the p85 subunit of class ia phosphatidylinositol 3kinase regulates the expression of multiple genes...

Published Ahead of Print 22 September 2008. 10.1128/MCB.00920-08.

2008, 28(23):7182. DOI:Mol. Cell. Biol. Robling, Feng-Chun Yang and Reuben KapurHuijie Li, Paul J. Niziolek, Clifford Takemoto, Alexander G.Catherine Sims, Subha Krishnan, Shi Chen, Jincheng Yan, Veerendra Munugalavadla, Sasidhar Vemula, Emily in Osteoclast Maturation and Migration the Expression of Multiple Genes InvolvedPhosphatidylinositol 3-Kinase Regulates

A Subunit of Class IαThe p85

http://mcb.asm.org/content/28/23/7182Updated information and services can be found at:

These include:

REFERENCEShttp://mcb.asm.org/content/28/23/7182#ref-list-1at:

This article cites 64 articles, 20 of which can be accessed free

CONTENT ALERTS more»articles cite this article),

Receive: RSS Feeds, eTOCs, free email alerts (when new

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on October 21, 2014 by guest

http://mcb.asm

.org/D

ownloaded from

on O

ctober 21, 2014 by guesthttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/content/28/23/7182

http://mcb.asm.org/content/28/23/7182#ref-list-1

http://mcb.asm.org/cgi/alerts

http://journals.asm.org/site/misc/reprints.xhtml

http://journals.asm.org/site/subscriptions/

http://mcb.asm.org/

http://mcb.asm.org/

MOLECULAR AND CELLULAR BIOLOGY, Dec. 2008, p. 7182–7198 Vol. 28, No. 230270-7306/08/$08.00�0 doi:10.1128/MCB.00920-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

The p85� Subunit of Class IA Phosphatidylinositol 3-Kinase Regulatesthe Expression of Multiple Genes Involved in Osteoclast

Maturation and Migration�

Veerendra Munugalavadla,1,4† Sasidhar Vemula,1,4 Emily Catherine Sims,1,4 Subha Krishnan,1,4

Shi Chen,1,4 Jincheng Yan,1,4 Huijie Li,1,4 Paul J. Niziolek,2‡ Clifford Takemoto,3Alexander G. Robling,2 Feng-Chun Yang,1,4 and Reuben Kapur1,4*

Department of Pediatrics,4 Department of Biochemistry and Molecular Biology,1 and Departments of Anatomy andCell Biology, Herman B Wells Center for Pediatric Research,2 Indiana University School of Medicine, Indianapolis,

Indiana, and Division of Pediatric Hematology, The Johns Hopkins University, Baltimore, Maryland3

Received 9 June 2008/Returned for modification 6 August 2008/Accepted 11 September 2008

Intracellular signals involved in the maturation and function of osteoclasts are poorly understood. Here, wedemonstrate that osteoclasts express multiple regulatory subunits of class IA phosphatidylinositol 3-kinase(PI3-K) although the expression of the full-length form of p85� is most abundant. In vivo, deficiency of p85�results in a significantly greater number of trabeculae and significantly lower spacing between trabeculae aswell as increased bone mass in both males and females compared to their sex-matched wild-type controls.Consistently, p85��/� osteoclast progenitors show impaired growth and differentiation, which is associatedwith reduced activation of Akt and mitogen-activated protein kinase extracellular signal-regulated kinase 1(Erk1)/Erk2 in vitro. Furthermore, a significant reduction in the ability of p85��/� osteoclasts to adhere to aswell as to migrate via integrin �v�3 was observed, which was associated with reduced bone resorption.Microarray as well as quantitative real-time PCR analysis of p85��/� osteoclasts revealed a significantreduction in the expression of several genes associated with the maturation and migration of osteoclasts,including microphathalmia-associated transcription factor, tartrate-resistant acid phosphatase, cathepsin K,and �3 integrin. Restoring the expression of the full-length form of p85� but not the version with a deletionof the Src homology-3 domain restored the maturation of p85��/� osteoclasts to wild-type levels. These resultshighlight the importance of the full-length version of the p85� subunit of class IA PI3-K in controlling multipleaspects of osteoclast functions.

Osteoclasts (OCs) are derived from precursors of monocyte/macrophage lineage, whose growth and maturation are mainlydependent on two osteoblast/stromal cell-derived cytokines,including macrophage colony stimulating factor (M-CSF) andreceptor activator of NF-�B ligand (RANKL) (22, 30, 35, 63).The critical role for these two cytokines in OC growth anddifferentiation has been further illustrated by studying micelacking the expression of RANKL and M-CSF (30, 64). Thesemice show severe osteopetrosis and lack mature OCs. M-CSFand RANKL regulate OC progenitor (OCp) growth and func-tion in part by regulating the expression of several OC genes,including tartrate-resistant acid phosphatase (TRAP), cathep-sin K, calcitonin receptor, and integrin �3 (15, 29). Stimulationof OC precursors by RANKL and M-CSF results in the acti-vation of a number of signaling molecules, including Gab2,Grb2, Vav, Src homology-2 (SH2)-containing inositol-5-phos-phatase (SHIP), Dap12, JNK, p38, and phosphatidylinositol

3-kinase (PI3-K). Mice deficient in the expression of some ofthese molecules have demonstrated the precise involvement ofeach of these enzymes and/or adaptor proteins in osteoclasto-genesis (16, 17, 47, 55). In addition to signaling molecules,several transcription factors have also been implicated in reg-ulating osteoclastogenesis. Some of these factors regulate earlygrowth and survival of OCs while others contribute to latestage maturation of OCs. Examples of these transcription fac-tors include c-fos, NF-�B, PU.1, microphathalmia-associatedtranscription factor (MITF), and Jun dimerization protein 2(JDP2) (27, 51, 52).

While several signaling molecules in OC development havebeen identified, the role of PI3-K appears to be particularlyimportant. This is partly because PI3-K has been shown to bea critical downstream effector from at least three distinct cellsurface receptors in OCs, including M-CSF receptor, �v�3,and RANK (20). Importantly, all three molecules and theirdownstream substrates have been identified as candidate ther-apeutic targets for treatment of OC-related bone disorders. InOCs, once activated by M-CSF, PI3-K influences survival aswell as actin remodeling (38, 39). Pharmacologic inhibitors ofPI3-K, including LY294002 and wortmannin, show a dramaticreduction in the development of OCs in cultures treated withM-CSF and RANKL. Furthermore, treating OCs with phar-macologic inhibitors of PI3-K also impairs the resorptive ac-tivity of OCs, which is associated with impaired ruffling, actinring formation, and reduced pit formation (36). Thus, these

* Corresponding author. Mailing address: Herman B Wells Centerfor Pediatric Research, Indiana University School of Medicine, CancerResearch Institute, 1044 W. Walnut Street, Room 425, Indianapolis,IN 46202. Phone: (317) 274-4658. Fax: (317) 274-8679. E-mail: [email protected].

† Present address: Cancer Signaling and Translational Oncology,Genentech, Inc., 1 DNA Way, South San Francisco, CA.

‡ Present address: Weldon School of Biomedical Engineering, Pur-due University, West Lafayette, IN.

� Published ahead of print on 22 September 2008.

7182


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

results clearly implicate the PI3-K pathway as an importantpathway in regulating OC functions. However, these conclu-sions have been largely based on studies conducted with com-mercially available PI3-K inhibitors such as wortmannin andLY294002. These compounds target the ATP-binding site ofall PI3-K family members and interfere with PI3-K-relatedkinases at elevated concentrations. Additionally, these inhibi-tors are broad spectrum and nonspecific and are associatedwith extreme toxicity. Therefore, to better understand andtherapeutically manipulate the PI3-K pathway in OCs, quan-titative as well as qualitative data evaluating the output ofindividual regulatory and/or catalytic subunit(s) of PI3-K areessential.

PI3-K belongs to a family of enzymes that are involved inphosphorylating PI lipids at the 3� position (26). Based onsequence similarity and biochemical properties, PI3-Ks havebeen divided into three classes. Class I PI3-Ks have beenshown to regulate receptor tyrosine kinase-mediated re-sponses. Members of the class IA PI3-K are heterodimers,which are composed of a catalytic subunit, p110 (�, �, or �),and a regulatory subunit, p85 (� or �). The p85 regulatorysubunit binds to phosphorylated tyrosine residues via theirSH2 domains, resulting in the recruitment and activation of thep110 catalytic subunit at the plasma membrane. In addition tothe presence of SH2 domains, p85 also consists of an SH3domain, a proline-rich domain (PRD), and a domain homol-ogous to the breakpoint cluster region (BCR) gene product(54). Although the precise role of these domains in p85�-regulated functions is poorly understood, it has been suggestedthat they might be involved in targeting p85� to distinct sub-cellular compartments and/or in the recruitment of additionalsignaling molecules. Interestingly, the shorter regulatory sub-units of p85, namely p55�, p50�, and p55�, that do not containthese additional domains (i.e., SH3, PRD, or BCR) appear tohave distinct biologic activities in cells (42, 50).

In the current study, we demonstrate that OCs express mul-tiple regulatory subunits of class IA PI3-K although the expres-sion of the full-length form of p85� is most abundant. In vivo,deficiency of p85� results in a significantly greater number oftrabeculae and significantly lower spacing between trabeculaeas well as increased bone mass in both males and femalescompared to their sex-matched wild-type controls. Consis-tently, p85��/� OCps show impaired growth and differentia-tion, which is associated with reduced activation of Akt andmitogen-activated protein (MAP) kinase extracellular signal-regulated kinase 1 (Erk1)/Erk2 in vitro. Furthermore, a signif-icant reduction in the ability of p85��/� OCs to adhere to aswell as to migrate via integrin �v�3 was observed, which isassociated with reduced bone resorption. Microarray as well asquantitative PCR analysis on p85��/� OCs revealed a signifi-cant reduction in the expression of several genes associatedwith the maturation and migration of OCs, including MITF,TRAP, cathepsin K, and �3 integrin. Restoring the expressionof the full-length form of p85� but not the version with adeletion of the SH3 domain restored the maturation ofp85��/� OCs to wild-type levels. These results suggest that thefunctional defects in p85�-deficient OCs are observed in spiteof the continuous expression of p50� and p55� subunits andhighlight the importance of the SH3, PRD, and the BCRdomain of p85� in regulating OC functions.

MATERIALS AND METHODS

Mice. p85��/� mice have been previously described (46, 50). p85��/� micewere obtained by mating of p85��/� mice. The genotype of the p85��/� micewas determined by PCR as previously described (46). The targeting strategyallowed selective disruption of p85� expression while leaving p55� and p50�isoforms intact (46). These mice were maintained under specific-pathogen-freeconditions in the Indiana University Laboratory Animal Research Center, Indi-anapolis, IN.

Histochemistry and histomorphometry. Female p85��/� and wild-type micewere sacrificed at 6 to 8 weeks of age. Prior to sacrifice, the mice were admin-istered intraperitoneal injections of calcein (20 mg/kg) and alizarin complexone(25 mg/kg) 5 and 2 days before sacrifice, respectively. The distal third of eachfemur was dissected, fixed in 4% paraformaldehyde, dehydrated in graded alco-hols, and embedded (undecalcificed) in methylmethacrylate. The polymerizedblocks were sectioned at 6 m in the frontal plane, mounted on charged micro-scope slides, and either left unstained (for fluorochrome histomorphometry) orreacted for TRAP activity using a commercially available reaction kit (Sigma-Aldrich). The TRAP-stained sections were counterstained with von Kossa toreveal mineralized tissue and analyzed on a Nikon Optiphot microscopeequipped with the BioQuant histomorphometry software (R&M Biometrics). Oneach section, the numbers of TRAP-positive (TRAP�) cells adjacent to thetrabecular bone matrix were counted in the secondary spongiosa, beginning 0.5mm proximal to the growth plate. OC counts were standardized to the totaltrabecular surface.

From the unstained sections, trabecular bone turnover was assessed in thesecondary spongiosa by measuring the extent of single-label and double-labelperimeter (sL.Pm and dL.Pm, respectively, in the formula below) and the area ofbone (dL.Ar) between the calcein and alizarin labels. Derived histomorphomet-ric parameters included mineralizing surface (the percentage of mineralizedsurface/bone surface [MS/BS]), a measure of active bone-forming surface, cal-culated as follows: MS/BS [1/2 (sL.Pm � dL.Pm)]/Tt.Pm � 100, where Tt.Pmis the total perimeter; the mineral apposition rate ([MAR] m/day), a measureof the rate of radial expansion of new bone, was calculated as dL.Ar/dL.Pm/3days; and the bone formation rate, an overall measure of bone formation thatcombines MS/BS and MAR, was calculated as MS/BS � MAR � 3.65.

�CT. Trabecular bone mass and architectural properties in the femoral distalmetaphysis were evaluated using a high-resolution desktop microcomputed to-mography (CT) imaging system (CT-20; Scanco Medical AG, Basserdorf,Switzerland). Each femur (n 7 males and 3 females per group) was scannedfrom the distal 70% to 90% of its total length. A microfocus X-ray tube with afocal spot of 10 m was used as a source. For each slice, 600 projections weretaken over 216° (180° plus half of the fan angle on either side). Approximately270 microtomograph slices were acquired per bone using a slice increment of 17m. A standard convolution back-projection procedure with a Shepp and Loganfilter was used to reconstruct the CT images in 1,024-by-1,024 pixel matrices. Thetrabecular area was partitioned manually from the cortical shell using the Scancosoftware. From the isolated three-dimensional trabecular networks, the followingparameters were calculated (respective units are given): bone volume fraction(calculated as a percentage of the total volume), connectivity density (mm�3),trabecular number (mm�1), trabecular thickness (m), and trabecular separa-tion (m).

Generation of murine OCs. Bone marrow cells from wild-type and p85��/�

mice were cultured in OC culture medium (�-minimal essential medium; 1%penicillin-streptomycin and 10% fetal bovine serum) supplemented with 10ng/ml of M-CSF overnight. The next day nonadherent cells were collected andcultured in the presence of 10 ng/ml of M-CSF and 100 ng/ml of RANKL for 6days. Culture medium was changed every 2 days. Multinucleated OCs wereidentified by TRAP activity assay. Briefly, adherent cells were fixed with 10%formaldehyde for 10 min at room temperature and then with ethanol-acetone(50:50, vol/vol) for 1 min and washed with phosphate-buffered saline (PBS), andTRAP staining was performed using a commercially available kit (Sigma 387-A).TRAP� cells with three or more nuclei were counted for quantification, andresults are represented per field.

OC proliferation and survival. A proliferation assay was conducted accordingto Faccio et al., with minor modifications (17). Briefly, 0.5 � 105 OCps fromwild-type and p85��/� mice were cultured in the presence of various concen-trations of M-CSF or RANKL or both in 96-well tissue culture plates. After 2days, 1.0 Ci of [3H]thymidine (Amersham) was added for 6 h before harvesting.Cells were harvested using an automated 96-well cell harvester (Brandel, Gaith-ersburg, MD), and thymidine incorporation was determined as counts perminute. Survival assay was conducted according to Yang et al. (61). Briefly, cellswere starved of serum and cytokines for various time intervals, harvested by the

VOL. 28, 2008 p85 REGULATORY SUBUNITS IN OSTEOCLASTS 7183


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

addition of trypsin-EDTA, and resuspended in 1� binding buffer (BD Pharmin-gen). A total of 1 � 106 cells were suspended in binding buffer containingannexin V-phycoerythrin (BD Pharmingen) and 7-aminoactinomycin D (7-AAD;BD Pharmingen) and incubated for 20 min at room temperature in the dark.Additional binding buffer was added before analysis by flow cytometry wasperformed.

OC migration and adhesion assay. Migration of OCs was evaluated using atranswell assay as described previously, with minor modifications (44, 60, 61). Toverify the number of cells loaded into each transwell, OCps previously culturedin M-CSF and RANKL for 5 days were lifted from the plates after the additionof 0.05% trypsin and 0.2% EDTA � 4Na in Hanks balanced salt solution andscored to identify TRAP� cells. Equivalent numbers of cells were loaded ontothe upper chamber of an 8 M polycarbonate transwell coated with vitronectinfor 15 h in a humidified incubator at 37°C, and a lower chamber was addedcontaining �-minimal essential medium, 0.1% bovine serum albumin, and M-CSF. After 4 h of incubation, cells that migrated to the bottom of the chamberwere stained for TRAP, and the number of TRAP� cells per field was thencounted (Empire Imaging Systems, Plattsburgh, NY). For adhesion experiments,OCps (1 � 105 cells/ml) were placed into 24-well plates coated with vitronectin(20 g/ml) supplemented with M-CSF as described previously (62).

Bone resorption assay. Single-cell suspensions of OCs were seeded onto den-tine slices (47, 61) (ALPCO Diagnostic, Windham, NH) and incubated at 37°Cin 5% CO2 in the presence of M-CSF and RANKL. Following 7 days of culture,the slices were rinsed with PBS, left overnight in 1 M ammonium hydroxide, andstained with 1% toluidine blue in 0.5% sodium tetraborate solution. The numberof resorptive areas or “pits” per low-power field on each bone slice was countedusing reflective light microscopy. The area (mm2) of each pit was evaluated bymeasuring the width and length using QCapture Pro software (version 5.1) by aninvestigator who was blinded to the experimental groups.

Immunofluorescence microscopy. To evaluate the cytoskeletal organization inp85��/� OCs, immunofluorescence microscopy was performed as previouslydescribed (40, 45). Briefly, OCs were grown on coverslips, washed with PBS, andpermeabilized with 0.01% saponin in 80 mM PIPES [piperazine-N,N�-bis(2-ethanesulfonic acid)], pH 6.8, 5 mM EGTA, and 1 mM MgCl2 for 5 min at roomtemperature. Cells were fixed in 3% paraformaldehyde in PBS for 20 min andquenched with 50 mM NH4Cl for 10 min. Cells were then washed in 2% bovineserum albumin with 0.01% saponin in PBS for 5 min to block nonspecific binding.Fluorescein isothiocyanate-conjugated phalloidin (Sigma, St. Louis, MO) wasused to incubate the permeabilized cells for 1 h at room temperature. After threewashes with the same buffer, nuclei were stained with 4�,6�-diamidino-2-phe-nylindole (DAPI). Slides were washed and then mounted with 80% glycerol inPBS. The cells were observed, and fluorescent images were taken with a NikonTE 2000-5 fluorescent microscope.

Western blot analysis. Wild-type or p85��/� OCps were starved of serum andgrowth factors and stimulated with M-CSF, RANKL, or both cytokines for theindicated times (see Fig. 9). The reaction was stopped by the addition of coldPBS, and cells were lysed as previously described (48). An equal amount ofprotein was subjected to sodium dodecyl sulfate-polyacrylamide gel electro-phoresis, and separated protein was transferred onto a nitrocellulose membrane.Western blot analysis was performed using an anti-phospho-Akt and an anti-phospho-Erk antibody (Cell Signaling, Beverly, MA). Pan-p85 antibody andp85� (recognizes the SH3 domain of p85�)-specific antibody as well as theantihemagglutinin (anti-HA) antibody were purchased from Upstate Biotech-nology, NY.

PI3-K assay. OCps were starved and stimulated with RANKL or M-CSF or acombination of both for 2 and 5 min at 37°C. Cells were lysed in 100 l of PI3-Klysis buffer containing 125 mM Tris, pH 7.0, 25 mM MgCl2, 5 mM EGTA, andprotease inhibitors. Equal amounts of protein lysates were subjected to a PI3-Kactivity assay (BCA Protein Assay kit; Pierce, Rockford, IL). The activity ofPI3-K in whole-cell lysates was measured by the amount of [�-32P]ATP incor-porated into the lipid substrates, which were separated using thin-layer chroma-tography. The reaction mixture containing 1 l of L-�-PI-4-monophosphate, 4 lof L-�-PI-4,5-diphosphate, 0.5 l of L-�-phosphatidyl-L-serine (Avanti Polar Lip-ids, Alabaster, AL), and [�-32P]ATP (10 Ci/reaction) was added to the lysatesand incubated at 37°C for 10 min. The reaction was terminated by the additionof 105 l of 1 N HCl, followed by the addition of 160 l of chloroform-methanol(1:1, vol/vol). The samples were vortexed vigorously and centrifuged to separatethe aqueous and organic phases. The lipid-containing organic phase was resolvedon silica-coated thin-layer chromatography plates (Whatman, England) with asolvent mixer of 65% propanol–1% glacial acetic acid for 12 h, air dried on silicaplate, and exposed to X-ray film (Kodak) with a Dupont intensifying screen atroom temperature.

Measurement of TRAP 5b in mouse serum. Solid-phase immunofixed enzymeactivity assay for the determination of OC-derived TRAP form 5b (TRAP 5b) inmouse serum was assessed as described by the manufacturer (ImmunodiagnosticSystems, Inc., Fountain Hills, AZ).

Microarray expression profiling and data analysis. The mRNA samples weresubmitted to Johns Hopkins Hospital Microarray core facility, and expressionprofiling was performed using Affymetrix MOE430_2 chips. To estimate the geneexpression signals, data analysis was conducted on the chips’ CEL file probesignal values at the Affymetrix probe pair (perfect match probe and mismatchprobe) level by employing the statistical technique of robust multiarray analysisusing GC content for background adjustment (7, 58) with the Bioconductorpackage available at www.bioconductor.org. This probe-level data processingincludes a normalization procedure utilizing quantile normalization (7) to reducethe obscuring variation between microarrays, which might be introducedduring the processes of sample preparation, manufacture, fluorescence label-ing, hybridization, and/or scanning. With the signal intensities estimatedabove, an empirical Bayes method with the gamma-gamma modeling, asimplemented in the R package EBarrays, was used to estimate the posteriorprobabilities of the differential expression of genes between wild-type andp85��/� OCs. The criterion of a posterior probability of �0.5, which meansthat the posterior probability is greater than what might have been producedby chance, was used to produce the differentially expressed gene lists. Allcomputation was performed in the R environment, and all Bioconductorpackages are available at www.bioconductor.org.

Relative quantitation of mRNAs by real-time quantitative RT-PCR. TotalRNA was isolated from wild-type and p85��/� OCs using an RNeasy Mini kit(Qiagen). Reverse-transcriptase reactions were done using a SuperScript First-Strand cDNA Synthesis system (Invitrogen Life Technologies, Carlsbad, CA).Five nanograms of first-strand cDNA was used in reverse transcription-PCR(RT-PCR) to ensure linear amplification of sequences. Real-time PCR wasperformed on an ABI Prism 7500 Sequence Detection system using Sybr GreenPCR Master mix (Applied Biosystems) and following the manufacturer’s proto-cols. Primer sequences used in this study were (900 nM, each) the following:Acp-5/TRAP, CCCAATGCCCCATTCCA and CGGTTCTGGCGATCTCTTTG; calcitonin receptor, CGCATCCGCTTGAATGTG and TCTGTCTTTCCCCAGGAAATGA; cathepsin K, GGCTGTGGAGGCGGCTAT and AGAGTCAATGCCTCCGTTCTG; matrix metallopeptidase 9 (MMP-9), TATTTTTGTGTGGCGTCTGAGAA and GAGGTGGTTTAGCCGGTGAA; integrin �3,TGTGTGCCTGGTGCTCAGA and AGCAGGTTCTCCTTCAGGTTACA;JDP2, GCCATGCATTGCAAACACA and GGGAGGTGGATTGCAGTCTATG; and �-tubulin (housekeeping gene), CTGGGAGGTGATAAGCGATGAandCGCTGTCACCGTGGTAGGT. Each of these primer sets gave a uniqueproduct. PCR assays were performed in triplicate, and the data were pooled.Values obtained for levels of mRNAs were normalized to the levels of �-tubulinmRNA.

Construction and expression of p85� expressing retroviral vectors. Wholespleen was used as source of total RNA for the synthesis of cDNA encodingp85�. Total RNA was extracted using TRI reagent (Molecular Research Center,Inc., Cincinnati, OH) following the manufacturer’s protocol. Briefly, 1 ml of TRIreagent was added into 100 mg of tissue for cell lysis and then vigorously mixedwith 0.2 ml of chloroform followed by centrifugation at 12,000 � g for 15 min.The aqueous phase was removed and mixed with 0.5 ml of isopropanol to allowRNA precipitation. The RNA was precipitated by centrifugation at 12,000 � gfor 8 min and then washed with 1 ml of 75% ethanol. The dry RNA pellet wasdissolved in RNase-free water. cDNA was synthesized using a Superscript First-Strand Synthesis system for RT-PCR (Invitrogen Life Technologies, Carlsbad,CA). Following synthesis of cDNA, the following primers were used for a p85�PCR: forward, 5�-GAATTCATGTACCCATACGATGTTCCAGATTACGCTATGAGTGCAGAGGGCTACCAG; reverse, 5�-CTCGAGTCATCGCCTCTGTTGTGCATATAC. Restriction sites used for cloning purposes have been un-derlined. The 5� end of the primer contains an HA sequence to discriminatebetween exogenous and endogenous p85� regulatory subunits. PCR was per-formed using the following conditions: an initial denaturation step at 94°C for 2min followed by 35 cycles of 94°C for 15 s, 60°C for 1 min, and 72°C for 2 min,with a final step of 72°C for 7 min. For the cloning of p85� with a deletion of SH3(i.e., p85� SH3; amino acid residues 81 to 724 of p85�), the full-length versionof p85� was used as a template and amplified using the following primers:forward, 5�-CCAGAATTCATGTACCCATACGATGTTCCAGATTAC GCTAGAATTTCACCCCCT ACTCCC; and reverse, 5�-CCACTCGAGTCATCGCCTCTGTTGTGCATATACTGG (restriction sites are underlined). The ampli-fied cDNA was cloned into the EcoRI and XhoI sites upstream of an internalentry site and the enhanced green fluorescence (EGFP) protein containingbicistronic retroviral vector MIEG3 (57).

7184 MUNUGALAVADLA ET AL. MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Retroviral supernatants for transduction of primary OCps were generatedusing the Phoenix ecotropic packaging cell line transfected with retroviral vectorplasmids using a calcium phosphate transfection kit (Invitrogen, Carlsbad, CA).Supernatants were collected at 48 h posttransfection and filtered through 0.45-m-pore-size membranes. For transductions using bone marrow-derived OCps,bone marrow cells were subjected to Histopaque-Ficol density gradient centrif-ugation. Low-density cells were collected, suspended in Iscove’s modified Dul-becco’s medium containing 20% fetal bovine serum and 1% penicillin-strepto-mycin, and prestimulated in non-tissue culture plates for 2 days prior totransduction on retronectin (Peprotech, Rocky Hill, NJ). Forty-eight hours afterinfection, cells expressing similar levels of EGFP in every group (vector aloneand p85�) were sorted to homogeneity, and OCs were generated by growingthem in the presence of M-CSF and RANKL. After 6 days of culture, multinu-cleated OCs were identified by a TRAP activity assay. Total numbers of cellswere enumerated by counting TRAP� cells in 24-well tissue culture plates.

RESULTS

OCs express multiple regulatory subunits of class IA PI3-K,and loss of the p85� regulatory subunit results in increasedbone mass and bone density in vivo. To determine whichregulatory subunit of class IA PI3-K is expressed in OCs, weperformed Western blot analysis on early (3 days old) and late(6 days old) in vitro bone marrow-derived OCps from wild-typeand p85��/� mice. As seen in Fig. 1, robust expression of p85�,p50�, and p55� isoforms of p85 in early (Fig. 1, lane 1) wild-type OCps as well as a modest but a significant reduction in theexpression of the shorter isoforms (p50� and p55�) in p85�-deficient OCps was observed (lane 2). In contrast, during latestages of OC maturation (6-day-old OCs), the expression ofthe shorter isoforms of p85� (p50� and p55�) was significantlyreduced in both wild-type as well as p85�-deficient OCps al-though a modest increase in the expression of the shorterisoform (p50�) was observed in p85�-deficient OCps com-pared to wild-type controls (lane 4). Overexpression of p50� inp85�-deficient adipocytes derived from these same mice hasalso been reported previously (50). The presence of the non-specific band in the middle of the full-length and shorter iso-forms has also been reported by other investigators using this

same antibody (50). These results suggest that OCs expressmultiple regulatory subunits of class IA PI3-K; however, theexpression of the full-length p85� isoform is most abundant.

Given the importance of the PI3-K pathway in regulatingOC functions in vitro based on studies using pharmacologicinhibitors of this pathway, we examined if p85� is specificallyrequired for bone development in vivo. To determine this, wecharacterized the skeletal defects in mice deficient in the ex-pression of the full-length form of p85�. We measured thebone mass and architecture of 18-week-old wild-type controland p85��/� mice using CT. Figure 2A and B demonstraterepresentativeCT reconstructions from the distal third of theright femur in 18-week-old male and female wild-type andp85��/� mice. The anterior half of the bone has been digitallyremoved to reveal the trabecular bone compartment within themetaphysis. Numerous trabeculae and greater proximal en-croachment of the trabecular network are readily apparent inp85��/� mice than in wild-type controls. Figure 2C shows aquantitative comparison of the trabecular number, trabecularspacing, bone volume fraction, and connectivity density be-tween wild-type and p85��/� mice. Significantly greater tra-becular number and significantly lower spacing between tra-beculae were observed in both female p85��/� mice (Fig. 2Aand C) and male p85��/� mice (Fig. 2B and C) than in theirsex-matched wild-type littermates (n 10 in each experiment),a common feature in high-bone-mass conditions. The bonevolume fraction was also elevated in p85��/� mice. These datasuggest that p85��/� mouse skeleton exhibits increased tra-becular bone mass and architecture.

Given the increase in bone volume in p85��/� mice, we nextdetermined the number of OCs in p85��/� mice in vivo. Thefemurs of 7- to 8-week-old syngeneic p85��/� and wild-typemice were decalcified, and histological sections from the distalmetaphysis were stained for the OC enzyme TRAP. Strikingly,there was a marked increase in the number of OCs per unit oftrabecular surface (Fig. 2D) in p85��/� mice compared towild-type controls. Recent studies have suggested that secretedTRAP 5b is an indicator of the number of OCs in vivo but nottheir activity (2–4, 11). To assess whether the increased num-bers of OCs observed in p85��/� mice by TRAP staining werealso observed using a surrogate assay, we enumerated TRAP5b serum levels in both young and older wild-type and p85��/�

mice. As seen in Fig. 2E and F, a significant increase in thelevel of serum TRAP 5b in both young (7 to 8 weeks old) andolder (16 to 17 weeks old) p85��/� mice was observed com-pared to wild-type control mice. However, bone formationrates in p85��/� mice were indistinguishable from their wild-type counterparts (Fig. 2G to I), establishing that the increasedskeletal mass of p85��/� mice does not reflect acceleratedbone formation. Interestingly, enhanced numbers of OCs invivo, along with elevated serum TRAP 5b levels, have beenreported in mouse mutants lacking Vav guanine exchange fac-tor as well as the adaptor protein Gab2 (16, 55). Both of thesetypes of mutant mice demonstrate increased bone mass in vivo,which is associated with impaired OC function(s) in vitro.Taken together, our results demonstrate a requirement forp85� in the regulation of bone mass in vivo. Furthermore, ourresults suggest that, although an increase in OC number isobserved in p85�-deficient mice in vivo, p85�-deficient OCsmay be functionally impaired.

FIG. 1. Expression of p85 (p85�, p50�, p55�, and p85�) in wild-type (WT) and p85��/� OCs. OCps were cultured in the presence ofM-CSF (10 ng/ml) and RANKL (100 ng/ml) for either 3 days or 6 days,after which the cells were harvested and subjected to Western blotanalysis using a pan-anti-p85 antibody (this antibody recognizes allregulatory subunits of class IA PI3-K). Arrows in the top panel indicatethe level of expression of p85 regulatory subunits in wild-type andp85��/� OCs. The bottom panel demonstrates total levels of �-actin ineach lane.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

7186


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

p85� is essential for OC growth and maturation. To eval-uate the effect of p85� in regulating OC growth, we nextdetermined whether deficiency of p85� affects OCps in vitro.To study this, we stimulated mutant and wild-type OCps withincreasing doses of M-CSF or increasing doses of RANKL orboth. After 48 h of culture, cells were pulsed with [3H]thymi-dine for 6 h. A significant reduction in [3H]thymidine incorpo-ration was observed in p85��/� OCps compared to wild-typecontrols at all doses of M-CSF (Fig. 3A) or RANKL (Fig. 3B)or in the presence of both M-CSF and RANKL (Fig. 3C).Given that PI3-K has been demonstrated to play an essentialrole in regulating the survival of cells in part by regulating theactivation of Akt (9, 13, 43), we next examined survival/apop-tosis in wild-type and p85��/� bone marrow-derived OCs. OCswere generated by culturing low-density mononuclear cells inthe presence of M-CSF and RANKL as previously described

(61). Purified OCs were cultured in M-CSF in the absence ofserum, and apoptosis was assessed over a span of 18 h usingannexin V staining. No significant difference in the rate ofapoptosis was observed between wild-type and p85��/� OCs(Fig. 4A and B). Thus, deficiency of p85� in OCps confers onthese cells hyporesponsiveness to the critical osteoclastogeniccytokines M-CSF and RANKL, which leads to reduction inOCp proliferation but not survival.

Defective morphology and differentiation of p85��/� OCs.It has been previously reported in mice that genetic deletion ofSHIP, a negative regulator for PI3-K, results in enhanced dif-ferentiation of OCs (i.e., gain of function) (47). To determinehow loss of the p85� regulatory subunit of class IA PI3-Kimpacts maturation of OCs, we evaluated OC differentiationfollowing OC culturing and subjected the cells to TRAP stain-ing to identify multinucleated OCs (61). Wild-type andp85��/� OCs were generated by culturing OCps for 6 dayswith RANKL (100 ng/ml) and increasing concentrations ofM-CSF (10, 30, and 100 ng/ml). As seen in Fig. 5A, osteoclas-togenesis was significantly impaired in p85��/� cultures, asreflected by a significant decrease in the number of multinu-cleated TRAP� cells at three concentrations of M-CSF to-gether with RANKL (100 ng/ml) compared to wild-type cul-tures (Fig. 5A). Representative photographs (Fig. 5A) and aquantitative assessment of TRAP� wild-type control andp85��/� OCs are shown in Fig. 5B and C. To examine whetherdeletion of p85� leads to a delay in OC differentiation, wecultured p85��/� OCs for an additional 2 days (total, 8 days)followed by TRAP staining. Culturing wild-type OCps for anadditional 2 days induced apoptosis in a majority of very largemultinucleated cells (data not shown); however, no improve-ment in the differentiation potential of p85��/� OCs was ob-served by maintaining these cells for an additional 2 days inculture (data not shown). These results suggest that loss ofp85� impairs OC maturation and proliferation in response toM-CSF and RANKL stimulation.

Expression of p85� in OCs is essential for �v�3 and OPN-mediated migration, adhesion, and bone resorption in vitro.Bone resorption by OCs is greatly dependent on their ability toadhere and migrate on the bone surface in part via integrin�v�3 (33). To determine whether the loss of p85� alters theability of these cells to migrate on extracellular matrix viaintegrins, equivalent numbers of wild-type and p85��/� OCs

FIG. 2. Deficiency of p85� in vivo results in increased bone mass. Representative CT reconstructions from the distal third of the right femurin 18-week-old female (A) and male (B) wild-type (WT) and p85��/� mice. The anterior half of the bone has been digitally removed to reveal thetrabecular bone compartment within the metaphysis. Note the more numerous trabeculae and the greater proximal encroachment of the trabecularnetwork in the p85��/� mice. (C) CT-derived measurements of the trabecular bone volume fraction (BV/TV), trabecular number (Tb.N),thickness (Tb.Th), and separation (Tb.Sp) revealed significantly more numerous trabeculae, with significantly less spacing between trabeculae, acommon feature in high-bone-mass conditions (n 20 mice including 10 wild-type [7 males and 3 females] and 10 p85��/� mice [7 males and 3females]). Error bars represent � 1 standard error of the mean. *, P � 0.01. (D) Quantitative analysis of the number of OC per bone volume invivo in wild-type and p85��/� bone sections reacted for TRAP activity (n 3). *, P � 0.05. TRAP 5b levels in the serum of 16- to 17-week-old(E) or 6- to 7-week-old (F) wild-type and p85��/� mice. Solid-phase immunofixed enzyme activity assay for the determination of OC-derivedTRAP 5b in mouse serum was assessed as described in Materials and Methods. A significant increase in the serum TRAP 5b levels was noted inboth old and young p85��/� mice compared to wild-type controls. For the 16- to 17-week age group, five wild-type and seven p85��/� mice wereused. For the 6- to 7-week-old age group, 11 wild-type and 12 p85��/� mice were used. *, P � 0.01. (G to I) Trabecular bone turnover was assessedin the secondary spongiosa by measuring the extent of single label (sL.Pm) and double label (dL.Pm) perimeter and the area of bone (dL.Ar)between the calcein and alizarin labels. Derived histomorphometric parameters include mineralizing surface (MS/BS), a measure of activebone-forming surface; MAR, a measure of the rate of radial expansion of new bone; and the bone formation rate (BFR). Five wild-type and fivep85��/� mice were used (P � 0.05).

FIG. 3. Defective proliferation of p85��/� OCps. Wild-type (WT)and p85��/� OCps were cultured in the presence of increasingamounts of M-CSF (A) or RANKL (B) or both (C). After 2 days,proliferation was evaluated by a [3H]thymidine incorporation assay.Bars represent the mean [3H]thymidine incorporation in OCps (cpm �standard deviation) from one representative experiment performed intriplicate. Similar results were observed in two independent experi-ments. *, P � 0.05 for wild-type versus p85��/� OCs.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

were placed in the upper chamber of a transwell coated with�v�3 or osteopontin (OPN), and migration was assessed inresponse to M-CSF. A significant reduction in the migration ofp85��/� OCs toward vitronectin and OPN was observed incomparison to wild-type controls (Fig. 6A). Further, deficiencyof p85� in OCs also affected their ability to adhere to OPN(Fig. 6B).

One of the functions of OCs is to form specialized cell-extracellular matrix to induce the degradation of bone matrixby releasing proteinases (8). We next asked whether deletionof p85� influences OC resorption activity. This process wasassessed in vitro by culturing OCs on bone slices (dentin) andthen evaluating the number and area of bone “pits” that wereresorbed. Wild-type and p85��/� OCs (105/dish) were culturedonto dentine slices for 7 days in the presence of M-CSF andRANKL. Following culture, dentine slices were stained withtoluidine blue, and pit formation was evaluated. As seen inrepresentative photomicrographs from two independent ex-periments, deficiency of p85� in OCs significantly impaired theability of these cells to form pits (Fig. 7A). Quantitative as-sessment of the percent resorbing area from four independentexperiments is shown in Fig. 7B. These results suggest that thebone resorption potential of p85��/� OCs is significantly re-duced compared to the resorption potential of wild-type OCs.

p85� regulates actin organization. The OC bone-resorbingcapacity involves the organization of the actin cytoskeleton toform a specialized matrix that initiates degradation of bonematrix by releasing proteases (8). This process involves severalsmall actin-based adhesion structures called podosomes thatare organized into complex structures identified as clusters,rings, and ultimately belts to form a functional sealing zone.Given the role of PI3-K in regulating cytoskeleton functions,we next evaluated the impact of p85� deficiency on modulatingthe actin cytoskeleton using previously reported criteria (12).Wild-type cultures demonstrated markedly larger multinucle-ated OCs than p85��/� cultures following phalloidin staining,as observed in the low-power field (�40 magnification) (Fig. 8)and a higher-power field (�100) (Fig. 8). The yellow arrow-heads in Fig. 8, frame 3, indicate representative belt formationin the OCs while red arrows represent clusters. p85��/� OCsdemonstrate significantly fewer numbers of belt structures thanthe wild-type (Fig. 8, frame 3). These data indicate that p85�plays an essential role in functional F-actin organization.

p85��/� OCps have reduced PI3-K, Akt, and Erk activation.Binding of M-CSF to its receptor results in the autophosphor-ylation of the M-CSF receptor on several intracellular tyrosineresidues, thereby creating docking sites for various SH2- andSH3-containing signaling molecules. Several of these tyrosine

FIG. 4. Deficiency of p85� in OCps does not alter the survival of these cells. Serum- and cytokine-depleted OCps were stained with annexinV-phycoerythrin and 7-AAD and analyzed by flow cytometry. (A) Representative dot blot showing the percent survival of OCps as determined bythe lack of staining of cells by either annexin V and/or 7-AAD (i.e., lower-left coordinate). (B) Bar graph demonstrating percentage of annexinV- and 7-AAD-negative cells at various time points in the absence of serum and cytokines.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

sites have been mapped in the M-CSF receptor. The p85�regulatory subunit of PI3-K binds to Tyr 721 (41), therebybringing PI3-K into proximity with its substrates in theplasma membrane. To determine the in vivo consequencesof loss of p85� in OCs on the activation of total PI3-Kactivity in wild-type and p85��/� OCps stimulated with ei-ther M-CSF alone, RANKL alone, or with a combination ofboth M-CSF and RANKL, OCps cultured in the presenceof M-CSF and RANKL for 2 to 3 days were starved for 6 hof growth factors and stimulated with either M-CSF alone,RANKL alone, or a combination of both cytokines for 2 and5 min. The lysates were subsequently subjected to a PI3-K

FIG. 5. Defective morphology and differentiation of p85��/� OCps. (A) Representative photomicrographs of OCps of the indicated genotypesgenerated in vitro following culture in M-CSF (10 to 100 ng/ml) and RANKL (100 ng/ml). OCps were identified by staining for TRAP activity. Arepresentative field is shown. (B) Quantitative reduction in the number of multinucleated (�3 nuclei/field) TRAP� OCs is shown. Bars representthe mean numbers of multinucleated cells (mean � standard deviation) of one representative experiment performed in replicates of three (10 fieldswere counted per replicate). *, P � 0.05 for wild-type versus p85��/�. (C) Relative number of TRAP� cells from five independent experimentsis summarized in a line chart. *, P � 0.05 for wild-type versus p85��/� OCs. OD, optical density.

FIG. 6. Impaired migration and adhesion in p85��/� OCs.(A) OC migration via �v�3 integrin or OPN in the presence ofM-CSF. (B) OC adhesion via OPN in the presence of M-CSF.Results represent mean � standard error of the mean of fourindependent experiments. *, P � 0.01; **, P � 0.001 (comparingp85��/� versus wild-type OCs). WT, wild type.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

activity assay as described in the Materials and Methodssection. As seen in Fig. 9A to C, a significant reduction inthe overall PI3-K activity was observed in p85�-deficientOCps treated with M-CSF, RANKL, or a combination ofboth cytokines. These results suggest that up to 40% of theM-CSF- and RANKL-induced PI3-K activity in OC progen-itors is regulated via the full-length form of p85�.

Previous studies have shown that PI3-K can regulate theactivation of both Akt and Erk MAP kinase (5). To determinethe extent to which the deficiency of p85� modulates the ac-tivation of Erk MAP kinase and Akt in response to M-CSF,RANKL, or both of these cytokines, we performed Western

blot analysis on OCps that were starved and then stimulatedwith these cytokines using phosphospecific antibodies that rec-ognize the activated forms of Akt and Erk MAP kinase. Asseen in Fig. 9D and E, deficiency of p85� in OCps results in asignificant decrease in the activation of both Akt and Erk MAPkinase. Under these culture conditions stimulation of OCpswith RANKL alone did not induce the activation of Erk MAPkinase although a significant increase in the activation of ErkMAP kinase was observed in wild-type OCps stimulated withboth M-CSF and RANKL together. In contrast, activation ofAkt in response to RANKL stimulation was robust and ap-peared to be further augmented in the presence of M-CSF

FIG. 7. Impaired bone resorption by p85��/� OCs. Bone resorptive activity was measured by a pit formation assay. (A) Representativephotomicrographs of a bone resorption assay from two independent experiments following culture of OCps on dentine slices. The resorbed boneis stained dark blue. The number and area of resorbed regions, referred to as pits, are quantitated in panel B. Data are the mean from fourindependent experiments. *, P � 0.01, wild-type versus p85��/�. WT, wild type.

FIG. 8. Altered actin organization in p85��/� OCs. Representative photomicrograph of OCps following staining with fluorescein isothiocya-nate-conjugated phalloidin at magnifications of �40 (frames 1 and 2) and �100 (frames 3 and 4). Arrows in frames 1 and 2 indicate clusters.Arrows in frame 3 indicate belt-forming cells. The experiment was conducted on three independent occasions.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

(Fig. 9D, lanes 6 and 8). These results suggest that activation ofboth Akt as well as Erk MAP kinase is significantly modulatedas a result of reduced over all PI3-K activity due to p85�deficiency in OCps.

Deficiency of p85� alters the expression of multiple OC-specific genes. Previous studies have demonstrated an essentialrole for PI3-K in regulating multiple aspects of OC biology,including growth, differentiation, and actin-based functions.Since most of these results have been derived from experi-ments performed using pharmacologic inhibitors of PI3-K,which inhibit all classes of PI3-K, we sought to determine thenature of genes affected by the loss of a specific subunit ofPI3-K, namely, p85�. We used Affymetrix GeneChips (MG-U74Av2) to profile mRNA expression in wild-type andp85��/� OCs. Wild-type and p85��/� OCs grown in the pres-ence of M-CSF and RANKL for 6 days were utilized forisolating mRNA. We chose this time point to define alterationsin gene expression related to OC growth and differentiation.Previous studies have shown that by 6 days of M-CSF andRANKL treatment, fully differentiated TRAP� OCs are typi-cally observed. Numerous known OC-specific genes were ob-served in OC samples derived from wild-type mice (Table 1).Importantly, a 13.9-fold reduction in the expression of thep85� subunit of class IA PI3-K was observed in samples derivedfrom p85��/� mice relative to the wild type, thus validating our

experimental system. Several of the genes affected by the lossof p85� expression were related to OC growth and maturation,including macrophage-stimulating 1 receptor, OC-associatedreceptor, calcitonin receptor, TRAP, MMP-9, integrin �v, in-tegrin �3, cathepsin K and transcription factors such as MITFand JDP2 (Table 1). In addition, the expression of severalother genes was also affected due to lack of p85�. These in-clude genes related to transcription, cell adhesion, signaling,cell growth, chemokines, proteases/inhibitors, transporters, ex-tracellular protein, cytoskeletal protein as well as proteins in-volved in metabolism, electron transport, blood coagulationand metal ion binding (Table 1).

To confirm the data generated using microarray experimentsusing another experimental approach, we performed real timequantitative RT-PCR analysis on mRNA samples from wild-type and p85��/� OCs generated in a manner similar to thosedescribed for the microarray analysis. We focused our analysison genes known to play a critical role in OC growth andmaturation and shown to be significantly downregulated inmicroarray analysis, including, macrophage-stimulating 1 re-ceptor, OC-associated receptor, calcitonin receptor, TRAP,MMP-9, integrin �v, integrin �3, cathepsin K, transcriptionfactor MITF, and JDP2. Consistent with the microarray anal-ysis, two independent quantitative real-time RT-PCR experi-ments also demonstrated a two- to threefold reduction in the

FIG. 9. Reduced activation of PI3-K, Akt, and MAP kinase in p85��/� OCps in response to both M-CSF and RANKL. Wild-type (WT) andp85��/� OCps were starved and stimulated with a combination of M-CSF and RANKL (A), RANKL (100 ng/ml) (B), or M-CSF (10 ng/ml) (C) for2 and 5 min. Equal amounts of cell lysates were subjected to a PI3-K lipid assay as described in the Materials and Methods section. Upper panelsdemonstrate quantitative reduction in the level of PI3-K activity in p85��/� OCps. Arrows in the bottom panels indicate the level of activation ofPI3P and PIP2 in response to the indicated cytokines. (D and E) Reduced activation of Akt and Erk1/2 MAP kinase in p85��/� OCps. Wild-typeand p85��/� OCps were starved and stimulated with M-CSF (10 ng/ml) or RANKL (100 ng/ml) or a combination of both. Equal amounts of celllysates were subjected to Western blot analysis using an anti-phospho-Akt or an anti-phospho-Erk1/2 antibody. The amount of total Akt and Erkin each lane is indicated.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

TABLE 1. Microarray expression data

Category Gene description Fold change

Transcription Microphthalmia-associated transcription factor �1.73Early growth response 2 �1.8JDP2 �2.08Histone 2, H2aa1 �2.04Transcription factor AP-2, gamma �1.62TNF-�-induced protein 3 �2.16

Cell adhesion Integrin beta 3 �1.97Integrin alpha X �1.87Epidermal growth factor-like repeats and discordin I-like domains 3 �2.9Sialic acid binding immunoglobulin-like lectin 5 �2.92Protocadherin 7 �2.82Milk fat globule-epidermal growth factor 8 protein �1.9Integrin alpha v �1.84Killer cell lectin-like receptor subfamily B member 1A �3.0CD72 antigen �1.93

Signaling Regulator of G-protein signaling 1 �2.67PI3-K, regulatory subunit, polypeptide 1 (p85 alpha) �13.97Down syndrome critical region homolog 1 (human) �1.6Guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 �1.7Rab38, member of RAS oncogene family �2.2Megakaryocyte-associated tyrosine kinase �3.17PI-4-phosphate 5-kinase, type 1 alpha �1.9PCTAIRE-motif protein kinase 3 �1.9SLAM family member 8 �3.0Related RAS viral (r-ras) oncogene homolog 2 �1.85Phosphoinositide-3-kinase adaptor protein 1 �1.7G protein-coupled receptor 68 �1.7MAP kinase kinase kinase kinase 1 �1.76Phosphodiesterase 1C �1.7Ras homolog gene family, member J �1.9Met proto-oncogene �2.8

Cell growth Growth differentiation factor 3 �1.8Platelet-derived growth factor, B polypeptide �1.94Exostoses (multiple) 1 �1.92Ras homolog gene family, member C �1.93

Chemokines Chemokine (C-C motif) ligand 5 �2.2Chemokine (C-C motif) ligand 22 �1.63

Proteases/inhibitors Neurolysin (metallopeptidase M3 family) �2.64Carboxypeptidase E �2.05Cathepsin K �1.94Matrix metalloproteinase 9 �2.07Matrix metalloproteinase 19 �1.94Serine (or cysteine) proteinase inhibitor, clade D, member 1 �1.64Serine (or cysteine) proteinase inhibitor, clade B, member 9 �1.7Serine (or cysteine) proteinase inhibitor, clade B, member 6b �4.2Serine (or cysteine) proteinase inhibitor, clade B, member 9b �3.74Serine (or cysteine) proteinase inhibitor, clade B, member 1b �2.17Serine (or cysteine) proteinase inhibitor, clade E, member 2 �2.44

Transporter/receptor Histocompatibility 2, T region locus 24 �1.63Macrophage stimulating 1 receptor (c-met-related tyrosine kinase) �2.12Protein C receptor, endothelial �2.46Ryanodine receptor 1, skeletal muscle �1.88Solute carrier family 4 (anion exchanger), member 2 �1.99Solute carrier family 37 (glycerol-3-phosphate transporter), member 2 �1.8Solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 �1.73Solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 �1.64Potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 �2.2Potassium inwardly-rectifying channel, subfamily J, member 2 �2.02Growth hormone receptor �1.9Calcitonin receptor �2.65Transmembrane 7 superfamily member 4 �5.19Epithelial membrane protein 2 �2.13Solute carrier family 18 (vesicular monoamine), member 1 �1.68OC-associated receptor �2.42Potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 �2.2ATPase, H� transporting, lysosomal V0 subunit a isoform 1 �1.8Killer cell lectin-like receptor, subfamily A, member 17 �1.61

Continued on following page



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

expression of these genes in p85��/� OCs compared to wild-type OCs (Fig. 10 and data not shown).

In summary, microarray and quantitative RT-PCR analysisof wild-type and p85��/� OCs verified the induction of numer-ous target genes involved in OC maturation and growth andseveral genes involved in OC function. These data suggest thatthe transcriptional activation regulated by p85� in response to

M-CSF/RANKL stimulation may be important for OC growthand differentiation.

Reconstituting the expression of p85� in p85��/� OCpsrescues OC maturation defects. Having established that p85�has a specific role in modulating OC functions in vivo and invitro, we next examined whether the defect in OC differenti-ation in p85��/� mice and p85��/� OCs is directly related tothe loss of p85� protein and not due to other changes in thesecells. We cloned the p85� cDNA into a retroviral vector andthen transduced wild-type or p85��/� OCps either with theempty vector or with a virus expressing the p85� cDNA. Trans-duction efficiency was monitored on the basis of EGFP expres-sion. EGFP-positive cells were sorted to homogeneity and dif-ferentiated into OCs (Fig. 11). p85��/� OCps expressing theempty vector demonstrated a significant reduction in thegeneration of TRAP� multinucleated cells (Fig. 11C). Incontrast, reconstituting p85��/� OCps with a virus express-ing the full-length p85� cDNA rescued the maturation (asobserved by large multinucleated OCs) of p85��/� OCps towild-type levels.

Since the maturation defects associated with p85��/� OCpswere observed in spite of the presence of the shorter p50� andp55� isoforms, we hypothesized that the amino-terminal SH3domain of p85� must contribute to the maturation of OCpsdownstream from M-CSF and RANKL. To test this, we con-structed a version of p85� with a deletion of the SH3 domainand expressed it in p85��/� OCps. Figure 11A demonstratesthe transduction efficiency of various constructs as assessed byEGFP expression shown on the x axis. Figure 11B demon-strates the relative expression of various constructs as assessedby Western blot analysis of the HA-tagged version of either the

FIG. 10. Quantitative RT-PCR analysis of OC-specific genes inwild-type (WT) and p85��/� OCps. Wild-type and p85��/� OCpswere generated from bone marrow cultured for 6 days with RANKL(100 ng/ml) and M-CSF (10 ng/ml). Total mRNA was extracted asdescribed in Materials and Methods. Expression of mRNA for TRAP,JDP2, cathepsin K (Ctsk), calcitonin receptor (Calcr), MMP-9, andintegrin �3 (Itg�3) was analyzed by real-time RT-PCR using �-tubulinmRNA as an endogenous control. Bars represent the mean � standarddeviation of one independent experiment performed in replicates ofthree. Similar results were seen in two independent experiments. *,P � 0.01, wild-type versus p85��/�.

TABLE 1—Continued

Category Gene description Fold change

Fibroblast growth factor receptor 1 �2.8Megalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human) �1.7

Extracellular protein Ephrin B2 �2.48Glypican 1 �2.59MAM domain containing 2 �2.65

Cytoskeletal/structural protein Myosin IE �2.2Scinderin �2.67Procollagen, type IV, alpha 5 �2.83Plakophillin �2.62

Metabolism Acetyl-coenzyme A synthetase 2 (ADP forming) �1.7Enolase 2, gamma neuronal �1.83Lipoprotein lipase �2.13Phosphatidic acid phosphatase 2a �2.0Carbonic anhydrase 2 �2.7Wolfram syndrome 1 homolog (human) �2.04Earbohydrate sulfotransferase 11 �2.663-Hydroxybutyrate dehydrogenase (heart, mitochondrial) �2.48UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 �2.3Stearoyl-coenzyme A desaturase 2 �2.02Aldo-keto reductase family 1, member C18 �2.472�-5� Oligoadenylate synthetase 3 �2.32Stearoyl-coenzyme A desaturase 2 �2.02Acid phosphatase 5, tartrate resistant �2.12

Electron transport Cytochrome b-561 �2.0Blood coagulation Coagulation factor III �4.08

Coagulation factor II (thrombin) receptor �2.36Metal ion binding Metallothionein 3 �4.6



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

full-length form of p85� or the version with the SH3 domaindeletion (Fig. 11B, top panel). Figure 11B (middle panel)demonstrates total p85� protein as assessed by an antibodyagainst the SH3 domain of p85�. Note the undetectable ex-pression of p85� in Fig. 11B (lane 3, middle panel). As seen inFig. 11C, expression of p85� with the SH3 deletion in p85��/�

OCps only marginally rescued OC maturation. Taken together,these results confirm the importance of the amino-terminalSH3 domain of p85� in regulating RANKL- and M-CSF-in-duced OC growth and maturation.

DISCUSSION

A large body of evidence has demonstrated that the PI3-Kpathway is intimately associated with different phases of OCgrowth and development; however, the exact role this enzymeplays in OC function(s) in vivo and the role of specific isoformsof PI3-K in OC growth and development in vivo or in vitroremain poorly understood. The conclusions from most studiesconcerning the role of PI3-K in OCs have been based onpharmacologic inhibitors of PI3-K (wortmannin and LY294002).

FIG. 11. Reexpression of p85� into p85��/� OCps restores normal OC formation in vitro. (A) Flow cytometry profiles demonstrating thepercentage of transduced cells (as determined by EGFP expression; x axis) expressing either the empty vector (control) or HA-tagged full-lengthform of p85� (p85�-HA) or an HA-tagged version of p85� with a deletion of the SH3 domain (p85� SH3). (B) Wild-type and p85��/� cellsexpressing various versions of p85� indicated in panel A were sorted to homogeneity and subjected to Western blot (WB) analysis. Arrows in thetop panel indicate the expression of various p85� constructs as determined by an anti-HA antibody (ab). The middle panel demonstrates acomparison of the level of expression of the HA-tagged full-length version of p85� in p85��/� cells with that of endogenous levels of p85� inwild-type cells using an antibody that recognizes only the SH3 domain of p85�. The bottom panel demonstrates the level of protein in each laneas determined by the expression of �-actin. (C) Representative photomicrographs of OC culture following TRAP staining. Wild-type and p85��/�

OCps expressing the indicated constructs were cultured in the presence of M-CSF and RANKL for 6 days and subjected to TRAP staining. Shownis a representative field. Similar results were observed in two independent experiments. WT, wild type; �, anti.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Although informative, these data are limited due to the non-specific inhibition of all classes of PI3-Ks by pharmacologicinhibitors, thereby underscoring the need to examine the rel-evance of specific regulatory as well as catalytic subunits ofPI3-K in OC development. Identifying the function of specificsubunits is crucial as recent studies have begun to demonstratespecificity with respect to the function of distinct catalytic andregulatory subunits of PI3-K (59). Furthermore, if the PI3-Kpathway is to be appropriately targeted for the treatment ofdiseases involving OCs, a better understanding of the relativecontribution of various subunits of PI3-K in regulating OCfunctions is necessary. Our results in primary OCs demonstratean essential and nonredundant role for p85� regulatory sub-unit of class IA PI3-K in controlling multiple aspects of OCbiology. Importantly, these defects are observed in spite of thecontinued presence of other subunits of class IA PI3-K in thesecells.

p85� and p85� subunits of class IA PI3-K share near identityin the known functional domains in the carboxy terminus,including the amino-SH2 and the carboxy-SH2 domains, whichare critical for mediating association with other SH2-contain-ing proteins as well as binding to the p110 catalytic subunit.Interestingly, the domains in the carboxy terminus of p85� andp85� are also shared by the p50� and p55� subunits of class IA

PI3-K. Therefore, the basis for any differences in the interac-tions with the SH2 domains of other proteins is likely not to bederived from the carboxy terminus sequences of these regula-tory subunits. Thus, the amino-terminal domain of p85� mustplay a unique role in regulating M-CSF/RANKL-inducedgrowth, differentiation, and gene expression in OCs. Consis-tent with this notion, our in vitro results demonstrating a com-plete rescue in the maturation of p85�-deficient OCs by re-constituting the expression of the full-length form of p85� butnot the version with the deletion of the SH3 domain suggeststhat the signals emanating from the SH3 domain of p85� arelikely to play a critical role in OC maturation. Previous studiesin heterologous cell lines have suggested that the SH3 domainof p85� can interact with proteins that consist of proline-richregions, such as Sos and Cbl (25, 53). Studies are ongoing toidentify proteins that preferentially bind to the amino-terminalend of p85� in OCs.

Our results in p85��/� OCs corroborate recent findingsobserved in SHIP-deficient (SHIP�/�) OCs (47). SHIP isknown to downregulate PI3-K-initiated signals by dephosphor-ylating PI-3,4,5-triphosphate (PIP3). Deficiency of SHIP re-sults in enhanced survival of OC precursors, including hyper-sensitivity to M-CSF and RANKL (47). The size of SHIP�/�

OCs is significantly larger than that of wild-type OCs, and theycontain significantly greater numbers of nuclei. Functionally,these cells exhibit greater resorptive activity than wild-typecontrols. Consistent with higher resorptive activity, trabecularthickness and the trabecular volume fraction are reduced inSHIP�/� mice. Consistently, we show that deficiency of p85�,a positive regulator of PIP3, results in reduced sensitivity toM-CSF/RANKL, reduced OC size, and reduced resorptiveactivity leading to greater bone mass than in wild-type controls.These defects are likely due in part to reduced Akt and ErkMAP kinase activation in p85��/� OCs.

Although our results demonstrate that the deficiency ofp85� impacts the growth, maturation, and actin-based func-

tions in OCs, how precisely this occurs is likely to be compli-cated. To this end, our microarray and quantitative PCR stud-ies demonstrate a significant reduction in the expression ofmultiple genes involved in the regulation of OC functions,including MITF as well as MITF target genes such as TRAPand cathepsin K. M-CSF- and RANKL-induced regulation ofthe transcription factor MITF is critical for normal OC devel-opment (21, 49, 56). MITF plays an essential role inmultinucleation of OCs. Mutations in the MITF gene are as-sociated with osteopetrosis due to impaired OC developmentin multiple species. OCs derived from cells bearing naturallyoccurring mutants of MITF tend to be smaller and mononu-clear, rather than multinuclear, and often show lower TRAPactivity than control OCs. The lack of normal numbers ofnuclei in MITF mutant OCs has led to the idea that MITF mayplay an essential role in the fusion of OCs.

Mutations in the Ctsk gene cause the human disease pykno-dysostosis (19). Pyknodysostosis is an autosomal recessive os-teosclerotic disorder that is manifested in the form of shortstature, skeletal dysplasia, and bone fragility (19). Deficiencyof cathepsin K in mice results in mild osteopetrosis, elevatednumbers of OCs, and increased bone mass (32). A findingsimilar to the one reported here in p85��/� mice. Since M-CSF has been shown to regulate cathepsin K levels, our resultssuggest that M-CSF-mediated p85�-induced PIP3 levels mustplay an essential role in this process.

In addition to reduced expression of MITF and MITF targetgenes such as cathepsin K in p85��/� OCs, the expression ofthe transcription factor JDP2 was also reduced twofold. Over-expression of JDP2 leads to activation of both TRAP andcathepsin K gene promoters as well as the formation of TRAP-positive multinuclear OCs (27). Antisense oligonucleotide toJDP2 strongly suppresses OC formation (27). The fact thatp85��/� OCs demonstrate a twofold reduction in the expres-sion of JDP2 along with reduced TRAP activity and cathepsinK expression supports the notion that perhaps JDP2 and MITFcollaborate to regulate normal OC maturation, which is signif-icantly impaired as a result of p85� deficiency in p85��/� OCs.Although MITF and JDP2 are implicated in regulating theexpression of cathepsin K and TRAP, our results demonstratethat deficiency of p85� also affects the expression of otherproteins involved in OC maturation, including MMP-9 andcalcitonin receptor. Therefore, it is likely that the overall re-duction in the expression of multiple OC-specific genes con-tributes to the p85��/� OC phenotype in vitro.

Bone resorption by OCs is partly dependent on cell adhesionand migration. In OCs, Rho family GTPases such as Rho andRac downstream from the M-CSF receptor and �v�3 integrinplay an essential role in this process. Mice deficient in theexpression of �3 or Vav3 (the guanine exchange factor for Rhoand Rac) demonstrate defective bone resorption in part due todefects in cytoskeletal organization. Surprisingly, in spite ofdefects in bone resorption in �3�/� and Vav3�/� mice, thesemutant mice consist of substantially greater numbers of OCs invivo compared to wild-type controls (16, 33). Interestingly,deficiency of p85� also results in increased numbers of OCs invivo, which is associated with defects in actin-based functionsincluding adhesion and migration via �v�3 and M-CSF. Wehave recently demonstrated that the stimulation of bone mar-row-derived macrophages from p85��/� mice with M-CSF



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

also results in reduced activation of Rho GTPase Rac (34).Thus, it is likely that the enhanced bone mass, along withdefective resorptive capacity of p85��/� OCs, is in part con-tributed by altered Rac activation via �v�3 and M-CSF.

Although the number of OCs is greater in p85��/� micethan in wild-type controls, these cells appear to be defective intheir functional capabilities, including adhesion, migration,and bone resorption. These data suggest that perhaps impair-ing the ability of OCs to efficiently remove bone in vivo triggersa compensatory accumulation of functionally impaired OCs inp85��/� mice. Although the mechanism(s) underlying this re-sponse is unclear, the phenomenon of increased numbers ofOCs in vivo due to an apparent deficiency in a signaling mol-ecule in OCs does not seem to be unique to p85�-deficientmice. Others have reported a similar accumulation of OCs invivo, which is associated with decreased net resorption afterextended treatment with bisphosphonate. In addition, severalmutant mice lacking signaling components of the M-CSFand/or RANKL as well as the �v�3 signaling cascade havebeen described that also demonstrate higher numbers ofTRAP 5b� OCs in vivo (similar to those seen in p85��/� mice)but possess enhanced bone volume as a result of defective OCfunction in vitro, including bone resorption. These includemice that are deficient in the expression of the guanine ex-change factor for Rac, Vav3 (16), �3 integrin (33), cathepsin K(32), NIK (37), and p62 (14) as well as mice lacking the mem-brane adaptor protein DAP12 (17, 23). A common feature ofthese mice with respect to osteoclastogenesis is the presence ofsevere and profound defects in OC growth and differentiationas well as other functions, including multinucleation in vitro inresponse to M-CSF and RANKL despite normal or elevatednumbers of OCs in vivo. Although the exact reason behind thein vivo and in vitro disparity in these mutant mice is not clear,some hypotheses have been put forth to explain these differ-ences (37). To this end, it has been suggested that in vitroculture conditions are likely to reflect activated or stress-in-duced osteoclastogenesis rather than basal osteoclast develop-ment (37). Alternatively, it has been proposed that a compen-satory mechanism(s) may mask the in vivo bone phenotypes insome of these mutant mice (37). There are significant data tosupport both these possibilities. Studies have shown that sev-eral of the above-listed mouse mutants do not reveal substan-tial bone phenotypes under steady-state conditions but exhibitdefects under conditions of stress. Likewise, although M-CSFand RANKL play an essential role in the growth and differ-entiation of osteoclasts in vitro, it is conceivable that in theabsence of normal signaling via these cytokines in vivo, othercytokines within the bone marrow microenvironment, such astumor necrosis factor alpha (TNF-�) and/or transforminggrowth factor � might compensate (1, 6, 10, 18, 24, 28, 31).Previous studies have shown that a combination of RANKL,TNF-�, and transforming growth factor � can rescue the OCdefects observed in the absence of NIK in vitro (37). Thus, it islikely that the expression of these additional growth factors inthe bone marrow environment allows normal OCs develop-ment in the absence of p85� in vivo, which would be reflectiveof basal but not activated or stressed-induced osteoclastogen-esis. These possibilities are currently being investigated.

In summary, our results demonstrate that genetic disruptionof the p85� subunit of class IA PI3-K dampens cytokine- and

integrin-based functions in OCs. We further show that thesedefects are associated with alteration in the expression of crit-ical OC-specific genes previously implicated in regulating bothOC maturation and actin-based functions. Thus, p85� plays anessential role in integrating signals downstream from cytokinesand integrins in regulating osteoclastogenesis.

ACKNOWLEDGMENTS

We thank Marilyn Wales for assistance in manuscript preparation.We have no conflict of interests to declare.This work was supported by NIH grants R01 HL075816 and R01

HL077177 to R.K.

REFERENCES

1. Abu-Amer, Y., F. P. Ross, J. Edwards, and S. L. Teitelbaum. 1997. Lipo-polysaccharide-stimulated osteoclastogenesis is mediated by tumor necrosisfactor via its P55 receptor. J. Clin. Investig. 100:1557–1565.

2. Alatalo, S. L., J. M. Halleen, T. A. Hentunen, J. Monkkonen, and H. K.Vaananen. 2000. Rapid screening method for osteoclast differentiation invitro that measures tartrate-resistant acid phosphatase 5b activity secretedinto the culture medium. Clin. Chem. 46:1751–1754.

3. Alatalo, S. L., K. K. Ivaska, S. G. Waguespack, M. J. Econs, H. K. Vaananen,and J. M. Halleen. 2004. Osteoclast-derived serum tartrate-resistant acidphosphatase 5b in Albers-Schonberg disease (type II autosomal dominantosteopetrosis). Clin. Chem. 50:883–890.

4. Alatalo, S. L., Z. Peng, A. J. Janckila, H. Kaija, P. Vihko, H. K. Vaananen,and J. M. Halleen. 2003. A novel immunoassay for the determination oftartrate-resistant acid phosphatase 5b from rat serum. J. Bone Miner. Res.18:134–139.

5. Bar-Sagi, D., and A. Hall. 2000. Ras and Rho GTPases: a family reunion.Cell 103:227–238.

6. Birkedal-Hansen, H. 1993. Role of matrix metalloproteinases in humanperiodontal diseases. J. Periodontol. 64:474–484.

7. Bolstad, B. M., R. A. Irizarry, M. Astrand, and T. P. Speed. 2003. A com-parison of normalization methods for high density oligonucleotide array databased on variance and bias. Bioinformatics 19:185–193.

8. Boyle, W. J., W. S. Simonet, and D. L. Lacey. 2003. Osteoclast differentiationand activation. Nature 423:337–342.

9. Burow, M. E., C. B. Weldon, L. I. Melnik, B. N. Duong, B. M. Collins-Burow,B. S. Beckman, and J. A. McLachlan. 2000. PI3-K/AKT regulation of NF-�Bsignaling events in suppression of TNF-induced apoptosis. Biochem. Bio-phys. Res. Commun. 271:342–345.

10. Cenci, S., M. N. Weitzmann, M. A. Gentile, M. C. Aisa, and R. Pacifici. 2000.M-CSF neutralization and egr-1 deficiency prevent ovariectomy-inducedbone loss. J. Clin. Investig. 105:1279–1287.

11. Chu, P., T. Y. Chao, Y. F. Lin, A. J. Janckila, and L. T. Yam. 2003. Corre-lation between histomorphometric parameters of bone resorption and serumtype 5b tartrate-resistant acid phosphatase in uremic patients on mainte-nance hemodialysis. Am. J. Kidney Dis. 41:1052–1059.

12. Destaing, O., F. Saltel, J. C. Geminard, P. Jurdic, and F. Bard. 2003.Podosomes display actin turnover and dynamic self-organization in osteo-clasts expressing actin-green fluorescent protein. Mol. Biol. Cell 14:407–416.

13. Dudek, H., S. R. Datta, T. F. Franke, M. J. Birnbaum, R. Yao, G. M. Cooper,R. A. Segal, D. R. Kaplan, and M. E. Greenberg. 1997. Regulation ofneuronal survival by the serine-threonine protein kinase Akt. Science 275:661–665.

14. Duran, A., M. Serrano, M. Leitges, J. M. Flores, S. Picard, J. P. Brown, J.Moscat, and M. T. Diaz-Meco. 2004. The atypical PKC-interacting proteinp62 is an important mediator of RANK-activated osteoclastogenesis. Dev.Cell 6:303–309.

15. Faccio, R., S. Takeshita, A. Zallone, F. P. Ross, and S. L. Teitelbaum. 2003.c-Fms and the �v�3 integrin collaborate during osteoclast differentiation.J. Clin. Investig. 111:749–758.

16. Faccio, R., S. L. Teitelbaum, K. Fujikawa, J. Chappel, A. Zallone, V. L.Tybulewicz, F. P. Ross, and W. Swat. 2005. Vav3 regulates osteoclast func-tion and bone mass. Nat. Med. 11:284–290.

17. Faccio, R., W. Zou, G. Colaianni, S. L. Teitelbaum, and F. P. Ross. 2003.High dose M-CSF partially rescues the Dap12�/� osteoclast phenotype.J. Cell Biochem. 90:871–883.

18. Fuller, K., J. M. Lean, K. E. Bayley, M. R. Wani, and T. J. Chambers. 2000.A role for TGFbeta(1) in osteoclast differentiation and survival. J. Cell Sci.113:2445–2453.

19. Gelb, B. D., G. P. Shi, H. A. Chapman, and R. J. Desnick. 1996. Pycnodys-ostosis, a lysosomal disease caused by cathepsin K deficiency. Science 273:1236–1238.

20. Golden, L. H., and K. L. Insogna. 2004. The expanding role of PI3-kinase inbone. Bone 34:3–12.

21. Hershey, C. L., and D. E. Fisher. 2004. Mitf and Tfe3: members of a



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

b-HLH-ZIP transcription factor family essential for osteoclast developmentand function. Bone 34:689–696.

22. Hsu, H., D. L. Lacey, C. R. Dunstan, I. Solovyev, A. Colombero, E. Timms,H. L. Tan, G. Elliott, M. J. Kelley, I. Sarosi, L. Wang, X. Z. Xia, R. Elliott,L. Chiu, T. Black, S. Scully, C. Capparelli, S. Morony, G. Shimamoto, M. B.Bass, and W. J. Boyle. 1999. Tumor necrosis factor receptor family memberRANK mediates osteoclast differentiation and activation induced by osteo-protegerin ligand. Proc. Natl. Acad. Sci. USA 96:3540–3545.

23. Kaifu, T., J. Nakahara, M. Inui, K. Mishima, T. Momiyama, M. Kaji, A.Sugahara, H. Koito, A. Ujike-Asai, A. Nakamura, K. Kanazawa, K. Tan-Takeuchi, K. Iwasaki, W. M. Yokoyama, A. Kudo, M. Fujiwara, H. Asou,and T. Takai. 2003. Osteopetrosis and thalamic hypomyelinosis withsynaptic degeneration in DAP12-deficient mice. J. Clin. Investig. 111:323–332.

24. Kaneda, T., T. Nojima, M. Nakagawa, A. Ogasawara, H. Kaneko, T. Sato, H.Mano, M. Kumegawa, and Y. Hakeda. 2000. Endogenous production ofTGF-� is essential for osteoclastogenesis induced by a combination of re-ceptor activator of NF-�B ligand and macrophage-colony-stimulating factor.J. Immunol. 165:4254–4263.

25. Kapeller, R., K. V. Prasad, O. Janssen, W. Hou, B. S. Schaffhausen, C. E.Rudd, and L. C. Cantley. 1994. Identification of two SH3-binding motifs inthe regulatory subunit of phosphatidylinositol 3-kinase. J. Biol. Chem. 269:1927–1933.

26. Katso, R., K. Okkenhaug, K. Ahmadi, S. White, J. Timms, and M. D.Waterfield. 2001. Cellular function of phosphoinositide 3-kinases: implica-tions for development, homeostasis, and cancer. Annu. Rev. Cell Dev. Biol.17:615–675.

27. Kawaida, R., T. Ohtsuka, J. Okutsu, T. Takahashi, Y. Kadono, H. Oda, A.Hikita, K. Nakamura, S. Tanaka, and H. Furukawa. 2003. Jun dimerizationprotein 2 (JDP2), a member of the AP-1 family of transcription factor,mediates osteoclast differentiation induced by RANKL. J. Exp. Med. 197:1029–1035.

28. Keffer, J., L. Probert, H. Cazlaris, S. Georgopoulos, E. Kaslaris, D.Kioussis, and G. Kollias. 1991. Transgenic mice expressing human tu-mour necrosis factor: a predictive genetic model of arthritis. EMBO J.10:4025–4031.

29. Kudo, O., A. Sabokbar, A. Pocock, I. Itonaga, and N. A. Athanasou. 2002.Isolation of human osteoclasts formed in vitro: hormonal effects on thebone-resorbing activity of human osteoclasts. Calcif. Tissue Int. 71:539–546.

30. Lacey, D. L., E. Timms, H. L. Tan, M. J. Kelley, C. R. Dunstan, T. Burgess,R. Elliott, A. Colombero, G. Elliott, S. Scully, H. Hsu, J. Sullivan, N.Hawkins, E. Davy, C. Capparelli, A. Eli, Y. X. Qian, S. Kaufman, I. Sarosi,V. Shalhoub, G. Senaldi, J. Guo, J. Delaney, and W. J. Boyle. 1998. Osteo-protegerin ligand is a cytokine that regulates osteoclast differentiation andactivation. Cell 93:165–176.

31. Lam, J., S. Takeshita, J. E. Barker, O. Kanagawa, F. P. Ross, and S. L.Teitelbaum. 2000. TNF-� induces osteoclastogenesis by direct stimulation ofmacrophages exposed to permissive levels of RANK ligand. J. Clin. Investig.106:1481–1488.

32. Li, C. Y., K. J. Jepsen, R. J. Majeska, J. Zhang, R. Ni, B. D. Gelb, and M. B.Schaffler. 2006. Mice lacking cathepsin K maintain bone remodeling butdevelop bone fragility despite high bone mass. J. Bone Miner. Res. 21:865–875.

33. McHugh, K. P., K. Hodivala-Dilke, M. H. Zheng, N. Namba, J. Lam, D.Novack, X. Feng, F. P. Ross, R. O. Hynes, and S. L. Teitelbaum. 2000. Micelacking beta3 integrins are osteosclerotic because of dysfunctional osteo-clasts. J. Clin. Investig. 105:433–440.

34. Munugalavadla, V., J. Borneo, D. A. Ingram, and R. Kapur. 2005. p85�subunit of class IA PI-3 kinase is crucial for macrophage growth and migra-tion. Blood 106:103–109.

35. Nakagawa, N., M. Kinosaki, K. Yamaguchi, N. Shima, H. Yasuda, K. Yano,T. Morinaga, and K. Higashio. 1998. RANK is the essential signaling recep-tor for osteoclast differentiation factor in osteoclastogenesis. Biochem. Bio-phys. Res. Commun. 253:395–400.

36. Nakamura, I., N. Takahashi, T. Sasaki, S. Tanaka, N. Udagawa, H.Murakami, K. Kimura, Y. Kabuyama, T. Kurokawa, T. Suda, et al. 1995.Wortmannin, a specific inhibitor of phosphatidylinositol-3 kinase, blocksosteoclastic bone resorption. FEBS Lett. 361:79–84.

37. Novack, D. V., L. Yin, A. Hagen-Stapleton, R. D. Schreiber, D. V. Goeddel,F. P. Ross, and S. L. Teitelbaum. 2003. The I�B function of NF-�B2 p100controls stimulated osteoclastogenesis. J. Exp. Med. 198:771–781.

38. Palacio, S., and R. Felix. 2001. The role of phosphoinositide 3-kinase inspreading osteoclasts induced by colony-stimulating factor-1. Eur. J. Endo-crinol. 144:431–440.

39. Pilkington, M. F., S. M. Sims, and S. J. Dixon. 1998. Wortmannin inhibitsspreading and chemotaxis of rat osteoclasts in vitro. J. Bone Miner. Res.13:688–694.

40. Razzouk, S., M. Lieberherr, and G. Cournot. 1999. Rac-GTPase, osteoclastcytoskeleton and bone resorption. Eur. J. Cell Biol. 78:249–255.

41. Reedijk, M., X. Liu, P. van der Geer, K. Letwin, M. D. Waterfield, T. Hunter,and T. Pawson. 1992. Tyr721 regulates specific binding of the CSF-1 receptor

kinase insert to PI 3�-kinase SH2 domains: a model for SH2-mediated re-ceptor-target interactions. EMBO J. 11:1365–1372.

42. Shin, B. C., M. Suzuki, K. Inukai, M. Anai, T. Asano, and K. Takata. 1998.Multiple isoforms of the regulatory subunit for phosphatidylinositol 3-kinase(PI3-kinase) are expressed in neurons in the rat brain. Biochem. Biophys.Res. Commun. 246:313–319.

43. Stambolic, V., T. W. Mak, and J. R. Woodgett. 1999. Modulation of cellularapoptotic potential: contributions to oncogenesis. Oncogene 18:6094–6103.

44. Suda, T., E. Jimi, I. Nakamura, and N. Takahashi. 1997. Role of 1 �,25-dihydroxyvitamin D3 in osteoclast differentiation and function. MethodsEnzymol. 282:223–235.

45. Sun, Y., K. G. Buki, O. Ettala, J. P. Vaaraniemi, and H. K. Vaananen. 2005.Possible role of direct Rac1-Rab7 interaction in ruffled border formation ofosteoclasts. J. Biol. Chem. 280:32356–32361.

46. Suzuki, H., Y. Terauchi, M. Fujiwara, S. Aizawa, Y. Yazaki, T. Kadowaki,and S. Koyasu. 1999. Xid-like immunodeficiency in mice with disruption ofthe p85� subunit of phosphoinositide 3-kinase. Science 283:390–392.

47. Takeshita, S., N. Namba, J. J. Zhao, Y. Jiang, H. K. Genant, M. J. Silva,M. D. Brodt, C. D. Helgason, J. Kalesnikoff, M. J. Rauh, R. K. Humphries,G. Krystal, S. L. Teitelbaum, and F. P. Ross. 2002. SHIP-deficient mice areseverely osteoporotic due to increased numbers of hyper-resorptive osteo-clasts. Nat. Med. 8:943–949.

48. Tan, B. L., M. N. Yazicioglu, D. Ingram, J. McCarthy, J. Borneo, D. A.Williams, and R. Kapur. 2003. Genetic evidence for convergence ofc-Kit- and �4 integrin-mediated signals on class IA PI-3kinase and theRac pathway in regulating integrin-directed migration in mast cells.Blood 101:4725–4732.

49. Tanaka, S., I. Nakamura, J. Inoue, H. Oda, and K. Nakamura. 2003. Signaltransduction pathways regulating osteoclast differentiation and function.J. Bone Miner. Metab. 21:123–133.

50. Terauchi, Y., Y. Tsuji, S. Satoh, H. Minoura, K. Murakami, A. Okuno, K.Inukai, T. Asano, Y. Kaburagi, K. Ueki, H. Nakajima, T. Hanafusa, Y.Matsuzawa, H. Sekihara, Y. Yin, J. C. Barrett, H. Oda, T. Ishikawa, Y.Akanuma, I. Komuro, M. Suzuki, K. Yamamura, T. Kodama, H. Suzuki, T.Kadowaki, et al. 1999. Increased insulin sensitivity and hypoglycaemia inmice lacking the p85 alpha subunit of phosphoinositide 3-kinase. Nat. Genet.21:230–235.

51. Thesingh, C. W., and J. P. Scherft. 1985. Fusion disability of embryonicosteoclast precursor cells and macrophages in the microphthalmic osteo-petrotic mouse. Bone 6:43–52.

52. Tondravi, M. M., S. R. McKercher, K. Anderson, J. M. Erdmann, M. Quiroz,R. Maki, and S. L. Teitelbaum. 1997. Osteopetrosis in mice lacking haema-topoietic transcription factor PU.1. Nature 386:81–84.

53. Vanhaesebroeck, B., S. J. Leevers, K. Ahmadi, J. Timms, R. Katso, P. C.Driscoll, R. Woscholski, P. J. Parker, and M. D. Waterfield. 2001. Synthesisand function of 3-phosphorylated inositol lipids. Annu. Rev. Biochem. 70:535–602.

54. Vanhaesebroeck, B., S. J. Leevers, G. Panayotou, and M. D. Waterfield.1997. Phosphoinositide 3-kinases: a conserved family of signal transducers.Trends Biochem. Sci. 22:267–272.

55. Wada, T., T. Nakashima, A. J. Oliveira-dos-Santos, J. Gasser, H. Hara, G.Schett, and J. M. Penninger. 2005. The molecular scaffold Gab2 is a crucialcomponent of RANK signaling and osteoclastogenesis. Nat. Med. 11:394–399.

56. Weilbaecher, K. N., G. Motyckova, W. E. Huber, C. M. Takemoto, T. J.Hemesath, Y. Xu, C. L. Hershey, N. R. Dowland, A. G. Wells, and D. E.Fisher. 2001. Linkage of M-CSF signaling to Mitf, TFE3, and the osteoclastdefect in Mitf(mi/mi) mice. Mol. Cell 8:749–758.

57. Williams, D. A., W. Tao, F. Yang, C. Kim, Y. Gu, P. Mansfield, J. E. Levine,B. Petryniak, C. W. Derrow, C. Harris, B. Jia, Y. Zheng, D. R. Ambruso, J. B.Lowe, S. J. Atkinson, M. C. Dinauer, and L. Boxer. 2000. Dominant negativemutation of the hematopoietic-specific Rho GTPase, Rac2, is associated witha human phagocyte immunodeficiency. Blood 96:1646–1654.

58. Wu, Z., and R. A. Irizarry. 2004. Preprocessing of oligonucleotide array data.Nat. Biotechnol. 22:656–658, author reply 658.

59. Wymann, M. P., M. Zvelebil, and M. Laffargue. 2003. Phosphoinositide3-kinase signalling—which way to target? Trends Pharmacol. Sci. 24:366–376.

60. Yang, F. C., S. J. Atkinson, Y. Gu, J. B. Borneo, A. W. Roberts, Y. Zheng, J.Pennington, and D. A. Williams. 2001. Rac and Cdc42 GTPases controlhematopoietic stem cell shape, adhesion, migration, and mobilization. Proc.Natl. Acad. Sci. USA 98:5614–5618.

61. Yang, F. C., S. Chen, A. G. Robling, X. Yu, T. D. Nebesio, J. Yan, T. Morgan,X. Li, J. Yuan, J. Hock, D. A. Ingram, and D. W. Clapp. 2006. Hyperacti-vation of p21ras and PI3K cooperate to alter murine and human neurofi-bromatosis type 1-haploinsufficient osteoclast functions. J. Clin. Investig.116:2880–2891.

62. Yang, F. C., R. Kapur, A. J. King, W. Tao, C. Kim, J. Borneo, R. Breese, M.Marshall, M. C. Dinauer, and D. A. Williams. 2000. Rac2 stimulates Akt



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

activation affecting BAD/Bcl-XL expression while mediating survival andactin function in primary mast cells. Immunity 12:557–568.

63. Yasuda, H., N. Shima, N. Nakagawa, K. Yamaguchi, M. Kinosaki, S. Mo-chizuki, A. Tomoyasu, K. Yano, M. Goto, A. Murakami, E. Tsuda, T. Mori-naga, K. Higashio, N. Udagawa, N. Takahashi, and T. Suda. 1998. Osteoclastdifferentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-in-

hibitory factor and is identical to TRANCE/RANKL. Proc. Natl. Acad. Sci.USA 95:3597–3602.

64. Yoshida, H., S. Hayashi, T. Kunisada, M. Ogawa, S. Nishikawa, H. Oka-mura, T. Sudo, L. D. Shultz, and S. Nishikawa. 1990. The murine mutationosteopetrosis is in the coding region of the macrophage colony stimulatingfactor gene. Nature 345:442–444.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

the p85 subunit of class ia phosphatidylinositol 3kinase regulates the expression of multiple genes...

Documents