Journal of Cellular Biochemistry 103:719–729 (2008)

The Role of Heat Shock Protein 27 in ExtravillousTrophoblast Differentiation

S. Tartakover Matalon,1* L. Drucker,1,2 A. Fishman,3 A. Ornoy,4 and M. Lishner1,2

1Oncogenetic Laboratory, Meir Medical Center, Kfar-Saba, Israel2Department of Medicine ‘A, Meir Medical Center, and Tel-Aviv University, Kfar-Saba, Israel3Department of Obstetrics & Gynecology, Meir Medical Center, Kfar-Saba, Israel4Department of Anatomy and Cell Biology, Hebrew University, Hadassah Medical School, Jerusalem, Israel

Abstract Trophoblast cells from placental explants differentiate in culture to extravillous trophoblast cells (EVTcells). During trophoblast differentiation heat-shock-protein-27 (HSP27) mRNA and multidrug-resistance-protein-5(MRP5, transporter of cyclic nucleotides) expression are increased. HSP27 is a regulator of actin filaments structure anddynamic, has a role in cell differentiation and may affect NF-kB activity. In this study we aimed to assess HSP27 level introphoblast cells and its correlation with motility and differentiation related processes [MMPs activity, nitric oxide (NO),inducible nitric oxide synthase (iNOS), proliferation and MRP5 levels]. We evaluated HSP27 expression in a first trimesterhuman trophoblast explants model designed to assess EVT cells differentiation/migration with/without 6-mercaptopurine(6MP, an EVT inhibitor of migration). We found that HSP27 level is expressed in the nucleous and cytoplasm of non-proliferting villous-trophoblast cells (negative for Ki67) and in the cell periphery and cytoplasm of motile EVT cells.Moreover, 6MP decreased HSP27 nucleous expression that was associated with inhibited MMP2 activity and NOproduction. Also decreased iNOS expression and increased MRP5 mRNA levels were observed. In conclusion, HSP27expression is modulated in concordance with migration dependent parameters in trophoblast cells. J. Cell. Biochem. 103:719–729, 2008. � 2007 Wiley-Liss, Inc.

Key words: 6-mercaptopurine; HSP27; MMP2; NO; MRP5; trophoblast

Successful invasion and remodeling of theuterine vasculature by extravillous trophoblast(EVT) cells are crucial steps in early pregnancy.cytotrophoblast (CT) cellsmaydifferentiate intoEVT cells which migrate and invade maternaluterine blood vessels [Genbacev et al., 1992;Malassine and Cronier, 2002]. During matura-tion CT cells switch from a proliferative state inthe proximal inner part of the column into aninvasive, non-proliferative phenotype at thedistal external part of the column [Bulmeret al., 1988; Genbacev et al., 1992]. Decreasedtrophoblastic invasion may be responsible for

preeclampsia, which is an important cause ofmaternal and fetal mortality. Interestingly,lately it was demonstrated that heat-shock-protein-27 (HSP27) levels are elevated in theplacentae of women with preeclampsia incomparison to normal term gestations [Geisleret al., 2004].HSP27, actively transcribed duringtrophoblast differentiation, is a downstreamregulator of actin filaments structure anddynamics [Landry and Huot, 1995; Morrishet al., 1996; Hirano et al., 2004]. Associationbetween HSP27 levels and MMPs, importantfacilitators of trophoblast invasion, level, andfunction has been described [Hansen et al.,2001; Aldrian et al., 2002]. HSP27 may also beinvolved in NF-kB regulation, which is respon-sible for transcription of the inducible nitricoxide synthase (iNOS) and resultant nitricoxide (NO) [Guzik et al., 2003; Parcellier et al.,2003]. Interestingly, NO and cGMP areinvolved in trophoblast motility and apoptosisand may be regulated by multidrug-resistance-protein-5 (MRP5) [Cartwright et al., 1999,2002; Xu et al., 2004; Dash et al., 2005]. MRP5

� 2007 Wiley-Liss, Inc.

Grant sponsor: Tel Aviv University- Hospital for SickChildren in Toronto exchange program.

*Correspondence to: S. Tartakover Matalon, OncogeneticLaboratory, Meir Medical Center, 45 Tshernehovski St.,Kfar-Saba 44281, Israel.E-mail: matalon.shelly@clalit.org.il

Received 13 June 2007; Accepted 14 June 2007

DOI 10.1002/jcb.21476

is a transmembrane transport protein for cyclicnucleotides [especially 30,50-cyclic GMP (cGMP)]recently suggested to participate in placentaldifferentiation [Xu et al., 2004; Meyer et al.,2005]. One of MRP5 substrates is the immuno-suppressive/chemotherapeutic agent 6-merc-aptopurine (6MP) which was previouslyreported by us to inhibit EVT cells invasion intothe matrigel [Estlin 2001; Matalon et al., 2005;Ritter et al., 2005]. In this study we aimed toassessHSP27 expression and levels duringEVTdifferentiation in placental explants and after6MP induced inhibition ofmigration.Moreover,associations between HSP27 levels, motility,and differentiation related processes (MMPsactivity, Ki67, iNOS, and NO) were studied.Also, MRP5 levels (mRNA), which may affect6MP and cGMP cytoplasmatic concentrationswere examined as well.

MATERIALS AND METHODS

Tissue Preparation and Culture

The local ethical committee has approved theuse of placental tissues. Placentae (6–8 weeks)retrieved from normal pregnancies terminatedlegally due to psychosocial causes were used.Placental villi were dissected from the fetalmembranes [Genbacev et al., 1992; Matalonet al., 2005]. Explants of 10mgwet-weight weretransferred into culture dish inserts (pore size:0.4 mm, diameter: 12 mm, Millipore Corpora-tion, Bedford), layered with 200 ml matrigel (BDBiosciences, Bedford). DMEM supplementedwith L-glutamine (2 mM), sodium pyruvate(1 mM), antibiotics, fetal-calf-serum (10%),was added to the lower well of the culture dish(bottom-medium) and no medium was addedabove the explants (Biological Industries, Beit-Haemek-Israel). Cultures were preincubatedovernight in 5% CO2 incubator. Twelve to 16 hlater bottom-media was replaced and mediawith/without 6MP in clinically relevant concen-trations (0.01 mM in 1MNaOH, SigmaM7000)was added above the placenta (top-medium).6MP was dissolved in NaOH 1 M (50 mg/ml),and diluted with themedium to the appropriateconcentration. Five placentae were analyzed inthe study. Medium with NaOH alone served ascontrol. An additional control of media onlywas included in three experiments. Indeed, noeffects of NaOH were observed in assayedparameters (data not shown). Both media fromthe insert (top) and from the well (bottom) were

replaced 24, 72, and 96 h from initiation ofexperiments and stored at�808C. Triplicates ofeach treatment for each placenta in every timepoint were preformed. Villi were dissected 24and 96 h after experiments initiation. Speci-mens were fixed (4% buffered formaldehyde)and paraffin embedded or freezes in liquidnitrogen for molecular analysis. Previouslythese cultures were used to analyze the effectof 6MP on trophoblast cell migration, apoptosis,and proliferation [Matalon et al., 2005].

HSP27 Analysis

HSP27 analysis was done by immunohisto-chemistry methods. 6MP affected HSP27 exp-ression in the villous trophoblast cells (VTCs,whereas, most EVT cells with/without 6MPexpress HSP27 in the cytoplasm). Proteinisolation from the placental explants couldreflect the protein levels of both cell populations(villous/EVT cells) and mask the differences inHSP27 levels in the villous cells. However,immunohistochemistry which allows visualseparation between different cells reflectedsolely the HSP27 levels on the VTCs. Theimmunohistochemistry method is described inthe next section.

Immunohistochemistry

Sections were deparaffinized and pretreatedwith proteinase K (Ki67 staining only),immersed in 10 nM (pH 6) sodium citrate bufferand heated in a microwave oven. Endogenousperoxides activity was quenched in 1% H2O2.

Then the slides were washed trice with PBS,coveredwith blocker serum, and incubatedwiththe primary antibody for 20 h in 48C (mouseanti low molecular weight cytokreatin, IgG1,Zymed, San Francisco, mouse anti Ki67,0.16 mg/ml, clone 7B11, IgG1 Zymed; mouseanti HSP27, 1.5 mg/ml, clone G3.1, IgG1,Chemicon, CA; rabbit anti iNOS, 2 mg/ml,polyclonal, Novous biologicals, Inc.). Next,slides were washed trice with PBS, incubatedwith biotinylated antibody (10 min, 208C),washed trice again and covered with horse-radish peroxidase conjugated streptavidin(HRP-SA, 10min, 208C), washed trice againwith PBS and developed with AEC–chromogen(Biotinylated antibody, HRP-SA, and AECbelongs to ‘‘Histostain plus’’ KIT Zymed labo-ratories, San Francisco, CA). Sections werecounterstained with Mayer’s hematoxylin. Iso-type matched control antibodies were used to

720 Matalon et al.

exclude non-specific staining. No staining wasobserved in these procedures. For double stain-ing procedure (HSP27 and Ki67) following AECdevelopment of Ki67 staining, slides werewashed trice with double distill water, coveredwith denaturing solution (3 min, 208C, BiocareMedical, CA), washed trice with PBS andincubated for 2h (208C)with the secondprimaryantibody for HSP27. Following PBS washingthe slides were incubated with biotinylatedantibody, covered with streptavidin conjugatedalkaline phosphatase (DBS), washed tricewith PBS, and developed with BCIP/NBT–chromogen (chemicon).

Cell Counting

Microscopic evaluation (400�) allowed enu-meration of stained cells out of trophoblast cellspresent in every villous of every slice as detailedin Table I. VTCs were analyzed for HSP27 andiNOS staining,whereasEVT cells (most of themweakly positive for HSP27) were analyzed onlyfor iNOS expression. Syncytiotrophoblast cellswere not studied in this research. Experimentswere carried out on five different placentae;accept the analysis of HSP27 levels follow-ing 24 h exposure that was tested in threeplacentae. Triplicates of each treatment foreach placenta in every time point were pre-formed. (Since we analyzed 5 placentae wehad 15 replicate for each treatment, accept foranalyzing HSP27 in 24 h that was preformednine times). We counted cells in 2 slices fromeach of the 15 or 9 replicates. In every slice, cellswere counted in 5–10 different villi.

Gelatin Zymography

Top media of all placentae were collected forgelatinase activity. Aliquots (20 ml) of top mediafrom 10 mg placental explant culture wereelectrophoresed at non-reducing conditions in10% polyacrylamide gels containing 1 mg/ml

gelatin typeA (Sigma, St. Louis,MO).Gelswerewashed trice in 2.5%TritonX-100 for gelatinaserenaturation and incubated overnight in 50mMTris–HCl (pH 7.5) and 5 mM CaCl2. Coomassieblue staining followed by destaining allowedvisualization of clear lysis zones. Analysis wasdone on three randomly chosen explants fromeach treatment in every experiment (3� 5¼ 15explants per treatment). MM2 andMMP9 wereidentified by gelatinase zymogram standardsfor human MMP2 and MMP9 (Chemicon) thatwere electrophoresed adjacent to the placentalaliquot. Analysis of gel bands intensity wasdone employing Gel Doc 2000 (Bio-Rad Labo-ratories, Hercules, CA). Evaluation of MMPactivity was done bymultiplication of band area(area) with light intensity that pass through theband (count) (count� area).

Nitric Oxide Detection

We assessed levels of nitrite, a stable end-product of nitric oxide with Griess reagent(100 ml, 1% sulfanilamide, 0.1% naphthylethy-lenediamine dihydrochloride in 2.5% H3PO4)mixed with 200 ml top medium of threerandomly chosen 10 mg placental explantsincubated 96 h with/without 6MP in eachexperiment (3� 5¼ 15 explants/treatment).Absorbance was measured at 550 nM. Nitritelevels were extrapolated from a standard curveof NaNO2.

Semi-Quantitative RT-PCR

Total RNA was extracted from the tropho-blast explantsemployingPURESCRIPT(Gentra#R-5110) according to manufacturer’s specifi-cations and reverse transcribed (SuperScriptIITM, GIBCOBRL #18053-017) with oligo d(T)15primers. Three microliter MRP5 cDNA wereamplified in a multiplex reaction with a house-keeping gene (b-actin) as an internal referenceof the reaction efficiency. PCR was optimized

TABLE I. Cell Counting of HSP27, Ki67, and iNOS in Human Trophoblast Cells

Ag. Timea NReplicate/treatment Slicesb Villi/slice

Cells in the villiaverageþSTD

EVT in thematrigel/slice

Control 6MP Control 6MP

iNOS 96 5 5� 3¼ 15 30 5 49þ 25 46þ 18 76þ 38 75þ 39HSP27 96 5 5� 3¼ 15 30 5–10 75þ 47 66þ 41 NC NCHSP27 24 3 3� 3¼9 18 5–10 87þ 55 79þ 48 NC NC

N, number of placentae.NC, not count.aTime from experimental initiation (h).bSlices per treatment (6MP, Control).

HSP27 Role in Human Placental Differentiation 721

(logarithmic phase) at an initial denaturationof 1 min at 958C followed by 12 cycles of 30 s at958C (denaturation), 30 s at 628C/increment�0.58C per cycle (annealing), 25 s at 728C(extension) and 23 cycles of 20 s at 958C(denaturation), 25 s at 568C (annealing), 25 sat 728C (extension). Primers used were: MRP5sense 50TCCATGCATTCTCAGCTCAG30; anti-sense 50CGTCT GGCCCAACTTCATTC; b-actin sense 50GAGACCTTCAACACCCCAG-C30; antisense 50GCTCATTGCCAATGGTGA-TG30. Electrophoresed RT-PCR products werevisualized with Gel Doc 2000 andMulti-analystsoftware (Bio-Rad). RT-PCR products werenormalized according to b-actin amplificationefficiency and then compared with transcriptlevel of untreated placental explants. Ninecontrols and seven 6MP treated trophoblastexplants were assayed by RT-PCR for MRP5expression. Quantified results are presented asMean�SE.

Statistical Analysis

The non-parametric ‘‘Wicoxon matched-pairssigned-ranks test’’ was used for the analysis of

all tested parameters except for the correlationtests. Pearson correlation and the non-para-metric spearman tests were used to determinethe degree of correlation between two differentgroups of variables. Statistic analysis waspreformed on results of five placentae (for 96 hanalysis) except for HSP27 analysis at 24 h thatwas preformed on three placentae. A P< 0.05was considered significant.

RESULTS

Staining for Low Molecular Weight Cytokeratin

To identify the trophoblast cells in the villiand the EVT cells in the matrigel we stainedplacental explants with antibodies to low mole-cular weight cytokreatin (Fig. 1a). EVT cells aswell as trophoblast cells in the villi were stainedpositively.

Differentiation of Trophoblast Cells

In order to characterize CT cells proliferationand differentiation into migratory cells, Ki67expression, and MMP2/9 activities were ana-lyzed. In trophoblast explant model flattening

Fig. 1. Photographs demonstrating: cytokeratin expression in trophoblast villi (a), trophoblast explants onthe matrigel [control (b) and 6MP exposed (c)], Ki67 staining (d,e), HSP27 expression in control placentalexplant (f) versus 6MP exposed explant (i) and Ki67/HSP27 double staining (g,h) of placental explants.

722 Matalon et al.

and attachment of villous tips to the substratewere observed within the first 12–16 h ofculture followed by cell migration into thematrigel 24 h later. The migration continuedmostly in the next 2 days of culture as expected(Fig. 1b) [Genbacev et al., 1992]. Following96 h of culture anti Ki67 monoclonal antibodystainedmainly cells in the proximal (inner) sideof the villous (Fig. 1d). Some villi displayedKi67in CT cells located in the distal part of thevillous; however, no staining was observedin the EVT located in the matrigel (Fig. 1e).MMPs were analyzed in placental explantstop medium. MMP9 and MMP2 secreted from10 mg placental explants were identified in theupper placental medium (Fig. 2a). Most of theMMP2 was in its pro-enzyme state. Activitylevel of MMP2 following zymogram assay washigher then that of MMP9 (Fig. 2b, P< 0.05).The activity levels of both enzymes increased

during the first 72 h of culture. However, theseelevations were not statistically significant dueto the high variability of the different placentae.

Expression of HSP27 in TrophoblastCells During Differentiation

During trophoblast differentiation, HSP27expression of the various VTCs varied. Theproximal inner part of the villous was repeat-edly negative for HSP27 staining (Fig. 1f,i).These negative cells were usually positive forKi67 (Fig. 1d). Double staining procedure forHSP27 and Ki67 demonstrated that HSP27positive cells do not proliferate (Fig. 1g,h), andthat the proliferating cells do not expressHSP27. However, more then 50% of the villoustrophoblast (located in the basal side of thevillous between the syncytiotrophoblast andthe proliferative VTCs, Fig. 1f-III) and most ofthe EVT cells in the matrigel stained positively(Fig. 1f-II). Interestingly, most of the tropho-blast cells in the villous that expressed HSP27did so in the nucleus (with/without cytoplasm)(Fig. 3) whereas EVT cells in the matrigelalmost always expressed HSP27 in the mem-brane and the cytoplasm alone (Fig. 1f-II).The number of cells expressing HSP27 in thecytosol increased significantly with time (Fig. 3,P< 0.05).

The Effect of 6MP on HSP27 Expressionin Trophoblast Cells

In order to evaluate the relationship betweenHSP27 expression and EVT motility we used6MPas an inhibitor of trophoblastmigration. Inour previous study we demonstrated that 6MPinhibited EVT cell migration to the matrigel. Inthe current study we found that 6MP inhibitedHSP27 expression in the trophoblast villouscells [Fig. 1f (control) vs. Fig. 1i (6MP)].Immunohistochemistry analysis of HSP27 exp-ression demonstrated a reduction of 25% in thenumber of HSP27 stained cells in the 6MPtreated explants after 96 h in culture (Fig. 3,P< 0.05). A significant decrease in the numberof cells expressingHSP27 in both cytoplasmandnucleus were found (Fig. 3). Interestingly, 6MPdid not affect HSP27 staining in the first 24 h(Fig. 3).

Effect of 6 MP on MMPs Activity Level

Since MMPs are important facilitatorsof trophoblast invasion during motility andbecause HSP27 was previously demonstrated

Fig. 2. MMP2/9 activities in control explants. MM2 and 9 wereidentified in placental upper medium by gelatinases zymogramstandards for human MMP2 and MMP9 that were electro-phoresed adjacent to the placental aliquot. Representativezymogram test of placental upper fluids 72 h following placentalculture (UPF-upper placental fluid, ST-zymogram standard forMMP2/9, PE- pro-enzyme, A-active enzyme (a)). Top media from10 mg placental explants (controls) were collected at differenttime points and MMPs activities were analyzed by gelatinzymography assay (b). Data represent the average� SE of fiveindependent experiments.

HSP27 Role in Human Placental Differentiation 723

to be associated with MMP’s activity [Hansenet al., 2001], we further analyzed the effect of6MP onMMPs released by trophoblast cells intothe medium. Twenty-four hours followingestablishment of the culture 6MP had no effecton MMPs activity as was tested in the zymo-gram assay. However, 48 h afterward 6MPinhibited MMP2 activity but did not affectMMP9. Twenty-nine and 44% inhibition ofMMP2 activity compared to control wereobserved following 72 and 96 h of 6MP expo-sures, respectively (Fig. 4a,b).MMP2was signi-ficantly inhibited following incubation of 72 h(P< 0.05) but not 96 h. This can probably beattributed to the high variability in MMP2activity at the end of the culture period. Asignificantly positive correlation was foundbetween the effects of 6MP on HSP27 level inthe villous to its effect on MMP2 activity (72 h)(Fig. 4c).

Effect of 6MP on NO Level

Since NO is involved in cell migration andmay regulate MMPs activity in human tropho-blast cells [Kook et al., 2003; Dash et al., 2005]we further analyzed nitrite levels in media ofexplants treated/not treated with 6MP (96 h).

6MP decreased NO level in all the placentae.A 28% decrease in nitrite levels was observedin 6MP treated explants compared to controls(P< 0.05, Fig. 5a).

Fig. 3. HSP27 expression in 6MP treated and control explants.First trimester placental explants were exposed to 6MP or themedium alone. Following 24 or 96 h of incubation the explantswere fixed in 4% formaldehyde, paraffin embedded, and antiHSP27 staining was preformed. Quantitative analysis of HSP27expression was done by counting stained cells out of trophoblastcells in the villi (Nuc-Nucleus, Cyt-cytoplasm). Data representpercent of stained cells form total cell count (Nucþ Cyt) in thecontrol. Data represent the average� SE of five independentexperiments (96 h) and three independent experiments (24 h).

Fig. 4. MMP2 and MMP9 activities in control and 6MP exposedexplants. Twenty microliter top media from 10 mg placentalexplants cultured with/without 6MP were collected at differenttime points during the experimental period and MMPs wereanalyzed by gelatin zymography assay. Representative figure ofMMP2 and MMP9 activities in control versus 6MP treatedexplant from the same placentae at different time points (a) andaverage MMPs activities of five different placentae during theexperimental period (b) as well as the correlation between MMP2activity and HSP27 expression (values demonstrated are resultsof the ratio Control/6MP) (c) is demonstrated. Data representthe average� SE of five independent placentae (preformed intriplicate).

724 Matalon et al.

Effect of 6MP on iNOS Level

SinceNO is produced by iNOSand is involvedin trophoblast motility [Aktan et al., 2004]we further analyzed the effect of 6MP on iNOSexpression. All trophoblast cells stained posi-tive for iNOS except for the syncytiotrophoblastcells. The strongest staining was observed inthe control motile EVT in the matrigel. In thetrophoblast controls, a higher number of cellswere stained in the nuclei (villous trophoblastand EVT) in comparison to the 6MP exposed

explants [P< 0.05 (Fig. 5b–d)].Moreover, in thecontrol explants more EVT cells were stainedin the nuclei compared to CT cells (P< 0.05).However, similar number of EVT and tropho-blast villous nuclei stained cells was observed inthe 6MP treated explants (Fig. 5d).

Effect of 6MP on MRP5 mRNA Levels

Since most effects of NO are mediatedthrough cGMP we further analyzed the effectof 6MP on MRP5 (cGMP transporter). mRNAwas purified from frozen explants of threedifferent experiments. As expected smalleryields of total RNA were purified from the6MP treated explants in comparison to controls(72.1 vs. 131.7 mg/ml, respectively, P¼ 0.006).This result is consistent with previously pub-lished data [Kawahata et al., 1983]. Bymeans ofsemi-quantitative RT-PCR we tested MRP5steady state transcript mRNA levels. Higherlevels of MRP5 mRNA were found in the 6MPtreated explants. Despite the up regulationthese results did not reach statistical signifi-cance due to the high variability between thedifferent trophoblast explants. Interestinglyno migration of EVT cells was observed in6MP treated explants that had elevated MRP5levels whereas all the explants excluding onethat displayed EVTmigration (6MP treated/ nottreated) had decreasedMRP5mRNA (Fig. 6a,b).Fig. 5. Analysis of No and iNOS levels. Nitrite levels in 200 ml

top media of 10 mg explants treated/not treated with 6MP for 96 hwas measured with Griess reagent. The level of nitrite wasextrapolated from a standard curve of NaNO2 (a). Data representthe average� SE of five independent experiments. For iNOSanalysis first trimester placental explants were exposed to 6MP orto the medium alone. Following 96 h of incubation the explantswere fixed in 4% formaldehyde, paraffin embedded, and antiiNOS staining was preformed. Photographs of iNOS expressionin placental explants cultured with/without 6MP are representedin (b and c, respectively). Quantitative analysis of iNOSexpression was done by counting stained cells out of trophoblastcells in the villi and the data are in (d). Data represent theaverage� SE of five independent experiments. [Color figure canbe viewed in the online issue, which is available at www.interscience.wiley.com.]

Fig. 6. A,B: Analysis of MRP5 mRNA levels. Semi-quantitativeRT-PCR served for MRP5 mRNA analysis. Amplification of MRP5was conducted in a multiplex PCR with a housekeeping gene(b-actin) as an internal reference of the reaction efficiency.

HSP27 Role in Human Placental Differentiation 725

DISCUSSION

During implantation EVT differentiate,invade maternal uterine blood vessels [Genba-cev et al., 1992] and progressively loose theirproliferative capacity [Bulmer et al., 1988]. Inorder to studyHSP27 expression during tropho-blast cell differentiation and motility, we usedthe placental explants culture model in whichthe placental explants are located above thematrigel and the EVT migrate from the villousinto the matrigel [Genbacev et al., 1992]. Wefound that during the culture period tropho-blast cells express HSP27 variably according totheir stage of differentiation: professionalmigratory cells express HSP27 in cell cyto-plasm; trophoblast non-proliferating villouscells displayed HSP27 in the nucleus andcytoplasm and proliferating villous cells didnot express HSP27. 6MP that inhibited tropho-blast cells’ migration [Matalon et al., 2005]concomitantly induced a decrease in HSP27,iNOS,NO levels, andMMP2 activity. Also, 6MPincreasedMRP5mRNA levels. Finally the effectof 6MP on HSP27 expression correlated pos-itively with its effects on MMP2 activity.

Genbacev et al. (1992) demonstrated thatmigration of EVT from the villous into thematrigel reliably mimics EVT invasion in vivo.Cytotrophoblast cells in the villous stainedpositively for Ki67. However, the differentiatedEVT cells in the matrigel, like the EVT cells inthe uterus, loose their proliferative activity andare Ki67 negative [Bulmer et al., 1988]. Thus,the migratory potential is linked to the differ-entiation of theEVTcell.We found that the leveland localization of HSP27 were affected by theproliferation and differentiation stage of thecells: trophoblast cells in the proximal innerside of the villous were Ki67 positive but didnot express HSP27. Inversely, differentiatedEVT in the matrigel, negative for Ki67, stainedpositively for HSP27 in the cell periphery.Similar inverse correlations between HSP27expression and cell proliferation were demon-strated in human breast and gynecologicalcancer cell lines that were treated with antineo-plastic agents [Vargas-Roig et al., 1997; Tanakaet al., 2004]. Moreover, over expression ofHSP27 in laryngeal cancer cells delayed cellgrowth, compared to control cells [Lee et al.,2007]. Thus, our findings suggest that HSP27 isinvolved in growth arrest and differentiationof trophoblast cells and that 6MP may have

inhibited differentiation of trophoblast cells byreducing HSP27 levels.

Localization of HSP27 in the cell peripheryprobably reflects the capability of HSP27 to actas an actin cap-binding protein that regulatesactin polymerization [Garrido, 2002]. Thus, it isnot surprising that the professional migratoryEVTcells displayHSP27 in their periphery.Thepositive correlation between 6MP inhibitoryeffect on HSP27 expression (nuclear and cyto-solic) and on migration also supports HSP27role in trophoblast cellmigration regulationandsuggests that 6MP affected trophoblast motilitythrough HSP27 regulation. HSP27 was pre-viously demonstrated to be associated withMMP’s activity. Indeed, HSP27 is a down-stream effectors of p38 MAP kinase-mediatedmatrix MMP2 activation and cell invasion inhuman prostate cancer [Xu and Bergan, 2006].Moreover, genistein (cancer chemopreventivedrug) inhibits MMP2 activation and prostatecancer cell invasion by blocking the MAP-KAPK2—HSP27 pathway [Xu and Bergan,2006]. Since MMPs are important facilitatorsof trophoblast invasion and because HSP27 isassociated with MMP’s activity we furtheranalyzed the effect of 6MP on MMPs activity.Indeed 6MP reducedMMP2 activity that paral-leled the decrease in HSP27 expression. Theselective effect of 6MP on MMP2 activity withno effect on MMP9 strengthens the previoussuggestion that MMP2 is the main gelatinaseresponsible for the invasive ability of tropho-blast cells [Staun-Ram et al., 2004]. Of note wasthe similarity in the timeframe of MMP2activity and HSP27 expression that supportsthe assumption that HSP27 does regulatemotility related processes or that commonpathways are involved in regulation of bothHSP27 and MMP2.

These findings, as well as the known regu-lation of trophoblast MMP2 by NO [Novaroet al., 2001, 2002] and the established impor-tance of NO in migratory processes [Kook et al.,2003; Lee et al., 2005] prompted us to examinethe effect of 6MP on NO levels in the explantsculture media. Indeed, 6MP induced significantreduction of NO levels.

The mechanisms by which 6MP inhibitedEVT cell migration and decreasedNO levels arenot clear. However, increased apoptosis andinhibition of motility by 6MP were observed inother biological systems and involved cGMPwhich mediate most effects of NO [Elferink

726 Matalon et al.

et al., 1997; Hortelano and Bosca, 1997]. GMPmediated rearrangement of the cytoskeletonand involvement in apoptosis dynamics werepreviously demonstrated [Gorodeski, 2000;Dreiza et al., 2005]. Moreover, the 6MP trans-porterMRP5 isalsoa transmembrane transportprotein for cGMP [Meyer et al., 2005]. Inductionof MRP5 following 6MP exposure was demon-strated herein. Similar induction of MRP5mRNA following exposure to chemotherapeuticagent was previously reported [Yoshida et al.,2001].MRP5may play a biological role in cGMPnucleotides cellular signaling. Indeed, a role forMRP5-mediated cGMP efflux in the regulationof NO [Xu et al., 2004] and in trophoblastdifferentiation has already been suggested[Meyer et al., 2005]. It was also suggested thatinduction of MRP5 facilitates elimination ofcGMP from the trophoblast cells [Meyer et al.,2005].The mechanism underlying the 6MP modu-

lation of HSP27 levels is unclear. Interestingly,previous studies demonstrated a regulatoryeffect of cyclic nucleotides on HSP expressionvia gene promoter [Choi et al., 1991].We showed a positive correlation between

6MP’s effect on HSP27 level, motility, and NOproduction. We also demonstrated decreasediNOS nuclear expression in 6MP treatedexplants concomitant with reduced HSP27.Involvement of iNOS and NO in migration oftrophoblast cells was already suggested [Cart-wright et al., 2002; Dash et al., 2005]. Expres-sion of iNOS that generates NO is regulatedby NF-kB transcription factor [Aktan, 2004].Interestingly, it was shown that HSP27 may beinvolved in I-Kba proteasomal degradation,which is the major NF-kB inhibitor, and itsinactivation occurs through proteasomal deg-radation [Parcellier et al., 2003]. Thus, wehypothesize that 6MP’s effect on HSP27 maybe responsible for decreasedNOproduction andinhibition of trophoblast migration throughNF-Kb regulation as suggested in Figure 7.

Conclusions

We demonstrated that HSP27 levels increasein differentiated trophoblast cells and thatplacental exposure to 6MP (known inhibitor ofEVT invasion) is associated with reduction introphoblast HSP27, iNOS, NO, and MMP2levels. Moreover, HSP27 levels are correlatedwith trophoblast MMP2 activity. The associa-

tion between HSP27, MMP2 activity, NO levelsandmotility suggests that HSP27 is involved inthe regulation or shares commonpathwayswiththeses processes.

ACKNOWLEDGMENTS

This work was supported by the ‘‘Tel AvivUniversity-Hospital for SickChildren inTorontoexchange program’’.

REFERENCES

Aktan F. 2004. iNOS-mediated nitric oxide production andits regulation. Life Sci 75:639–653.

Aldrian S, Trautinger F, Frohlich I, Berger W, MickscheM,Kindas-Mugge I. 2002. Overexpression of Hsp27 affectsthe metastatic phenotype of human melanoma cellsin vitro. Cell Stress Chaperones 7:177–185.

Bulmer JN, Morrison L, Johnson PM. 1988. Expression ofthe proliferation markers Ki67 and transferrin receptorby human trophoblast populations. J Reprod Immunol14:291–302.

Cartwright JE, Holden DP, Whitley GS. 1999. Hepatocytegrowth factor regulates human trophoblast motility andinvasion: A role for nitric oxide. Br J Pharmacol 128:181–189.

Cartwright JE, Tse WK, Whitley GS. 2002. Hepatocytegrowth factor induced human trophoblast motility in-volves phosphatidylinositol-3-kinase, mitogen-activated

Fig. 7. Schemes which suggest the following hypothesize:6MP’s effect on HSP27 is responsible for the decreased NOproduction and the inhibition of trophoblast migration throughNF-Kb regulation.

HSP27 Role in Human Placental Differentiation 727

protein kinase, and inducible nitric oxide synthase. ExpCell Res 279:219–226.

Choi HS, Li B, Lin Z, Huang E, Liu AY. 1991. cAMP andcAMP-dependent protein kinase regulate the humanheat shock protein 70 gene promoter activity. J BiolChem 266:11858–11865.

Dash PR, Whitley GS, Ayling LJ, Johnstone AP, Cart-wright JE. 2005. Trophoblast apoptosis is inhibited byhepatocyte growth factor through the Akt and beta-catenin mediated up-regulation of inducible nitric oxidesynthase. Cell Signal 17:571–580.

Dreiza CM, Brophy CM, Komalavilas P, Furnish EJ, JoshiL, Pallero MA, Murphy-Ullrich JE, von Rechenberg M,Ho YS, Richardson B, Xu N, Zhen Y, Peltier JM, PanitchA. 2005. Transducible heat shock protein 20 (HSP20)phosphopeptide alters cytoskeletal dynamics. FASEB J19:261–263.

Elferink JG, Daha MR, de Koster BM. 1997. A cyclicGMP- and G-kinase-dependent effect of azathioprine onmigration by human neutrophils. Cell Mol Life Sci 53:593–599.

Estlin EJ. 2001. Continuing therapy for childhood acutelymphoblastic leukaemia: clinical and cellular pharma-cology of methotrexate, 6-mercaptopurine and 6 thiogua-nine. Canc Treat Rev 27:351–363.

Garrido C. 2002. Size matters: of the small HSP27 and itslarge oligomers. Cell Death Differ 9:483–485.

Geisler JP, Manahan KJ, Geisler HE, Tammela JE, RoseSL, Hiett AK, Miller GA, Wiemann MC, Zhou Z. 2004.Heat shock protein 27 in the placentas of women withand without severe preeclampsia. Clin Exp ObstetGynecol 31:12–14.

Genbacev O, Schubach SA, Miller RK. 1992. Villous cultureof first trimester human placenta-model to study extra-villous trophoblast (EVT) differentiation. Placenta 13:439–461.

Gorodeski GI. 2000. NO increases permeability of culturedhuman cervical epithelia by cGMP-mediated increase inG-actin. Am J Physiol Cell Physiol 278:C942–C952.

Guzik TJ, Korbut R, Adamek-Guzik T. 2003. Nitric oxideand superoxide in inflammation and immune regulation.J Physiol Pharmacol 54:469–487.

Hansen RK, Parra I, Hilsenbeck SG, Himelstein B, FuquaSA. 2001. Hsp27-induced MMP-9 expression is influ-enced by the Src tyrosine protein kinase yes. BiochemBiophys Res Commun 282:186–193.

Hirano S, Shelden EA, Gilmont RR. 2004. HSP27 regulatesfibroblast adhesion, motility, and matrix contraction.Cell Stress Chaperones 9:29–37.

Hortelano S, Bosca L. 1997. 6-Mercaptopurine decreasesthe Bcl-2/Bax ratio and induces apoptosis in activatedsplenic B lymphocytes. Mol Pharmacol 51:414–421.

Kawahata RT, Chuang LF, Holmberg CA, Osburn BI,Chuang RY. 1983. Inhibition of human lymphoma DNA-dependent RNA polymerase activity by 6-mercaptopur-ine ribonucleoside triphosphate. Cancer Res 43:3655–3659.

Kook H, Ahn KY, Lee SE, Na HS, Kim KK. 2003. Nitricoxide-dependent cytoskeletal changes and inhibition ofendothelial cell migration contribute to the suppressionof angiogenesis by RAD50 gene transfer. FEBS Lett 553:56–62.

Landry J, Huot J. 1995. Modulation of actin dynamicsduring stress and physiological stimulation by a signal-

ing pathway involving p38 MAP kinase and heat-shockprotein 27. Biochem Cell Biol 73:703–707.

Lee JS, Kang Decker N, Chatterjee S, Yao J, Friedman S,Shah V. 2005. Mechanisms of nitric oxide interplay withRho GTPase family members in modulation of actinmembrane dynamics in pericytes and fibroblasts. Am JPathol 166:1861–1870.

Lee JH, Sun D, Cho KJ, Kim MS, Hong MH, Kim IK, LeeJS, Lee JH. 2007. Overexpression of human 27 kDa heatshock protein in laryngeal cancer cells confers chemo-resistance associated with cell growth delay. J CancerRes Clin Oncol 133:37–46.

Malassine A, Cronier L. 2002. Hormones and humantrophoblast differentiation: A review. Endocrine 19:3–11.

Matalon ST, Ornoy A, Fishman A, Drucker L, Lishner M.2005. The effect of 6-mercaptopurine on early humanplacental explants. Hum Reprod 20:1390–1397.

Meyer Zu, Schwabedissen HE, Grube M, Heydrich B,Linnemann K, Fusch C, Kroemer HK, Jedlitschky G.2005. Expression, localization, and function of MRP5(ABCC5), a transporter for cyclic nucleotides, in humanplacenta and cultured human trophoblasts: Effects ofgestational age and cellular differentiation. Am J Pathol166:39–48.

Morrish DW, Linetsky E, Bhardwaj D, Li H, Dakour J,Marsh RG, PatersonMC, Godbout R. 1996. Identificationby subtractive hybridization of a spectrum of novel andunexpected genes associated with in vitro differentiationof human cytotrophoblast cells. Placenta 17:431–441.

Novaro V, Colman-Lerner A, Ortega FV, JawerbaumA, PazD, Lo Nostro F, Pustovrh C, Gimeno MF, Gonzalez E.2001. Regulation of metalloproteinases by nitric oxide inhuman trophoblast cells in culture. Reprod Fertil Dev13:411–420.

Novaro V, Pustovrh C, Colman-Lerner A, Radisky D, LoNostro F, Paz D, Jawerbaum A, Gonzalez E. 2002. Nitricoxide induces gelatinase A (matrix metalloproteinase 2)during rat embryo implantation. Fertil Steril 78:1278–1287.

Parcellier A, Schmitt E, Gurbuxani S, Seigneurin-Berny D,Pance A, Chantome A, Plenchette S, Khochbin S, SolaryE, Garrido C. 2003. HSP27 is a ubiquitin-binding proteininvolved in I-kappa B alpha proteasomal degradation.Mol Cell Biol 23:5790–5802.

Ritter CA, Jedlitschky G, Meyer zu, Schwabedissen H,Grube M, Kock K, Kroemer HK. 2005. Cellular exportof drugs and signaling molecules by the ATP-bindingcassette transporters MRP4 (ABCC4) and MRP5 (ABCC5).Drug Metab Rev 37:253–278.

Staun-Ram E, Goldman S, Gabarin D, Shalev E. 2004.Expression and importance of matrix metalloproteinase2 and 9 (MMP-2 and -9) in human trophoblast invasion.Reprod Biol Endocrinol 2:59.

Tanaka Y, Fujiwara K, Tanaka H, Maehata K, Kohno I.2004. Paclitaxel inhibits expression of heat shock protein27 in ovarian and uterine cancer cells. Int J GynecolCancer 14:616–620.

Vargas-Roig LM, Fanelli MA, Lopez LA, Gago FE, Tello O,Aznar JC, Ciocca DR. 1997. Heat shock proteins and cellproliferation in human breast cancer biopsy samples.Cancer Detect Pre 21:441–451.

Xu L, Bergan RC. 2006. Genistein inhibits matrix metal-loproteinase type 2 activation and prostate cancer cell

728 Matalon et al.

invasion by blocking the transforming growth factorbeta-mediated activation of mitogen-activated proteinkinase-activated protein kinase 2-27-kDa heat shockprotein pathway. Mol Pharmacol 70:869–877.

Xu HL, Gavrilyuk V, Wolde HM, Baughman VL, PelligrinoDA. 2004. Regulation of rat pial arteriolar smoothmusclerelaxation in vivo through multidrug resistance protein

5-mediated cGMP efflux. Am J Physiol Heart CircPhysiol 286:H2020–H2027.

Yoshida M, Suzuki T, Komiya THatashita, Nishio K,Kazuhiko N, Fukuoka M. 2001. Induction of MRP5 andSMRP mRNA by adriamycin exposure and its over-expression in human lung cancer cells resistant toadriamycin. Int J Cancer 94:432–437.

HSP27 Role in Human Placental Differentiation 729