systemic aminoglycoside treatment in rodent models of retinitis pigmentosa
TRANSCRIPT
lable at ScienceDirect
Experimental Eye Research 87 (2008) 197–207
Contents lists avai
Experimental Eye Research
journal homepage: www.elsevier .com/locate/yexer
Systemic aminoglycoside treatment in rodent models of retinitis pigmentosa
K. Guerin a,b, C.Y. Gregory-Evans c, M.D. Hodges c, M. Moosajee c, D.S. Mackay c,K. Gregory-Evans c,d,*,1, John G. Flannery a,b,1
a Vision Science, University of California, Berkeley, CA 94720, USAb Helen Wills Neuroscience Institute, University of California, Berkeley, CA 94720, USAc Department of Clinical Neuroscience, Faculty of Medicine, Imperial College London, London SW7 2AZ, UKd Western Eye Hospital, London NW1 5QH, UK
a r t i c l e i n f o
Article history:Received 7 March 2008Accepted in revised form 25 May 2008Available online 3 June 2008
Keywords:gentamicinpremature stop codonretinitis pigmentosaretinal degenerationRd12S334ter
* Corresponding author. Department of Clinical NeLondon, Room 9L-07, Laboratory Block, Charing CrosLondon W6 8RP, UK. Tel.: þ44 20 8383 3633; fax: þ4
E-mail address: [email protected] (K1 The authors contributed equally to this work.
0014-4835/$ – see front matter � 2008 Elsevier Ltd.doi:10.1016/j.exer.2008.05.016
a b s t r a c t
We studied the potential of systemically administered aminoglycosides as a therapy for retinaldegeneration resulting from premature termination codon (PTC) mutations. Aminoglycosides weresystemically delivered to two rodent models of retinal degeneration: a transgenic rat model of dominantdisease caused by a PTC in rhodopsin (S334ter); and a mouse model of recessive disease (rd12) caused bya PTC in the retinoid isomerase Rpe65. Initial luciferase reporter assays were undertaken to measure theefficiency of gentamicin-induced read-through in vitro. These experiments indicated that gentamicintreatment induced on average a 5.3% extra read-through of the S334ter PTC in vitro, but did not affect therd12 PTC. Beginning at postnatal day 5, animals received daily subcutaneous injections of gentamicin orgeneticin at a range of doses. The effect of the treatment on retinal degeneration was examined byhistopathology and electroretinography (ERG). Systemic treatment with aminoglycoside significantlyincreased the number of surviving photoreceptors in the S334ter rat model over several weeks oftreatment, but was not effective in slowing the retinal degeneration in the rd12 mouse model. Similarly,ERG recordings indicated better preservation of retinal function in the treated S334ter rats, but no dif-ference was observed in the rd12 mice. Daily subcutaneous injection of 12.5 mg/g gentamicin was the onlyregimen that inhibited retinal degeneration without apparent adverse systemic side effects. Reducedeffectiveness beyond postnatal day 50 correlated with reduced ocular penetration of drug as seen ingentamicin-Texas red (GTTR) conjugation experiments. We conclude that, in the rat model, an w5%reduction of abnormal truncated protein is sufficient to enhance photoreceptor survival. Such a change intruncated protein is consistent with beneficial effects seen when aminoglycosides has been used in other,non-ocular animal models. In the rd12 mouse, lack of efficacy was seen despite this particular PTC beingtheoretically more sensitive to aminoglycoside modification. We conclude that aminoglycoside read-through of PTCs in vitro and in vivo cannot be predicted just from genomic context. Because there isconsiderable genetic heterogeneity amongst retinal degenerations, pharmacologic therapies that are notgene-specific have significant appeal. Our findings suggest that if adverse issues such as systemic toxicityand limited ocular penetration can be overcome, small molecule therapeutics, such as aminoglycosides,which target classes of mutation could hold considerable potential as therapies for retinal disease.
� 2008 Elsevier Ltd. All rights reserved.
´ ´
1. IntroductionMolecular genetic studies in patients with inherited retinaldisease have identified a large number of the causative genes.Interestingly, a significant fraction is caused by premature termi-nation codon (PTC) mutation (Daiger et al., 2007). In manyinstances these PTC mutations disrupt photoreceptor- or retina-
uroscience, Imperial Colleges Campus, St Dunstans Road,4 20 8383 3697.. Gregory-Evans).
All rights reserved.
specific genes (Senechal et al., 2006; Hong et al., 2004). However,there are also numerous examples of syndromic retinaldegeneration (Bardet–Biedl syndrome, Usher syndrome, choroi-deremia) caused by PTC mutations in ubiquitously expressed genes(Leroy et al., 2001; Adato et al., 1997). Biochemical studies showthat some PTC mutations generate a truncated protein (Hong et al.,2004; Friedman et al., 2006), whereas other PTC mutations result ina complete loss of the protein with a concomitant reduction inmRNA levels due to nonsense-mediated mRNA decay (Zhang et al.,2002; Frischmeyer and Dietz, 1999).
A large number of systemic diseases including cystic fibrosis,Duchenne muscular dystrophy, and b-thalassemia are also knownto be caused by PTC. It is estimated that 12% of all mutations are
K. Guerin et al. / Experimental Eye Research 87 (2008) 197–207198
single point mutations that result in a premature terminationcodon (Human Gene Mutation Database) (Krawczak et al., 2000;Cooper et al., 2007 in http://www.hgmd.cf.ac.uk/ac/index.php). Aspecific tabulation of PTC mutations for the identified retinaldegeneration genes (RetNet, http://www.sph.uth.tmc.edu/Retnet/)have not been conducted, but it may be assumed that the pro-portion of retinal diseases caused by PTCs are similar to othersystemic disease (12%). A small molecule therapy that targets thesepremature stop codons and converts these truncated proteins intofull-length proteins could therefore treat a substantial portion ofpatients, making the approach practical and economical.
There are two classes of treatment under study for diseasesresulting from PTC mutations: homologous replacement of thepremature stop mutation with a wildtype sequence and delivery ofpharmacological agents or suppressor tRNAs to reduce the effi-ciency of premature translation termination. Clearly, homologousreplacement of the defective gene with a normal copy is the mostelegant strategy to treat monogenic disease. However, to date theefficiency of homologous recombination methods in tissues hasbeen quite low (Urnov et al., 2005; Moehle et al., 2007) with typicaltargeted integration frequencies of w15%. At these efficiencies,targeted gene addition is currently only appropriate for ex vivo genetherapy in isolated cells where selection of cells with successfulhomologous recombination can be performed. Homologousrecombination at these low efficiencies is not currently efficaciousas a therapy for complex tissues such as retina.
Pharmacologic treatments for PTCs are designed to reduce thepremature translation termination and generate ‘‘read-through’’ tothe genuine termination codon, thereby converting a potentiallytoxic, truncated protein into a full-length, functional protein.Aminoglycosides therapy often produces an increased amount offull-length functional protein, although generally a low percentage(Howard et al., 2000, 2004; Barton-Davis et al., 1999; Hein et al.,2004). This effect can result in a significant improvement in thedisease phenotype, particularly in recessive disorders resultingfrom nonsense mutations in genes encoding an enzyme, whereprotein expression and activity is very low. Restoration of a smallpercentage of normal protein function may result in a clinically lesssevere or apparently normal phenotype (Wagner et al., 2001).
Indeed, it has been primarily recessive disorders where cell cultureand clinical experiments with aminoglycosides have given the mostpromising results.
Retinitis pigmentosa (RP) is a debilitating disease affecting sig-nificant numbers of patients worldwide. Currently, there is no cureand the few approved treatments (vitamin A supplements, cataractextraction, and acetazolamide for macular edema) are of verylimited efficacy. Within the last decade a great deal of moleculargenetic study has been undertaken and over 32 genes (http://www.sph.uth.tmc.edu/Retnet/) have now been identified to causeRP, making it the most genetically heterogeneous disease known inhumans. Gene identification has allowed the subsequentdevelopment of a number of very useful transgenic and knockoutanimal models of RP. Unfortunately, the large degree of geneticheterogeneity raises significant problems with regard todeveloping new treatments. With a frequency in the population of1:10,000, each identified gene corresponds to a relatively smallnumber of affected patients relative to the cost of treatmentdevelopment and initiation of clinical trials. Mutation-specifictechniques, such as viral mediated gene augmentation therapy forrecessive disease, and ribozyme or siRNA mediated knockdown fordominant diseases may fractionate the patient population to thepoint that they are financially unviable. Currently, techniques thatare broadly applicable and to some extent mutation-independent,may be much more feasible in treating large numbers of patients.
Significant advances are being made in the study of many otherinherited diseases and this can be extrapolated to retinitis
pigmentosa research’. For instance, recently, aminoglycosides suchas gentamicin have shown therapeutic benefit in nonsense muta-tion animal models of cystic fibrosis and Duchenne musculardystrophy by causing read-through of premature stop codons (Duet al., 2002; Barton-Davis et al., 1999). This is most likely due toaminoglycoside interaction with ribosomes, reducing the strin-gency of codon–anticodon pairing (Mankin and Liebman, 1999).Successful in vitro proof of principle has been demonstrated in celllines of Hurler’s syndrome (Keeling et al., 2001), late-infantileneuronal ceroid lipofuscinosis (Sleat et al., 2001) and coagulationfactor VII deficiency (Pinotti et al., 2006). Therapeutic efficacy hasalso been achieved in animal models of cystic fibrosis (Du et al.,2002), Duchenne muscular dystrophy (Barton-Davis et al., 1999)and nephrogenic diabetes insipidus (Sangkuhl et al., 2004). Othergroups have failed to reproduce this success (Dunant et al., 2003),but nonetheless, the positive results have lead to human trials incystic fibrosis (Linde et al., 2007; Wilschanski et al., 2003) andDuchenne muscular dystrophy (Wagner et al., 2001; Politano et al.,2003), which have shown therapeutic benefit in patients.
Systemic aminoglycoside therapy has been previously attemp-ted in models of RP. Gentamicin treatment was tried in a human cellline (Grayson et al., 2002) and an animal model of RP (Pittler et al.,2001) with limited effectiveness. Despite limitations in thesestudies, the fact that the approach could be applicable to largenumbers of RP patients with different stop mutations in differentgenes, prompted us to take up a more systematic assessment usingdisease models closer to human disease.
2. Methods
2.1. Rodent models of retinal degeneration
Two models of monogenic retinal disease caused by PTCmutations were tested, a rat model of dominant disease anda mouse recessive model. These animal models were selectedbecause they exhibit a relatively slow rate of degeneration, whichallows sufficient time for the effect of a systemic treatment to beassessed. Unlike many other rodent models, these slowlyprogressing degeneration models are more representative of theslow, progressive degeneration seen in human disease.
The S334ter transgenic rat is a model of autosomal dominant’gain of function’ retinitis pigmentosa (Steinberg et al., 1996). Apremature stop codon was created in a mouse opsin transgene atamino acid position 334 by site-directed mutagenesis of two bases(TCT / TAA) in the last exon of the rhodopsin gene (Chen et al.,1995) and inserted by pronuclear injection onto a Sprague–Dawleyrat background. The insertion of the PTC leads to the translation ofa truncated protein lacking the last 15 amino acids. This truncatedopsin lacks the phosphorylation and arrestin binding sites critical forthe deactivation of the light activated opsin. This model is not trulyrepresentative of an actual dominant disease genotype, as twowildtype rat rhodopsin alleles function in addition to the transgene.In this transgenic line, the truncated mouse opsin protein isexpressed at w10% that of native rat rhodopsin (Green et al., 2000).Most studies suggest that the retinal degeneration phenotyperesults from mis-sorting of the truncated rhodopsin protein andaccumulation of misfolded protein within the RER and Golgi, whichinitiates a stress response in the cell triggering apoptosis byinterference with the post-Golgi transport pathways (Green et al.,2000; Lee et al., 2006). Several lines of S334ter rats have been madewith different rates of retinal degeneration, proportional tothe transgene copy number and the resultant level of expression ofthe mutant mouse opsin relative to the wildtype full-length ratopsin. The S334ter-line four rats have a relatively low mutant opsinexpression and a correspondingly slow, progressive retinaldegeneration. The inter-animal variation in degeneration rate is
K. Guerin et al. / Experimental Eye Research 87 (2008) 197–207 199
quite small (Green et al., 2000). Breeding pairs were obtained fromProfessor Matt LaVail (University of California at San Francisco, CA,USA). Experimental heterozygous animals were produced bybreeding transgenic homozygotes with wildtype, outbred, Sprague–Dawley rats purchased from Simonsen Laboratories Inc. (Gilroy, CA,USA), and Harlan International Ltd. (Bicester, Oxfordshire, UK).
A second rodent model of RP, the rd12 mouse, a naturallyoccurring, autosomal recessive model with retinal degenerationresulting from a premature stop (R44ter (CGA-TGA)) in the retinoidisomerase Rpe65 (Pang et al., 2005) was also tested. Retinaldegeneration in this model occurs by ’loss of function’ with loss ofthe isomerase function of Rpe65 in the retinal pigment epithelium.Photoreceptor cell death is hypothesized to be triggered by lack ofavailability of 11-cis retinal. Rd12 breeding pairs were obtainedfrom the Jackson Laboratory (Bar Harbor, ME, USA), strain name B6(A)-Rpe65rd12/J, Stock number 005379. Homozygous animals wereused experimentally and wildtype mouse controls were obtainedfrom local vendors.
The P23H (line 3) transgenic rat is another model of autosomaldominant ’gain of function’ retinitis pigmentosa (Steinberg et al.,1996). The retinal degeneration is caused by a missense mutation inthe rhodopsin gene leading to an amino acid substitution (Pro/His)at position 23 of the peptide chain. Photoreceptor degeneration isbelieved to occur by apoptosis, triggered by the accumulation of themisfolded mutated rhodopsin in the RER. We used these animals asinternal controls, as gentamicin treatment should not affectmissense mutations. Breeding pairs were again obtained fromProfessor Matt LaVail (University of California at San Francisco, CA,USA).
All animals were given food and water ad libidum and main-tained on a 12-h light/dark schedule.
2.2. Rho S334ter-luciferase and Rpe65-luciferase reporter assays
A series of in vitro reporter assays were undertaken to determinewhether aminoglycosides could read-through the Rho S334ter andthe Rpe65 mutations (Howard et al., 2004). To generate the reporterconstruct, cDNA was synthesized from 1 mg mouse retinal RNAusing the 1st strand cDNA synthesis kit for RT-PCR (RocheDiagnostics Ltd, Burgess Hill, UK). RT-PCR was carried out using 1 mlcDNA using PfuUltra II Fusion HS polymerase (Stratagene Europe,Amsterdam, Netherlands) under the following conditions: 95 �C2 min, followed by 40 cycles of: 95 �C 20 s, 56 �C 20 s, 72 �C 20 s anda final cycle of 3 min at 72 �C. To generate the mouse construct, tword12 mouse eyes were homogenized in Trizol (Invitrogen Ltd.,
0123456789
10
Read
th
ro
ug
h (%
)
A
12.5 100 250 500Gentamicin (µg/ml)
25 50
Fig. 1. Luciferase reporter assays comparing mutant (MT) gene translational read-throughread-through (6.1%, n ¼ 6) using 50 mg/ml gentamicin with mutant RHO construct transfcomparable dose response curve using gentamicin with mutant Rpe65 construct showed sabsence or presence of 50 mg/ml gentamicin (þGent). A 5.3% (n ¼ 3) increase in read-througwas no positive effect with Rpe65 construct.
Paisley, UK) and total RNA extracted following manufacturer’sinstructions. Then, 1 mg total RNA mouse eye RNA was used forcDNA synthesis and RT-PCR as described above.
The short wildtype Rho sequence (142 bp) containing the S334codon was amplified with primers containing NcoI linkers (Rhoforward primer, 5’-ccatggCATGGACAAGCAGTTCCGGAAC; Rho re-verse primer, 5’-ccatggGGGCCGGGGCCACCTGGCTCGTCTCCGTCTT).The reverse primer had an additional guanine (bold) introduced tokeep final pGL3 construct in-frame with luciferase. Primers forRT-PCR of a short rd12 Rpe65 (270 bp) sequence were of similardesign to the Rho construct (Rpe65 forward primer, 5’-ccatggCATGTCTATCCAAATTGAACACCCTGCT; Rpe65 reverse primer,5’-ccatggGGAATCTTCTGTGGTATGTGACATGGCCCTCCTT).
PCR products were gel purified (Qiagen Ltd., Crawley, UK) andcloned into pCR Blunt-II TOPO vector (Invitrogen Ltd., Paisley, UK).Clones were sequenced to insure validity. Insert sequences for Rhoand rd12 Rpe65 were excised with NcoI and cloned into the NcoI siteof pGL3 control (Promega Ltd., Southampton, UK). Correctly orien-tated clones were selected that would generate a fusion product withthe luciferase gene. Site-directed mutagenesis was then used tointroduce a mutant S334ter sequence (underlined) in the wildtypeRho construct (mutagenesis primer GACGATGAGGCCTAAGCTACCGTGTCCA) and the wildtype sequence into the rd12 Rpe65 construct(mutagenesis primer CAGTCTCCTCCGATGTGGGCC). All constructswere sequenced to confirm mutagenesis.
Plasmid DNA for transfection was purified with maxiprep col-umns (Qiagen Ltd., Crawley, UK) and quantitated by Nanodrop�
spectroscopy. COS-7 cells were maintained in DMEM, containing10% fetal calf serum and 10,000 U penicillin/streptomycin. Lipo-some-mediated co-transfections of COS-7 cells were performed insix-well plates for each construct (1 mg/well), in three independenttransfections according to manufacturer’s instructions (PromegaLtd., Southampton, UK). Renilla luciferase (pRL-CMV) wasco-transfected (0.5 mg/well) as a control for efficiency of trans-fection. Cells were dosed with gentamicin (12.5–500 mg/ml) 24 hafter the start of transfection, for a further 48 h. Dual luciferaseactivity was measured in cell lysates using a luminometer (NicholsInstitute Diagnostics Ltd., Heston, UK) to determine the effect ofgentamicin on read-through of the stop mutations. All results areexpressed as the mean � SEM.
2.3. Gentamicin-Texas red (GTTR) conjugation
In order to assess aminoglycoside penetration into the retina,gentamicin-Texas red conjugate was injected subcutaneously into
B
MTRHO+Gent
MTRHO
MTRpe65+Gent
MTRpe65
relative to wildtype constructs (100%). (A) Initial dose response showing the greatestected into COS-7 cells and luciferase activity determined after 48 h incubation. Theimilar low read-through at all doses tested. (B) Mutant constructs were tested in theh was observed for the mutant RHO construct in the presence of gentamicin, but there
K. Guerin et al. / Experimental Eye Research 87 (2008) 197–207200
test animals (Lyeford-Pike et al., 2007). Briefly, a stock solution ofTexas Red�-X, succinimidyl esters (Invitrogen Ltd., Paisley, UK)was prepared in DMSO at a concentration of 2 mg/ml. For con-jugation, 2.2 ml of gentamicin sulfate (50 mg/ml in 100 mMK2CO3) was added to 0.3 ml of Texas Red (TR) stock solution,vortexed and agitated overnight at 4 �C in the dark. The highmolar ratio of gentamicin to TR esters (300:1) typically producesa conjugation ratio of one Texas red molecule to a single genta-micin molecule. S334ter rats were injected subcutaneously withthe GTTR conjugate from postnatal day 8 (P8) to P60. In the rd12mice, GTTR (at doses of 50 and 12.5 mg/ml gentamicin) wasinjected from P8 to P21.
2.4. Treatment regimens
2.4.1. GentamicinIn preliminary experiments, heterozygous S334ter-4 rats were
given a daily subcutaneous injection of gentamicin sulfate (50 mgper gram of body weight, Sigma-Aldrich Co Ltd., Gillingham, UK)
Fig. 2. Gentamicin-Texas red (GTTR) conjugate penetration into rodent retina. S334ter rats wP60 (C) showing penetration of drug only at P21 (arrows). Texas red only (TR) controls at P21at other time points. Rd12 mice were treated at P21 with either 50 mg/ml (G) or 12.5 mg/mlat P21. Inserts in A, D, G & H are magnified views of the ONL and RPE layers showing GTTR
from P5 to P30. In a second study, gentamicin was administered viaAlzet osmotic pumps (Model 1007D, Alzet Corp., Palo Alto, CA,USA). The osmotic pumps were implanted under the skin of anes-thetized rats following the manufacturer’s instructions. Due to thesize of the osmotic pump, the pump could not be safely implanteduntil P15. The implanted animals received daily injection of 50 mg/ggentamicin until P15, when pump insertion was possible. Pumpswere loaded according to the manufacturer’s instructions with theappropriate drug concentration for the rats to receive 50 mg/ggentamicin for 5 days, at which time the depleted osmotic pumpwas removed from the animal and replaced by a new full one. Inseparate experiments, S334ter-4 heterozygous rats were given dailysubcutaneous injections of 12.5, 25, 37.5 or 50 mg gentamicin pergram of body weight from P5. Treatment was continued up to P70.Rd12 homozygous mice were treated with 12.5, 25 or 37.5 mg gen-tamicin per gram of body weight from P5. P23H-3 heterozygousrats were given a daily subcutaneous injection of 50 mg/g of gen-tamicin from P5 to P30. All control animals were injected withidentical volumes of 0.9% NaCl.
ere treated with 50 mg/ml subcutaneous GTTR and sections taken at P21 (A); P50 (B);(D), P50 (E) and P60 (F). These show good penetration of GTTR in the rat at P21 but not
(H) GTTR or just TR (I). These also show GTTR penetration (arrows) in the mouse retinalocalization.
Table 1Comparison of mean scotopic ERG a- and b-wave amplitudes of S344ter-4 rats treated with daily subcutaneous 0.9% NaCl (S), daily gentamicin injections (50 mg/g body weightper day – SCI) and continuous osmotic pump delivery of the same dose of gentamicin (OP)
Stimulus cd.s/m2 Age Treatment a-wave amplitude p value b-wave amplitude p value n
0.01 P30 S Not detected 152.18 � 31.27 9P30 SCI Not detected n/a 221.62 � 29.45 <0.001 9P30 OP Not detected n/a 122.93 � 48.98 0.092 5P60 S Not detected 117.50 � 17.76 5P60 SCI Not detected n/a 69.86 � 24.02 <0.001 9
0.316 P30 S 17.49 � 11.69 265.23 � 66.83 9P30 SCI 30.92 � 17.67 0.041 436.81 � 68.57 <0.001 9P30 OP 17.32 � 17.77 0.492 310.49 � 128.46 0.190 5P60 S 32.11 � 12.31 225.38 � 33.21 5P60 SCI 15.76 � 9.18 0.007 142.76 � 53.95 0.002 9
3.16 P30 S 57.63 � 21.86 385.98 � 79.30 9P30 SCI 92.71 � 30.37 0.007 577.95 � 78.57 <0.001 9P30 OP 56.50 � 22.14 0.464 438.22 � 196.56 0.256 5P60 S 54.25 � 13.24 323.82 � 63.09 5P60 SCI 35.68 � 16.92 0.028 228.17 � 92.31 0.019 9
Recordings are taken at P30 and P60. Significant improvement is seen with daily gentamicin injections only. n ¼ number of eyes studied.
AS334ter-4 P30 control
-100.00
0.00
100.00
200.00
300.00
400.00
500.00
600.00
0 50 100 150 200 250Time (ms)
Am
plitu
de
(m
ic
ro
Vo
lts
)
BS334ter-4 Gent P5P30
-100.00
0.00
100.00
200.00
300.00
400.00
500.00
600.00
0 50 100 150 200 250Time (ms)
CS334ter-4 Mini-pump P30
-100.00
0.00
100.00
200.00
300.00
400.00
500.00
600.00
0 50 100 150 200 250Time (ms)
log -2.0 cd.s/m2
log -0.5 cd.s/m2
log 0.5 cd.s/m2
Fig. 3. Scotopic ERG recordings at P30 of S334ter-4 animals at three different lightintensities: 0.01 cd.s/m2 (dashed line), 0.316 cd.s/m2 (dotted line) and 3.16 cd.s/m2
(solid line). The amplitude of the response is expressed in mV. (A) Daily injection with0.9% NaCl (n ¼ 9); (B) daily injection with 50 mg/g gentamicin (n ¼ 9); (C) continuousosmotic pumps delivery (n ¼ 5). The amplitudes of both a- and b-waves in the twotreated groups are significantly larger than in the control group. n ¼ number of eyesstudied.
K. Guerin et al. / Experimental Eye Research 87 (2008) 197–207 201
2.4.2. G418 (geneticin)Basing dosages on studies of G418 in mice (Sangkuhl et al.,
2004), heterozygous S334ter-4 rats were treated with G418 (Invi-trogen Ltd., Paisley, UK) at a dose of 14 or 28 mg per gram of bodyweight; these doses were based on regimens in studies of cysticfibrosis mice models. Mice were treated with G418 at doses of 6 or14 mg per gram of body weight.
2.5. Histological assessment
Thin (1 mm) plastic sections of the eye cut along the verticalmeridian, through the optic nerve were used to assess thicknessand undertake cell counts of the outer nuclear layer (ONL) (LaVailet al., 1987). To account for regional variation in retinaldegeneration in this model (Green et al., 2000) separate assess-ments were taken of the superior and inferior retina. Retinalthickness measurements were made with a digitizing tablet(Wacom Technology Corp., Vancouver, WA, USA), a light micro-scope with camera lucida drawing tube and no-cost axiovisionmorphometry software (Carl Zeiss, Jena, Germany).
Outer nuclear layer cell counts were undertaken rather thanouter nuclear layer thickness measurements in order to improvethe sensitivity of data. In vertical sections cut through the opticnerve, counts were made over a 140 mm length of ONL in four areas:the peripheral and central retina in the upper hemisphere; theperipheral and central retina in the lower hemisphere. Twoindependent observers masked to the treatment status of animalsundertook cell counting.
2.6. Electrodiagnostic assessment
Animals were dark-adapted overnight, anesthetized withXylazine (13 mg/ml) and Ketamine (87 mg/ml) and maintainedon a heating pad. The corneas were locally anesthetized with0.5% proparacaine hydrochloride and the pupils were dilatedwith 2.5% phenylephrine and 1% atropine. Electroretinogramswere initially recorded in preliminary studies in the S334ter-4rats using an Espion Colorburst mini-Ganzfeld stimulator (Diag-nosys LLC, Lowell, MA, USA) and corneal contact lens electrodes.Other electroretinographic experiments were undertaken usingRetiport equipment (Roland Consult, Eisingen, Germany). Briefwhite light flashes were presented at intensities 0.01, 0.316 or3.16 candela-second (cd-s)/m2. Averages of eight responses wererecorded.
K. Guerin et al. / Experimental Eye Research 87 (2008) 197–207202
2.7. Statistical analysis
All statistical analysis was undertaken using Microsoft Excel(Microsoft), and JMP software (SAS Institute Inc., Cary, NC, USA).
2.8. Ethical approvals
All the animals were treated in accordance with the ARVOStatement for the Use of Animals in Ophthalmic and VisionResearch and with the approval of the UC Berkeley Animal Care andUse Committee. In addition, work in the UK was undertaken inaccordance with Home Office Project License PPL 70/6308.
3. Results
3.1. In vitro luciferase reporter assays
The efficacy of gentamicin-induced translational read-through(the ability of the drug to promote gene translation past a termi-nation sequence or nonsense mutation) was tested on the mutantRho S334ter construct in COS-7 cells. In an initial dose responseexperiment the highest level of read-through (6.1%, n ¼ 6) was witha 50 mg/ml gentamicin dose (Fig. 1A). At higher doses, gentamicinwas toxic to the cells. Using a 50 mg/ml dose we repeated theluciferase assays in three independent experiments and observedan average 5.3% increase in read-through for the mutant RhoS334ter construct, whereas no positive effect was seen with themutant Rpe65 (rd12) S44ter construct (Fig. 1B).
3.2. Gentamicin-Texas red (GTTR) conjugate penetrationinto the retina
Good GTTR conjugate penetration was seen in both animalmodels studied. However, although apparent in experiments at P21much less penetration was seen at P50 in the Rho S334ter rat andnone was seen at P60 in this model (Fig. 2).
Fig. 4. Representative 1 mm-thin histology sections of WT and S334ter-4 rat retina at P30. (Afaster in the superior (F) than in the inferior (B) retina. The photoreceptor’s nuclei layer is thicS334ter-4 implanted with the osmotic pumps (D, H). Note the better organization of the outeAge-matched WT inferior (A) and superior (E) retinas are shown for comparison.
3.3. In vivo proof of principle experiments
Initial experiments were undertaken in the S334ter-4 hetero-zygous rat using two regimens: either daily subcutaneous injectionof 50 mg/g body weight gentamicin or the same dose delivered overa 24 h period using an osmotic pump (see Section 2). These animalswere compared with control animals treated with subcutaneoussaline injections. Average ERG responses (Table 1 and Fig. 3) at P30show that both a- and b-wave amplitudes were significantly largerin the gentamicin treated animals, particularly in the daily injectedgroup, compared to the controls at all light intensities tested,suggesting a preservation of retinal function. That daily injectionsseem more effective than continuous osmotic pump delivery ofdrug have been reported by others (Barton-Davis et al., 1999). Thisslowing of the loss of the ERG amplitude was also reflected in betterpreservation of outer nuclear layer thickness (Figs. 4 and 5). Nosignificant preservation in electroretinographic responses was seenat P60 in the daily injected group (Table 1).
As expected, functional and histological results from the P23H-3transgenic rats at P30 confirm the lack of effect of gentamicinagainst missense mutation-induced photoreceptor degeneration(Fig. 6).
3.4. Dose response assessments
These positive results with daily injection led us to undertakedose response assessments in order to identify an aminoglycosidedosage that gave longer preservation of photoreceptors with lesssystemic side effects. We initially undertook a histological assess-ment because our preliminary data suggested that this was themost sensitive method. Experiments were repeated using lowerdose, daily gentamicin injections of 12.5, 25, or 37.5 mg/g from P5.We found that only animals treated at the lowest dose of 12.5 mg/ggentamicin survived to P70. Such animals showed no systemic sideeffects. Interestingly, these animals also showed the best preser-vation of outer nuclear layer in terms of cell count (Fig. 7) and
–D) Inferior retina; (E–H) superior retina. In the S334ter-4 rats the degeneration rate isker in both inferior and superior retinas of S334ter-4 treated with gentamicin (C, G) and
r segments in the treated retinas compared to controls, particularly in the superior area.
0
10
20
30
40
50
60
Average ONL
Thickness (µm)
S334ter(OP)
S334ter(SCI)
S334ter(S)
WT
Fig. 5. Mean outer nuclear thickness measurements of superior (white) and inferior(black) retina in the S334ter-4 rat at. The ONL thickness is markedly decreased incontrol S334ter-4 (S, n ¼ 5) compared to WT (n ¼ 6). Both daily gentamicin injection(SCI, n ¼ 11) and continuous delivery through osmotic pump (OP, n ¼ 5) significantlypreserve the thickness of the ONL. No significant difference is observed between thetwo groups receiving the gentamicin regimen.
K. Guerin et al. / Experimental Eye Research 87 (2008) 197–207 203
preservation of photoreceptor structure. Animals treated at higherdoses of gentamicin showed less impressive preservation ofphotoreceptor cell and more side effects. We also undertookexperiments using an alternative aminoglycoside, G418 (geneticin),which has been described to be a more potent drug in overwritingstop mutations and with fewer adverse effects. Good preservationof photoreceptor cell count was seen at P19, comparable with that
A B
C D
A Histology B
Am
plitu
de (m
icro
Vo
lts)
Am
plitu
de
(m
icro
Vo
lts)
Fig. 6. Morphological and functional data at P30 in theP23H-3 rat model of RP. (A) Represensignificant difference between the group treated with 0.9% NaCl (A, C; n ¼ 5) and the group tr(dashed line), 0.316 cd.s/m2 (dotted line) and 3.16 cd.s/m2 (solid line). The amplitude of theb-waves between animals who received daily injection of 0.9% NaCl (upper panel; n ¼ 5) o
seen with 37.5 mg/g gentamicin (Fig. 8). However, G418 showedsignificantly more systemic toxicity, with no animal survivingbeyond P20 when treated with this agent.
We concluded from these cell count experiments and the mor-tality associated with different aminoglycoside doses, that dailysubcutaneous injection with 12.5 mg/g gentamicin was the optimalregimen.
3.5. Electroretinography of the S334ter-4 rat and rd12 mouse
Using the optimal regimen of daily subcutaneous injection of12.5 mg/g gentamicin we undertook functional electroretinographicstudies. Table 2 documents significant retention of ERG a- andb-waves in treated animals for test dates P30 and P50. However, atP70 this effect was no longer statistically significant.
In addition, we undertook electroretinographic studies ina second stop mutant model, homozygous rd12 mice. Table 3 doc-uments that no benefit could be detected using either gentamicinor G418 in this model.
4. Discussion
Using systemically administered aminoglycosides, we havefound a significant slowing of retinal degeneration in an animalmodel of retinitis pigmentosa caused by a premature stop mutationin rhodopsin. This finding is surprising given results in otherstudies (Grayson et al., 2002; Pittler et al., 2001) and may reflect ourchoice of model. The S334ter-4 rat exhibits a relatively slow pro-gression of retinal degeneration in comparison to many otherrodent models of disease, particularly the rd mouse that loses themajority of its photoreceptors in the first postnatal month (Jimenezet al., 1996; Farber et al., 1994). We chose line 4 of the S334ter ratspecifically because it has a relatively slow rate of photoreceptordegeneration, allowing more time to see a therapeutic effect. Also,in contrast to the rd mouse, significant retinal tissue remainedintact at the start of the experiment. Another factor in comparing
ERG
0.9% NaCl
-100.00
0.00
100.00
200.00
300.00
400.00
0 50 100 150 200 250
Time (msec)
50ug/g gentamicin
-100.00
0.00
100.00
200.00
300.00
400.00
Time (msec)
tative 1 mm-thin retina sections of inferior (A, B) and superior (C, D) retinas. There is noeated with 50 mg/g gentamicin (B, D; n ¼ 5). (B) Scotopic ERG recordings at 0.01 cd.s/m2
response is expressed in mV. There is no difference in the amplitudes of both a- andr of 50 mg/g gentamicin (lower panel; n ¼ 5).
40
50
60
70
80
90
100
64
74
58
30P19 P30 P50 P70
66
48
78
5449
38
50
Ph
oto
recep
to
r n
uclei cell co
un
ts
co
mp
arin
g w
ild
-typ
e (%
)
Postnatal age of animal (days)
85
64
8886
Saline treated control
12.5µg/g daily gentamicin
25µg/g daily gentamicin
37.5µg/g daily gentamicin
14µg/g daily G418
Fig. 7. Photoreceptor nuclei cell counts comparing wildtype (100%) with controlstreated with 0.9% NaCl and animals treated with gentamicin or G418. Results groupedat time points P19–P70. Each column represents average cell counts from four eyes.Numbers above columns correspond to actual percentage of cell nuclei compared withwildtype. Even though treatment with G418 provides significant cell survival at P19,the drug could not be tested further due to acute systemic toxicity. Gentamicin at thelowest dose tested (12.5 mg/g) appears to be the optimal dose in this study.
K. Guerin et al. / Experimental Eye Research 87 (2008) 197–207204
our results in the S334ter-4 rat with those of the rd mouse is thatrats are physically larger and less inbred than most mice strains. It ispossible that rats and mice may metabolize and clear the amino-glycosides at different rates.
Fig. 8. Representative 1 mm thin histological sections from rat retina taken at P19. SectionsS334ter-4 injected daily with 0.9% NaCl; (C, G) S334ter-4 injected daily with 37.5 mg/g gentamouter nuclear layer early on in animals treated with G418 and gentamicin.
This work raises many questions. For instance, can we be surethat the retardation of degeneration occurs through gentamicintranslational modification (driving read-through of PTCs) or is thisoutcome through some other effect of systemic gentamicin? This ispossible, but if this were true we would have expected to see someretardation of degeneration in the treated Pro23His animals.Another important question is why the retardation of degenerationwith aminoglycoside was partial and did not persist longer? Our invitro work and that of others shows that gentamicin has a veryvariable effect on different PTCs. It has been suggested that severalfactors can influence the efficiency of aminoglycoside-inducedread-through of stop codon (Manuvakhova et al., 2000). The mostefficient codon at terminating translation (therefore the least sus-ceptible to read-through) is UAA, followed by UAG then UGA. Inaddition, the action of the aminoglycoside is influenced by thenucleotide context surrounding the stop codon. The base imme-diately after the stop codon (þ4 nt) appears to be of criticalimportance for the ‘‘success’’ of driving read-through, in the orderC > U > G > A, although this order differs somewhat based on thestop codon identity and the aminoglycoside used to induce read-through (Manuvakhova et al., 2000; Howard et al., 2000; Bidouet al., 2004; Howard et al., 2004). Based on these results, theUAA(A) codon found in the S334ter-4 rat would be expected tobe the least sensitive to read-through. However, it is important tonote that this particular codon is found in the dystrophin gene ofthe mdx mouse and has been shown to be responsive to gentamicintreatment, resulting in 10–20% production of full-length functionaldystrophin protein (Barton-Davis et al., 1999). Similarly, the UGA(U)codon in the rd12 mouse would be expected to very responsive toaminoglycoside treatment, but we did not find this in our in vitrowork. This might have been explained by nonsense-mediatedmRNA decay (NMD) limiting responseness to aminoglycoside
were taken from superior (A–D) and inferior (E–H) central retina. (A, E) WT rat; (B, F)icin; (D, H) S334ter-4 injected daily with 14 mg/g G418. This shows preservation of the
Table 2ERGs at P30, P50 and P70 in S334ter-4 rats treated with 12.5 mg/g gentamicin
Stimulus cd.s/m2 Age Treatment a-wave amplitude p value b-wave amplitude p value n
0.01 P30 S 3.05 � 1.53 69.62 � 22.91 4P30 SCI 7.17 � 3.85 0.054 108.90 � 35.31 0.050 16P50 S 7.44 � 8.93 48.26 � 19.80 16P50 SCI 5.62 � 3.95 0.654 35.13 � 10.11 0.001 7P70 S 5.24 � 8.36 52.38 � 23.92 6P70 SCI 3.55 � 2.95 0.531 63.98 � 21.63 0.315 12
3.16 P30 S 20.75 � 3.97 96.75 � 15.05 4P30 SCI 33.62 � 7.73 0.005 180.06 � 49.27 0.004 4P50 S 17.45 � 6.08 75.69 � 13.58 16P50 SCI 11.80 � 5.90 0.034 101.22 � 28.66 0.001 7P70 S 15.18 � 8.26 83.00 � 12.80 6P70 SCI 13.54 � 5.88 0.632 90.71 � 32.23 0.585 12
Daily aminoglycoside treatment allow for significant retention of a- and b-waves at P30 and P50. However the effect is no longer significant at P70. S: daily injection with 0.9%NaCl; SCI: daily injection with 12.5 mg/g gentamicin. n ¼ number of eyes treated.
K. Guerin et al. / Experimental Eye Research 87 (2008) 197–207 205
treatment in the rd12 mouse. NMD is an mRNA surveillancemechanism that eliminates mRNA containing a PTC (Maquat, 2004;Holbrook et al., 2004; Behm-Ansmant et al., 2007). In the rd12mouse, the PTC is located very early in the mRNA sequence andtherefore is a potential target for NMD. However, using quantitativePCR to compare the expression level of the Rpe65 mRNA in C57Bl6/J(wildtype) and rd12 mice we found no difference (data not shown)indicating that this mRNA is not subject to NMD. We conclude fromthis that it is not possible to predict the effectiveness of amino-glycoside read-through based just on its genomic sequence andeach mutation should be individually studied.
Our in vitro studies may also seem surprising in that we saw onlypartial (5.3%) overwriting of the Rho S334ter mutation and yet sawcellular and functional rescue in our in vivo studies. Such an effectwould have little impact on the total amount of rhodopsin inphotoreceptors. This is however very consistent with work in manyother animal models in that a 5.3% drop in the amount of mutantrhodopsin in cells is considered enough to retard a dominantnegative effect and precipitate a clinical benefit. For instance, it issimilar to aminoglycoside effectiveness in mutations in the dys-trophin gene (Howard et al., 2004; Bidou et al., 2004). However, itmay be insufficient to overcome a biochemical abnormality in thelong term and may in part explain the loss of effect we see after P50.To address this issue of low-level read-through, work by Xi et al.(2004) might be relevant. They have demonstrated that amino-glycoside-induced read-through can be enhanced in a gene-specificway when combined with a chemical enhancer targeted at thepromoter of the gene of interest. Rhodopsin promoter activators forexample could be used in combination with low dose amino-glycoside to therapeutic advantage in phenotypes caused by non-sense mutation in the rhodopsin gene.
Table 3ERG recordings in homozygous rd12 mice treated with 12.5, 25 and 37 mg/g gentamicin,
a-wave amplitude (mV)
3 cd.s/m2 0.01
P30 Untreated 3.74 � 0.46 1.9512.5 mg/g gentamicin 12.08 � 9.57 3.6525 mg/g gentamicin 4.46 � 2.37 3.8337 mg/g gentamicin 3.16 � 2.22 6.516 mg/g G418 10.37 � 3.50 4.74
P50 Untreated 3.69 � 3.26 3.3512.5 mg/g gentamicin 3.30 � 0.84 10.0925 mg/g gentamicin 10.36 � 3.24 27.5237 mg/g gentamicin 9.95 � 7.74 7.61
P70 Untreated 3.23 � 0.37 7.0325 mg/g gentamicin 9.99 � 3.27 15.46
The ERG of the untreated rd12 mice is barely detectable. No improvement could be obser
Other factors could also explain the limited effectiveness ofgentamicin. Firstly, our GTTR conjugate experiments show thatgentamicin penetration, although good at least until P21, trails offas the animal ages. Later loss of effectiveness may therefore besomewhat explained by a reduction in the amount of drug pene-trating the retina. Antibiotics such as the penicillins, cephalosporinsand aminoglycosides are sparingly lipid-soluble and thereforepenetrate the eye with difficulty (Fiscella et al., 1998; Verbraekenet al., 1996). It is unlikely however that this fully explains the lim-ited effectiveness seen in our study since in such a situation wewould have expected to see a reduction in effect with reduceddosage whereas we actually saw a minor improvement withreduced dose. Secondly, sub-clinical systemic and ocular toxicitycould still be causing serious cellular damage inhibiting the retina’sability to withstand insult (Nagai and Takano, 2004). Followingsystemic delivery, aminoglycosides accumulate in specific celltypes, most notably kidney nephrons and cochlear hair cells.Aminoglycosides are nephrotoxic because a significant proportion(w5%) of the administered dose is retained in the epithelial cells ofthe proximal tubules (Fabre et al., 1976; Vandewalle et al., 1981). Itis encouraging to note however, that the biochemical mechanismresponsible for toxic side effects is not directly related to theirproperty of inducing translation misreading, but a side effect oftheir charged chemical structure. For example, gentamicin consistsof a mixture of three enantiomers (C1, C1a and C2) and it is thoughtthat only the C2 component causes nephrotoxicity. Fortunatelythere are studies that suggest that the ototoxicity and nephrotox-icity can be ameliorated by changes in the aminoglycoside andco-administration of other agents (Watanabe et al., 2004; Karataset al., 2004). Redesigned aminoglycosides (Nudelman et al., 2006)or newer aminoglycosides such as negamycin do not cause
or 6 mg/g G418
b-wave amplitude (mV) n
cd.s/m2 3 cd.s/m2 0.01 cd.s/m2
� 1.25 9.55 � 6.15 4.59 � 2.41 3� 2.85 15.41 � 10.99 7.15 � 5.12 2� 1.91 30.63 � 15.02 6.42 � 1.49 2� 0.78 8.18 � 10.45 7.25 � 1.04 3� 1.19 4.34 � 1.54 1.75 � 0.61 3
� 2.95 11.84 � 9.80 7.51 � 7.03 2� 2.70 4.29 � 1.91 6.05 � 0.56 3� 20.42 21.18 � 12.81 20.81 � 14.22 3� 5.96 39.99 � 35.31 21.25 � 19.42 2
� 3.49 24.04 � 10.28 11.54 � 2.89 3� 2.95 5.11 � 3.43 6.43 � 2.66 3
ved at any time point using either gentamicin or G418. n ¼ number of eyes treated.
K. Guerin et al. / Experimental Eye Research 87 (2008) 197–207206
nephrotoxicity (Arakawa et al., 2003). Moreover, adjunctive drugssuch as cytochrome c (Watanabe et al., 2004) and Tempol (Karataset al., 2004) could also be used to limit nephrotoxicity. Newer drugsthat interact with ribosomes and that also reduce stringency ofcodon–anticodon pairing, but without the systemic side effects ofaminoglycosides (PTC124; http://www.ptcbio.com/big/discovery1flash.html) may prove more efficacious (Ainsworth, 2005; Welchet al., 2007).
In conclusion, we have demonstrated preservation of photore-ceptors with systemic administration of low dose aminoglycosidein a gain-of-function autosomal dominant (dominant negativeeffect) rat model of RP. This may be of benefit in clinical practice ifused as an adjuvant, or in combination with other strategies, suchas inhibition of apoptosis. It has been suggested that combinatorialapproaches more closely represent what happens in nature wheresurvival responses to insult always involve more than one agent.Synergistic combinatorial approaches have been applied in asthmatreatment (Combivent: ipratropium bromide and salbutamol sul-phate) in glaucoma (Cosopt: dorzolamide combined with timolol)and recently in work combining neuroprotective growth factorswith photodynamic therapy in neovascular retinopathy (Paskowitzet al., 2007).
Acknowledgements
This work was supported by the National Eye Institute GrantR01-EY013533; the Foundation Fighting Blindness, USA; and theBritish Retinitis Pigmentosa Society, Project Number GR550.
References
Adato, A., Weil, D., Kalinski, H., Pel-Or, Y., Ayadi, H., Petit, C., Korostishevsky, M.,Bonne-Tamir, B., 1997. Mutation profile of all 49 exons of the human myosinVIIA gene, and haplotype analysis, in Usher 1B families from diverse origins.Am. J. Hum. Genet. 61, 813–821.
Ainsworth, C., 2005. Nonsense mutations: running the red light. Nature 438,726–728.
Arakawa, M., Shiozuka, M., Nakayama, Y., Hara, T., Hamada, M., Kondo, S., Ikeda, D.,Takahashi, Y., Sawa, R., Nonomura, Y., Sheykholeslami, K., Kondo, K., Kaga, K.,Kitamura, T., Suzuki-Miyagoe, Y., Takeda, S., Matsuda, R., 2003. Negamycinrestores dystrophin expression in skeletal and cardiac muscles of mdx mice. J.Biochem. 134, 751–758.
Barton-Davis, E.R., Cordier, L., Shoturma, D.I., Leland, S.E., Sweeney, H.L., 1999.Aminoglycoside antibiotics restore dystrophin function to skeletal muscles ofmdx mice. J. Clin. Invest. 104, 375–381.
Behm-Ansmant, I., Kashima, I., Rehwinkel, J., Sauliere, J., Wittkopp, N., Izaurralde, E.,2007. mRNA quality control: an ancient machinery recognizes and degradesmRNAs with nonsense codons. FEBS Lett. 581, 2845–2853.
Bidou, L., Hatin, I., Perez, N., Allamand, V., Panthier, J.J., Rousset, J.P., 2004. Prematurestop codons involved in muscular dystrophies show a broad spectrum ofreadthrough efficiencies in response to gentamicin treatment. Gene Ther. 11,619–627.
Chen, J., Makino, C.L., Peachey, N.S., Baylor, D.A., Simon, M.I., 1995. Mechanisms ofrhodopsin inactivation in vivo as revealed by a COOH-terminal truncationmutant. Science 267, 374–377.
Cooper, D.N., Ball, E.V., Stenson, P.D., Phillips, A.D., Howells, K., Mort, M.E., 2007. TheHuman Gene Mutation Database. http://www.hgmd.cf.ac.uk.
Daiger, S., Rossiter, B., Greenberg, J., Christoffels, A., Wu, H., 2007. RetNet, the RetinalInformation Network. http://www.sph.uth.tmc.edu/RetNet.
Du, M., Jones, J.R., Lanier, J., Keeling, K.M., Lindsey, J.R., Tousson, A., Bebok, Z.,Whitsett, J.A., Dey, C.R., Colledge, W.H., Evans, M.J., Sorscher, E.J., Bedwell, D.M.,2002. Aminoglycoside suppression of a premature stop mutation in a Cftr�/�mouse carrying a human CFTR-G542X transgene. J. Mol. Med. 80, 595–604.
Dunant, P., Walter, M.C., Karpati, G., Lochmuller, H., 2003. Gentamicin fails to in-crease dystrophin expression in dystrophin-deficient muscle. Muscle Nerve 27,624–627.
Fabre, J., Rudhardt, M., Blanchard, P., Regamey, C., Chauvin, P., 1976. Persistence ofsisomicin and gentamicin in renal cortex and medulla compared with otherorgans and serum of rats. Kidney Int. 10, 444-449.
Farber, D., Flannery, J., Bowes-Rickman, C., 1994. The rd mouse story: seventy yearsof research on an animal model of inherited retinal degeneration. Prog. RetinaEye Res. 13, 31–64.
Fiscella, R.G., Gieser, J., Phillpotts, B., Gilmartin, C., Labib, S., Cwik, M.J., Solomon, M.J.,Shapiro, M.J., 1998. Intraocular penetration of gentamicin after once-daily ami-noglycoside dosing. Retina 18, 339–342.
Friedman, J.S., Chang, B., Kannabiran, C., Chakarova, C., Singh, H.P., Jalali, S.,Hawes, N.L., Branham, K., Othman, M., Filippova, E., Thompson, D.A., Webster, A.R., Andreasson, S., Jacobson, S.G., Bhattacharya, S.S., Heckenlively, J.R.,Swaroop, A., 2006. Premature truncation of a novel protein, RD3, exhibitingsubnuclear localization is associated with retinal degeneration. Am. J. Med.Genet. 79, 1059–1070.
Frischmeyer, P.A., Dietz, H.C., 1999. Nonsense-mediated mRNA decay in health anddisease. Hum. Mol. Genet. 8, 1893–1900.
Grayson, C., Chapple, J.P., Willison, K.R., Webster, A.R., Hardcastle, A.J., Cheetham, M.E., 2002. In vitro analysis of aminoglycoside therapy for the Arg120stopnonsense mutation in RP2 patients. J. Med. Genet. 39, 62–67.
Green, E.S., Menz, M.D., LaVail, M.M., Flannery, J.G., 2000. Characterization ofrhodopsin mis-sorting and constitutive activation in a transgenic rat model ofretinitis pigmentosa. Invest. Ophthal. Vis. Sci. 41, 1546–1553.
Hein, L.K., Bawden, M., Muller, V.J., Sillence, D., Hopwood, J.J., Brooks, D.A., 2004.Alpha-L-iduronidase premature stop codons and potential read-through inmucopolysaccharidosis type I patients. J. Mol. Biol. 338, 453–462.
Holbrook, J.A., Neu-Yilik, G., Hentze, M.W., Kulozik, A.E., 2004. Nonsense-mediateddecay approaches the clinic. Nat. Genet. 36, 801–808.
Hong, D.H., Pawlyk, B.S., Adamian, M., Li, T., 2004. Dominant, gain-of-functionmutant produced by truncation of RPGR. Invest. Ophthal. Vis. Sci. 45, 36–41.
Howard, M.T., Shirts, B.H., Petros, L.M., Flanigan, K.M., Gesteland, R.F., Atkins, J.F.,2000. Sequence specificity of aminoglycoside-induced stop codon readthrough:potential implications for treatment of Duchenne muscular dystrophy. Ann.Neurol. 48, 164–169.
Howard, M.T., Anderson, C.B., Fass, U., Khatri, S., Gesteland, R.F., Atkins, J.F.,Flanigan, K.M., 2004. Readthrough of dystrophin stop codon mutations inducedby aminoglycosides. Ann. Neurol. 55, 422–426.
Jimenez, A.J., Garcia-Fernandez, J.M., Gonzalez, B., Foster, R.G., 1996. The spatio-temporal pattern of photoreceptor degeneration in the aged rd/rd mouse retina.Cell Tissue Res. 284, 193–202.
Karatas, Y., Secilmis, M.A., Karayaylali, I., Doran, F., Singirik, E., Sagliker, Y.,Dikmen, A., 2004. Effect of tempol (4-hydroxy tempo) on gentamicin-inducednephrotoxicity in rats. Fundam. Clin. Pharmacol. 18, 79–83.
Keeling, K.M., Brooks, D.A., Hopwood, J.J., Li, P., Thompson, J.N., Bedwell, D.M., 2001.Gentamicin-mediated suppression of Hurler syndrome stop mutations restoresa low level of alpha-L-iduronidase activity and reduces lysosomal glycosami-noglycan accumulation. Hum. Mol. Genet. 10, 291–299.
Krawczak, M., Ball, E.V., Fenton, I., Stenson, P.D., Abeysinghe, S., Thomas, N.,Cooper, D.N., 2000. Human gene mutation database-a biomedical informationand research resource. Hum. Mutat. 15, 45–51.
LaVail, M.M., Gorrin, G.M., Repaci, M.A., 1987. Strain differences in sensitivity to light-induced photoreceptor degeneration in albino mice. Curr. Eye Res. 6, 825–834.
Lee, E.S., Burnside, B., Flannery, J.G., 2006. Characterization of peripherin/rds androm-1 transport in rod photoreceptors of transgenic and knockout animals.Invest. Ophthal. Vis. Sci. 47, 2150–2160.
Leroy, B.P., Aragon-Martin, J.A., Weston, M.D., Bessant, D.A., Willis, C., Webster, A.R.,Bird, A.C., Kimberling, W.J., Payne, A.M., Bhattacharya, S.S., 2001. Spectrum ofmutations in USH2A in British patients with Usher syndrome type II. Exp. EyeRes. 72, 503–509.
Linde, L., Boelz, S., Nissim-Rafinia, M., Oren, Y.S., Wilschanski, M., Yaacov, Y.,Virgilis, D., Neu-Yilik, G., Kulozik, A.E., Kerem, E., Kerem, B., 2007. Nonsense-mediated mRNA decay affects nonsense transcript levels and governs responseof cystic fibrosis patients to gentamicin. J. Clin. Invest. 117, 683–692.
Lyeford-Pike, S., Vogelheim, C., Chu, E., Della Santina, C.C., Carey, J.P., 2007. Genta-micin is primarily localized in vestibular type I hair cells after intratympanicadministration. J. Assoc. Res. Otolarygol. 8, 497–508.
Mankin, A.S., Liebman, S.W., 1999. Baby, don’t stop!. Nat. Genet. 23, 8–10.Manuvakhova, M., Keeling, K., Bedwell, D.M., 2000. Aminoglycoside antibiotics
mediate context-dependent suppression of termination codons in a mamma-lian translation system. RNA 6, 1044–1055.
Maquat, L.E., 2004. Nonsense-mediated mRNA decay: splicing, translation andmRNP dynamics. Nat. Rev. Mol. Cell Biol. 5, 89–99.
Moehle, E.A., Rock, J.M., Lee, Y.L., Jouvenot, Y., DeKelver, R.C., Gregory, P.D., Urnov, F.D.,Holmes, M.C., 2007. Targeted gene addition into a specified location in the humangenome using zinc finger nucleases. Proc. Natl. Acad. Sci. USA 104, 3055–3060.
Nagai, J., Takano, M., 2004. Molecular aspects of renal handling of aminoglycosidesand strategies for preventing the nephrotoxicity. Drug Metab. Pharmacokinet19, 159–170.
Nudelman, I., Rebibo-Sabbah, A., Shallom-Shezifi, D., Hainrichson, M., Stahl, I.,Ben-Yosef, T., Baasov, T., 2006. Redesign of aminoglycosides for treatment ofhuman genetic diseases caused by premature stop mutations. Bioorg. Med.Chem. Lett. 16, 6310–6315.
Pang, J.J., Chang, B., Hawes, N.L., Hurd, R.E., Davisson, M.T., Li, J., Noorwez, S.M.,Malhotra, R., McDowell, J.H., Kaushal, S., Hauswirth, W.W., Nusinowitz, S.,Thompson, D.A., Heckenlively, J.R., 2005. Retinal degeneration (rd12): a new,spontaneously arising mouse model for Leber congenital amaurosis (LCA). Mol.Vis 11, 152–162.
Paskowitz, D.M., Donohue-Rolfe, K.M., Yang, H., Yasumura, D., Matthes, M.T.,Hosseini, K., Graybeal, C.M., Nune, G., Zarbin, M.A., LaVail, M.M., Duncan, J.L.,2007. Neurotrophic factors minimize the retinal toxicity of verteporfin photo-dynamic therapy. Invest. Ophthal. Vis. Sci. 48, 430–437.
Pinotti, M., Rizzotto, L., Pinton, P., Ferraresi, P., Chuansumrit, A., Charoenkwan, P.,Marchetti, G., Rizzuto, R., Marian, G., Bernardi, F., 2006. Intracellular readthroughof nonsense mutations by aminoglycosides in coagulation factor VII. J. Thromb.Haemost. 4, 1308–1314.
K. Guerin et al. / Experimental Eye Research 87 (2008) 197–207 207
Pittler, S.J., Coan, P., Kontzen, P.L., Allen, D., Bedwell, D., Kraft, T.W., 2001. Amino-glycosides partially restore photoreceptor function in the rd1 mouse. E-Abstract2837. Available at. Invest. Ophthal. Vis. Sci. 43. http://www.iovs.org.
Politano, L., Nigro, G., Nigro, V., Piluso, G., Papparella, S., Paciello, O., Comi, L.I., 2003.Gentamicin administration in Duchenne patients with a premature stop codon.Preliminary results. Acta. Myol. 22, 15–21.
Sangkuhl, K., Schulz, A., Rompler, H., Yun, J., Wess, J., Schoneberg, T., 2004.Aminoglycoside-mediated rescue of a disease-causing nonsense mutation inthe V2 receptor gene in vitro and in vivo. Hum. Mol. Genet. 13, 893–903.
Senechal, A., Humbert, G., Surget, M.O., Bazalgette, C., Bazalgette, C., Arnaud, B.,Arndt, C., Laurent, E., Brabet, P., Hamel, C.P., 2006. Screening genes of theretinoid metabolism: novel LRAT mutation in leber congenital amaurosis. Am. J.Ophthalmol. 142, 702–704.
Sleat, D.E., Sohar, I., Gin, R.M., Lobel, P., 2001. Aminoglycoside-mediated suppressionof nonsense mutations in late infantile neuronal ceroid lipofuscinosis. Eur. J.Paediatr. Neurol. 5, 57–62.
Steinberg, R.H., Flannery, R.G., Naash, M., 1996. Transgenic rat models of inheritedretinal degeneration caused by mutant opsin genes. E-Abstract 698. Availableat. Invest. Ophthal. Vis. Sci. 37. http://www.iovs.org.
Urnov, F.D., Miller, J.C., Lee, Y.L., Beausejour, C.M., Rock, J.M., Augustus, S.,Jamieson, A.C., Porteus, M.H., Gregory, P.D., Holmes, M.C., 2005. Highly efficientendogenous human gene correction using designed zinc-finger nucleases.Nature 435, 646–651.
Vandewalle, A., Farman, N., Morin, J.P., Fillastre, J.P., Hatt, P.Y., Bonvalet, J.P., 1981.Gentamicin incorporation along the nephron: autoradiographic study onisolated tubules. Kidney Int. 19, 529–539.
Verbraeken, H., Verstraete, A., Van de Velde, E., Verschraegen, G., 1996. Penetrationof gentamicin and ofloxacin in human vitreos after systemic administration.Graefes Arch. Clin. Exp. Ophthalmol. 234 (Suppl. 1), S59–S65.
Wagner, K.R., Hamed, S., Hadley, D.W., Gropman, A.L., Burstein, A.H., Escolar, D.M.,Hoffman, E.P., Fischbeck, K.H., 2001. Gentamicin treatment of Duchenne andBecker muscular dystrophy due to nonsense mutations. Ann. Neurol. 49, 706–711.
Watanabe, A., Nagai, J., Adachi, Y., Katsube, T., Kitahara, Y., Murakami, T., Takano, M.,2004. Targeted prevention of renal accumulation and toxicity of gentamicin byaminoglycoside binding receptor antagonists. J. Control Release 95, 423–433.
Welch, E.M., Barton, E.R., Zhou, J., Tomizawa, Y., Friesen, W.J., Trifillis, P., Paushkin, S.,Patel, M., Trotta, C.R., Hwang, S., Wilde, R.G., Karp, G., Takasugi, J., Chen, G., Jones, S.,Ren, H., Moon, Y.C., Corson, D., Turpoff, A.A., Campbell, J.A., Conn, M.M., Khan, A.,Almstead, N.G., Hedrick, J., Mollin, A., Risher, N., Weetall, M., Yeh, S., Branstrom, A.A., Colacino, J.M., Babiak, J., Ju, W.D., Hirawat, S., Northcutt, V.J., Miller, L.L., Spatrick, P.,He, F., Kawana, M., Feng, H., Jacobson, A., Peltz, S.W., Sweeney, H.L., 2007. PTC124targets genetic disorders caused by nonsense mutations. Nature 477, 87–91.
Wilschanski, M., Yahav, Y., Yaacov, Y., Blau, H., Bentur, L., Rivlin, J., Aviram, M.,Bdolah-Abram, T., Bebok, Z., Shushi, L., Kerem, B., Karem, E., 2003. Gentamicin-induced correction of CFTR function in patients with cystic fibrosis and CFTRstop mutations. N. Engl. J. Med. 349, 1433–1441.
Xi, B., Guan, F., Lawrence, D.S., 2004. Enhanced production of functional proteinsfrom defective genes. J. Am. Chem. Soc. 126, 5660–5661.
Zhang, Q., Acland, G.M., Wu, W.X., Johnson, J.L., Pearce-Kelling, S., Tulloch, B.,Vervoort, R., Wright, A.F., Aguirre, G.D., 2002. Different RPGR exon ORF15mutations in Canids provide insights into photoreceptor cell degeneration.Hum. Mol. Genet. 11, 993–1003.