*:
a) Dispatch of long-term technical experts b) Dispatch of short-term technical experts c) Provision of counterpart training d) Provision of equipment
Supervising Agency Ministry of Education, Science and Technology Implementing Agency Ministry Headquarter, North Divisional Office, South West
Divisional Office and relevant districts education offices
![Page 90: 02 SMASSE INSET Malawi Pilot Programme Progress Report II Main](https://reader033.vdocuments.mx/reader033/viewer/2022061118/54682cd4af795979338b5b1e/html5/thumbnails/90.jpg)
- 90 -
* Proposed Input from Japanese side:
Assigned/Distributed Organisation No. Purposes
Technical Cooperation Experts
Planning Department� (Team Leader) 1
Technical support on planning,
monitoring and evaluating the programme for administrative
capacity building
North Divisional Office (Mzuzu) 1
South West Divisional Office (Blantyre) 1
Support of Equipment
Vehicle
MoEST Headquarters (Lilongwe) 1
For the effective management of
activities
North Divisional Office (Mzuzu) 1
South West Divisional Office (Blantyre) 1
Office Equipment The pilot areas S/A
For effective office work in planning and management
Counterpart Training
Japan/ Africa-Asia regional cooperation
Tanzania/Colombo Plan Secretariat
10-20/year
Strengthening capacity in
administrative management
* S/A: Situational Assessment is necessary
� Please see the footnotes of Component 1.