superior osteogenic capacity for bone tissue engineering of fetal compared with perinatal and adult...

Superior Osteogenic Capacity for Bone Tissue Engineering of FetalCompared with Perinatal and Adult Mesenchymal Stem Cells

ZHI-YONG ZHANG,a,b SWEE-HIN TEOH,b MARK S.K. CHONG,a,b JAN THORSTEN SCHANTZ,c

NICHOLAS M. FISK,d MAHESH A. CHOOLANI,e JERRY CHANe

aGraduate Program in Bioengineering, National University of Singapore, Singapore; bCentre for BiomedicalMaterials Applications and Technology (BIOMAT), Department of Mechanical Engineering, Faculty of Engineering,National University of Singapore, Singapore; cDepartment of Surgery, Yong Loo Lin School of Medicine, NationalUniversity of Singapore and National University Hospital Systems, Singapore; dThe University of QueenslandCentre for Clinical Research, Brisbane, Australia; eExperimental Fetal Medicine Group, Department of Obstetrics &Gynaecology, Yong Loo Lin School of Medicine, National University of Singapore and National UniversityHospital Systems, Singapore

Key Words. Mesenchymal stem cells • Tissue engineering • Scaffold • Fetal • Umbilical cord • Adipose tissue • Bone marrow

ABSTRACT

Mesenchymal stem cells (MSCs) from human adult bonemarrow (haMSCs) represent a promising source for bonetissue engineering. However, their low frequencies and lim-ited proliferation restrict their clinical utility. Alternativepostnatal, perinatal, and fetal sources of MSCs appear tohave different osteogenic capacities, but have not been sys-tematically compared with haMSCs. We investigated theproliferative and osteogenic potential of MSCs from humanfetal bone marrow (hfMSCs), human umbilical cord (hUC-MSCs), and human adult adipose tissue (hATMSCs), andhaMSCs, both in monolayer cultures and after loading intothree-dimensional polycaprolactone-tricalcium-phosphatescaffolds.

Although all MSCs had comparable immunophenotypes,only hfMSCs and hUCMSCs were positive for the embry-onic pluripotency markers Oct-4 and Nanog. hfMSCs ex-pressed the lowest HLA-I level (55% versus 95%–99%) andthe highest Stro-1 level (51% versus 10%–27%), and had the

greatest colony-forming unit–fibroblast capacity (1.6�–2.0�; p < .01) and fastest doubling time (32 versus 54–111hours; p < .01). hfMSCs had the greatest osteogenic capac-ity, as assessed by von-Kossa staining, alkaline phosphataseactivity (5.1�–12.4�; p < .01), calcium deposition (1.6�–2.7� in monolayer and 1.6�–5.0� in scaffold culture; p <.01), calcium visualized on micro-computed tomography(3.9�17.6�; p < .01) and scanning electron microscopy, andosteogenic gene induction. Two months after implantation ofcellular scaffolds in immunodeficient mice, hfMSCs resultedin the most robust mineralization (1.8�–13.3�; p < .01).

The ontological and anatomical origins of MSCs haveprofound influences on the proliferative and osteogeniccapacity of MSCs. hfMSCs had the most proliferative andosteogenic capacity of the MSC sources, as well as beingthe least immunogenic, suggesting they are superior can-didates for bone tissue engineering. STEM CELLS 2009;27:126 –137

Disclosure of potential conflicts of interest is found at the end of this article.

INTRODUCTION

Mesenchymal stem cells (MSCs) are rare cells that can bereadily isolated from bone marrow (BM) and expanded throughmultiple passages while retaining their multipotent differentia-tion capacity [1]. They are therefore an attractive cellular sourcefor tissue-engineering applications [2–4]. Under permissivestimulation, MSCs undergo osteogenic differentiation through a

well-defined pathway [5, 6], acquiring osteoblastic markers andsecreting extracellular matrix (ECM) and calcium crystals [1, 7].MSCs have been shown to be nonimmunogenic in both in vitro[8–10] and in vivo [11, 12] transplantation paradigms, suggest-ing their utility for both autologous and allogeneic tissue engi-neering applications [13–15]. Investigations into their use invarious animal models have demonstrated efficacy in healingcritical size calvarial defects in mice [16] and femoral defects inrat [17] and sheep [18] models. However, clinical translation is

Author contributions: Z.Y.Z.: design of the study, collection, analysis, and interpretation of data, manuscript writing; T.S.H.:conception and design of the study, provision of study material, analysis and interpretation of data, manuscript writing; M.C.: provisionof study material, analysis and interpretation of data, manuscript writing; J.T.S.: provision of study material; N.M.F.: analysis of data,manuscript writing; M.C.: conception and design, financial support, administrative support, provision of study materials, analysis ofdata, manuscript writing, final approval of the manuscript; J.C.: conception and design, financial support, administrative support,provision of study materials, analysis of data, manuscript writing, final approval of the manuscript; M.A.C. and J.C. contributed equallyto this work.

Correspondence: Mahesh A. Choolani, F.R.C.O.G., Ph.D., Experimental Fetal Medicine Group, Department of Obstetrics & Gynaecology,Yong Loo Lin School of Medicine, National University of Singapore and National University Hospital Systems, Singapore 119074.Telephone: 65-6772-4261; Fax: 65-6779-4753; e-mail: [email protected] Received May 16, 2008; accepted for publication September18, 2008; first published online in STEM CELLS EXPRESS October 2, 2008. ©AlphaMed Press 1066-5099/2008/$30.00/0 doi: 10.1634/stemcells.2008-0456

TISSUE-SPECIFIC STEM CELLS

STEM CELLS 2009;27:126–137 www.StemCells.com

hampered by the low frequency at which MSCs exist in BM,especially in older age groups, in which fractures and nonunionpredominate. In addition, adult BM-derived MSCs have highcellular senescence and limited proliferation capacity [7, 19] andosteogenic potential [20–22].

More recently, MSCs with osteogenic potential have beenisolated from a diverse range of tissue types and ontogenies,including adipose tissue [23] and perinatal tissues such as um-bilical cord [24], umbilical cord blood [25, 26], amniotic fluid[27, 28], and fetal blood, bone marrow, and liver [29–32].Although investigations into their basic biology, immunogenic-ity, and osteogenic potential have been reported, MSCs have notbeen systematically compared for bone tissue-engineering ap-plications. Hence, it remains unclear how these novel fetalperinatal and adult MSC sources compare with their standardadult BM MSC counterparts for osteogenic differentiation andpotential for tissue engineering.

Three-dimensional (3D) scaffolds provide the necessarysupport for cells to attach, grow, and differentiate, and define theoverall shape of the tissue-engineered transplant [33]. A rangeof biomaterials has been investigated for use in bone tissue-engineering scaffolds, which can be considered chiefly in twocategories: bioceramic material and biodegradable polymers[34]. Although bioceramic material, such as synthetic hydroxy-lapatite or �-tricalcium phosphate (�-TCP), has been shown tobe osteoconductive, the use of ceramics is limited by their poormechanical properties and difficulty in morphological process-ing [35]. Recently, we explored the use of a polymer ceramiccomposite material for bone tissue-engineering scaffolds, whichis made of poly �-caprolactone (PCL) and bioactive ceramic�-TCP [36]. This can be fabricated into honeycomb structuresthat allow for rapid vascularization as well as maintenance ofthe structural integrity of tissue-engineered bone grafts in load-bearing applications [37].

We compared four types of MSC from different ontologicaland anatomical origins in a direct head-to-head manner. In vitrocomparative studies were done in both a monolayer culturesystem and on 3D PCL-TCP bioactive scaffold cultures toinvestigate their proliferation capacity, osteogenic differentia-tion and mineralization, and in vivo ectopic bone formation. Wereport that the ontological and anatomical origin of MSCs has aprofound influence on their proliferative and osteogenic capac-ity, with hfMSCs being the most promising candidate for bonetissue engineering.

MATERIALS AND METHODS

Samples, Animals, and EthicsAll human tissue collection for research purposes was approved bythe Domain Specific Review Board of National University Hospital,in compliance with international guidelines regarding the use offetal tissue for research [38]. In all cases, patients gave separatewritten consent for the use of the collected tissue. Fetal gestationalage was determined by ultrasonic crown–rump or femur lengthmeasurements. Fetal femurs were collected for isolation of hfMSCsafter clinically indicated termination of pregnancy. Samples corre-spond to 10�6, 11�1, 14�2, 17�0, and 18�3 weeks(�days) gestation(n � 5). Umbilical cords were collected following term deliveries(n � 3). Adipocyte-derived MSCs were derived from adipose tissueharvested during cosmetic surgery (donor ages, 20, 48, and 56years; n � 3). Human adult MSC samples used in this study wereprovided by the Tulane University Health Sciences Center (donorages, 19, 22, and 35 years; n � 3).

Male nonobese diabetic/severe combined immunodeficient(NOD/SCID) mice were acquired through Charles Rivers, Austra-lia, and all procedures were approved by the Institutional AnimalCare and Use Committee at National University of Singapore. All

materials used were purchased from Sigma-Aldrich (Singapore,http://www.sigmaaldrich.com) unless otherwise stated.

Isolation and Characterization of MSCs

Growth Medium. Routine culture for all MSCs was conducted inDulbecco’s modified Eagle’s medium (DMEM)-Glutamax (Gibco,Grand Island, NY, http://www.invitrogen.com) supplemented with10% fetal bovine serum, 50 U/ml penicillin, and streptomycin(Gibco), hereafter referred to as D10 medium.

hfMSCs. hfMSCs were isolated as previously described [31, 32].Briefly, single-cell suspensions were prepared by flushing the BMcells out of femurs using a 22-gauge needle, passing through a70-�m cell strainer (BD Biosciences, San Diego, http://www.bdbiosciences.com), and plating on Petri dishes (Nunc, Rochester,NY, http://www.nuncbrand.com) in D10 medium at 106 cells/ml.Adherent spindle-shaped cells were recovered from the primaryculture after 4–7 days. Nonadherent cells were removed with initialmedium changes every 2–3 days. At subconfluence, they weretrypsinized and replated at low density (104 cells/cm2).

hUCMSCs. hUCMSCs were isolated in a similar manner de-scribed by others [24]. Briefly, umbilical cords were washed withphosphate-buffered saline (Gibco), umbilical cord arteries wereimmersed in 1% collagenase for 20 minutes at 37°C, and cells werepelleted by centrifuging before plating in D10 medium. Emergingspindle-shaped adherent cells were cultured as above.

hATMSCs. hATMSCs were isolated as previously described byothers [39]. Briefly, adipose tissue was washed before digestionwith collagenase type I (1:1,000 w/v) for 60 minutes at 37°C withintermittent shaking. After removal of floating adipocytes by cen-trifugation (300 �g for 5 minutes), the stromal-vascular fractionwas plated at 3,500 cells/cm2 in D10 medium, and hATMSCs wererecovered as above.

haMSCs. human BM-derived MSCs obtained from Tulane Uni-versity were thawed and cultured as above.

All experiments were performed on passage 4 cells.

Immunophenotype. MSC samples were screened by immunocy-tochemistry (ICC) (all from DAKO, Glostrup, Denmark, http://www.dako.com, unless otherwise stated) and flow cytometry wasperformed as previously described [29]. ICC was used to screen forCD14, CD34, CD45, CD31, von Willebrand factor (vWF) (Abcam,Cambridge, MA, http://www.abcam.com), CD105 (SH2), CD73(SH3, SH4) (Abcam), vimentin, laminin, CD29 (Chemicon, Te-mecula, CA, http://www.chemicon.com), CD44 (BD Biosciences),CD106, CD90 (Chemicon), Oct-4 (Abcam), and Nanog (Abcam),whereas flow cytometry was used to search for HLA-I, HLA-II, andStro-1 (Chemicon).

Multipotent Differentiation. For osteogenic induction, MSCswere plated at 2 � 104 cells/cm2 and cultured in osteogenic differ-entiation medium (D10 medium supplemented with 10 mM �-glyc-erophosphate, 10�8 M dexamethasone, and 0.2 mM ascorbic acid)for up to 20 days, with medium changed three times per week.Extracellular accumulation of calcium was assayed by von Kossastaining. For adipogenic induction, MSCs were plated at 2 � 104

cells/cm2 and cultured in adipogenic differentiation medium (D10medium supplemented with 5 �g/ml insulin, 10�6 M dexametha-sone, and 0.6 � 10�4 M indomethacin) for up to 5 weeks withmedium changed three times per week. The existence of lipidvacuoles was confirmed by oil red O staining. For chondrogenicinduction, MSCs were pelleted and cultured in chondrogenic dif-ferentiation medium (DMEM supplemented with 0.1 �M dexa-methasone, 0.17 mM ascorbic acid, 1.0 mM sodium pyruvate, 0.35mM L-proline, 1% insulin-transferrin sodium-selenite (Thermo-Fisher Scientific, Singapore, http://www.fishersci.com), 1.25 mg/mlbovine serum albumin, 5.33 �g/ml linoleic acid, and 0.01 �g/mltransforming growth factor-�) for 28 days with medium changedthree times per week. The micromass pellets were formalin fixed,paraffin embedded, and sectioned in 10-�m slices. Thereafter, theywere dewaxed and rehydrated before safranin O staining [40].

127Zhang, Teoh, Chong et al.

www.StemCells.com

Growth Kinetics and Colony-FormingUnit–Fibroblast AssayThe growth kinetics of MSCs were assessed by plating cells at 104

cells/cm2 in D10 medium in triplicate. Cells were trypsinized every 3days, their numbers were enumerated, and population doubling timeswere calculated. The colony-forming unit–fibroblast (CFU-F) capacityof MSCs was assessed by low-density plating of MSCs at 4 cells/cm2

in 100-mm dishes (200 cells per dish) in D10 medium for 14 days, andstaining with 3% crystal violet in 100% methanol for 5 minutes at roomtemperature. Colonies �2 mm in diameter were counted.

Osteogenic AssaysMSCs were plated for osteogenic differentiation as above for up to 28days, with medium changed three times per week. Samples wereharvested in triplicate for the following assays. The calcium contentassay was done by dissolving crystals with 0.4 ml 0.5 N acetic acidovernight, and quantifying them with a calcium assay kit (BioAssaySystems, Hayward, CA, http://www.bioassaysys.com) according to themanufacturer’s instructions. The amount of calcium released fromacellular scaffolds grown in osteogenic medium was 23.5 � 3.7,27.8 � 3.1, 35.9 � 7.8, and 36.7 � 5.4 �g/scaffold at days 7, 14, 21,and 28, respectively. This was then subtracted from the values obtainedin the test groups. The alkaline phosphatase (ALP) activity in celllysates was measured using SensoLyte pNPP Alkaline PhosphataseAssay Kit (AnaSpec, San Jose, CA, http://www.anaspec.com) follow-ing the manufacturer’s instructions and normalized to total proteincontent through the Bradford assay (Bio-Rad, Hercules, CA, http://www.bio-rad.com).

Scaffold Manufacturing and Loading of Cells inScaffoldsPCL-TCP 3D bioactive scaffold specimens were fabricated as re-ported by others. We chose a lay-down pattern of 0°/60°/120° togive a honeycomb-like pattern of triangular pores with a porosity of70% and average pore size of 0.523 mm. Scaffolds 4 mm in heightand 5 mm diameter were generated with an internal empty space of55 mm3 per scaffold for cellular loading. The surface was treatedwith 5 M NaOH for 3 hours to enhance hydrophilicity [41], and allscaffolds were sterilized before cellular loading.

MSCs were suspended in fibrin glue (Tisseel kit, Immuno AG,Vienna, Austria, http://www.baxter.com) for seeding into the po-rous scaffolds (1.6 � 105 cells per scaffold, 3,000 cells/mm3).Cultures were maintained in 24-well plates with D10 medium andincubated overnight before transferring to osteogenic medium andculturing in osteogenic medium for 4 weeks with medium changesthrice weekly.

Cellular Adhesion, Viability, and Proliferation in 3DScaffold CultureCellular morphology, adhesion, and ECM production were exam-ined daily by phase contrast light microscopy over 28 days. Anal-ysis of cell viability was performed with fluorescein diacetate/propidium iodide (FDA/PI) staining in triplicate, where FDA stainsviable cells green and PI stains dead cells red, as previously de-scribed [41]. Samples were imaged using a confocal laser scanningmicroscope (Olympus FV300 Fluoview, Olympus, Tokyo, http://www.olympus-global.com).

Total cell numbers in 3D cellular-scaffold constructs on days 1,4, 7, 14, and 28 (n � 3, separate scaffolds from those used forFDA/PI) were estimated by quantifying the DNA content of eachscaffold using the PicoGreen DNA Quantification Kit (MolecularProbes Inc., Eugene, OR, http://probes.invitrogen.com) as per themanufacturer’s instructions.

Osteogenic Differentiation and MineralizationAssays in 3D Scaffold Culture

Osteogenic Gene Expression. Cellular-scaffold constructs were col-lected on days 1, 7, 14, 21, 28 for RNA extraction and conversion tocDNA as previously described [31]. We undertook real-time Taqmanreverse transcription-polymerase chain reaction (RT-PCR) of the fol-

lowing osteogenic genes: collagen 1A1 (COL1A1), osteonectin,RunX2, and ALP (Table 1). PCRs were performed in triplicate, in 25�l: 5 �l cDNA, 12.5 �l TaqMan Universal PCR Master Mix (AppliedBiosystems, Foster City, CA, http://www.appliedbiosystems.com), and7.5 �l primer working solution. Thermal cycle conditions were 50°Cfor 2 minutes, 95°C for 10 minutes, then 50 cycles at 95°C for 15seconds and 60°C for 1 minute. Amplifications were monitored withthe ABI Prism 7000 Sequence Detection System (Applied Biosys-tems). Results were normalized against the housekeeping gene glycer-aldehyde-3-phosphate dehydrogenase (GAPDH), and relative gene ex-pression was analyzed with the 2�ddCt method.

Micro-Computed Tomography (CT). Micro-CT was performed withthe 1076 SkyScan machine (SkyScan, Kontich, Belgium, http://www.skyscan.be). Cellular-scaffold constructs (n � 3 from each group) werefixed in 2.5% gluteraldehyde and placed in the sample holder forscanning through 180° with a rotation step of 1° at a spatial resolutionof 35 �m. An averaging of five and a 1-mm aluminum filter were usedduring scanning. Scan files were reconstructed at a step size of oneusing a modified Feldkamp algorithm as provided by SkyScan. Recon-structed data were loaded into 3D modeling software, VGstudio (Vol-ume Graphics GmbH, Heidelberg, Germany, http://www.volumegraphics.com), to stack the two-dimensional (2D) image into a3D model for quantitative histomorphometric analysis. The thresholdused was 200. Control acellular scaffolds that had been cultured inosteogenic medium over the same period of time were imaged, and theamount of mineralization (0.065 � 0.023 mm3) was subtracted fromthe measurements made in the test groups. During scanning the newbone formation in vivo, acellular scaffold implants were used as neg-ative controls for the subtraction as well.

Scanning Electron Microscope (SEM) and Energy DispersiveX-ray (EDX) Spectrometer Analysis. Fixed scaffolds (n � 3 fromeach group) were then dehydrated in a graded ethanol series, air-dried, and gold sputtered with SCD 005 gold sputter machine(Bal-Tec AG, Balzers, Liechtenstein, http://www.bal-tec.com) for70 seconds at 30 mA under high vacuum. The samples were viewedwith a JSM-6700 SEM with an EDX accessory (JEOL Ltd., Pea-body, MA, http://www.jeol.com) operating at 10 kV under highvacuum mode. The elemental composition of the nodules inside thesamples was analyzed by EDX.

In Vivo Transplantation and Ectopic Bone Assays

Cellular-Scaffold Construct Preparation. MSCs were seeded ontoPCL-TCP scaffolds and predifferentiated in osteogenic differentiationmedium for 2 weeks before implantation. Surgical procedure: Afterinducing general anesthesia, a midline longitudinal skin incision wasmade on the dorsal surface of each mouse, and subcutaneous pocketswere created, into which the MSC cellular-scaffold constructs wereinserted. The skin was closed with interrupted 6-O vicryl sutures. After

Table 1. Design of primers and probes

Gene Primers: 5�–3�

COL1A1 F: AGGACAAGAGGCATGTCTGGTTR: CCCTGGCCGCCATACTCP: CGAGAGCATGACCGATGGAHCCAGTT

Osteonectin F: AGATGATGGTGCAGAGGAAR: GGTGGTTCTGGCAGGGATTTP: CCGAAGAGGAGGTGGTGGCGG

RunX2 F: AGTAGGTGTCCCGCCTCAGAR: CCHGTGGAHAAAAGGACTTGGTP: CCCACGGCCCTCCCTGAACTCT

ALP F: CAGGCTGGAGATGGACAAGHCR: GGACCTGGGCATTGGTGHP: CCTTCGTGGCCCTCTCCAAGACG

GAPDH F: CCACCCATGGCAAATTCCR: GGATTTCCATTGATGACAAGCTTP: TGGCACCGTCAAGGCTGAGAACG

Abbreviations: ALP, alkaline phosphatase; COL1A1, collagen1A1; F, forward; GAPDH, glyceraldehyde-3-phosphatedehydrogenase; P, probe; R, reverse.

128 Superior Osteogenic Capacity of Fetal MSCs

2 months, animals were euthanized and the implants were retrieved forhistological and micro-CT analysis in triplicate.

Histology. Cellular-scaffold constructs (n � 3) from each groupwere embedded in OCT medium (Tissue-Tek; Sakura Finetek,Tokyo, Japan, http://www.sakura-finetek.com) and sectioned at a30-�m thickness with a cryostat (CM 3050S; Leica MicrosystemsGmbH, Wetzlar, Germany, http://www.leica-microsystems.com).Sections were stained with von Kossa and counterstained withhematoxylin and eosin (H&E) to visualize tissue morphology andevidence of new bone formation.

Human–Mouse Chimerism. Lamin A/C immunostaining was usedto investigate chimerism of human cells in murine tissue as previouslydescribed [31, 32]. Briefly, sections from each sample were blockedwith 5% normal goat serum for 2 hours and left to react with mono-clonal mouse anti-human Lamin A/C antibody (1:100; Vector Labo-ratories, Burlingame, CA, http://www.vectorlabs.com) overnight; sec-tions were then incubated with goat anti-mouse secondary antibodies(1:100, Alexa Fluor� 488; Invitrogen, Renfrew, U.K.; http://www.invitrogen.com) for 1 hour and counterstained with PI. Images were

visualized through confocal microscopy as above. The number ofhuman and murine cells within scaffolds (n � 3) was enumeratedmanually for six low-powered fields (LPFs) to calculate the rate ofchimerism of human cells. In total, 1,189 cells (range, 133–254 perLPF; mean, 115) were counted for each specimen.

StatisticsParametric data are shown as mean � standard deviation, and wereanalyzed using one-way and two-way analysis of variance. p � .05 wasconsidered significant.

RESULTS

Characterization of MSCs from Various Ontologicaland Anatomical SiteshfMSCs, haMSCs, hUCMSCs, and hATMSCs shared a similar spin-dle-shaped morphology when cultured in monolayers (Fig. 1A). ICC

Figure 1. Characterization of hfMSCs, hUCMSCs, haMSCs, and hATMSCs. (A): All MSC sources demonstrated a spindle-shaped morphology(100� and 400�). (B): All MSC types demonstrated a nonhemopoietic, nonendothelial phenotype, with hfMSCs and hUCMSCs expressing markersassociated with embryonic stem cells, Oct-4 and Nanog. All four types of MSC expressed multiple cell adhesion molecules and did not expressHLA-II. hfMSCs expressed the lowest level of HLA-I and the highest level of Stro-1, compared with other sources. (C): The trilineage differentiationcapacity of the different MSC types was confirmed by von Kossa staining for extracellular calcium (black crystals), oil red O for intracytoplasmicvacuoles of neutral fat (red vacuoles), and safranin O for extracellular cartilage stains in micromass pellet cultures (red). Abbreviations: haMSC,human adult bone marrow MSC; hATMSC, human adult adipose tissue MSC; hfMSC, human fetal bone marrow MSC; hUCMSCs, human umbilicalcord MSC; ICC, immunocytochemistry; MSC, mesenchymal stem cell; vWF, von Willebrand factor.


www.StemCells.com

staining and flow cytometry revealed a consistent immunophe-notype that was negative for hemopoietic (CD14, CD34, CD45)and endothelial (CD31, vWF) markers, and positive for mesen-chymal markers (CD105 [SH2], CD73 [SH3, SH4]), intracellu-lar markers (vimentin and laminin), and cell adhesion molecules(CD29, CD44, CD106, CD90). They expressed HLA-I but notHLA-II, with hfMSCs having a lower expression level of HLA-I(55.0%) than the other MSC types (95.5%–99.1%; Fig. 1B).hfMSCs had a higher expression level of Stro-1 (51.2%) thanthe other MSCs (10.4%–27.2%). In addition, gating revealed asubpopulation of hfMSCs (37.1% and 24.3%, respectively) andhUCMSCs (32.5% and 20.4%, respectively) that expressed theembryonic stem cell markers Oct-4 and Nanog, both of whichwere absent in haMSCs and hATMSCs (Fig. 1B).

All MSC sources differentiated readily into osteogenic, adi-pogenic, and chondrogenic lineages under permissive condi-tions. Exposure to osteogenic inductive medium resulted insecretion of extracellular calcium crystals, identified on vonKossa staining, indicating osteogenic differentiation (Fig. 1C).When cultured in adipogenic inductive medium, intracytoplas-mic lipid vacuoles were observed from day 14, confirmed by oilred O staining (Fig. 1C). After 30 days of cell pellet culture inchondrogenic inductive medium, chondrogenic differentiationwas observed, with hfMSCs developing the largest cell pellet,followed by haMSCs, whereas both hUCMSCs and hATMSCsdisplayed much less safranin O staining (Fig. 1C).

hfMSCs Have Higher Proliferative and OsteogenicPotential than hUCMSCs, haMSCs, and hATMSCsin Monolayer CulturesIn 2D monolayer cultures, hfMSCs proliferated the fastest (pop-ulation doubling time, 32.3 � 2.5 hours; n � 3), followed byhUCMSCs (54.7 � 4.3 hours; n � 3) and hATMSCs (70.4 �3.6 hours; n � 3), with the slowest being haMSCs (116.6 � 22.4hours; n � 3), resulting in a significant difference in the numberof population doublings achieved over the 18-day culture period(p � .01; Fig. 2A). In addition, hfMSCs had a higher CFU-Fforming ability, with 75.1% � 5.0% of cells forming colonies,compared with haMSCs (39.6% � 4.6%), hUCMSCs (47.5% �7.5%), and hATMSCs (37.5% � 5.6%) (p � .01; Fig. 2B).

When exposed to osteogenic medium over 28 days, hfMSCsunderwent more robust osteogenic differentiation, generatingmore extracellular mineralization than the other MSC types, asshown by more intense von Kossa staining (Fig. 2C). This wasconfirmed with direct quantification of calcium deposition,showing a 1.6- to 2.7-fold increase (Fig. 2D; p � .01) in ALPactivity, indicating a 5.1- to 12.4-fold increase over the otherMSC types (Fig. 2E; p � .01). Overall, the order of preferentialosteogenic differentiation was hfMSCs, followed by hUCMSCs,haMSCs, and finally hATMSCs (Fig. 2C–2E).

hfMSC PCL-TCP Cellular-Scaffold ConstructsDemonstrated the Highest Proliferation CapacityNext, we loaded the various MSCs onto high-porosity PCL-TCPscaffolds (Fig. 3A) and cultured them over 28 days to test theirproliferative and osteogenic capacities in a 3D culture paradigm.FDA/PI staining of the cellular-scaffold constructs demon-strated high cellular viability over 28 days in culture in all fourMSC constructs (Fig. 3B). After loading with fibrin glue, allfour MSC types remained spherical during the initial period, dueto their confinement within the fibrin gel. Over the next 7–14days, they assumed a spindle-shaped morphology reminiscent ofthat seen in monolayer cultures, with hfMSCs achieving this atan earlier time point, at day 7, compared with day 14 for theother MSC types (Fig. 3B).

hfMSCs reached confluence within the scaffold, taking upall available spaces by day 7, whereas the other MSC typesachieved confluence only at the end of the 28-day experimentalperiod (Fig. 3B). This was confirmed by an analysis of cellnumbers with a double-stranded DNA (dsDNA) quantificationmethod, showing a sharp increase during the first week ofculture in hfMSCs, undergoing a fourfold further increase be-tween day 4 and day 7 (Fig. 3C). Thereafter, levels plateaued inhfMSC constructs, in line with the FDA/PI results. In contrast,in other MSC scaffolds, there was a small drop in dsDNAquantity from day 1 to day 4, followed by a slow increase in thedsDNA amount, which finally plateaued on day 28. hfMSCsconsistently showed a higher dsDNA percentage than hUCMSCsand haMSCs from day 4 and hATMSCs from day 7 to day 28(p � .001); hATMSC dsDNA was higher than haMSC andhUCMSC dsDNA from day 7 to day 28 (p � .001), andhUCMSC dsDNA was higher than haMSC dsDNA from day 21onwards (p � .05; Fig. 3C).

hfMSC and haMSC Scaffolds Demonstrate HigherOsteogenic Differentiation Capacity than hUCMSCand hATMSC ScaffoldsWhen cultured in 3D, all four osteogenic genes were upregu-lated earlier (ALP) or more robustly (RunX2, COL1A1, andosteonectin) in hfMSC scaffolds than in the other MSC scaf-folds. haMSCs demonstrated earlier expression of osteonectinand higher expression of ALP than hUCMSCs and hATMSCs(Fig. 4).

Using serial light microscopy, crystalline deposits were seenappearing within the scaffolds, which were most abundant in thehfMSC scaffolds, followed by the haMSC, hUCMSC, andhATMSC scaffolds when exposed to osteogenic induction me-dium (day 19 analysis; Fig. 5A). In contrast, no crystallinedeposits were observed in MSC scaffolds cultured in controlmedium. The nature of these calcium crystals was confirmedthrough von Kossa staining, demonstrating the darkest stainingin hfMSC scaffolds followed by haMSC, hUCMSC, andhATMSC scaffolds, respectively (Fig. 5A).

Analysis through SEM of dehydrated scaffolds demon-strated a trabecular bone-like structure in all, with hfMSC scaf-folds having the most extensive trabecular network of ECM,followed by haMSC scaffolds and the other two scaffolds. Therewas a large number of nodules found within the ECM of hfMSCscaffolds but not the other MSC scaffolds, confirmed as calciumphosphate nodules through EDX analysis (Fig. 5B).

Next, micro-CT was used to quantify mineralization of thescaffolds, allowing assessment of the entire volume of theconstruct. hfMSC scaffolds resulted in a 3.9- to 17.6-fold highermineral content than the other scaffolds (p � .01), whereashaMSCs demonstrated a 4.1- and 4.5-fold higher mineral con-tent than hUCMSCs and hATMSCs, respectively (p � .05; Fig.5C). This finding was replicated by direct measurement of thecalcium content within scaffolds through dissolution of theminerals and quantification of calcium ions. From day 14 ofculture on, hfMSC scaffolds had a calcium content 1.6- to5.0-fold higher than the other constructs (p � .01), with haMSCsdemonstrating a 2.8- and 3.2-fold higher calcium content thanhUCMSCs and hATMSCs, respectively (p � .01; Fig. 5D).

hfMSC and haMSC Scaffolds Demonstrate MoreEctopic Bone Formation than hUCMSC andhATMSC Constructs After 2 months ofSubcutaneous ImplantationNext, subcutaneous implantation in immunodeficient NOD/SCID mice was performed to compare the osteogenic potential


of MSC scaffolds in vivo. Scaffolds were cultured for 2 weeksin vitro as osteogenic preinduction before implantation, andremoved after 2 months for analysis. All scaffolds demonstratedneovascularization, with blood vessels infiltrating the scaffoldsfrom the surrounding tissue macroscopically (data not shown).

In all constructs, human cells were detected in high numbers(60%–67% chimerism), as demonstrated by human-specific nu-clear stain (lamins A and C), with infiltration of murine cellsaccounting for one third of the cellular population within theinternal spaces of the scaffolds (Fig. 6A).

Figure 2. Comparison of proliferative and osteogenic potential of different MSCs in monolayer cultures. (A): hfMSCs demonstrated the fastestproliferation, followed by hUCMSCs, hATMSCs, and haMSC (p � .01). (B): CFU-F assay. hfMSCs had higher clonogenicity than the other MSCtypes; ** p � .01. (C): hfMSCs and hUCMSCs experienced much greater mineralization than the other MSC types, as shown by darker von Kossastaining, whereas in the control medium no mineralization was detected. (D): hfMSCs laid down a higher level of calcium than the other MSC types,and hUCMSCs deposited comparatively more calcium than haMSCs and hATMSCs; ** p � .01, * p � .05. (E): hfMSCs expressed fivefold higherALP activity than the other MSC types; ** p � .01. Abbreviations: ALP, alkaline phosphatase; CFU-F, colony-forming unit–fibroblast; haMSC,human adult bone marrow MSC; hATMSC, human adult adipose tissue MSC; hfMSC, human fetal bone marrow MSC; hUCMSCs, human umbilicalcord MSC; MSC, mesenchymal stem cell.


www.StemCells.com

Ectopic bone formation within constructs was evaluated usingboth traditional von Kossa histological staining and micro-CT. vonKossa staining demonstrated that hfMSC scaffolds had the largestmineralization area, followed by haMSC, hUCMSC, and hATMSCscaffolds (Fig. 6B, with H&E counterstain). Micro-CT quantifica-

tion of mineralization showed that hfMSC scaffolds generated thehighest bone volume (16.6 � 3.0 mm3; p � .01), followed byhaMSC scaffolds (9.1 � 1.1 mm3; p � .05), whereas hUCMSCand hATMSC scaffolds generated the lowest new bone volume(2.9 � 1.0 and 1.3 � 0.1 mm3, respectively).

Figure 3. Cellular adhesion, viability, andproliferation comparison in three-dimen-sional scaffold culture. (A): The PCL-TCPscaffold is laid down in a lattice formationthat is highly porous, as shown in this scan-ning electron micrograph image. (B): Thecellular viability of MSCs within the scaf-folds was demonstrated by staining withFDA (green), which is taken up by live cells,and PI (red), which is retained by dead cells,concurrently. All four types of MSC retainedhigh viability over 28 days, with hfMSCsachieving confluence within the scaffoldsand attaining a spindle-shaped morphologyat an earlier time point than the other MSCtypes. (C): This was confirmed by quantifi-cation of dsDNA content by picogreen as-say, showing the most rapid rise and highestamounts of dsDNA in the hfMSC constructs(p � .01). Abbreviations: FDA, fluoresceindiacetate; dsDNA, double-stranded DNA;haMSC, human adult bone marrow MSC;hATMSC, human adult adipose tissueMSC; hfMSC, human fetal bone mar-row MSC; hUCMSCs, human umbilicalcord MSC; MSC, mesenchymal stem cell;PCL-TCP, poly �-caprolactone–tricalciumphosphate; PI, propidium iodide.


DISCUSSION

Large bone defects are a major clinical problem and an area ofunmet need, with about one million cases requiring bone graft-ing in the U.S. annually [34, 42]. However, autologous grafts arenot available in up to 40% of patients [43], and there is thus apressing need for effective tissue-engineered solutions. Bonetissue engineering requires a porous biodegradable scaffold anda nonimmunogenic cellular source with osteogenic potential.The identification of various MSC types from different onto-logical and anatomical sites has raised the question as to theoptimal cellular source for such allogeneic applications. Here,we compared four well-characterized MSC types from differenttissues for their osteogenic potential for tissue engineering usinga battery of stringent tests in the same setting. Our key findingwas that hfMSCs are a superior cellular candidate not only dueto their primitiveness and expression of embryonic stem cellmarkers, lower HLA-I expression, and higher proliferative ca-pacities, but in particular because of their osteogenic potentialboth in vitro and in vivo for ectopic bone formation whencompared with hUCMSCs, haMSCs, and hATMSCs.

The MSC types here were subjected to identical isolationand culture conditions in the same laboratory, to better controlfor the inherent differences that characterize samples processedin different laboratories. They were fully characterized in excessof criteria laid down by the International Society for CellularTherapy [44], being fibroblastic in morphology, demonstratingclonogenicity, expressing various mesenchymal markers andadhesion molecules, lacking in hemopoietic and endothelialmarkers, and being capable of trilineage differentiation underpermissive conditions. The osteogenic potential of these MSCtypes was investigated both in standard monolayer cultures andafter loading onto an advanced generation bioactive scaffoldsuitable for clinical application, with results corroboratedthrough multiple proliferation assays (cell enumeration, CFU-Fcapacity, FDA/PI confocal imaging, dsDNA quantification),osteogenic induction (real-time RT-PCR of key osteogenicgenes and ALP activity), and ECM deposition (von Kossa

staining, quantitative calcium content, micro-CT quantification,and SEM/EDX analysis). We did not perform these experimentson clonal cultures because the heterogeneity between clonesmakes comparisons more variable, and their utility in the clinicis limited by the immense cost involved. Moreover, nonclonalcell cultures are more likely to be clinically relevant.

Only hfMSCs and hUCMSCs expressed the pluripotencymarkers Oct-4 and Nanog, which are essential factors for themaintenance of pluripotency and proliferative capacity in em-bryonic stem cells [45], reflecting their primitiveness. This may,in part, explain their higher proliferative potential and CFUcapacity compared with other sources, which confers advan-tages for rapid expansion and consequent downstream applica-tion. In addition to first trimester-derived hfMSCs [40], we havenow demonstrated that similar markers are expressed in secondtrimester BM-derived hfMSCs. Oct-4� and Nanog� MSCsfrom human umbilical cord veins have also been reported byKermani et al. [46], suggesting that these markers are an onto-logical rather than an anatomical feature. We did not find thesemarkers in adult MSC types, although Pochampally and co-workers showed that pluripotency markers can be induced inhaMSCs after a period of selection under serum deprivation[47].

hfMSCs had the lowest HLA-I expression, which forallogeneic applications should render them immunologicallyadvantageous over the other MSC types. Further advantagesinclude their lack of intracellular HLA class II and slowerupregulation in response to stimulation by �-interferon, aspreviously reported by Gotherstrom et al. [48 –50]. Already,in cellular transplantation, allogeneic fetal hfMSC transplan-tation in a clinical case of osteogenesis imperfecta (OI)resulted in chimerism of up to 7% in bone, with possibleclinical benefit [51], whereas intrauterine xenotransplanta-tion of hfMSCs in a murine model of OI resulted in similarchimerism rates, and amelioration of the phenotype withoutevidence of immune rejection [52].

Stro-1, which is a marker most commonly associated withthe osteogenic progenitor fraction found within MSC cultures[53, 54], is expressed highly in hfMSCs. This may, in part,

Figure 4. Osteogenic gene expression ofdifferent MSCs cultured in 3D scaffolds.Quantitative analysis of key osteogenicgenes (ALP; Collagen 1A1; osteonectin;RunX2) of MSCs cultured in 3D scaffoldsdemonstrated either higher and/or earlier up-regulation in hfMSC scaffold-constructsthan the other constructs by quantitative RT-PCR. Abbreviations: 3D, three-dimensional;ALP, alkaline phosphatase; haMSC, humanadult bone marrow MSC; hATMSC, hu-man adult adipose tissue MSC; hfMSC, hu-man fetal bone marrow MSC; hUCMSCs,human umbilical cord MSC; MSC, mesen-chymal stem cell; RT-PCR, reverse tran-scription-polymerase chain reaction.


www.StemCells.com

explain their observed superior osteogenicity in monolayer and3D scaffold cultures and in vivo ectopic bone formation over theother MSC types.

Our observation that ontogeny is an important determi-nant for proliferative and osteogenic capacity mirror thefindings of Kim et al. [55] of a diminishing capacity fromfetal through neonatal, infant, and juvenile BM-derived rhe-sus macaque MSCs, although they did not examine adult BM.More recently, Guillot et al. [56] demonstrated that firsttrimester hfMSC sources had higher expression levels ofosteogenic genes, both basally and during osteogenic induc-tion, than haMSCs in both in vitro and in vivo paradigms. Acomparison of hUCMSCs and haMSCs by Baksh et al. [57]concurs with our findings that hUCMSCs have a higher

proliferative and osteogenic differentiation capacity thanhaMSCs in 2D cultures, which suggests that ontogeny mayplay a bigger role than the anatomical origins of MSCs.Conversely, in 3D scaffold culture both in vitro and in vivo,haMSCs produced higher proliferation rates and more robustosteogenic differentiation. Although the reason for this dis-parity between 2D and 3D behavior for proliferation andosteogenic differentiation in haMSCs and hUCMSCs is un-known, we speculate that haMSCs may respond differently tocues associated with the adoption of a more native morphol-ogy and multidimensional cell– cell signaling processes [58 –60].

We find that the anatomical origin of cultured expandedMSCs influences their osteogenic potential, with BM-derived

Figure 5. Mineralization of different MSCs within scaffold constructs. (A): Mineralization of the cellular scaffolds after 19 days of osteogenicinduction resulted in deposition of opaque crystals within the scaffolds, more obviously in the hfMSC and haMSC scaffolds (light microscopy,40–400�), which was confirmed through von Kossa staining (calcium crystals staining black). Cellular scaffolds grown in normal growth mediumdid not result in mineralization (control). (B): Scanning electron microscopy showed trabecular-like networks within the cellular-scaffold constructs,with nodular deposits found only on the hfMSC scaffolds and not the others (magnification, 1–5,000�); such nodules were shown to be calciumphosphate via EDX elemental analysis. (C): Quantification of mineral content through micro-CT analysis showed a higher mineral volume in hfMSCsthan in the other MSC types, and in haMSCs compared with hUCMSCs and hATMSCs (n � 4, threshold � 200; ** p � .01, * p � .05). (D): Thiswas confirmed through direct measurement of the calcium content within the scaffold (** p � .01). Abbreviations: 3D, three-dimensional; ALP,alkaline phosphatase; Ctrl M, control medium; EDX, energy dispersive x-ray; haMSC, human adult bone marrow MSC; hATMSC, human adultadipose tissue MSC; hfMSC, human fetal bone marrow MSC; hUCMSCs, human umbilical cord MSC; micro-CT, micro-computed tomography;MSC, mesenchymal stem cell; OM, osteogenic medium.


hfMSCs and haMSCs performing better than MSCs derivedfrom the umbilical cord and adipose tissues. This is in agree-ment with the findings of Im et al. [61] and Liu et al. [62] thathATMSCs have higher adipogenic but less osteogenic andchondrogenic potential than haMSCs, which has a role in pro-ducing bone and cartilage tissues in the bone marrow. Geneexpression studies support this anatomical relationship to theosteogenic potential of each MSC source, with Panepucci et al.[63] demonstrating that haMSCs are more committed to osteo-genesis, whereas hUCMSCs are more committed to angiogen-esis, in keeping with their anatomical site of origin, and Guillotet al. [56] showing higher osteogenic gene expression in firsttrimester fetal BM-derived hfMSCs than in fetal blood and fetalliver hfMSCs.

We chose a panel of genes that are known to be upregulatedin early (osteonectin and RunX2), intermediate (ALP), and late(COL1A1) stages of osteogenesis, and demonstrated that hfMSCscaffolds undergo earlier and more robust upregulation, mirror-ing their phenotypic performance in mineralization.

Scaffolds offer a 3D framework in which a temporarymatrix for cellular proliferation, differentiation, and deposi-tion of ECM allows neovasculature to develop [34, 64]. We

used a bioactive PCL-TCP scaffold of high porosity to dem-onstrate their biocompatibility, with high cellular viability inall four MSC types after 4 weeks of in vitro culture, and 2months on in vivo scaffolds. In addition, it allowed thedeposition of trabecular bone-like ECM and calcium phos-phate nodules in vitro, and ectopic bone formation within anin vivo environment.

In conclusion, the ontological and anatomical origins ofMSCs have a profound influence on their proliferation anddifferentiation capacities, and hence affect their performance ascellular sources for bone tissue engineering. hfMSCs are thebest cellular candidate, compared with hUCMSCs, haMSCs,and hATMSCs, because they express pluripotency markers andhave lower immunogenicity and greater proliferative capacity.In addition, when cultured in osteogenic conditions, hfMSCsexhibited the most robust osteogenic gene induction, extracel-lular mineralization, and in vivo ectopic bone formation. Ourdata here support the use of hfMSCs as a superior allogeneiccellular source over the other MSC types for bone tissue-engineering applications. Transplantation of these cellular scaf-fold constructs into preclinical critical-sized femoral defectmodels is currently underway.

Figure 6. In vivo ectopic bone formation ofdifferent MSC cellular-scaffold constructs 2months after subcutaneous implantation in aNOD/SCID mouse. (A): Analysis of im-planted cellular-scaffold constructs demon-strated high levels of cellular viability andchimerism (60%–67%) within the interior ofthe scaffolds through staining for human nu-clei (lamins A and C, green) and counter-staining with propidium iodide (red) for allnuclei, with the dark voids being the scaf-folds (S). (B): von Kossa staining of repre-sentative sections with H&E counterstainingdemonstrated a larger area of mineralization(black) in hfMSC and haMSC cellular-scaf-fold constructs than in the other cellular-scaffold constructs. Scale bar: 30 �m. (C):Micro-CT analysis of ectopic bone forma-tion through 3D quantitative bone volumemeasurement demonstrated that hfMSC cel-lular-scaffold constructs resulted in the mostbone formation, followed by the haMSC,hUCMSC, and hATMSC cellular-scaffoldconstructs (n � 3, threshold � 200; ** p �.01, * p � .05). Abbreviations: 3D, three-dimensional; H&E, hematoxylin and eo-sin; haMSC, human adult bone marrowMSC; hATMSC, human adult adipose tis-sue MSC; hfMSC, human fetal bone mar-row MSC; hUCMSCs, human umbilicalcord MSC; micro-CT, micro-computed to-mography; MSC, mesenchymal stem cell;NOD/SCID, nonobese diabetic/severecombined immunodeficient.


www.StemCells.com

ACKNOWLEDGMENTS

We acknowledge the following people for their kind assistancewith this project: Lay Geok Tan, Praveen Vijayakumar, YipingFan, and Sherry Ho from the Department of Obstetrics &Gynaecology; Eddy Lee, Bina Rai, and Fenghao Chen from theGraduate Programme in Bioengineering; Erin Teo from thedepartment of Mechanical Engineering; and Lam Xu Fu andEvelyn Susanto from the Tissue Engineering lab, National Uni-versity of Singapore. We thank Citra Mattar for reviewing thismanuscript. Some of the materials employed in this work wereprovided by the Tulane Center for Gene Therapy through a grantfrom NCRR of the NIH, Grant # P40RR017447.

This work is supported by grants from the National MedicalResearch Council (NMRC/0974/2005), the Cross Faculty Grantof NUS, Grant # R-174-000-107-123, and National HealthcareGroup SIG Grant 06013 and Grant 08031, and funding from theClinician Scientist Unit, NLAM, NUS. J.C. received salarysupport from an Exxon-Mobil-NUS Fellowship.

DISCLOSURE OF POTENTIAL CONFLICTS

OF INTEREST

Swee-Hin Teoh owned stock in and served as an officer ormember of the board for Osteopore International.

REFERENCES

1 Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential ofadult human mesenchymal stem cells. Science 1999;284:143–147.

2 Porada CD, Zanjani ED, Almeida-Porad G. Adult mesenchymal stemcells: A pluripotent population with multiple applications. Curr StemCell Res Ther 2006;1:365–369.

3 Pountos I, Corscadden D, Emery P et al. Mesenchymal stem cell tissueengineering: Techniques for isolation, expansion and application. Injury2007;38(suppl 4):S23–S33.

4 Le Blanc K, Pittenger M. Mesenchymal stem cells: Progress towardpromise. Cytotherapy 2005;7:36–45.

5 Qi H, Aguiar DJ, Williams SM et al. Identification of genes responsiblefor osteoblast differentiation from human mesodermal progenitor cells.Proc Natl Acad Sci U S A 2003;100:3305–3310.

6 Frank O, Heim M, Jakob M et al. Real-time quantitative RT-PCRanalysis of human bone marrow stromal cells during osteogenic differ-entiation in vitro. J Cell Biochem 2002;85:737–746.

7 Bruder SP, Jaiswal N, Haynesworth SE. Growth kinetics, self-renewal,and the osteogenic potential of purified human mesenchymal stem cellsduring extensive subcultivation and following cryopreservation. J CellBiochem 1997;64:278–294.

8 Di Nicola M, Carlo-Stella C, Magni M et al. Human bone marrowstromal cells suppress T-lymphocyte proliferation induced by cellular ornonspecific mitogenic stimuli. Blood 2002;99:3838–3843.

9 Krampera M, Glennie S, Dyson J et al. Bone marrow mesenchymal stemcells inhibit the response of naive and memory antigen-specific T cells totheir cognate peptide. Blood 2003;101:3722–3729.

10 Tse WT, Pendleton JD, Beyer WM et al. Suppression of allogeneic T-cellproliferation by human marrow stromal cells: Implications in transplan-tation. Transplantation 2003;75:389–397.

11 Horwitz EM, Gordon PL, Koo WK et al. Isolated allogeneic bonemarrow-derived mesenchymal cells engraft and stimulate growth inchildren with osteogenesis imperfecta: Implications for cell therapy ofbone. Proc Natl Acad Sci U S A 2002;99:8932–8937.

12 Koc ON, Day J, Nieder M et al. Allogeneic mesenchymal stem cellinfusion for treatment of metachromatic leukodystrophy (MLD) andHurler syndrome (MPS-IH). Bone Marrow Transplant 2002;30:215–222.

13 Caplan AI. Adult mesenchymal stem cells for tissue engineering versusregenerative medicine. J Cell Physiol 2007;213:341–347.

14 Mauney JR, Volloch V, Kaplan DL. Role of adult mesenchymal stemcells in bone tissue engineering applications: Current status and futureprospects. Tissue Eng 2005;11:787–802.

15 Niemeyer P, Krause U, Kasten P et al. Mesenchymal stem cell-basedHLA-independent cell therapy for tissue engineering of bone and carti-lage. Curr Stem Cell Res Ther 2006;1:21–27.

16 Cowan CM, Shi YY, Aalami OO et al. Adipose-derived adult stromalcells heal critical-size mouse calvarial defects. Nat Biotechnol 2004;22:560–567.

17 Meinel L, Betz O, Fajardo R et al. Silk based biomaterials to heal criticalsized femur defects. Bone 2006;39:922–931.

18 Petite H, Viateau V, Bensaid W et al. Tissue-engineered bone regener-ation. Nat Biotechnol 2000;18:959–963.

19 Phinney DG, Kopen G, Righter W et al. Donor variation in the growthproperties and osteogenic potential of human marrow stromal cells.J Cell Biochem 1999;75:424–436.

20 Mendes SC, Tibbe JM, Veenhof M et al. Bone tissue-engineered im-plants using human bone marrow stromal cells: Effect of culture condi-tions and donor age. Tissue Eng 2002;8:911–920.

21 Mueller SM, Glowacki J. Age-related decline in the osteogenic potential

of human bone marrow cells cultured in three-dimensional collagensponges. J Cell Biochem 2001;82:583–590.

22 D’Ippolito G, Schiller PC, Ricordi C et al. Age-related osteogenicpotential of mesenchymal stromal stem cells from human vertebral bonemarrow. J Bone Miner Res 1999;14:1115–1122.

23 Zuk PA, Zhu M, Mizuno H et al. Multilineage cells from human adiposetissue: Implications for cell-based therapies. Tissue Eng 2001;7:211–228.

24 Sarugaser R, Lickorish D, Baksh D et al. Human umbilical cord perivas-cular (HUCPV) cells: A source of mesenchymal progenitors. STEMCELLS 2005;23:220–229.

25 Bieback K, Kern S, Kluter H et al. Critical parameters for the isolationof mesenchymal stem cells from umbilical cord blood. STEM CELLS2004;22:625–634.

26 Lee OK, Kuo TK, Chen W-M et al. Isolation of multipotent mesenchy-mal stem cells from umbilical cord blood. Blood 2004;103:1669–1675.

27 De Coppi P, Bartsch G Jr, Siddiqui MM et al. Isolation of amniotic stemcell lines with potential for therapy. Nat Biotechnol 2007;25:100–106.

28 In ’t Anker PS, Scherjon SA, Kleijburg-van der Keur C et al. Amnioticfluid as a novel source of mesenchymal stem cells for therapeutictransplantation. Blood 2003;102:1548–1549.

29 Campagnoli C, Roberts IA, Kumar S et al. Identification of mesenchymalstem/progenitor cells in human first-trimester fetal blood, liver, and bonemarrow. Blood 2001;98:2396–2402.

30 Chan J, O’Donoghue K, de la Fuente J et al. Human fetal mesenchymalstem cells as vehicles for gene delivery. STEM CELLS 2005;23:93–102.

31 Chan J, O’Donoghue K, Gavina M et al. Galectin-1 induces skeletalmuscle differentiation in human fetal mesenchymal stem cells and in-creases muscle regeneration. STEM CELLS 2006;24:1879–1891.

32 Chan J, Waddington SN, O’Donoghue K et al. Widespread distributionand muscle differentiation of human fetal mesenchymal stem cells afterintrauterine transplantation in dystrophic mdx mouse. STEM CELLS2007;25:875–884.

33 Langer R, Vacanti JP. Tissue engineering. Science 1993;260:920–926.34 Salgado AJ, Coutinho OP, Reis RL. Bone tissue engineering: State of the

art and future trends. Macromol Biosci 2004;4:743–765.35 LeGeros RZ. Properties of osteoconductive biomaterials: Calcium phos-

phates. Clin Orthop Relat Res 2002:81–98.36 Rai B, Teoh SH, Hutmacher DW et al. Novel PCL-based honeycomb

scaffolds as drug delivery systems for rhBMP-2. Biomaterials 2005;26:3739–3748.

37 Hutmacher DW, Schantz T, Zein I et al. Mechanical properties and cellcultural response of polycaprolactone scaffolds designed and fabricatedvia fused deposition modeling. J Biomed Mater Res 2001;55:203–216.

38 Polkinghorne J. Review of the Guidance on the Research Use of Fetusesand Fetal Material. CM 762. London: HMSO, 1989.

39 Gronthos S, Franklin DM, Leddy HA et al. Surface protein character-ization of human adipose tissue-derived stromal cells. J Cell Physiol2001;189:54–63.

40 Guillot PV, Gotherstrom C, Chan J et al. Human first-trimester fetalMSC express pluripotency markers and grow faster and have longertelomeres than adult MSC. STEM CELLS 2007;25:646–654.

41 Rai B, Teoh SH, Ho KH et al. The effect of rhBMP-2 on canineosteoblasts seeded onto 3D bioactive polycaprolactone scaffolds. Bio-materials 2004;25:5499–5506.

42 Bongso A. Stem Cells: From Bench to Bedside. Hackensack, NJ: WorldScientific, 2005:442.

43 Boyce T, Edwards J, Scarborough N. Allograft bone. The influence ofprocessing on safety and performance. Orthop Clin North Am 1999;30:571–581.

44 Dominici M, Le Blanc K, Mueller I et al. Minimal criteria for definingmultipotent mesenchymal stromal cells. The International Society forCellular Therapy position statement. Cytotherapy 2006;8:315–317.

45 Loh YH, Wu Q, Chew JL et al. The Oct4 and Nanog transcription


network regulates pluripotency in mouse embryonic stem cells. NatGenet 2006;38:431–440.

46 Kermani AJ, Fathi F, Mowla SJ. Characterization and genetic manip-ulation of human umbilical cord vein mesenchymal stem cells: Po-tential application in cell-based gene therapy. Rejuvenation Res 2008;11:379 –386.

47 Pochampally RR, Smith JR, Ylostalo J et al. Serum deprivation of humanmarrow stromal cells (hMSCs) selects for a subpopulation of earlyprogenitor cells with enhanced expression of OCT-4 and other embry-onic genes. Blood 2004;103:1647–1652.

48 Gotherstrom C. Immunomodulation by multipotent mesenchymal stro-mal cells. Transplantation 2007;84(1 suppl):S35–S37.

49 Gotherstrom C, Ringden O, Tammik C et al. Immunologic properties ofhuman fetal mesenchymal stem cells. Am J Obstet Gynecol 2004;190:239–245.

50 Gotherstrom C, Ringden O, Westgren M et al. Immunomodulatoryeffects of human foetal liver-derived mesenchymal stem cells. BoneMarrow Transplant 2003;32:265–272.

51 Le Blanc K, Gotherstrom C, Ringden O et al. Fetal mesenchymalstem-cell engraftment in bone after in utero transplantation in a patientwith severe osteogenesis imperfecta. Transplantation 2005;79:1607–1614.

52 Guillot PV, Abass O, Bassett JH et al. Intrauterine transplantation ofhuman fetal mesenchymal stem cells from first-trimester blood repairsbone and reduces fractures in osteogenesis imperfecta mice. Blood2008;111:1717–1725.

53 Gronthos S, Graves SE, Ohta S et al. The STRO-1� fraction of adulthuman bone marrow contains the osteogenic precursors. Blood 1994;84:4164–4173.

54 Simmons PJ, Torok-Storb B. Identification of stromal cell precursors in

human bone marrow by a novel monoclonal antibody, STRO-1. Blood1991;78:55–62.

55 Kim BS, Lee CC, Christensen JE et al. Growth, differentiation, andbiochemical signatures of rhesus monkey mesenchymal stem cells. StemCells Dev 2008;17:185–198.

56 Guillot PV, De Bari C, Dell’accio F et al. Comparative osteogenictranscription profiling of various fetal and adult mesenchymal stem cellsources. Differentiation 2008; Jun 13 [Epub ahead of print].

57 Baksh D, Yao R, Tuan RS. Comparison of proliferative and multilineagedifferentiation potential of human mesenchymal stem cells derived fromumbilical cord and bone marrow. STEM CELLS 2007;25:1384–1392.

58 Abbott A. Cell culture: Biology’s new dimension. Nature 2003;424:870 – 872.

59 Cukierman E, Pankov R, Stevens DR et al. Taking cell-matrix adhesionsto the third dimension. Science 2001;294:1708–1712.

60 Grayson WL, Zhao F, Izadpanah R et al. Effects of hypoxia on humanmesenchymal stem cell expansion and plasticity in 3D constructs. J CellPhysiol 2006;207:331–339.

61 Im GI, Shin YW, Lee KB. Do adipose tissue-derived mesenchymal stemcells have the same osteogenic and chondrogenic potential as bonemarrow-derived cells? Osteoarthritis Cartilage 2005;13:845–853.

62 Liu TM, Martina M, Hutmacher DW et al. Identification of commonpathways mediating differentiation of bone marrow- and adipose tissue-derived human mesenchymal stem cells into three mesenchymal lin-eages. STEM CELLS 2007;25:750–760.

63 Panepucci RA, Siufi JL, Silva WA Jr et al. Comparison of gene expres-sion of umbilical cord vein and bone marrow-derived mesenchymal stemcells. STEM CELLS 2004;22:1263–1278.

64 Rai B, Oest ME, Dupont KM et al. Combination of platelet-rich plasmawith polycaprolactone-tricalcium phosphate scaffolds for segmental bonedefect repair. J Biomed Mater Res A 2007;81:888–899.

See www.StemCells.com for supporting information available online.


www.StemCells.com

superior osteogenic capacity for bone tissue engineering of fetal compared with perinatal and adult...

Documents