Salmonella enterica Serotype Choleraesuis: Epidemiology, Pathogenesis, Clinical Disease, and Treatment†

Cheng-Hsun Chiu,1,* Lin-Hui Su,2 and Chishih Chu3

Author information ► Copyright and License information ►

This article has been cited by other articles in PMC.

ABSTRACT

Nontyphoid Salmonella strains are important causes of reportable food-borne infection. Among more than 2,000 serotypes, Salmonella enterica serotype Choleraesuis shows the highest predilection to cause systemic infections in humans. The most feared complication of serotype Cholearesuis bacteremia in adults is the development of mycotic aneurysm, which previously was almost uniformally fatal. The advances in diagnostic techniques, surgical care, and antimicrobial therapy have greatly improved the survival of these patients. However, the recent emergence of serotype Choleraesuis that is resistant to ampicillin, chloramphenicol, trimethoprim-sulfamethoxazole, and, notably, fluoroquinolone antibiotics has aroused concern about the use of these agents for the empirical treatment of systemic infection caused by this organism. In view of the serious implications of the situation, the chain of transmission and mechanism of resistance should be carefully studied to reduce the spread of infection and threat to human health. To date, there are no vaccines available to prevent serotype Choleraesuis infections in humans. The availability, in the near future, of the genome sequence of serotype Cholearesuis will facilitate the development of effective vaccines as well as the discovery of new targets for novel antimicrobial agents.

Go to:

INTRODUCTION

Salmonella infection of humans and animals continues to be a distressing health problem worldwide. Salmonella is a genus of the family Enterobacteriaceae (51). Before 1983, the existence of multiple Salmonella species was taxonomically accepted. Since then, as a result of experiments indicating a high degree of DNA similarity, all Salmonella isolates were classified in a single species, Salmonella choleraesuis (42, 51, 135). This species was subsequently subclassified into seven subgroups based on DNA similarity and host range (51, 135). Subgroup I contains almost all the serotypes pathogenic for humans (110, 111, 141).

In 1999, Euzéby proposed to designate “Salmonella enterica” as a “neotype species” and replace type species of the genus Salmonella from S. choleraesuis to S. enterica (49), because the name S. choleraesuis can lead to confusion since the specific epithet is also the name of a serotype (or serovar).

Although this new system of nomenclature has not formally been adopted by the International Committee of Systematic Bacteriology, it has been accepted for use by the World Health Organization and in publications of the American Society for Microbiology. In this review, we write “S. enterica serotype Choleraesuis” or “serotype Choleraesuis” rather than “S. cholearesuis” to designate a specific serotype for the purpose of continuity with the literature.

The antigenic classification or serotyping of Salmonella used today is a result of extensive studies of antibody interactions with bacterial surface antigens by Kauffman and White (85). Three kinds of surface antigens, somatic O antigens, flagellar H antigens, and Vi, determine the reactions of the organisms to specific antisera (85). Specific serotypes were defined as a result of complex antigen variability. This resulted in the identification of over 2,000 Salmonella serotypes, most of which were named for the cities where they were defined (85, 97, 110, 111). Although extensive serotyping of all surface antigens can be used for formal identification, most clinical microbiological laboratories perform a few simple agglutination reactions to define specific O antigens into serogroups, designated groups A, B, C1, C2, D, and E (51). This grouping system is useful in epidemiologic studies and can be used clinically to confirm genus identification; however, it cannot quickly identify whether the organism is likely to cause enteric fever, because considerable cross-reactivity among serogroups occurs. For example, serotype Infantis, which typically causes gastroenteritis, and serotype Choleraesuis, a prominent cause of invasive infections, are both group C1. Similarly, serotype Enteritidis, another common cause of gastroenteritis, and serotype Typhi, which causes enteric fever, are both group D.

Among more than 2,000 serotypes, some, such as serotypes Typhi and Paratyphi, are highly adapted to humans and have no other known natural hosts (51, 141). Others, such as serotypes Typhimurium and Enteritidis, have a broad host range and can infect a wide variety of animals (122). Some, such as serotype Choleraesuis (swine) (52, 123, 154), serotype Dublin (cattle) (50), and serotype Arizonae (reptiles) (18, 151), are most highly adapted to a specific animal species but occasionally infect humans. These nontyphoid Salmonella serotypes can cause protean manifestations in humans, including acute gastroenteritis, bacteremia, and extraintestinal localized infections involving many organs.

Serotype Choleraesuis is a host-adapted pathogen that causes swine paratyphoid (52, 154). It is also highly pathogenic to humans, usually causing septicemic disease with little involvement of the intestinal tract (19, 39). The resulting serotype Choleraesuis reservoir in swine is a concern, not only because of its disease-causing potential in young pigs but also because of its public health implications for humans (19, 35, 154). Although Salmonella is one of the most extensively studied bacterial species in terms of its physiology, genetics, cell structure, development, and host immune response, we are only just beginning to understand at the cellular and molecular levels how serotype Choleraesuis causes invasive infections in humans. This review discusses what is currently known about serotype Choleraesuis.

Specific topics discussed include its epidemiology, pathogenesis, genetics, clinical perspectives, treatment, antimicrobial resistance, and vaccines.

Go to:

EPIDEMIOLOGY

In many countries the incidence of human Salmonella infection has increased markedly over the years. In the United States, nontyphoid Salmonella serotypes affect approximately 2 million to 3 million persons and cause 500 to 2000 deaths each year (5). In 2000, the two most common serotypes isolated from human sources were S. enterica serotype Typhimurium and S. enterica serotype Enteritidis (Table (Table1)1) (24). S. enterica serotype Choleraesuis, including var. Kunzendorf, ranked lower than 20th in causing human infections among nontyphoid Salmonella strains (24). The annual number of serotype Choleraesuis infections of humans reported to the Centers for Disease Control and Prevention was approximately 80 in 1990 to 1996. The figure decreased gradually thereafter, with an annual number of 49 in 1997, 36 in 1998, 34 in 1999, and 15 in 2000 (24). Serotype Choleraesuis is also an infrequent serotype isolated from human sources in Canada and the United Kingdom (11, 88). However, the epidemiological pattern differed greatly in Asian countries. In Thailand, during 1988 to 1993, serotype Choleraesuis was the 10th most common serotype that caused salmonellosis in humans (8). This highly invasive serotype is of particular concern in Taiwan, since among the common Salmonella serotypes isolated from human sources, it was ranked the second in two independent epidemiological surveys (Table (Table1)1) (30, 32). A hospital-based surveillance study demonstrated that the average annual number of serotype Choleraesuis infections during 1987 to 2000 was 35 in a 3,500-bed medical center in northern Taiwan (35, 137). The proportion of total Salmonella isolates accounted for by serotype Choleraesuis was stable before 1995; however, it decreased from an average of 8.4 to 2.7% in 1996 through 1998 (35, 137). During 1999 to 2000, this proportion increased to an average of 5% (35, 137). The transient decline in 1996 to 1998 was attributed to an outbreak of foot-and-mouth disease in swine, which resulted in an island-wide slaughter of the pigs (35). The study also demonstrated that most of the serotype Choleraesuis isolates from humans and swine exhibited the same or similar DNA fingerprints, indicating that human infections were acquired from pigs (35). We reasoned that the cross-infection arises as a result of contamination of the food or water source by the organism. It is also speculated that the habit of eating pig offal by the local population significantly contributes to the high prevalence of serotype Choleraesuis infection in the locality.

TABLE 1.

TABLE 1.

The 10 most frequently isolated Salmonella serotypes from human sources in the United States and Taiwana

Serotype Choleraesuis is the serotype most frequently isolated from swine; it is rarely isolated from nonporcine reservoirs (24). It causes swine paratyphoid, with clinical manifestations of enterocolitis and septicemia (52, 154). The source of serotype Choleraesuis appears to be limited to carrier pigs and facilities previously contaminated with this serotype (65, 68). The carrier state of serotype Choleraesuis in swine after experimental infection has been described previously (68). Pigs infected with serotype Choleraesuis usually exhibit clinical signs between 36 and 48 h after infection and shed 103 to 106 CFU of bacteria per g of feces during peak clinical disease (66, 116, 130). Most of the naturally exposed pigs, after recovering from the disease, were able to clear serotype Choleraesuis between 9 to 12 weeks postinfection, indicating that long-term carrier status is an uncommon event (68). Nevertheless, serotype Choleraesuis is able to survive and remain infective in the environment. Shedding of the organism by infected animals can result in long-term environmental contamination and continued reinfection of animals newly introduced in the farms. Furthermore, contaminated environment, food, or water sources can serve as a reservoir for serotype Choleraesuis infection of humans.

In direct contrast to the decrease seen in human infections in the United States, isolations of serotype Choleraesuis from nonhuman clinical sources have increased significantly in recent years (24, 125). The appearance of the porcine reproductive and respiratory syndrome virus (PRRSV), since 1987 has been suggested as one factor that might have contributed to the recent surge of serotype Choleraesuis infections in the United States (125). Serotype Choleraesuis is a highly swine-adapted organism, which can lie dormant in herds until activated by one of several possible stressors. Many secondary diseases, including paratyphoid due to serotype Choleraesuis, have plagued swine herds after a PRRSV outbreak (155). A carrier state of as long as 12 weeks was demonstrated in pigs infected with serotype Choleraesuis (68). The secondary diseases are thought to be exacerbations of quiescent or subclinical serotype Choleraesuis infections already present in the herds prior to the PRRSV infection; alternatively, subclinically infected pigs may serve as the source of new serotype Choleraesuis infection in repopulated pigs following a PRRSV outbreak (155).

Go to:

PATHOGENESIS

There have been relatively few investigations of serotype Choleraesuis compared to other Salmonella serotypes, such as serotype Typhimurium, in terms of bacterial pathogenesis. Although the infection is associated with a high mortality rate, publications to date on serotype Choleraesuis account for only a small percentage of published studies of Salmonella infections. In contrast, considerable work has been described for serotype Typhimurium (4, 28, 44, 53, 56, 59, 83, 91, 93, 95, 101, 108, 115, 139). As a result, we now have a fairly comprehensive understanding of the dominant host defense and protective mechanisms against nontyphoid Salmonella infection.

Host Defense

There have been only a few studies that specifically examined host defenses against serotype Choleraesuis. Serotype Choleraesuis is highly host adapted to pigs (52, 154). A pig model of experimental and natural infection of weaning pigs with serotype Choleraesuis has been developed (6). In this model, infection by oral inoculation of 108 CFU of serotype Choleraesuis was established, as indicated by an acute illness as well as by recovery of the organism from ileocolic lymph nodes collected at necropsy 7 days postchallenge (6). Serotype Choleraesuis appears to colonize and invade the intestinal epithelium, disseminate to peripheral organs, and cause septicemia in pigs, as does serotype Typhimurium in mice (6, 44, 116). As with serotype Typhimurium, histologically serotype Choleraesuis revealed a predilection for the mucosa of the colon and the luminal surface of ileal M cells of Peyer's patches (113). The invasive capacity of serotype Choleraesuis was also demonstrated by the presence of large numbers of labeled organisms in macrophages in the enteric mucosa as well as in the related lymph nodes (113). Genetically, a cluster of genes controlling the ability of serotype Typhimurium to invade cells in culture and cells lining the intestinal tract of mice has been identified (59). Serotype Choleraesuis also contains the inv genes encoding all the invasion functions; however, results of experiments involving knocking out these genes in regard to cell invasion have given ambiguous results (60). In line with this, Finlay et al., who had generated an extensive collection of serotype Choleraesuis mutants which had been screened for cell infectivity, never found any mutant with specific invasion defects (54). This indicates that serotype Choleraesuis might possess a unique means, not exhibited by serotype Typhimurium, of being invasive.

The immune response to serotype Choleraesuis was also investigated by using a swine or mouse challenge model. Both cellular and humoral immune activation occur after oral inoculation (67). Antibody response to both lipopolysaccharide and outer membrane protein antigens in pigs following an oral challenge of 108 CFU of serotype Choleraesuis has been documented (133). Such doses also result in the development of a long-term carrier state in pigs (66, 133). The carrier state existed despite the presence of antibody and a measurable cellular response to serotype Choleraesuis antigens (66, 133). It was suggested that the immune system of pigs may be overwhelmed by a challenge with such a large dose of bacteria (66). At moderate doses, between 103 and 107 CFU, antigen stimulation of lymphocytes was optimal and mitogenic responses remained normal (66). Cellular immunity is thought to be essential to overcome infections with facultatively intracellular pathogens such as Salmonella. This concept was described by Mackaness and colleagues who first established the relationship between infection with intracellular pathogens of macrophages and induction of the host response that was mediated by activation of macrophages by T cells and their secreted products (94). We now know that the T cells involved in this pathway are of the T-helper 1 (Th1) phenotype and that gamma interferon (IFN-γ) is the T-cell product that is primarily responsible for macrophage activation (103). There have been only a few animal or in vitro studies that provide some indication of the importance of cellular immunity in host defense against serotype Choleraesuis. Foss et al. demonstrated that both in vivo and ex vivo infection

of the intestinal mucosa with serotype Choleraesuis resulted in a decrease in the amount of interleukin-18 (IL-18), which is consistent with cleavage of the preprotein by caspase-1 (55). IL-18 is a cytokine that has structural and functional similarities to IL-12; it induces the secretion of IFN-γ and was originally identified in mice as an IFN-γ-producing factor. This suggests that the caspase-1 activation of IL-18 may be an important step in mucosal immunity to serotype Choleraesuis infection. The role of another cytokine, IL-15, in protection against serotype Choleraesuis was also investigated by Hirose and colleagues using mice depleted of IL-15 by administration of anti-IL-15 antibody (80). The results indicated that IL-15 may be involved in protection at early stages of infection through activation of NK cells at infected sites (80). Furthermore, the use of mice deficient in γδ T cells showed that these cells play an important role in the pathogenesis of lethal infection with serotype Choleraesuis (47, 48). Excessive tumor necrosis factor alpha production, which is often detrimental in the pathogenesis of gram-negative bacterial infection, is not evident in γδ T-cell-deficient mice after infection, and this phenomenon may be at least partly ascribed to the resistance of such mice to lethal serotype Choleraesuis infection (48). Interestingly, most of the studies mentioned above were performed using avirulent strains of a serotype Choleraesuis. These strains were cured of a 50-kb virulence plasmid (pSCV) and had high 50% lethal doses for mice. Hence, it was postulated that a plasmid-borne virulence factor may impair the cellular immune response to serotype Choleraesuis; on the other hand, cytokines in the Th1 pathway had an important function in protection against infection with plasmidless, avirulent strains of serotype Choleraesuis accompanied by increases in NK-cell and IFN-γ production. The plasmid-associated immunosuppression may have important implications in the development of a vaccine to prevent serotype Choleraesuis infection in farm pigs.

The nature of the interaction of various Salmonella serotypes with porcine macrophages was studied using pigs as the infection model (7, 152). Serotype Choleraesuis can survive, multiply, and even establish bacteremia after being ingested by macrophages (7). Persistence of Salmonella organisms within porcine macrophages seems not to directly correlate with their virulence to pigs. In other words, serotype Choleraesuis is highly virulent to pigs but persists in smaller numbers than does serotype Typhimurium. This appears to support a recent observation that the serotype-host specificity of serotype Choleraesuis does not correlate with invasion of the porcine intestinal mucosa (20). The interaction of serotype Choleraesuis with porcine polymorphnuclear leukocytes (PPMN) has been well characterized in vitro. PPMN readily killed either virulent or avirulent serotype Choleraesuis strains; however, the virulent serotype Choleraesuis strains survived PPMN killing more effectively than did the avirulent ones (121). Interestingly, the functions of PPMN were markedly suppressed in the presence of virulent and avirulent serotype Choleraesuis strains (121). Both strains appeared to have similar capabilities to either prevent degranulation or inhibit H2O2 production (121); however, only the virulent serotype Choleraesuis strain significantly reduced ingestion of Staphylococcus aureus by PPMN (121). The exact mechanisms behind these observations remain unclear.

Bacterial Genetics

In an analysis of Salmonella genomes by microarray techniques using the genome of serotype Typhimurium LT2 as a standard, approximately 90% of the annotated LT2 open reading frames (ORFs) were homologous among members of all seven subgroups (112). Comparative genomic analysis of serotypes Typhimurium and Typhi (full genome sequences), and serotypes Dublin, Enteritidis, and Paratyphi (draft sequences) revealed that in each genome approximately 10 to 12% of unique DNA was acquired by horizontal gene transfer (96, 109). Most of these acquired regions are related to the pathogenicity islands by insertion into tRNA genes (78). Salmonella pathogenicity islands contain virulence genes and regulatory elements in addition to those encoding specialized protein secretion systems known as type I and III secretion systems (96). In addition, a few serotypes of Salmonella, including serotype Choleraesuis, carry a virulence plasmid that is involved in the pathogenesis of the organism in its natural host.

Virulence plasmids.

Subgroup I Salmonella serotypes include 1,454 serotypes and at least 99% of clinical isolates (110, 111, 141). Only a few of these serotypes harbor a virulence plasmid which carries the spv operon (34, 73, 74). The size of these plasmids varies with each serotype, ranging from 50 to 285 kb (73, 74, 107). The spv operon is required for the systemic phase of disease in specific hosts with specific virulence plasmid size, i.e., serotype Choleraesuis with a 50-kb virulence plasmid in pigs (43), serotype Dublin with an 80-kb virulence plasmid (pSDV) in cattle (92, 149), serotype Gallinarum with an 85-kb virulence plasmid (pSGV) and serotype Pullorum with an 85-kb virulence plasmid (pSPV) in fowl (12, 13), serotype Typhimurium with a 95-kb virulence plasmid (pSTV) and serotype Enteritidis with a 60-kb virulence plasmid (pSEV) in mice (74, 84), and serotype Abortusovis with a 95-kb virulence plasmid (pSAV) in sheep (146).

The complete nucleotide sequences of pSCV (pKDSC50) of serotype Choleraesuis RF1 and pSTV of serotype Typhimurium LT2 have been determined. The 49,503-bp pSCV contained 48 ORFs (43, 77), and the 93,939-bp pSTV contained 108 ORFs molecules (96). Comparison of the two plasmids reveals that they are closely related (37, 38). In fact, all the Salmonella virulence plasmids show a very close relationship. A heteroduplex analysis indicates that the level of closeness runs, in descending order, from pSTV to pSEV to pSCV to pSDV (102). Analysis of the major variations in serum resistance genes rsk (for “resistance to serum killing”), rck (for “resistance to complement killing”), and traT and the minor fimbria genes, pef, faeH, faeI, and oriT suggested the existence of at least two groups of virulence plasmids. Group I includes pSDV and pSPV, which contain faeH and faeI without rsk, repA of RepFIB, and pef; in contrast, group II includes pSTV, pSEV, and pSCV, which contain rsk and repA of RepFIB and pef but no faeH and faeI (37, 38). In comparison to the nucleotide sequence of pSTV, two large deletions of the pef operon and the tra region are found in pSCV (37), suggesting that pSCV is derived from pSTV by deletions. The major differences in operons or genes among the various virulence plasmids are summarized in Table Table22.

TABLE 2.

TABLE 2.

Major differences in operons or genes among virulence plasmids

Serum resistance genes rck, rsk, and traT are present in most of the virulence plasmids. The rck gene encodes an outer membrane protein, homologous to PagC (for “phoP-activated gene”) (76) and Ail (for “attachment and invasion locus”) (100), which conferred host serum resistance. The rsk gene is only 66 bp long and contains a series of direct 10-bp repeat in the 5 -noncoding region of the repA gene of ′RepFIB (148). In addition, a gene, spf (for “stimulation of protein forty”), near rsk was recently found to be involved in the production of IL-12 p40 in Salmonella-infected macrophages (25). The traT gene encodes a surface lipoprotein homologous to the product of the traT surface exclusion gene located on plasmid F and F-like conjugation systems. The introduction of the traT-containing plasmid appears to be responsible for the slight increase in serum resistance of rough serotype Typhimurium strains (119). In comparison with other virulence plasmids, apparently pSCV lacks rck but contains traT (Table (Table22).

Adhesins are known to support the colonization of Salmonella in the host alimentary tract, thereby increasing the bacterial load in the vicinity of the epithelial cell lining. The pef operon is a 7-kb region containing genes for plasmid-encoded fimbriae (57). It includes the pefBACD, orf5, orf6, and pefI genes (57). It has been documented that the pef fimbriae mediate bacterial adhesion to murine intestinal epithelium, resulting in fluid accumulation in the gut (17). pSCV has a deletion in the region behind pefD (37), and pSEV has sequence variations in orf5 and orf6 (77). These deletions and variations of orf5, orf6, and rck may be associated with host adaptation in Salmonella.

All virulence plasmids contain two virulence factors, mig-5 and the spv operon. The mig-5 gene is important for bacterial colonization in the mouse spleen (147). The spv operon consists of four structural genes, spvABCD, and a positive regulatory gene, spvR (71, 73, 75). The spv genes are induced during different stresses, including starvation and the stationary phase of growth (72), and within host cells (118, 156). The expression of spv genes is positively regulated by SpvR, the product of spvR (2), and is enhanced at stationary phase under the control of sigma factor RpoS (σ38) but is repressed by the SpvA (1).

Evolution of the serotype Choleraesuis virulence plasmid.

As mentioned above, serotype Choleraesuis usually harbors a pSCV plasmid of 50 kb. Recently, however, several serotype Choleraesuis isolates from humans and pigs that harbored various numbers as well as

sizes of plasmids were isolated (36). The 50-kb plasmids are all pSCV since they all carry a spv operon, and the larger plasmids, ranging from 125 to 140 kb, were also shown to carry a spv operon; hence, they were all pSCVs (36). The results of PCR with primers flanking two specific deletion regions, orf5-repA of RepFIIA and traT-samA (36), confirmed that these large pSCVs were indeed derived from the 50-kb pSCV. These large pSCVs also contained additional DNA from other 75- and 90-kb plasmids. Most of the clinical isolates were resistant to multiple antimicrobial agents (36). We found that at least two resistance genes, sul and blaTEM-1, which were responsible for resistance to sulfonamide and ampicillin, respectively, were present on the large pSCVs. These genes on the large pSCVs were apparently acquired through recombination. The acquisition of resistance genes by pSCV constitutes a new and interesting example of plasmid evolution and presents a serious public health problem. Biologically, the larger size of pSCV may not have any advantage, except that the process of its formation is probably the means by which pSCV acquires drug resistance, an advantage in an unfavorable drug environment.

Go to:

CLINICAL SPECTRUM OF INFECTION

Nontyphoid Salmonella serotypes are major causes of food-borne infections worldwide. They still seriously affect human health and cause morbidity and mortality. Infections with nontyphoid Salmonella serotypes most often result in self-limited acute gastroenteritis that does not require antimicrobial therapy. Nevertheless, approximately 5% of individuals with gastrointestinal illness caused by nontyphoid Salmonella serotypes develop bacteremia. Children with certain underlying conditions are at increased risk of bacteremia, which may lead to extraintestinal focal infections. Such conditions include very young age (babies), AIDS, malignancies, immunosuppressive therapy, hemolytic anemia, and inflammatory bowel disease (29, 32, 39, 129). Nontyphoid Salmonella bacteremia is even more serious in adult patients with underlying diseases; these patients are more likely to develop focal infections such as meningitis, septic arthritis, and osteomyelitis. Certain serotypes of Salmonella, i.e., serotypes Choleraesuis and Dublin, show a much higher predilection for causing bacteremia in humans (29, 31-33, 39, 143). These serotypes rapidly invade the bloodstream with little or no intestinal involvement. In Taiwan, serotype Choleraesuis has the highest invasiveness (measured in terms of invasion index, which is the number of extraintestinal isolates divided by the total number of isolates) (31-33). In England and Wales, while the largest numbers of bloodstream isolates were from infections caused by serotypes Typhimurium and Enteritidis, the highest incidence of sepsis, also based on the invasion index of each individual serotype, was attributable to infections with serotypes Choleraesuis, Dublin, and Virchow (143). A recent retrospective analysis of adult patients with serotype Choleraesuis bacteremia showed that most of the patients had obvious risk factors for salmonellosis, including malignancy, liver cirrhosis, systemic lupus erythematosus, and previous use of corticosteroids (29). It was notable that 21% of the bacteremic patients subsequently developed focal infections, including septic arthritis, pneumonia, peritonitis, and cutaneous abscess (29). This reflects both the tenacity of serotype Choleraesuis and the comorbidities of the adult patients who develop bacteremia.

A feared complication of Salmonella bacteremia in adults is the development of infectious endarteritis (also known as infectious aortitis or mycotic aneurysm). The description “mycotic aneurysm” originated early in 1885 and was coined by Osler (106). It was originally used to describe the septic emboli seen in patients with infective endocarditis. These embolic materials are carried by the blood flow to distal arterioles, where they cause obstruction or attach to the vessel walls. Inflammation and subsequent destruction of the involved vessels ensue, leading to the formation of a mushroom-shaped aneurysm. However, most people think that “mycotic” simply referred at that time to any infection caused by microorganisms and was only later restricted to fungi. In 1986, Sheng and Busuttil classified these aneurysms into five categories, one of which is caused by secondary infection in patients with bacteremia and with underlying atherosclerosis or severely damaged arterial walls (127). Nowadays, the use of the term “mycotic aneurysm” implies a wide spectrum of disease entities including all cases of true or pseudoaneurysms. Most of the patients with mycotic aneurysm due to Salmonella have preexisting atherosclerotic disease at the site of subsequently infected aneurysm (40, 105). In a series of patients with bacteremia due to Salmonella, 25% of those older than 50 years developed an endothelial infection (40). This reflects the ability of Salmonella, which has been reported to invade normal arterial intima, to cause endothelial infection in the presence of atherosclerosis (40). The predominance of older patients with or without hypertension among patients with Salmonella aortitis is probably due to the increased incidence of atherosclerosis and intimal damage in these patients. Recently, Salmonella bacteremia has been noted in patients with human immunodeficiency virus infection; however, aortitis rarely occurs in these patients because they are relatively younger and do not have the above risk factors (99). Unfortunately, most of the data on risk factors were from anecdotal reports or retrospective reviews; consequently, the precise risk factors remain unclear. A prospective case-control study is urgently called for.

According to a review of 140 cases of aortitis due to Salmonella reported in the literature since 1948, the most common site of infection is the abdominal aorta, more precisely its infrarenal portion (131). The most common clinical features consisted of fever, abdominal pain, and/or back pain, the last of which may be related to the site of involvement (131). A computed tomographic (CT) scan with contrast enhancement is considered the method of choice to diagnose mycotic aneurysm because of its ability to detect early changes in the arterial wall and the periaortic tissue (63, 131). These changes include a periaortic soft tissue density with rim enhancement (Fig. (Fig.1),1), an eccentric, thickened wall with rapid growth, lack of calcium in the aneurysmal wall of the aorta, and gas in the perianeurysmal soft tissue (63). Angiography may subsequently be performed for confirmation of the diagnosis or assistance in planning future surgical procedures. However, angiography is invasive and does not detect the early changes produced in the arterial wall or in the periaortic tissue. It may be virtually contraindicated because of the risk of aneurysmal rupture. Magnetic resonance (MR) imaging, on the other hand, provides the most safe and accurate technique for diagnosis. An understanding of the principles underlying the appearance of flowing blood on MR images has led to the development of MR angiography, in which a clear display of vascular anatomy is generated. The use of MR angiography has

particular appeal for diagnosing mycotic aneurysm since it is entirely noninvasive and does not require the use of intravenous contrast material or ionizing radiation. MR angiography produces images in the transverse, sagittal, and coronal planes, which display the entire thoracic or abdominal aorta in one plane. The availability of these multiple views facilitates the diagnosis of mycotic aneurysm and the determination of its extent and in many cases reveals the presence of branch vessel involvement (27, 131, 150). Figure Figure22 shows an MR angiogram of a patient with a mycotic aneurysm at the infrarenal portion of the abdominal aorta.

FIG. 1.

FIG. 1.

Axial CT scan of the abdomen of a patient with S. enterica serotype Choleraesuis infection, depicting a periaortic mass with intimal rim enhancement (arrow). Abbreviation: Sp, spine.

FIG. 2.

FIG. 2.

Coronal MR angiogram of a patient with S. enterica serotype Choleraesuis infection, revealing aneurysm formation (arrow) at the infrarenal portion of the abdominal aorta. Abbreviations: A, aorta; K, kidney; L, liver; S, spleen.

Mycotic aneurysm caused by Salmonella was almost uniformly fatal in previous times; however, multiple publications of case reports and case series found that early surgical intervention has greatly increased survival (3, 27, 63, 105, 131, 142, 150). Most surgeons consider the excision of an infected vessel with extra-anatomic vascular reconstruction to be the surgery of choice for abdominal mycotic aneurysm (142). In addition, a prolonged course of antibiotics (for 6 weeks or longer) is indicated (3, 40, 150). A recent review of 136 evaluable cases in patients seen from 1948 through 1999 found a 62% survival rate (38% mortality) for all such patients treated with combined surgical and medical therapy (131). This improved survival was apparently due to the use of advance diagnostic techniques, surgical care, and antimicrobial therapy.

In literature reviews of Salmonella aortitis, the serotypes most commonly isolated were serotypes Typhimurium, Enteritidis, and Choleraesuis, in decreasing order (127, 131). Overall, around 30% of the reported patients was infected by serotype Typhimurium and 15% each were infected by serotypes Enteritidis and Choleraesuis (131). Interestingly, the reports of a relatively high incidence of serotype Choleraesuis infection came mostly from Taiwan (27, 150). In Taiwan, serotype Choleraesuis was the second most common serotype among all Salmonella serotypes isolated and showed the greatest ability to cause extraintestinal infections (32, 33). The high virulence of serotype Choleraesuis to humans, as

well as its high prevalence, may have contributed to the high incidence of endovascular infection caused by this organism in Taiwan.

Go to:

TREATMENT

Antimicrobial agents should not be used routinely to treat uncomplicated nontyphoid Salmonella gastroenteritis. However, antimicrobial therapy is essential in the treatment of serotype Choleraesuis infection, in view of the high rate of extraintestinal infections caused by this organism. Because of the increasing prevalence of resistance to conventional antimicrobial agents (see below), such as ampicillin, chloramphenicol, and trimethoprim-sulfamethoxazole, empirical therapy for life-threatening bacteremia or focal infection suspected to be caused by nontyphoid Salmonella should include a broad-spectrum cephalosporin or a fluoroquinolone until susceptibility patterns are known. It is also important to search for endovascular abnormalities by using imaging techniques in older patients with or without evidence of atherosclerosis. Although there is no consensus on the optimal duration of postoperative antibiotic therapy for endovascular infections caused by Salmonella, most investigators still recommend a minimum of 6 weeks (3, 39, 40, 150). The duration of therapy for other extraintestinal infections should be considered based on the site of infection. In general, 10 to 14 days for bacteremia, 4 to 6 weeks for osteomyelitis, and 4 weeks for meningitis are suggested. Prolonged therapy may be needed in immunocompromised patients. Many consultants would prescribe some months of suppressive therapy, following parenteral treatment, especially for human immunodeficiency virus-infected patients. For patients with a focal suppurative process, surgical drainage should be undertaken as soon as possible in addition to antibiotic treatment for the best chance of achieving a cure.

Go to:

ANTIMICROBIAL RESISTANCE

Epidemiology

Antimicrobial resistance among nontyphoid Salmonella serotypes has been a serious problem worldwide (35, 41, 81, 117, 124, 137, 140). Conventional antimicrobial agents, such as ampicillin, chloramphenicol, and trimethoprim-sulfamethoxazole, had been the drugs of choice in the treatment of salmonellosis before the 1980s. However, multidrug resistance, with rates of resistance to these antimicrobial agents of more than 50%, has been reported in many areas of the world (35, 45, 124, 137). Extended-spectrum cephalosporins and fluoroquinolones have been suggested as appropriate alternative agents in the treatment of infections caused by such multidrug-resistant Salmonella serotypes (10, 22, 64); however, since 1991, outbreaks or cases of infections caused by Salmonella

serotypes resistant to extended-spectrum cephalosporins or fluoroquinolones have been increasingly reported (9, 16, 21, 23, 35, 61, 62, 90, 114, 128).

As to serotype Choleraesuis, probably due to a relatively lower prevalence rate, reports of antimicrobial susceptibility in the western countries are rare. Nevertheless, a number of reports from Taiwan have indicated a worrisome situation that this highly invasive serotype has expressed high-level resistance to antimicrobial agents (29, 30, 35, 36, 137, 138). A report described the secular trend of antimicrobial resistance to the conventional antibiotics in serotype Choleraesuis isolates from a university hospital in Taiwan (35), showing that the rate of resistance to ampicillin, chloramphenicol, or trimethoprim-sulfamethoxazole had increased to around 90% for all three drugs in 2000 (35). Veterinary studies also demonstrated a high rate of chloramphenicol resistance (MIC for 90% of strains [MIC90] > 128 μg/ml) in serotype Choleraesuis strains isolated from swine (26). Moreover, in 2000 we observed the emergence of resistance to ciprofloxacin in serotype Choleraesuis in Taiwan (35); the resistance rate increased to 59% in 2002. As to the extended-spectrum cephalosporins, for the first time a ciprofloxacin-resistant serotype Choleraesuis isolate was found to express an intermediate level of resistance (MIC = 16 μg/ml) to ceftriaxone in 2002 (34a). Imipenem became the last and only effective antimicrobial agent in such circumstances to treat infections caused by the multidrug-resistant serotype Choleraesuis strain. In view of the serious implications arising from these situations, the chain of transmission and mechanism of resistance should be carefully studied to reduce the spread of resistance and its threat to human health.

Spread of Resistance

The emergence of antimicrobial resistance in Salmonella is complicated because the use of antibiotics for therapeutic purposes in veterinary medicine and as growth promoters in animal feed may promote the emergence of resistance, thus presenting a potential risk to public health from zoonotic infections (35, 82, 132). In addition, pet animals such as frogs and turtles and their water environment were shown to carry multidrug-resistant Salmonella strains (126, 145), which could subsequently cause infections in humans. For serotype Choleraesuis, results of molecular epidemiological surveys indicated that swine serve as the prime reservoir for resistant serotype Choleraesuis strains (35). To curb the resistance problem in Salmonella, it has been suggested that inappropriate use of antimicrobial agents in food animals should be prohibited (35, 153).

Mechanisms of Resistance

Some studies pointed out the serious problem that several Salmonella serotypes, including serotype Choleraesuis, could generate different types of hybrid plasmids, which consisted of the serotype-specific virulence plasmid and an array of gene cassettes (36, 69, 70, 93). Most of the gene cassettes contained resistance genes that were responsible for resistance to conventional antibiotics, such as ampicillin, chloramphenicol, gentamicin, oxacillin, spectinomycin, streptomycin, sulfadiazine, tetracycline, trimethoprim, and other materials, including ammonium antiseptics and mercury (36, 69, 70, 93).

A rapid emergence of resistance to ciprofloxacin has been reported in serotype Choleraesuis recently, and all of the resistant strains were shown to have mutations that gave rise to the substitution of phenylalanine for serine at position 83 and asparagine for aspartic acid at position 87 in GyrA (35). In addition, mutations in parC leading to an amino acid change from serine to isoleucine at position 80 were found in most of the ciprofloxacin-resistant serotype Choleraesuis isolates (C. H. Chiu, unpublished data). Further studies are required to determine whether active-efflux pumps are also involved in fluoroquinolone resistance phenotype in serotype Choleraesuis.

Resistance to broad-spectrum cephalosporins is due to the production of extended-spectrum β-lactamases. A variety of such β-lactamases have been described in Salmonella, most of which are cefotaxime-hydrolyzing β-lactamases (CTX-M types) (9, 16, 21, 61, 62, 114, 128) or CMY-2 AmpC β-lactamases that could hydrolyze cephalosporins as well as cephamycins (23, 90). The genes encoding extended-spectrum β-lactamases could be carried by conjugative plasmids, transposons, or integrons. These mobile genetic elements could spread, under selective antibiotic pressure, between bacterial species (23, 58, 134).

There have been no such reports regarding the resistance of serotype Choleraesuis to the extended-spectrum cephalosporins in the literature. However, we have recently isolated a CMY-2-producing serotype Choleraesuis strain that expressed intermediate-level resistance to ceftriaxone. The blaCMY-2 of this isolate was carried by a 140-kb F-like plasmid. In addition, a class 1 integron with a gene cassette carrying dfr and aadA2 genes was found on both the chromosome and the 140-kb plasmid of this isolate (34a). Since the strain also expressed resistance to ciprofloxacin, carbapenem became the only agent available for effective treatment (89). A feared fact is that Salmonella isolates with resistance to imipenem have already been reported early in 1997 (46).

Clinical Relevance

The association between antimicrobial resistance and salmonellosis has several facets (14, 15, 144). The most important appears to be its impact on the treatment of infections. Patients with invasive salmonellosis require effective antimicrobial therapy. Growing antimicrobial resistance may add to the difficulty in treating patients with such infections, thus leading to increased morbidity and mortality (98). Many previous reports have provided evidence of this development for other antimicrobial-resistant Salmonella serotypes (79, 136). Although no similar developments have been reported for serotype Choleraesuis, it may be expected that the situation would be worse in this case because serotype Choleraesuis usually causes invasive infections that require antimicrobial therapy.

Another impact of antimicrobial resistance on human and veterinary medicine is the linkage of virulence traits and resistance genes, which implied that resistant strains may be more virulent than susceptible strains (14, 144). Epidemiological reports have indicated that antimicrobial-resistant strains of Salmonella could cause more prolonged or more severe illness than do susceptible strains (144). A previous molecular study demonstrated that serotype Choleraesuis could become resistant to multiple antibiotics by acquiring drug resistance genes through recombination of the virulence plasmid and the resistance plasmid (36). Such plasmid-mediated antimicrobial resistance could provide virulent Salmonella with the advantage of causing infections in an unfavorable drug environment, leading to increased mortality in patients or infected animals.

Go to:

VACCINE

Nontyphoid Salmonella serotypes causing gastroenteritis in humans are most often transmitted through the food chain by contamination of poultry and eggs, pork, beef and dairy products, and, increasingly in the United States by vegetables and fruits that are irrigated with Salmonella-contaminated water (98). The question that had been posed by investigators many years ago is whether vaccination would be a feasible approach when combined with improved management practices for the control of Salmonella in poultry, swine, and cattle to lessen the likelihood of Salmonella transmission through the food chain to humans. In other words, could vaccines to prevent the infection and colonization of animals with Salmonella contribute to the safety of food? One difficulty in attaining such a goal is the probably correct assertion that most Salmonella serotypes that colonize animal species and that are passed through the food chain to humans are essentially members of the normal flora of these animals and do not often cause disease. Hence, the design of any efficacious vaccine to block colonization of or infection by “normal flora” constitutes a difficult task.

Proven means of attenuation of serotype Typhimurium for mice did not yield a protective vaccine when used to attenuate serotype Choleraesuis. This included using aro, galE, and cya-crp mutations (86, 104).

In an attempt to attenuate serotype Choleraesuis some years ago, Curtiss and colleagues discovered the cdt locus adjacent to crp and found that a serotype Choleraesuis strain with the Δcya and Δcrp-cdt double mutations was avirulent and immunogenic in mice (86). In the United States, there are three licensed serotype Choleraesuis vaccines for swine. The Arco serotype Choleraesuis vaccine was derived by chemical mutagenesis, but the basis of attenuation is not very well understood. The Nobl vaccine was passaged through neutrophils and lost its virulence plasmid, which is the principal attenuating defect (120). Argus-SC, which is distributed by Bayer but was originally developed by Upjohn, has the Δcya Δcrp-cdt mutations. In studies at Upjohn, young pigs were immunized with the Bayer Argus-SC vaccine and challenged, nonvaccinated and challenged, or not challenged (87). There was significant morbidity after challenge in animals that were not vaccinated and a high degree of diarrhea. Since the animals were about 6 weeks of age, there was no mortality, but the pigs continued to shed the challenge strain a week after challenge. There was also a significant increase in body temperature compared to the control nonvaccinated, nonchallenged pigs. Pigs vaccinated with the Nobl vaccine, which lacks the virulence plasmid, had higher temperatures and diarrheal scores with more Salmonella shed in feces after challenge than was the case in pigs immunized with the Δcya Δcrp-cdt vaccine. Both groups of immunized pigs performed better than the nonimmunized challenged pigs and showed better weight gains. None of these vaccines for swine have been introduced in Europe (except Germany) or other parts of the world.

It is concluded that the most logical means of diminishing the transmission of Salmonella through the food chain to humans would be to vaccinate farm animals on a routine basis with live attenuated Salmonella vaccine. The problem is that other than Germany, there is no requirement to do so in any other part of the world. Agriculturally important animals are commodities, and therefore producers are not willing to invest in the cost of a vaccine and a vaccination program unless they are required to do so or unless failure to vaccinate results in a severe problem, such as being unable to market their products. In this regard, it is permissible in the United States to have up to 20% of broiler carcasses fecally contaminated with Salmonella at the time of slaughter. Therefore, although the means for using vaccination to contribute to the improvement of food safety exists, it will take education and a change in government policies to bring that about.

Go to:

CONCLUSIONS

S. enterica serotype Choleraesuis usually causes systemic infections without overt gastroenteritis in humans. In comparison with other highly prevalent serotypes of Salmonella, such as serotypes Typhi, Typhimurium, and Enteritidis, this organism has received much less attention; therefore, not surprisingly, our knowledge of it is not only incomplete but also significantly lacking. With serotype Choleraesuis being increasingly recognized as a problematic cause of systemic salmonellosis in Asian countries, additional prospective studies of host risk factors and of important virulence factors are

needed. A major issue is the management of serotype Choleraesuis infections. The emergence of serotype Choleraesuis that is resistant to ampicillin, chloramphenicol, trimethoprim-sulfamethoxazole, and, notably, fluoroquinolone antibiotics has aroused concern about the use of these agents for the empirical treatment of systemic infection caused by this organism. In view of the serious implications of this situation, the chain of transmission and mechanism of resistance should be studied to reduce the spread of resistance and its threat to human health. On the other hand, advanced tools are now in hand to further elucidate the pathogenesis of serotype Choleraesuis at a molecular level. To obtain a global view of genes possessed by serotype Choleraesuis and to solve the worrying clinical problems, we propose that the genome of serotype Choleraesuis should be sequenced. Understanding the genome sequence of serotype Choleraesuis may facilitate the development of effective vaccines as well as the identification of new targets for novel antimicrobial agents. In any event, if serotype Choleraesuis infections are to be adequately controlled in the future, comprehensive studies of their epidemiology, pathogenesis, genetics, and resistance must be performed.

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC387403/

Salmonella, Non-Typhoidal Species (S. Choleraesuis, S. Enteritidis, S. Hadar, S. Typhimurium)

Authors: Cheng-Hsun Chiu, M.D., Ph.D., Lin-Hui Su, M.Sc.

Salmonella infection of man and animals continues to be a distressing health problem worldwide. Far from disappearing, the incidence in developing countries may be much higher than expected. Salmonella are widely dispersed in nature, including the gastrointestinal tracts of domesticated and wild mammals, reptiles, birds, and insects. They are both commensals and pathogens that cause a broad spectrum of diseases in man and animals. There are over 2,500 serotypes of Salmonella, as defined by the somatic and flagellar antigens. Some Salmonella serotypes, such as Typhi and Paratyphi are highly adapted to humans and have no other known natural hosts. Others, such as Typhimurium and Enteritidis, have a broad host range and can infect a wide variety of animal hosts. These non-typhoid Salmonella can cause protean manifestations in humans, including acute gastroenteritis, bacteremia, and extraintestinal localized infections involving many organs. The widespread distribution of Salmonella in the environment, their increasing prevalence in the global food chain, and their virulence and adaptability result in an enormous medical, public health, and economic impact worldwide.

MICROBIOLOGY

Salmonella is named for the pathologist Salmon who first isolated Salmonella choleraesuis from porcine intestine. Salmonella is a genus of the family Enterobacteriaceae (29). The nomenclature of Salmonella has been changed many times and still remains unstable. Before 1983 the existence of multiple Salmonella species was taxonomically accepted. As a result of further experiments indicating a high degree of DNA similarity, all Salmonellaisolates were classified into a single species, S. choleraesuis (19,29). The species S. choleraesuis can be subclassified into seven subgroups based on DNA similarity and host range. Subgroup I contains almost all the serotypes pathogenic for humans, except for rare human infections with group IIIa and IIIb formally designated S. arizonae (60).

In 1999, Euzéby proposed to designate “Salmonella enterica” as a “neotype species” and replace the type species of the genus Salmonella from S. choleraesuis to S. enterica (28). There are now two species recognized in the genus Salmonella: S. enterica (six subspecies) and S. bongori (one subspecies). Members of the seven subspecies can be serotyped into one of the more than 2,500 different serotypes. This system of nomenclature has become accepted for use by the World Health Organization (WHO) and in publications of the American Society for Microbiology.

The antigenic classification or serotyping of Salmonella used today is a result of years of study of antibody interactions with bacterial surface antigens by Kauffman and White in the 1920s and 1940s. Three kinds of surface antigens determine the organisms’ reaction to specific antisera. These surface antigens are made accessible to antibody after the organisms are treated in various ways. Antibodies to the somatic or polysaccharide O antigen can be used to agglutinate the bacteria in a slide agglutination test. After treatment with formaldehyde, antibodies to the flagellar or H antigen can be used to agglutinate the organism in a tube agglutination test. Specific serotypes are defined as a result of complex antigen variability. This resulted in the identification of over 2,500 Salmonella serotypes, the majority of which are named for the city where they were defined (48). Most variability noted in the O antigen that is composed of chains of oligosaccharides attached to a core oligosaccharide linked covalently to lipid A. This structure comprises the bacterial lipopolysaccharide (LPS). Hence, most serotypes have unique LPS structure.

Certain Salmonella serotypes are associated with specific clinical syndromes (60) (Table 1). Although extensive serotyping of all surface antigens can be used for formal identification, most laboratories perform a few simple agglutination reactions to define specific O antigens into serogroups, designating groups A, B, C1, C2, D, and E Salmonella (60). Although this grouping system is useful in epidemiologic studies and can be used clinically to confirm genus identification, it cannot quickly identify whether the organism is likely to cause enteric fever, because considerable cross-reactivity among serogroups occurs. For example, S. Infantis, which typically causes gastroenteritis, and S. Choleraesuis, a prominent cause of invasive infections, are both group C1. Similarly another common cause of gastroenteritis, S. Enteritidis,

and S. Typhi, which causes enteric fever, are both group D. Both biochemical and serologic determinations are required to define the specific Salmonella serotypes.

back to top

EPIDEMIOLOGY

In many countries the incidence of human Salmonella infection has increased markedly over the years. During the last few decades S. Enteritidis and S. Typhimurium have emerged as the two predominant serotypes in most western countries. In the United States, each year non-typhoid Salmonella affect approximately 2-3 million persons, and cause 500-2,000 deaths (2). In 2000, the two most common serotypes isolated from human sources wereS. Typhimurium and S. Enteritidis (8). The 1995 global survey conducted by WHO showed that the global pandemic of S. Enteritidis has continued to occur in recent years. The frequent occurrence of this serotype in chickens suggests that poultry may be an important reservoir. S. Typhimurium is among the most prevalent serotypes in Europe and America and of growing importance in Southeast Asia, Africa, and the Western Pacific. S. Typhimurium can be found among a large number of different animal reservoirs. S. Choleraesuis is an infrequent serotype isolated from human sources in North America (8). However, the epidemiological pattern differs greatly in Asian countries. In Thailand, during 1988-1993, S. Choleraesuis represented the tenth most common serotype that caused salmonellosis in humans (3). This highly invasive serotype is of particular concern in Taiwan, as among the commonSalmonella serotypes isolated from human sources, it was ranked the 2nd in an epidemiological survey (11). Some studies demonstrated that most of the S. Choleraesuis isolates from humans and swine exhibited the same or similar DNA fingerprints, indicating that human infections were acquired from pigs (15,69). The cross-infection may arise as a result of the contamination of food or water source by the organism. It is also speculated that the habit of eating pig offal by the local population significantly contributed to the high prevalence of S. Choleraesuis infection in the locality. Different serotypes in one country can be of global importance because of travel and animal and food product trade. Knowledge about the occurrence and epidemiology of different serotypes in different countries and geographic regions may assist in the recognition and tracing of new emerging pathogens.

Infection with non-typhoid Salmonella reflects ingestion of food or water contaminated with these organisms. The number of bacteria that must be ingested to cause symptomatic disease in healthy adults is 106 to 108 non-typhoid Salmonella organisms. In infants and persons with certain underlying conditions, a smaller inoculum can produce diseases, so that direct person-to-person transmission, although uncommon, sometimes occurs. Nursery outbreaks are a result of neonatal susceptibility to low numbers of Salmonella. After infection, Salmonella is excreted in feces for a median of 5 weeks. In young children, the excretion is prolonged. In older children and adults,Salmonella excretion lasting more than 8 weeks after infection is uncommon.

back to top

CLINICAL MANIFESTATIONS

Several distinct clinical syndromes can develop in humans infected with non-typhoid Salmonella, depending on host factors and the specific serotype involved.

back to top

Acute Enteritis

The most common clinical presentation of salmonellosis is acute enteritis. After an incubation period of 6-72 hr (mean, 24 hr), there is an abrupt onset of nausea, vomiting, and crampy abdominal pain primarily in the periumbilical area and right lower quadrant, followed by mild to severe watery diarrhea and sometimes by diarrhea containing blood and mucus. Fever affects about 70% of patients. Abdominal examination reveals some tenderness. The stool typically contains a moderate number of polymorphonuclear leukocytes and occult blood. Mild leukocytosis may be detected. Symptoms subside within 2-7 days in healthy children, and fatalities are rare.

In certain high-risk groups, the course of Salmonella enteritis may be more complicated. Neonates, young infants, and children with primary or secondary immune deficiency may have symptoms persisting for several weeks. In patients with inflammatory bowel diseases, especially active ulcerative colitis, Salmonella enteritis may cause invasion of the bowel with rapid development of toxic megacolon, systemic toxicity, and death.

back to top

Bacteremia

In contrast to adults who usually are immunologically impaired and develop Salmonella bacteremia in the absence of diarrhea, the majority of children have no predisposing risk factors and develop bacteremia as a complication of acute enteritis (41). Transient bacteremia during non-typhoid Salmonella gastroenteritis is believed to occur in approximately 5% of patients. Salmonella bacteremia is

associated with fever, chills, and often with a toxic appearance. Bacteremia has been documented, however, in afebrile, well-appearing children, including neonates (occult bacteremia). Patients with certain underlying conditions, such as malignancies, collagen vascular diseases, inflammatory bowel diseases, and AIDS, are at increased risk of bacteremia, which may lead to extraintestinal infection. In patients with AIDS, septicemia often recurs despite antibiotic therapy, often with a negative stool culture forSalmonella and sometimes with no identifiable focus of infection (56). Adults with persistent bacteremia may have endocarditis, arteritis, or an infected aortic aneurysm.

Certain serotypes of Salmonella, i.e. S. Choleraesuis and S. Dublin, show much higher predilection for causing bacteremia in humans (9,11,62). These serotypes rapidly invade the bloodstream with little or no intestinal involvement. In Taiwan, S. Choleraesuis exhibits the highest degree of invasiveness (measured in terms of invasion index = no. of extra-intestinal isolates/total isolates), followed by S. Dublin and S. Enteritidis (9,11,62). In England and Wales, while the highest numbers of bloodstream isolates were from infections caused by S. Typhimurium and S. Enteritidis, the highest incidence of sepsis, also based on the invasion index of each individual serotype, was attributable to infections with S. Choleraesuis, S. Dublin, and S. Virchow (62). A recent retrospective analysis of adult cases with S. Choleraesuis bacteremia showed that most of the patients had obvious risk factors for salmonellosis, including malignancy, liver cirrhosis, systemic lupus erythematosus, and previous use of corticosteroid (9). It was also notable that 21% of the bacteremic patients subsequently developed focal infections, including septic arthritis, pneumonia, peritonitis, and cutaneous abscess (9). Such phenomenon reflects both the tenacity of the organism and comorbidities of the adult patients who develop bacteremia.

back to top

Extraintestinal Focal Infections

After salmonellae have entered the bloodstream, they have a unique capability to metastasize and cause a focal suppurative infection of almost any organ. Sites of pre-existing abnormalities are often involved. Extraintestinal infections are most common in the first 3 months of life, in those with sickle cell disease, and in those who have had prior gastrointestinal surgery (52). The most common focal infections involve the skeletal system, meninges, and intravascular sites. Salmonella is a common cause of osteomyelitis in patients with sickle cell disease. Salmonella osteomyelitis and septic arthritis also occur at sites of previous trauma or skeletal prosthesis. Reactive arthritis may follow Salmonella enteritis, usually in adolescents with the HLA-B27 antigen. Meningitis occurs about 100 times less frequently than bacteremia. Although meningitis can occur at any age, the peak incidence is in infancy (52). Patients may present with no fever and minimal symptoms, or rapid deterioration, and neurologic sequelae despite appropriate antibiotic therapy.

A feared complication of Salmonella bacteremia in adults is the development of infectious endarteritis (also known as infectious aortitis or mycotic aneurysm). Most of the patients with mycotic aneurysm due to Salmonellahave pre-existing atherosclerotic disease at the site of subsequently infected aneurysm (18,39). In a series of patients with bacteremia due to Salmonella, 25% of those >50 years of age developed an endothelial infection (18,39). This reflects the ability of Salmonella, which have been reported to invade normal arterial intima, to cause endothelial infection in the presence of atherosclerosis (18). The predominance of older patients with or without hypertension among patients with Salmonella aortitis is likely due to the increased incidence of atherosclerosis and intimal damage in these patients. Recently, Salmonella bacteremia has been noted in patients with HIV infection; however, aortitis rarely occurs in these patients because they are relatively younger and without the above risk factors (43). Unfortunately, most of the data on risk factors were from anecdotal reports or retrospective reviews, and consequently, the precise risk factors remain unclear.

In a review of 140 cases of aortitis due to Salmonella reported in the literature since 1948, the most common site of infection is the abdominal aorta, more precisely its infrarenal portion (45,55). The most common clinical features consisted of fever, abdominal pain, and/or back pain, the latter of which may be related to the site of involvement (45,55). Computed tomographic scan with contrast enhancement is considered the method of choice to diagnose mycotic aneurysm because of its ability to detect early changes in the arterial wall and the periaortic tissue (45,55). Magnetic resonance imaging (MRI), on the other hand, provides the safest and most accurate technique for diagnosis. The use of MRI angiography has particular appeal for diagnosing mycotic aneurysm in that it is entirely noninvasive and does not require the use of intravenous contrast materials or ionizing radiation. MRI angiography produces images in the transverse, sagittal, and coronal planes, which display the entire thoracic or abdominal aorta in one plane. The availability of these multiple views facilitates the diagnosis of mycotic aneurysm and determination of its extent and in many cases reveals the presence of branch vessel involvement (14).

In recent literature reviews of Salmonella aortitis, the serotypes most commonly isolated were (in order) S. Typhimurium, S. Enteritidis, and S. Choleraesuis (14,45,55). Interestingly, the reports of relatively high incidence of S. Choleraesuis infection came mostly from Taiwan (14,39). In Taiwan, S. Choleraesuis was the second most common serotype among all Salmonella serotypes isolated, and of these serotypes, it showed the highest ability to cause extra-intestinal infections (14,39). The high virulence of S. Choleraesuis to humans as well as its high prevalence may have contributed to the high incidence of endovascular infection caused by this organism in Taiwan (14,39).

back to top

LABORATORY DIAGNOSIS

The diagnosis of salmonellosis requires bacteriologic isolation of the organisms from appropriate clinical specimens. A wide range of media has been used for this purpose. All contain selective agents to inhibit different components of the gastrointestinal flora. These compounds are intended to inhibit the normal fecal flora, but may inhibit the pathogens to some extent. Thus there is a balance between selection and diagnostic yields. Bile salts will select for organisms that inhabit the bowel. More selective still is sodium desoxycholate, found in xylose lysine desoxycholate (XLD) agar, or desoxycholate citrate agar (DCA).

The next stage in the diagnostic process is the use of biochemical screening tests to distinguish them from Proteus colonies, which have similar appearances. These fermentation reactions utilize combination media such as Kligler iron agar, triple sugar agar, or Kohn’s tubes. Commercially produced kits also detect the characteristic activity of preformed enzymes (API ZYM). Organisms giving characteristic reactions are then subjected to full biochemical and serological identification. The biochemical tests include sugar fermentation tests, decarboxylation and dehydrogenation reactions and hydrogen sulphide production. Serological identification of Salmonella without biochemical confirmation is unreliable, because of the many cross-reactions with commensal gut flora. Full serological typing of Salmonella is only indicated for the identification and investigation of outbreaks.

back to top

PATHOGENESIS

Salmonella is a gastrointestinal pathogen that can penetrate into the intestinal barrier and function as intracellular pathogens within phagocytic cells. There are three types of diseases caused by Salmonella species in humans, and all occur by variations of the infection route described below. S. Typhi is the causative agent of typhoid fever. Enteritis, commonly known as food poisoning, is caused by many other non-typhoidal Salmonella serotypes, including S. Typhimurium and S. Enteritidis. S. Choleraesuis is the prototype of invasive Salmonella. These bacteria proceed through the intestinal epithelium, enter the blood, and disseminate throughout the body.

Salmonellosis in animals used for human consumption continues to be of worldwide significance, with both host adapted and broad host range serotypes being of considerable importance. Disease in animals is manifested in three forms, namely enteritis, septicemia and abortion. However, serotypes such as S. Enteriditis do not cause diseases, yet pose a significant risk to humans due to consumption of

contaminated animal products. The most common serotype associated with cattle is S. Typhimurium and it typically causes enteritis resulting in watery feces containing mucous and blood. In some cases, this ultimately will result in death due to dehydration and loss of electrolytes. Most pathology is associated with the ileum, jejunum and colon, although the ileum appears to be the preferred site of colonization and invasion. Once the organism passes into the lamina propria and is taken up by macrophages, it can then spread systemically to other organs.

Salmonella organisms are considered facultative intracellular parasites with most infections arising from oral ingestion of tainted food or water. In the small intestine Salmonella species penetrate the intestinal mucosa, usually at Peyer's patches. These bacteria cause the microvilli of M cells to disappear, and the bacteria enter into a membrane bound inclusion of this epithelial cell. The intracellular bacteria can then pass through these cells to the opposite surface, and also trigger M cell lysis. Cells of the reticuloendothelial system then ingest the Salmonella, but at least with macrophages, do not readily kill the bacteria. CD18-positive cells also appear to play a role in intestinal penetration (64). In systemic infections such as typhoid fever, infected macrophages then migrate to the intestinal lymph nodes where Salmonella replicate before escaping these cells and entering the blood to disseminate throughout the body. Polymorphonuclear neutrophils (PMNs) kill Salmonella, and it is thought that these cells, and activated macrophages, control bacterial growth effectively. During enteritis, there is significant localized intestinal inflammation, including neutrophil infiltration, and fluid accumulation (70).

Salmonella invade host cells and survive intracellularly as a central part of their pathogenesis, a process that can be easily modelled in vitro in tissue culture cells. Following initial contact of a bacterium with the mammalian cell surface, several events occur (30). Host cell signal transduction cascades are activated, a marked rearrangement in actin-containing cytoskeleton occurs, and polymerized actin is required for Salmonella invasion. This appears to be mediated by the small GTP-binding protein CDC42. Membrane ruffling and macropinocytosis are also stimulated in the immediate vicinity of the invading organisms. Salmonella are engulfed by the actin driven membrane ruffles and are rapidly internalized within a vacuole. Several bacterial loci have been identified that are involved in Salmonella invasion (31). These genes are primarily clustered at the Salmonella pathogenicity island-1 (SPI-1) on the bacterial genome, although several SPI-1 secreted effectors are scattered around the chromosome. SPI-1 encodes several factors, including a type III secretory apparatus that mediates export of specific effector proteins into the host cell. These translocated effectors are involved in triggering host signal transduction pathways and mediating invasion of Salmonella into host cells by redirecting actin polymerization. Mutations in bacterial invasion genes (SPI-1) moderately decrease Salmonella virulence when delivered orally but not systemically in the murine model, but play a critical role in bovine gastroenteritis. On the other hand the SPI-2 type III secretion system is essential for systemic salmonellosis. SPI-2 is a 40-kb pathogenicity island found in S. enterica, but not in E. coli K12 (36). Mutations in the type III secretion

systems genes cause the loss of survival in phagocytic cells, and are essential for virulence in the murine model (37).

Salmonella affects the expression of many epithelial and macrophage genes. Several studies have shown that proinflammatory cytokines and chemokines are activated. Microarray experiments have been used to confirm and extend these studies, determining that several other cytokines are induced, as are signalling molecules and transcriptional activators, in addition to finding several other changes in genes previously not implicated in pathogenesis (27,50).

Most studies of S. Typhimurium pathogenesis employ a well-characterized mouse infection model which closely mimics typhoid fever in humans. The bacteria penetrate the intestinal barrier and migrate to the lymph nodes and then to the liver and spleen where they proliferate (49). Importantly, this is a systemic disease and diarrheal symptoms are not seen. At early infection times (3 days) there is a rapid influx of PMNs at the infection foci, while at later times these are replaced by macrophages (classic inflammation). In both the liver and spleen, S. Typhimurium resides inside these cells (49,51) and triggers extensive apoptosis of macrophages, but not other cell types. The increasing availability of knockout mice and other reagents, as well as its similarity to typhoid fever continue to make the murine model attractive to study systemic infectious processes of salmonellosis.

back to top

SUSCEPTIBILITY IN VITRO AND IN VIVO

Global Increase of Antimicrobial Resistance

Since the end of the last century, a worldwide increase of antimicrobial resistance in non-typhoid Salmonella has been documented (57). Although S. Enteritidis remains relatively susceptible to various antimicrobial agents, high resistance rates to some traditional antibiotics have been reported for S. Typhimurium, S. Choleraesuis, and other serotypes (Table 2). The spread of a distinct multidrug-resistant S. Typhimurium strain, phage type 104 (DT104), (resistant to five antimicrobial agents: ampicillin, chloramphenicol, streptomycin, sulfonamide, and tetracycline) may have contributed greatly to such an increase (44). On the other hand, although resistance to newer antibiotics, such as extended-spectrum cephalosporins and fluoroquinolones, remains low, outbreaks or sporadic cases of infections caused by Salmonella organisms with resistance to these antibiotics have been increasingly reported over the past decade (24,57).

Since 2000, an epidemic clone of S. Choleraesuis that is resistant to multiple antibiotics, including ciprofloxacin, has emerged and widely spread in Taiwan (15,16). A clinical isolate of S. Choleraesuis simultaneously resistant to both ceftriaxone and ciprofloxacin was first found in Taiwan in 2002 (13). The occurrence and dissemination of such multi-drug resistant S. Choleraesuis have posed a serious threat to the public health in Taiwan (69).

back to top

Mechanism of Antimicrobial Resistance

Being a member of the family Enterobacteriaceae, Salmonella organisms are able to develop antimicrobial resistance through mechanisms similar to those expressed by other enterobacteria. These mechanisms include the production of hydrolytic enzymes to destroy the antibiotics in the surrounding environment, mutations in the specific target genes to escape from the action of antibiotics, decreased outer membrane permeability to prevent the antibiotics from entering the bacterial cell itself, and active efflux systems to exclude antibiotics before they become effective.

Resistance mechanisms against extended-spectrum cephalosporins are mainly due to the production of extended-spectrum cephalosporinases by the resistant bacteria. A variety of such enzymes have been described inSalmonella, and the majority belong to cefotaxime-hydrolyzing β-lactamases (CTX-M types) or CMY-2 AmpC β-lactamase that could hydrolyze cephalosporins as well as cephamycins (4,13,24,58,59,66,69). The genes encoding these extended-spectrum cephalosporinases could be carried by conjugative plasmids (4,13,34,58,65,67,69), transposons (65), or integrons (34,65). These mobile genetic elements could spread, under selective pressure, horizontally between enteric organisms (58,67). Genotyping and plasmid analysis indicated that both clonal dissemination and horizontal transfer of resistance genes, such as blaCMY-2, may contribute to the spread of the resistance determinant (66). Identical blaCMY-2-carrying plasmids have been found in Salmonella isolates with distinct chromosomal DNA patterns (66), while genetically related Salmonella isolates could harbor unrelated blaCMY-2-carrying plasmids (69). Moreover, the spread of blaCMY-2 among Salmonella isolates also could occur through the mobilization of non-conjugative plasmids that carry the resistance gene (13).

The mechanisms for Salmonella isolates to develop fluoroquinolone resistance involve mutations in the quinolone resistance-determining regions (QRDRs) of the DNA gyrase genes, active efflux, and decreased outer membrane permeability (17). The most frequently observed point mutations of the gyrA gene in fluoroquinolone-resistant Salmonella are the amino acid changes at serine-83 to phenylalanine,

tyrosine, alanine, or at aspartic acid-87 to glycine, asparagine, or tyrosine (17). Mutations in the gyrB (25,32), parC (13,25), and parE (25) genes have all been found in fluoroquinolone-resistant Salmonella. Recent reports indicated that an AcrAB-TolC efflux system and its regulatory genes, marRAB and soxRS, also participate in the resistance to fluoroquinolones in Salmonella (33,47).

High-level resistance (MIC, ≥32 µg/mL) to fluoroquinolones can be reached when the individual mechanism described above appears step by step (33), although the active efflux seems to play a major role in Salmonella. When the acrB gene was inactivated, resistance levels to fluoroquinolones significantly reduced even though multiple target gene mutations are present (5). A recently identified efflux pump inhibitor, Phe-Arg-naphthylamide (MC207,110), exhibits an efficient inhibitory effect to the efflux system and was considered a promising therapeutic agent in combination therapy with fluoroquinolones to treat multi-drug resistant Salmonella infections (5). However, the use of such efflux pump inhibitors in the clinical setting needs further evaluation.

back to top

Laboratory Detection of Antimicrobial Resistance

Similar to other enteric bacteria, phenotypic examination of antimicrobial resistance in Salmonella is performed using standard methods suggested by the National Committee for Clinical Laboratory Standards (NCCLS) or now the Clinical and Laboratory Standards Institute (CLSI). Although many reports have demonstrated the production of extended-spectrum cephalosporinases among Salmonella serotypes, NCCLS guidelines have not suggested the routine screening for the production of extended-spectrum β-lactamases among these bacteria. Failure to identify drug-resistant Salmonella organisms might affect the treatment outcome of patients with invasive salmonellosis. Similarly, Salmonella with reduced fluoroquinolone susceptibility may not be detected by the standard disc diffusion method using the current NCCLS criteria (44). However, treatment by fluoroquinolones on extraintestinal infections caused by such Salmonella is relatively poorer, compared to infections caused by the susceptible strains (44). It is now known that nalidixic acid – the prototypic quinolone – is a good predictor for the reduced susceptibility to fluoroquinolones in Salmonella (35). Therefore, NCCLS has recommended in the 2003 guidelines that nalidixic acid may be used to detect such reduced susceptibility to fluoroquinolones in isolates recovered from patients with extraintestinal Salmonella infections.

back to top

ANTIMICROBIAL THERAPY

Gastrointestinal Infections

Anticrobial therapy is usually not indicated for non-toxic immunocompetent patients. Gastroenteritis caused by non-typhoid Salmonella is a self-limiting disease and treatment should consist mainly of replenishing liquids and electrolytes. A study performed on uncomplicated non-typhoid Salmonella gastroenteritis in children comparing the usefulness of oral azithromycin 10 mg/kg/day, cefixime 10 mg/kg/day, or no antibiotics for 5 days showed that no benefits were obtained with antibiotic treatment (12). This was confirmed by a meta-analysis, which showed no evidence of any clinical benefit of antibiotic therapy in otherwise healthy children and adults with non-severe Salmonella gastroenteritis. Antibiotics appear to prolong Salmonella shedding from stools at the convalescent stage (54). Antibiotics apparently eradicate gastrointestinal flora that protects the gastrointestinal tract.

However, although the risk of developing bacteremia is low (< 5% of all patients), certain patients, such as young infants < 3 months old, patients with toxic appearance and suspected extraintestinal infection, immunocompromised patients, and patients with severe colitis would benefit from empirical antibiotic treatment (38).

Empirical treatment consists of administering an oral or intravenous antibiotic for 48-72 h, or until the fever remits and the culture becomes negative. The choice of the antibiotic depends on the characteristics of patients, the susceptibility pattern of the strain and the clinical condition (Table 3). Options include ampicillin, trimethoprim-sulfamethoxazole, fluoroquinolones or third-generation cephalosporins, depending on the results of in vitrosusceptibility testing or the prevalence of known resistant strains in a specific geographical area. In a 2003 study, children admitted to the hospitals with gastroenteritis, some infected by resistant strains, ceftriaxone was the best therapeutic option (10). Although the fluoroquinolones are not recommended in children, they may be used in serious infections if there is no other alternative treatment available. In infections caused by susceptible organisms, treatment with an oral fluoroquinolone, trimethoprim-sulfamethoxazole or amoxicillin is recommended.

back to top

Extraintestinal Infections

Bacteremia should be treated with third-generation cephalosporins or fluoroquinolones, taking into account the in vitro activity of these compounds against Salmonella. In cases of high-grade bacteremia (positivity of > 50% of the three blood cultures), the existence of endovascular infection should be

investigated. If such lesions are confirmed, treatment with third-generation cephalosporins should be given for 6 weeks, and in some cases, surgery would be indicated. Less experience in treating these conditions with fluoroquinolones has been obtained, although therapeutic failures have been described associated with nalidixic acid-resistant strains. In the case of low-grade bacteremia, treatment should be given for 10-14 days.

In patients with AIDS experiencing their first episode of bacteremia, intravenous antibiotic treatment for 1-2 weeks is indicated, followed by the administration of an oral fluoroquinolone for 4 weeks in order to eradicate the organism and reduce the risk of recurrence. Patients who relapse should be given prolonged treatment with trimethoprim-sulfamethoxazole or fluoroquinolones, depending on the antibiotic susceptibility of the isolate (40).Zidovudine has been reported to be active against this pathogen and patients given this drug as part of their antiretroviral therapy are better protected against recurrence (7).

Focal infections due to Salmonella may be found at different locations and their cure depends on the degree of penetration of the antibiotic at the site of the infection (46). In general, 2-4 weeks of antibiotic therapy is recommended (depending on the site) and if possible, drainage or surgical removal of the lesions should be performed. In cases of chronic osteomyelitis, abscesses, and urinary or biliary tract abnormality, surgical interventions may be required in addition to prolonged antibiotic therapy in order to eradicate the bacteria.

Recently, treatment of extraintestinal salmonellosis with ciprofloxacin has been questioned if the strains are nalidixic acid - resistant in vitro. A growing body of clinical and microbiological evidence indicates that such nalidixic acid - resistant Salmonella infections exhibit a decreased clinical response to fluoroquinolones, with subsequent therapeutic failure despite being susceptible in vitro by NCCLS criteria for quinolones. Therefore, short-course fluoroquinolone therapy should be avoided in extra-intestinal infections caused by nalidixic acid - resistant strains (1,21,68).

Involvement of the central nervous system results in a high mortality (>50%). The treatment of choice is high-dose ceftriaxone, as this drug penetrates the blood-brain barrier. For meningitis, antibiotic treatment should be continued for 4-6 weeks, in order to prevent relapse. Urinary tract infections due to Salmonella may be secondary to bacteremia and should be treated with drugs with high renal excretion, such as trimethoprim-sulfamethoxazole or fluoroquinolones.

Many antibiotics can be shown to have excellent in vitro activity but are clinically ineffective. Thus the aminoglycosides, polymyxins, and tetracyclines should not be used for systemic Salmonella infection despite their in vitro activity. There is limited evidence that large intravenous doses of some first- or second-generation cephalosporins have therapeutic value. These drugs should be considered only as possibly useful.

Reactive arthritis and undifferentiated oligoarthritis occur in some patients and are postinfectious complications of gastroenteritis caused by this pathogen. In such cases, long-term ciprofloxacin treatment has not been proven to be beneficial (53).

back to top

ADJUNCTIVE THERAPY

Surgical drainage is indicated for localized Salmonella infections. Mycotic aneurysm, the most severe form of extraintestinal non-typhoid Salmonella infection, was almost uniformly fatal in early days; however, publications of case reports and series revealed that early surgical intervention greatly increased survival (14,45,55). Most surgeons consider the excision of an infected vessel with extra-anatomic vascular reconstruction to be the surgery of choice for abdominal mycotic aneurysm (61). In addition, a prolonged course of antibiotics for 6 weeks or longer is indicated (14,45,55). A review of 136 evaluable cases seen from 1948 through 1999 found a 62% survival rate for all patients treated with combined surgical and medical therapy (14,45,55). This improved survival was apparently due to the use of advanced diagnostic techniques, surgery, and antimicrobial therapy.

back to top

ENDPOINTS FOR MONITORING THERAPY

Complete recovery is the rule in healthy children who develop Salmonella gastroenteritis, so monitoring for resolution of symptoms is usually sufficient. Young infants and immunocompromised patients often have systemic involvement, a prolonged course, and extraintestinal foci. So, objective parameters should be monitored including fever and white blood cell count. Children with sickle cell disease and osteomyelitis must receive at least 6 weeks of antibiotic treatment. Patients with HIV infection and salmonellosis need long-term oral suppressive therapy, in addition to the standard intravenous antibiotic treatment. The response of the infection to antibiotics in these patients is less predictable and relapses are not uncommon.

back to top

VACCINES

Non-typhoid Salmonella causing gastroenteritis in humans are most often transmitted through the food chain by contamination of poultry and eggs, pork procedures, beef and dairy products, and increasingly in the US by vegetables and fruits that are irrigated in the globally dispersed truck farm with Salmonella-contaminated water (42). The theoretical efficacy of vaccines which prevent the infection and colonization of animals with Salmonella is uncertain. The difficulty is that most Salmonella serotypes colonizing the animal species that are passed to humans are normal flora for these animals. The design of any vaccine to block colonization of or infection by “normal flora” is a difficult task.

There are a number of licensed live attenuated Salmonella vaccines for poultry, swine, and cattle. Most of these vaccine strains are auxotrophic for chorismic acid biosynthesis (the aro mutants), which have deletions in genes encoding adenylate cyclase (cya) or cyclic 3’, 5’-adenosine monophosphate receptor protein (crp) (22,23). All of these mutants are attenuated, yet highly immunogenic in animal models. Some of these vaccines have been used extensively to control Salmonella infection in domestic animals. However, the efficacy of vaccination of these animals in reducing Salmonella transmission through the food chain to humans is unknown.

back to top

PREVENTION OR INFECTION CONTROL MEASURES

General

Reservoirs for non-typhoid Salmonella organisms include a wide range of domestic and wild animals, such as cattle, poultry, swine, rodents, and pets like iguanas, turtles, dogs, cats, chicks, and ducklings. In humans infected with Salmonella, the excretion of bacteria can last throughout the course of infection and as a temporary carrier state for months. The mode of transmission may include ingestion of the organisms in food derived from infected animals or contaminated by feces of an infected animal or person. The source may be contaminated meat, poultry, eggs, milk, and their products, as well as water, fruits and vegetables. Preventive measures therefore should include the education of food handlers about hand hygiene, refrigerating foods in small portions, thoroughly cooking all foodstuffs, avoiding recontamination of cooked food, and maintaining a sanitary kitchen to prevent from contamination by rodents and insects. The public should be educated about the importance of consuming well-cooked

food. Adequate Salmonella control programs should be established for feed control, vector control, and other sanitary measures in the animal husbandry.

back to top

Infection Control

For hospitalized patients with salmonellosis, enteric precautions in handling feces and contaminated clothing and bed linen are required. Proper handwashing should be stressed. Terminal cleaning is required when the patient has discharged. Symptomatic individuals must be excluded from food handling and from direct care of patients. Permission to return to work in handling food or in patient care generally requires at least two consecutive negative stool cultures for Salmonella collected not less than 24 hours apart; if antibiotics have been given, the initial culture should be taken at least 48 hours after the last dose.

http://www.antimicrobe.org/new/b258.asp

Detection of Salmonella and several common Salmonella serotypes in food by loop-mediated isothermal amplification method

Zhongqiang Chen1, Ke Zhang1, Huan Yin, Qi Li, Lan Wang, Zhiguo Liu

Abstract

Salmonella Choleraesuis, S. Enteritidis and S. Typhimurium are the main pathogens that contaminate animal products and cause human Salmonella food poisoning. To establish the loop-mediated isothermal amplification (LAMP) method for the rapid detection of Salmonella and 3 common Salmonella serotypes, inner and outer primer sets targeting Salmonella invE gene and 3 serotype-specific genes fliC, lygD and STM4495 were designed. The LAMP reaction conditions were optimized. The specificity of LAMP primers was identified by testing 10 different bacterial strains including S. Choleraesuis, S. Enteritidis and S. Typhimurium. Take S. Choleraesuis as example, the detection limit of LAMP assay was 1.33 × 101 CFU/mL for bacteria culture and 2.0 × 101 CFU/mL for simulated pork sample. The results show that LAMP is a rapid, sensitive and specific method for Salmonella detection and can be used for the rapid detection of Salmonella in food.

1. Introduction

Salmonella is a significant pathogen for humans and animals. It cannot only cause a variety of livestock and poultry diseases, but also cause food poisoning in humans [1]. Currently, diseases caused by Salmonella rank first in food poisoning diseases in China [2]. Among the foods that cause Salmonella poisoning, more than 90% are meat and other animal products [3] and [4]. Statistics show that S. Choleraesuis, S. Enteritidis and S. Typhimurium are the major pathogenic bacteria that contaminate animal products and cause human Salmonella poisoning. They cause significant harm to human health and livestock development [5].

The conventional detection methods for Salmonella include bacterial culture, biochemical and serological identification methods. These methods are complicated, time-consuming and laborious, costly and require a variety of reagents. With the development of molecular biology and immunology methods, a number of PCR-based detection techniques have been established, such as immuno-PCR, real-time quantitative PCR and multiplex PCR [6] and [7], as well as immunoassay methods based on antigen. These methods are fast, sensitive and accurate. As these modern detection methods for Salmonella require certain equipment, technique know-how and expensive reagents, they are less economical and practical. To conduct extensive and rapid detection of Salmonella and effectively prevent and control Salmonella food poisoning at the grassroots level, the establishment of a practical, simple, rapid and sensitive detection method is necessary.

The significance of loop-mediated isothermal amplification (LAMP) method in microbial detection has been drawn increasing attentions recently [8]. It was developed by Notomi et al. in 2000 [9]. It amplifies nucleic acids within tens of minutes by self-circulation of strand displacement DNA polymerase under isothermal conditions. With the advantages of high specificity and sensitivity, simplicity, rapidity and cheapness, it has been widely applied in many areas [10]. Research shows that invE gene exits in all Salmonella serotypes but not in non-Salmonella bacteria [11], while fliC, lygD and STM4495 specifically exists in S. Choleraesuis, S. Enteritidis and S. Typhimurium, respectively [12], [13] and [14]. Therefore, the specific sequences in invE, fliC, lygD and STM4495 genes were selected as the target sequences for LAMP assay.

2. Materials and methods

2.1. Bacterial strains

S. Enteritidis CICC 21513, S. Typhimurium CICC 21483, S. Choleraesuis CICC 21513, Streptococcus hemolyticus CICC 10373, Shigella flexneri CICC 21534, Shigella boydii CICC 21680 and Shigella sonnei CICC 21594 were obtained from China Industrial Microbiology Culture Collection. Staphylococcus aureus, Escherichia coli DH5α, Bacillus subtilis were preserved in our laboratory.

2.2. Preparation of DNA

The DNA template was prepared by boiling method [15]. The single Salmonella colony was picked and dissolved in 100 μL distilled water, lysed by water bath at 100 °C for 15 min and ice bathed for 5 min. The reactants were then centrifuged at 12,000 r/min for 5 min at 4 °C. The supernatant that contained DNA template was used for LAMP.

2.3. Primer design and synthesis

The LAMP reaction needs four oligonucleotide primers: forward inner primer (FIP), back inner primer (BIP), forward outer primer (F3) and back outer primer (B3). The primers targeting Salmonella invE gene and 3 serotype-specific genes fliC, lygD and STM4495 were designed according to the sequences published in GenBank. The primer sequences are listed in Table 1. Primers were synthesized by Generay Biotech Co., Ltd. (Shanghai, China).

Table 1.

LAMP primer sets for amplifying invE, fliC, lygD and STM4495.

Target gene Primer Sequence (5 → 3 )′ ′

invE invE F3

invE B3

invE FIP

invE BIPGTTACGAAATTGCGCCAGC

TGGCTCAACCTCCGGTAT

AGGATTCGTCTCCAGGGGCGCCGCTGACATTTCGTCCG

TGCGGCCTGTTGTATTTCCGCTTGTCCCGGCAGACATCT

fliC fliC F3

fliC B3

fliC FIP

fliC BIP CTGTCAGTGGATACGATGA

CTGCATCTGCAACTCCT

CGCAAAAGTAACTGCTCCTGTAGATAAAAATGGAACCTATGAAGTC

CTTACCAACTGATGCAAAAGCAGTTTTTTAATGCAGCTTTCGCA

lygD lygD F3

lygD B3

lygD FIP

lygD BIP TGTCTGCTCACCATTCG

ACAATCTACCGTCAGTCAC

ACCGGATTTGGCCGATCTAATGAAGTTGTCATCGTAAGTACC

CGTAACTCTTCGGGTTTAACTCTCTATTTGAACGGTAAGGCACC

STM4495 STM4495 F3

STM4495 B3

STM4495 FIP

STM4495 BIP GATAATTTCATCTTCAATTTCTGG

AATTTTTGCGTGAGATATCGT

GCACTCCGGTTGTAAACCATTATTTGTACTGAGGCTAATTCACCAC

CGCAGCGTAAAGCAACTCATCCAAAAGGGTTTGTTTTTGATG

Table options

2.4. LAMP reaction and condition optimization

LAMP reaction was carried out in a 25 μL mixture which contained inner and outer primer sets, Bst DNA polymerase, dNTPs, 1× ThermoPol buffer and DNA template. The mixture with Bst DNA polymerase absent was water bathed at 95 °C for 5 min, then quickly cooled on ice. After cooling, Bst DNA polymerase was added. The mixture was incubated at certain temperature for tens of minutes in a thermal cycler (UNO II, Whatman Biometra, Germany), then heated to 80 °C for 10 min to terminate the reaction. The LAMP products were electrophoresed in a 1% agarose gel and visualized by ethidium bromide staining. The concentration ratio between inner and outer primer sets, reaction duration and temperature were optimized to determine the most efficient amplifying conditions of LAMP. The efficiency was analyzed by electrophoresis.

2.5. Specificity of LAMP detection

The specificity of LAMP primers was identified by LAMP detection for the 3 major strains of pathogenic Salmonella serotypes, i.e., S. Choleraesuis, S. Enteritidis and S. Typhimurium and seven non-Salmonella strains.

2.6. Sensitivity of LAMP detection

The single colony of Salmonella was picked after culturing for 2 days, dissolved in 1 mL liquid medium and mixed. 10-fold serial dilutions of the bacteria liquid was carried out with saline. Plate cultivation counting was performed with 100 μL bacteria liquid of each dilution. DNA was prepared by boiling. LAMP amplification was conducted by using 1 μL of supernatant after quantitation.

2.7. LAMP assay of Salmonella in simulated pork samples

2.5 g sterilized fresh pork homogenized in 22.5 mL sterile saline worked as the diluent for Salmonella. The bacteria liquid was 10-fold serially diluted. Samples were taken for plate cultivation counting. DNA template was prepared for LAMP.

3. Results and discussion

3.1. Optimization of LAMP reaction conditions

The LAMP products appeared as a ladder of multiple bands, while no bands was amplified from no template control. Take S. Choleraesuis as example, the optimum concentration ratio of inner and outer primers was 3:1 ( Fig. 1A); the typical DNA ladder appeared after amplification for 45 min, while better stability was observed after amplification for 60 min (Fig. 1B); the optimal temperature was 65 °C (Fig. 1C).

Optimization of LAMP reaction conditions.

Fig. 1.

Optimization of LAMP reaction conditions.

Figure options

The LAMP products under different reaction conditions were electrophoresed in 1% agarose gel and stained with ethidium bromide. (A) Determination of optimal concentration ratio between inner and outer primers. M, DNA marker (DL2000); Lane1–4, the concentration ratio between inner and outer primers was 4:1, 3:1, 2:1 and 1:1, respectively; Lane 5, negative control. (B) Optimization of reaction duration. M, DNA marker; Lane 1–6, LAMP reaction carried out for 30, 45, 60, 75, 90 and 105 min, respectively; Lane 7, negative control. (C) Optimization of reaction temperature. M, DNA marker; Lane 1–4, LAMP reaction carried out at 61, 63, 65 and 67 °C, respectively; Lane 5, negative control.

3.2. Specificity of LAMP detection for Salmonella

3.2.1. Genus-specificity of LAMP detection for Salmonella

Amplification reactions were performed using invE LAMP primers to detect the 10 strains of Salmonella and non-Salmonella bacteria. The LAMP results showed that the characteristic ladder bands were amplified from the DNA templates of 3 strains of Salmonella, while not from that of the 7 non-Salmonella strains ( Fig. 2).

Genus-specificity of LAMP detection for Salmonella.

Fig. 2.

Genus-specificity of LAMP detection for Salmonella.

Figure options

Salmonella is one of the major pathogens of food poisoning, among which S. Choleraesuis, S. Enteritidis and S. Typhimurium are dominant. The protein encoded by invE gene is the main virulence factor [11] and play an important role in Salmonella pathogenesis. The results indicated that the invE LAMP primers were highly specific for Salmonella.

The genus-specificity of invE LAMP primers was determined by amplifying the 10 different bacterial strains; the products were electrophoresed in 1% agarose gel and stained with ethidium bromide. M, DNA marker (DL2000); Lane 1–10, LAMP amplifications of DNA templates from S. aureus, E. coli DH5α, S. hemolyticus, B. subtilis, S. Enteritidis, S. Typhimurium, S. Choleraesuis, S. flexneri, S. boydii and S. sonnei, respectively; Lane 11, negative control.

3.2.2. Specificity of LAMP detection for the 3 major strains of pathogenic Salmonella serotypes

Amplification reactions were conducted using LAMP primers for fliC, lygD and STM4495 to detect the 10 strains respectively ( Fig. 3). As FliC gene encoding S. Choleraesuis flagellum protein is conservative at both ends, but multifarious in the middle area among Salmonella serotypes [12] and [16]. LygD gene exists only in S. Enteritidis genome [13] and in all the genomes of 39 S. Enteritidis phage types that isolated from clinical samples [17]. The region including genes STM4488 to STM4497 houses a putative type II restriction enzyme that is only present in S. Typhimurium [14]. Therefore, the specific sequences in invE, fliC, lygD and STM4495 genes were selected as the target sequences for LAMP assay. The results in Fig. 3 showed that the characteristic ladder bands were amplified only from the DNA templates of their corresponding Salmonella serotypes, while not from that of the other 2 serotypes or the 7 non-Salmonella strains.

Specificity of LAMP detection for the 3 Salmonella serotypes.

Fig. 3.

Specificity of LAMP detection for the 3 Salmonella serotypes.

Figure options

LAMP specificity was determined by amplifying the DNA of 10 different strains using primers for fliC (A), lygD (B) and STM4495 (C), respectively; the products were electrophoresed in 1% agarose gel and stained with ethidium bromide. M, DNA marker (DL2000); Lane 1–10, LAMP amplifications of DNA

templates from S. aureus, E. coli DH5α, S. hemolyticus, B. subtilis, S. Enteritidis, S. Typhimurium, S. Choleraesuis, S. flexneri, S. boydii and S. sonnei, respectively; Lane 11, negative control.

3.3. Sensitivity of LAMP detection for Salmonella

Salmonella was 10-fold serially diluted in saline and the DNA templates of each dilution were extracted for LAMP reactions. The results exemplified by S. Choleraesuis showed that the LAMP products could be detected to 10−7 dilution (Fig. 4A), and the detection limit was 1.33 × 101 CFU/mL by calculation according to the plate counting. When 0.3 μL SYBR Green was added into the LAMP products, fluorescence was observed under the UV light in the amplifications from the templates of 10−6 dilution (Fig. 4B). The detection limit of PCR for S. Choleraesuis was 1.67 × 102 CFU/mL when assays were performed with different dilutions (Fig. 4C). The detection results of the sensitivity for the other serotypes are shown in Table 2.

Sensitivity of LAMP detection.

Fig. 4.

Sensitivity of LAMP detection.

Figure options

Table 2.

Sensitivity of LAMP and PCR for the detection of Salmonella.

Bacterial Strain Target Gene LAMP detection limit for bacteria culture (CFU/mL) PCR detection limit for bacteria culture (CFU/mL) LAMP detection limit for simulated pork sample (CFU/mL)

Salmonella invE 2.0 × 101 2.33 × 103 1.67 × 101

S. Choleraesuis fliC 1.33 × 101 1.67 × 102 2.0 × 101

S. Enteritidis lygD 2.33 × 101 1.33 × 103 2.67 × 101

S. Typhimurium STM4495 1.67 × 101 2.17 × 102 2.0 × 101

Table options

(A) The electrophoresis analysis of LAMP products of S. Choleraesuis culture with 10-fold serial dilutions. M, DNA marker (DL2000); Lane 1–6, S. Choleraesuis culture with 10−3, 10−4, 10−5, 10−6, 10−7 and 10−8 dilutions, respectively; Lane 7, negative control. (B) SYBR GREEN fluorescence analysis of LAMP products

of S. Choleraesuis. Tube 1–4, S. Choleraesuis culture with 10−5, 10−6, 10−7 and 10−8 dilutions, respectively; Tube 5, no template control. (C) The electrophoresis analysis of PCR products of S. Choleraesuis with serial dilutions, with the positive band of 221 bp. M, DNA marker (DL2000); Lane 1–6, S. Choleraesuis culture with 10−3, 10−4, 10−5, 10−6, 10−7 and 10−8 dilutions, respectively; Lane 7, negative control.

3.4. LAMP detection for Salmonella in simulated pork samples

Salmonella was 10-fold serially diluted with sterilized pork homogenate and DNA was extracted from each dilution for LAMP assay. The results exemplified by S. Choleraesuis showed that the LAMP products could be detected to 10−6 dilution (Fig. 5), and the detection limit was 2.0 × 101 CFU/mL by calculation according to the plate counting.

LAMP detection of S. Choleraesuis in simulated pork samples.

Fig. 5.

LAMP detection of S. Choleraesuis in simulated pork samples.

Figure options

The products were electrophoresed in 1% agarose gel and stained with ethidium bromide. M, DNA marker (DL2000); Lane 1–4, LAMP detection of S. Choleraesuis diluted to 10−4, 10−5, 10−6 and 10−7, respectively, with sterilized pork homogenate; Lane 5, negative control; Lane 6–7, LAMP with sterilized pork homogenate as template.

4. Conclusion

In this study, we demonstrated that LAMP amplification for invE gene could successfully detected S. Enteritidis, S. Choleraesuis and S. Typhimurium with invE in their genome, while could not detect non-Salmonella strains. And LAMP amplifications for fliC, lygD and STM4495 genes could detect their corresponding Salmonella serotypes respectively, while did not cross-reacted with the irrelevant Salmonella serotypes or non-Salmonella strains. This indicated that the invE LAMP primers and the sequences in invE, fliC, lygD and STM4495 genes were highly specific for Salmonella.

The detection limit of Salmonella was 2.0 × 101 CFU/mL when LAMP assay was exploited for invE gene, which was 2.33 × 103 CFU/mL by PCR for invE. The results indicated that LAMP assay was more sensitive than PCR.

The LAMP reactions can be accomplished at a constant temperature of 63–65 °C within 45–70 min and terminated by inactivate the enzyme at 80 °C for 10 min. Just a thermostat water bath will work. Sample consumption is less and DNA template preparation is simple. Furthermore, identification methods of LAMP products are simple and various, such as observing precipitation by naked eyes, adding SYBR Green and agarose gel electrophoresis.

In conclusion, the LAMP detection method for pathogenic Salmonella is specific, sensitive, simple, rapid and cost-effective. It has wide application prospect in the rapid detection of S. Choleraesuis, S. Enteritidis, S. Typhimurium and other pathogenic Salmonella in food.

http://www.sciencedirect.com/science/article/pii/S2213453015000270

Evaluation of an indirect ELISA for the detection of Salmonella in chicken meat

ABSTRACT

In this work, an indirect ELISA based on a monoclonal antibody (MAb) specific for an outer membrane protein of Salmonellaenterica serovar Enteritidis was used for detection of Salmonella in 154 samples of chicken meat. Its efficiency was determined through comparison with the results obtained from the conventional method. The prevalence of samples contaminated with Salmonella was 23% with the conventional culture method, and 26% with the ELISA. From thirty-five samples positive for Salmonella by the conventional method, 33 were also positive by ELISA. Seven other samples were only positive in the ELISA. Comparison of the results obtained in the two methods showed an ELISA sensitivity and specificity of 94%, and positive and negative predictive values of 82% and 98% respectively. The serotyping of the isolates revealed 31 Salmonella enterica serovar Enteritidis, 2 Salmonella enterica serovar Heidelberg, 1 Salmonella enterica serovar Choleraesuis and 1 Salmonella enterica sorovar 6,7:-:-.

Key words: Salmonella, monoclonal antibody, policlonal antibody, ELISA

INTRODUCTION

Salmonella bacteria are often involved in outbreaks of gastroenteritis all over the world (21,28). As Salmonella is widely spread throughout the environment, contaminating water and a wide range of foods, it represents a serious problem for public health and it is therefore necessary to have fast and reliable methods of detection.

The conventional method of cultivation used in detection is reliable but slow as it includes stages of pre-enrichment, selective enrichment, cultivation in selective agars, biochemical characterisation of suspected isolates and a final serological confirmation (20). The relatively long time required to carry out analysis (4-7 days) as well as the costs incurred and the storage of foods suspected of being contaminated have stimulated the development of faster detection methods that can be useful in studies of the source of contamination and of outbreaks due to food contamination (7,15,19).

Among the methods that have already been put forward are DNA hybridisation (1,17), polymerase chain reaction (3,30,35), tests with specific bacteriophages (4), latex agglutination tests (9,11,32), immunomagnetic assays (29,34) and other types of immunoenzymatic assays (24,33,36,37).

The enzyme-linked immunosorbent assay (ELISA), a type of immunoenzymatic assay that uses solid phases to anchor the antibody-antigen complex, have been widely used because offer several advantages. One of these is the capacity to detect the presence of bacteria antigens without the cells having to be viable (24). Besides, many ELISA tests, mainly those that use polyclonal antibodies, show good sensitivity, but have restricted specificity for certain serovars. Others use a combination of polyclonal antibodies in order to obtain a wide spectrum of specificity. However, this method may potentialize the occurrence of unspecific reactions due to the nature and the way that these antibodies are obtained (6).

The use of monoclonal antibodies (MAbs) with high specificity and affinity has been a good alternative in making ELISA tests more reliable. The use of a combination of MAbs for specific Salmonella epitopes is also an important tool in order to increase the sensitivity of the ELISA (10).

This study aims to evaluate an ELISA system that uses a specific monoclonal antibody for a protein taken from the external membrane of Salmonella Enteritidis in the detection of Salmonella in naturally contaminated chicken.

http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1517-83822006000300027

A survey of dairy calf management practices in some producing regions in Brazil

Glauber dos Santos 1 , Carla Maris Machado Bittar 2

ABSTRACT

This study aimed to characterize the Brazilian dairy calves raising systems through a survey of major aspects of animal husbandry. One hundred seventy-nine producers and/or technicians were interviewed. The questionnaire addressed issues related to the management of the dry cow and the newborn, nutritional management of the liquid-feeding phase, housing, and health management. A third of newborn calves stay with their mothers for more than 24 h after delivery, and only 56% of the calves receive colostrum within the first 8 h of life. Four out of ten producers allow the calf to suckle colostrum directly from the mother. Regarding the liquid diet, 44 and 35% of the farms provide marketable milk and discard milk for the calves, respectively. It was possible to identify several areas of improvement in the raising system; for instance, greater attention could be given to dry cows and the monitoring of births and to the establishment of adequate protocols to evaluate colostrum quality and feeding management.

INTRODUCTION

High mortality and/or morbidity rates of newborn animals, caused mainly by failures in the transfer of passive immunity, are the main causes for this inefficiency in the dairy activity. However, the identification of inadequate handling practices and improvements in the processing of colostrum feeding can reduce mortality and consequently production costs.

Several factors can cause failures in passive immunity transfer, some of which are linked to the animal, both cows and newborns; others are linked to human factors such as producers and employees. With relation to the cow, factors can be linked to the calving number, breed, volume of colostrum produced, extension of the dry period, and presence of mastitis, all of which can influence this transfer (Robison et al., 1988; Machado Neto et al., 1995). The newborn, on the other hand, should have the ability to

consume and to absorb the colostrum constituents in adequate amounts (James et al., 1983; Losinger and Heinrichs, 1995), which is reduced over time after birth.

In several countries, some studies have already been conducted to understand how producers raise replacement animals (Machado Neto et al., 2004; Kehoe et al., 2007; Vasseur et al., 2010; Walker et al., 2012). Through these studies, it was possible to provide information on handling regarding the feeding and health management of the calves, all of which contribute to a reduction in the animal mortality and morbidity rates.

As regards the data from Brazilian systems, there is a scarcity of studies that characterize the production of dairy calves; in the literature, only one study focused on issues related to colostrum feeding, but in a specific state of Brazil (Machado Neto et al., 2004). Despite the wealth of information, the study did not reveal more detailed information about the production of dairy calves considering dry cows and weaning. Unlike countries such as the USA, which maintain studies about characterization of milk production systems in order to understand and to identify problems, Brazil does not have a government program with this purpose. Thus, the objective of this study was to characterize the current dairy calf management practices in important dairy productions states (Minas Gerais, Paraná, and São Paulo), which can help with the understanding of challenges on dairy calf raising, labor training opportunities, and direction of future research.

http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1516-35982015001000361

A Survey of Management Practices That Influence Performance and Welfare of Dairy Calves Reared in Southern Brazil

Maria J. Hötzel,* Cibele Longo, Lucas F. Balcão, Clarissa S. Cardoso, and João H. C. Costa

Abstract

Here we report dairy calf management practices used by 242 smallholder family farmers in the South of Brazil. Data were collected via a semi-structured questionnaire with farmers, inspection of the production environment and an in-depth interview with a sample of 26 farmers. Herds had an average of 22.3 lactating cows and an average milk production of 12.7 L/cow/day. Calves were dehorned in 98% of the farms, with a hot iron in 95%. Male calves were castrated in 71% of the farms; methods were surgery (68%), emasculator (29%), or rubber rings (3%). No pain control was used for these interventions. In 51% of the farms all newborn male calves were reared, sold or donated to others; in 35% all newborn males were killed on the farm. Calves were separated from the dam up to 12 h after

birth in 78% of the farms, and left to nurse colostrum from the dam without intervention in 55% of the farms. The typical amount of milk fed to calves was 4 L/day until a median age of 75 days. In 40% of the farms milk was provided in a bucket, in 49% with bottles, and in 11% calves suckled from a cow. Solid feeding in the milk-feeding period started at a median age of 10 days. Calves were housed individually in 70% of the farms; in 81% of the farms calves were housed in indoor pens, in 6% in outdoor hutches and in 13% they were kept on pasture. Diarrhoea was reported as the main cause of calf mortality in 71% of the farms. Farmers kept no records of calf disease, mortality, or use of medicines. Changing the scenario identified in this survey is essential to support the sustainable development of dairy production, an activity of great economic and social relevance for the region.

Go to:

Introduction

In the state of Santa Catarina, the fifth largest and fastest growing Brazilian dairy producer [1], 87% of the milk is produced in family farms of up to 50 ha [2]. Milk generates income to an estimated 50 thousand families and employment opportunities to many others [3], [4]. For these reasons the milk production chain is considered among the most important activities for family farming by the Brazilian Federal Government, which supports it through a variety of programs [5].

Animal welfare is recognised as an essential component of the social pillar of sustainability for the dairy industry [6], [7]. Societal concerns regarding the ethical treatment of animals have raised the interest in animal welfare in Brazil [8]. The quality of dairy calves' rearing may impact the welfare of the calves, the productive outcome of the future cow and, through heifers' survival indices, the rate of genetic improvement of the herd. In recent years there has been important scientific advancement on our understanding of several aspects of dairy calf rearing that influence their growth, health and wellbeing. Neonatal calf care, feeding and housing practices, the fate of newborn male calves and pain inflicting procedures practiced routinely in dairy farms are considered some of the most critical areas in calf rearing that impact animal welfare [6], [9], [10].

Colostrum management is key to calf health, survival and welfare, as inadequate intake leads to increased mortality and risk of diseases such as diarrhoea and respiratory illnesses [11]. Feeding calves known amounts of colostrum soon after birth is more effective [12]–[14] than leaving them to suckle for colostrum from the dam without supervision, which increases the risk of failure of passive transfer (defined as a circulating immunoglobulin concentration bellow 10.0 g/L [15]). Besides conferring immunity to the neonate, colostrum stimulates the maturation and function of the gastrointestinal tract in neonate calves, enhancing the absorptive capacity of the gastrointestinal tract [16].

Neonate management often includes early separation from the dam. A recent study involving North American citizens [17] suggests that most people not familiar with the dairy industry oppose this practice, which contrasts with a more favourable view among farmers, veterinarians and other dairy professionals. The views of the latter are underpinned by perceptions that early separation prevents disease transmission and reduces separation stress in the cow and calf [10]. Also based on these reasons, early separation is widely recommended in the Brazilian technical literature [18], [19]. However, contact with the dam during early life may have several advantages, like favouring calf growth and health and reducing abnormal behaviours [16], [20]–[23].

Until recently there has been some controversy in the literature regarding the long term effects of early growth on the onset of puberty, first lactation and milk production – with some studies reporting no relationship [24], [25] and others reporting a positive association [26], [27]. A recent meta-analysis of 12 published studies concluded that increasing nutrient intake from milk or milk replacer in preweaned calves has overall positive impacts on first lactation milk production [28]. However, dairy calves are often provided limited milk allowances, which besides potentially restricting growth, reduce health [29], increase risk of perinatal mortality [30], and are associated with behaviours indicative of hunger [31]–[33].

Most preweaning calves are housed individually in farms in the United States [34], Canada [35], and Europe [36]. Group housing may improve postweaning growth [37], [38] and the development of cognitive and social skills [39]–[41]. The preference for individual housing stems from the idea that this management can reduce the incidence of cross-suckling and disease transmission [10]. These problems may be reduced or overcome with some management practices. For example, health problems in group-housed calves seem to be mostly associated with large groups (see review by Von Keyserlingk and Weary [10]), which in turn may be related to poorer hygiene than in single housing systems. Cross-suckling may be prevented by using teats, instead of buckets to supply milk to calves, added to adequate milk allowances that prevent hunger [9], [32].

Scientific information gathered in on-farm surveys can be valuable to guide public policy, and research and extension programs aiming to support on-farm adoption of best practices to improve animal welfare and productivity. Surveys of dairy calf rearing practices conducted in North America [34], [35], [42] and European farms [30], [36], [43], [44] have identified the main practices that need to be improved in order to achieve productive and animal welfare goals. Similar information on dairy calf rearing practices used by Brazilian family farmers is not available. In a recently published paper [45] we presented data from an on-farm survey carried out in the South of Brazil pertaining to lactating cattle welfare and productivity. In this paper we present data covering aspects of calf rearing from birth to weaning in farms of the same region. We evaluated aspects of the living environment of the animals and

management practices used, and interviewed a subsample of the farmers, aiming to understand the reasons behind their choices of practices.

Dynamics of Ruminant Livestock Management in the Context of the Nigerian Agricultural System

O. A. Lawal-Adebowale

[1] Department of Agricultural Extension and rural Development, Federal University of Agriculture, Abeokuta Ogun State, Nigeria

1. Introduction

Among all the livestock that makes up the farm animals in Nigeria, ruminants, comprising sheep, goats and cattle, constitute the farm animals largely reared by farm families in the country’s agricultural system. Nigeria has population of 34.5million goats, 22.1million sheep and 13.9million cattle. The larger proportion of these animals’ population are however largely concentrated in the northern region of the country than the southern region. Specifically about 90 percent of the country’s cattle population and 70 percent of the sheep and goat populations are concentrated in northern region of the country. Concentration of Nigeria’s livestock-base in the northern region is most likely to have been influenced by the ecological condition of the region which is characterised by low rainfall duration, lighter sandy soils and longer dry season. This submission is predicated by the fact that drier tropics or semi-arid regions are more favourable to the ruminants, Notwithstanding this situation, certain breeds of sheep and goats, particularly the West African Dwarf (WAD) species, are peculiarly adapted to the southern (humid) region of the country and are commonly reared by rural households in the region. Although, no breed of cattle is peculiar to the southern humid region of Nigeria, the available cattle in the region was largely due to settlement of the Hausa/Fulani pastoralists, who constitute the main cattle rearers, in the region.

The option of settled lifestyle of the Fualani pastoralists in the southern region of Nigeria was largely informed by a number of changes in the ecological condition of the region. One of the changing conditions that made the southern/humid region of the country habitable for cattle rearing was the drastic reduction in the incidence of tsetse fly (Glossina spp) infestation- a vector of the cattle disease known as trypanosomoses or sleeping sickness, in the region. The reduced incidence of tsetse fly the reduced incidence of tsetse flies was brought about by considerable transformation of the southern region’s forest-base to derived savanna arising from continuous and expanded land clearing for agriculture and human habitation; and the emerging incidence and severity of bush burning. These actions respectively lowered the region’s humidity and heightened its heat intensity, thereby making the environment less conducive for the tsetse flies’ survival or lifecycle completion. In the same vein, the successful settlement of the pastoralists in the southern region to the animal’s development of a level of tolerance or resistance to the trypanosomosis or sleeping sickness as a result of prolonged exposure to

tsetse flies. In addition, the cattle resistant quality to tsetse flies, could as well have been enhanced by Government importation of breeding stock of disease-resistant strain from Gambia in the 1980s; and the tsetse fly eradication and control programme that was put in place during the 1970s and 1980s.

2. Breeds of ruminants’ characteristics and distribution in Nigeria

With the changing ecological condition of the southern Nigeria and its conduciveness to cattle survival, the animal have become common in the region, though with the Fulani and Hausa tribes that have chosen to settle in the southern region with their herds of cattle. Based on this cattle, sheep and goats, as commonly found in the northern region of Nigeria, are as well found in the southern part of the country, though in less proportion to that of the northern region. Most of the available ruminants in the country are however of indigenous breeds.

Cattle breeds: breeds of locally available cattle in Nigeria are basically indigenous and are grouped as the Zebu and Taurine. The zebus as locally recognised by the cattle rearers in northern part of Nigeria include Bunaji, Rahaji, Sokoto Gudali, Adamawa Gudali, Azawak and Wadara. The Taurines on other hand include Keteku, N’dama and Kuri [11, 12]. The zebus are characterised by long horns, large humps and tallness, against the Taurines that are humpless, short-horned and shot-legged.

Although, there are varying estimations of cattle population in Nigeria ranging between 10 and 15million [2,3,14] the mean average of the nation’s cattle population was put at 13.9 million as at 1990 [12]. While about 11.5 million of the cattle population was kept in pastoral systems, the remaining 2.4 million were kept in villages. Country-wide distribution of the cattle population however showed that the sub-humid region of Nigeria has about 4.5million heads[1] - [13], with the mean cattle density of about 15 per km2 or 6.6 hectare per head; and approximately 45% of the national herd could be readily found in the sub-humid zone of the country on year [12].

Production characteristics of surveyed cattle in the Kaduna plain of Nigeria, entails an average of 45.9 head, out of which 64.4% were females; 60months (5years) as first age of calving, 25months (about 2years) of calving intervals and calving percentage of 48%. Calf life-weight and mortality to 1 year of age averaged 103 kg and 22.4% respectively. Milk production by the cattle, after adjusting for length of calving intervals, for humans and calves averaged 112 and 169 litres/cow/year respectively.

Sheep: Nigeria has a population of about 8 to13.2million sheep out of which about 3.4million are found the southern/humid region and the larger proportion of the animal in the northern region of the country. Available breeds of sheep in the country are mainly indigenous and these are the West African Dwarf (WAD) sheep, Balami, Uda and Yankasa. Out of these four major of breeds of sheep in the country, the WAD breed is common to southern region against the widespread of Balami, Uda and Yakansa breeds in the northern region of the country. Characteristics analysis of sheep in the country, especially among the Fulani pastoralists showed that ewes had approximately 120% fertility rate, 12% rate of twinning and 25% lamb mortality rate at 3months old. Sheep productivity index puts lamb weight at 0.327 kg at a weaning age of 90 days, and 0.490 kg at a weaning age of 180days per ewe per year. Mature males of the local breeds of sheep have a live weight of about 30 to 65kg and their female counter parts often weigh between 30 and 45kg.

Goats: on the other hand has a population of about 22 to 26million in Nigeria with rough estimates of 6.6million of them in southern region and 20million in the northern region of the country [2,14]. The breeds of goats in Nigeria are largely indigenous; and the common ones [19] include the West African Dwarf (WAD) goat, Sahel/desert goat- known as West African Long-Legged goat; and Sokoto Red/Maradi. The Kalahari goat breed, which is of South Africa origin is gradually being adapted to the Nigeria’s ecological zones on experimental efforts. Distribution of the goat breeds in the country showed that the West African Dwarf (WAD) goat is common to southern Nigeria while the Sahel or desert goat and Sokoto Red are common to the northern region of the country. Production characteristic of the small ruminant showed that breeds of goats in the country had low fertility rate (below 100%), 40% twins and triplets birth rates, and low mortality rates of 22% for kids and 14.4% for adults. The productivity indices for 90 and 180 days weaning age were 0.259 kg and 0.437 kg kid/kg doe respectively. Milk production characteristic of the goats varies from breed to breed. [20,21] The Sokoto Red produces a daily milk yield of about 0.5 to 1.5kg and 100days of lactation; Sahel goats produce between 0.8 and 1.0kg of milk daily with lactation period of 120days; and the WAD breeds produce about 0.4kg milk per day on a lactation period of 126 days. It was further indicated that these local breeds of goat usually weighs between 18kg and 37kg.

3. Social and economic values of ruminants in Nigeria

The economic values: the ruminants play significant roles in the social and economic wellbeing of the Nigerians in various ways. Economically the animals serve as source of income earning to major ruminants’ dealers- sellers of live animals and butchers/meat sellers; generates employments and creates markets for larger number of people who explore the animals’ product and by-products for economic gains. Meat constitutes the foremost animal product that is highly explored by the Nigerian households, particularly for direct consumption and as such, the ruminants, especially cattle, constitute the major and cheapest source of meat consumption for most households in the country [22] about

1million cattle are annually slaughtered for meat in the country. This suggests heavy dependence on cattle for meat consumption by households in the country. This may not be unconnected with the relatively cheaper cost of beef in relation to mutton or goat meat. For instance, while a Kilogramme beef might cost about N400 (US$2.5)[2] - , the equivalent is about N1000 (US$6.25) for mutton or goat meat. In addition, the large size of cattle also makes it possible for daily meat demands of the Nigerians to be readily met. Although, the small ruminants, especially goat, are as well slaughtered for meat sale, the small size of the animals and high market price of their meats makes the animals less demanded for regular meat consumption.

However, live goats and sheep are much more easily acquired by individuals in relation to cattle owing to market price differentials between the small and large ruminants. For instance, a sizeable cow or bull sells for about N70, 000 (US$437.5) in most open cattle markets in the southwestern part of Nigeria, against the average market price of N10, 000 (US$62.5) for WAD sheep and goats, N18, 000 (US$112.5) for Sahel goats; and N20, 000 (US$125) for sheep (Uda and Balami)[3] - . This situation thus accounted for the widespread of sheep and goats among individuals in Nigeria either for consumption, though mostly on events celebration, or rearing for widespread sheep and goats as important animals of trade within humid West Africa though with different demand and consumption patterns in the region. For instance, while sheep are largely consumed during Muslim religious holidays, goats are used for all ceremonies throughout the year, especially for ceremonies such as births, deaths, marriages and festivals; thereby making the demand for goats consistently high. As a result of this, there is a clear price premium for male sheep during the festival period, and some early purchasing for fattening and re-sale takes place.

The market value of the ruminants not only creates employment and generates income for those that directly owned the animals, but indirectly for the butchers, foragers and government. For instance, cattle slaughtering and dressing cost N3, 000 per head per cow and the same services on sheep and goat cost N1, 000 per head per the animal. And to a lesser extent, the animals indirectly generate income for the Nigerian Government through licensing of abattoirs and taxation on every slaughtered animal at the registered abattoirs. Although, ruminants are generally kept on free range management system, conscientious feeding is provided the farm animals primarily kept for commercial purpose. Based on this, forages, either fresh or dry, are sought from the foragers for feeding the commercially-oriented farm animals. In the light of this, crop debris such as dried cowpea shafts and ground vines and husks becomes additional source of income for farmers that cultivate cowpea and groundnuts. Valuation of the Nigerian livestock resources [23] puts the total livestock value at N60billion, based on mid-1991 market prices and as indicated by [22], account for as much as one third of the country's agricultural gross domestic product (GDP).

Social values: socio-cultural value of the ruminants varied across the country. While the sheep and goats are highly prized for cultural heritage in the southwest Nigeria, cattle is of much significance among the Hausa/Fulani in the northern region. Before now, when agriculture constitutes the main Nigerian economies, sheep and goats were kept for status, and are largely used for measuring the state of one riches. But with the relegation of agriculture from the economic fore, use of the number or size of farm animals as measuring tool of social status is no longer tenable, especially at rural level in southwest Nigeria where subsistence agriculture is the main practice. However, the small ruminants still found value in sacrificial offerings among the traditional worshippers in southwest Nigeria. Up till now, goat, specifically doe, constitutes traditional requirement as part of bride price and the animals are kept in memory of the enacted marital relationship between in-laws. Unlike beef and mutton, goat meat are generally considered and consumed as delicacy.

Unlike the devalued state of the socio-cultural value of the small ruminants in southwest Nigeria, cattle, sheep and goats remained relevant as measuring tools of social status and economic strength among the rural households in the northern region of the country. The size of cattle herds and flock of sheep owned by a particular individual or household determines the economic strength of such ones. In addition, a herder’s stock of animals constitutes his financial base thereby disposing the animals for income generation whenever it is necessary [24]. Cattle also serve as good means of transportation and animal traction among the livestock farmers in the northern region of the country, whereby the animals are used for land cultivation in preparation for crop cultivation, transportation of farm families to and from the farms and transportation of farm produce between farms and storage points. Given the volume and nature of excreta produce by cattle, the large ruminant have served as valuable source for manure for soil fertility and development of organic agriculture. [22] cattle produces manure outputs of 1368 kg DM/head/year and 248 kg DM/head/year by sheep for soil fertility.

4. Dynamics of ruminant livestock management system in Nigeria

In general, farm animals are poorly managed in Nigeria’s agricultural system owing to the fact that the animals are mostly managed on free range/extensive system and semi-intensive system. These management systems are basically influenced by cheap means of feeding the stock all year round. Based on this, the animals are thus allowed to roam the streets and neighbourhood to fend for themselves with little or no special or conscientious provision of supplements for the animals. Although, commonly raised farm animals under the free range and semi-intensive systems include the monogastrics and ruminants, sheep and goats, alongside chicken constitutes the major farm animals largely raised in these systems of livestock management by the Nigerian rural households or livestock farmers.

Small ruminant management system: the small ruminants are however intensively managed on the free range/extensive system, especially in the southern part of Nigeria where crop farming dominates the agricultural practices and with farmers keeping an average of 10 sheep and/or goats. Under the free range system, the animals move about freely to feed on forages/grasses, which are abundantly available during the raining season, and on other feed source such as left over foods/ kitchen wastes and refuse dumps. Hardly are the animals provided supplementary feeds and even shelter by their keepers. The animals thus squat around corridors or available shades in the compounds. Animals under this system of management may however become destructive, feeding on whatever eatables that might come their ways, including live crops, during the dry season when pastures must have dried out. This implies that the free range system may be a healthy practice for ruminant management during the rainy seasons, at least for abundance of forage availability, and but unhealthy during the dry seasons as livestock infringement on the neighbourhood property often lead to conflicts.

Some households or livestock keepers on the other hand maintain semi-intensive management system whereby the animals are provided shelter and kept indoors for security purpose. The animals somehow have their movements regulated and as such are released to fend for themselves in the early and late hours of the day, after which they are kept indoors over the night. As it were in the extensive or free range system, the animals feed on natural pasture and kitchen wastes or by-products of processed foods/farm produce, especially during the rainy season. Although, hardly are the animals under semi-intensive management provided supplements or essential ration for consumption, efforts are made by their keepers to feed them with by-products from farm produce, especially during dry season when pasture are hardly available for free grazing.

The extensive management system is however largely applied for the WAD sheep and goats than for other breeds such as Balami, Uda and Yakansa breeds of sheep; and Sokoto Red goats in southwest Nigeria. This may not be unconnected with economic value of these breeds of small ruminants arising from their bigger body size and better market prices than the WAD breeds. In addition, these breeds of small ruminants are highly prized for social ceremonies and prestige; and are more tempting to be stolen than the WADs. The Balami, Uda, Yankasa; and Sokoto Red breeds of the small ruminants are thus kept on a ‘modified intensive management system’ whereby the animals are mostly tethered or kept in a guarded enclosure and fed on cut-and-feed forages and by-products of farm produce.

Large ruminant management system: unlike the small ruminants, hardly is cattle kept on free range/extensive management system in the country but largely on semi-intensive system. A level of modification is however applied to the semi-intensive management for cattle. Unlike the small ruminants that could be left to freely range about all alone, cattle are never left all alone to freely graze about or scavenge, but are conscientiously guided by the rearers in the search for pasture and water; and thereafter, are securely checked into the provided shelter. This may not unconnected with the

social and economic value of the large ruminant, as the loss of a cattle, either in death or getting misplaced, is at great cost to the herder(s) and as such, the animals are jealously guided for survival, productivity and profitability. Socially, the size of the animal is highly intimidating to humans as appearance of unguided cattle in the public is known to cause commotions whereby people run helter-skelter. This farm animal is never neared as one would near sheep and goats. This situation thus accounted for the need to guide the cattle on grazing over a wide range of vegetations.

Nomadism/Exclusive pastoral system: in addition to the modified semi-intensive management of the cattle by herders, [12] other pastoral management systems commonly practised by cattle herders in the country include the exclusive, transhumant and agro pastoral systems. The exclusive pastoral practice or nomadism entails sole management of the ruminants, especially cattle for the socioeconomic wellbeing of the pastoral farmers. [12] The exclusive pastoralists do not grow crops but simply depend on sales of their ruminants and dairy products to meet their food needs. As a feeding practice, the exclusive pastoralists usually move their animals over long distances, usually through a set migration routes, in search of pasture for their animals or by going into advance arrangement with crop farmers for collection of crop residue for their animals.

Transhumance pastoral system: this entails rearing of ruminants in settlements with a low level of crop cultivation. The transhumant pastoralists [25], often have a permanent homestead and base at where the older members of the community remain throughout the year. The herds are however regularly moved in response to seasonal changes in the quality of grazing and the tsetse-fly challenge, or in an attempt to exploit seasonal availability of pasture. The herds are however regularly moved in response to seasonal changes in the quality of pasture and the tsetse-fly challenge, or in an attempt to exploit seasonal the availability of pasture. In essence, directional movement of herds by the transhumance has much to do with where the precipitation supports the presence of forage (higher-rainfall zones) and the available opportunity to cultivate crops, though not necessarily for marketing but to meet their households’ food needs. They however meet their other basic needs through the proceeds from sales of milk and other dairy products. While the women take care of the production and marketing of the dairy products in the local markets, the men take away majority of the herds in search of grazing, leaving the older members of the community with a nucleus of lactating females. The male herders however return at the start of the wet season to help with crop cultivation and where necessary, household income is supplemented with the sales of surplus male sheep or cattle.

Agro pastoral system: the agro-pastoralist practice entails conscious crop cultivation for both home consumption and marketing purposes alongside their reared cattle.[25] Agro-pastoralists hold land rights and cultivate acquired land for crops such as maize, sorghum, millet, yams and cassava, using family or hired labours. While cattle are still valued property, the size of herds are averagely smaller than that of other pastoral systems, usually about 30 head per household in southwest Nigeria [26],

possibly because they no longer solely rely on cattle for their livelihood sustenance. In this case, the large ruminants are guided on grazing within a short distance range from their permanent place of abode while the women explored the lactating animals for milk and having it processed into local cheese (wara) and skimmed sour milk (nono) for consumption and local marketing. The Agropastoralists, [25], invest more in housing and other local infrastructure, and where their herds become large, they often send them away with more nomadic pastoralists. In addition, the agropastoralists often act as brokers in establishing cattle tracks and negotiation of “camping” of herds on farms, whereby crop residues can be exchanged for valuable manure, and as well for rearing of work animals, all of which add value to overall agricultural production.

Implications of the extensive and semi-intensive management systems: widespread adoption of extensive and semi-intensive systems of management for livestock in general. Ruminants, is believed to have been highly influenced by its relatively low cost of feeding the animals. Although, the animals may feed on freely available pasture and forages, these systems exposed the livestock to environmental dangers, ranging across stealing and death of the animals [27]. In addition, these systems of livestock management accounted for the generally observed poor production performance of the local breeds of ruminants in terms of meat, milk and litter production in Nigeria, and does not allow for proper recording keeping of the animals production performance [28]. On the same note, [24,29] stress that farm animals kept under the extensive and semi-intensive management systems are burdened with high incidence of diseases, parasites, low productivity and small contribution to household’s earnings.

5. Ruminants’ pests and diseases and dynamics of management

Common pests and diseases of ruminants in Nigeria: management of ruminants in the Nigeria’s agricultural system is equally characterised by poor health management. As a matter of fact, [30] maintenance and sustenance of healthiness of farm animals constitutes a major challenge to efficient livestock production among the Nigerian livestock entrepreneurs. Several surveys of ruminants kept by the rural farmers, and even in the markets, across the country revealed that the animals are mostly infected with one form of diseases/pests or the other [30-32]. According to Dipeolu (2010), most of the diagnosed livestock diseases in the country were identified to be bacteria, viral, fungi and parasitic-caused diseases. Specifically, the diseases include rinderpest, foot-and-mouth disease, and contagious bovine pleuropneumonia to be the common diseases of cattle in Nigeria. In addition to these are small number of cases of dermatophilosis, lumpy skin disease, papillomatosis and keratoconjunctivitis. [33] on the other hand, indicated that infections such as pneumonia, helminthiasis, peste des petits and enterotoxaemia as common diseases of sheep and goats in Nigeria. Assessment of seasonal pattern of tick load on Bunaji cattle under the traditional management by [31] revealed the dominant tick species as Amblyomma variegatum; Boophilus decoloratus, Rhipicephalus (simus) senegalensis, R. tricuspis and Hyalomma spp.

Although, the incidence and intensity of pests and diseases infestation in the ruminant farm animals may vary between the rainy and dry seasons, and Across Nigeria’s ecological zones, the infestation portends a great danger for healthiness and productivity of the animals. According to Dipeolu (2010), livestock farmers may experience total loss of stock in death, or partial losses (through morbidity) in which the productivity of the animals becomes greatly reduced. Disease such as pneumonia, especially PPR, as the major causes of deaths in of ruminants; diarrhoea is mostly caused by parasitic gastroenteritis and PPR; and abortions and neonatal deaths are associated with starvation. In order to overcome these gruesome effects of pests and diseases on the ruminants, it becomes essential for the livestock farmers to either prevent or control the incidence of the diseases.

Pests and diseases control: in terms of control of livestock diseases, the livestock farmers hardly take up veterinary treatment of the affected animal(s), especially the small ruminant farmers, as they considered the veterinary treatment as too expensive to bear (Fabusoro, Lawal-Adebowale & Akinloye, 2007; Oluwafemi, 2009). In as much as the small ruminant farmers may which to save any diseased animals by taking to ethno-veterinary treatment, they may afford to lose the animal in death rather than expending their hard earned income on veterinary treatment of a diseased animal. The losses may be marginal in case of one or two of the animals are lost in death, but will be a great economic loss where about five or more of the animals are lost in quick succession as result of disease infestation (Dipeolu, 2010; Aina, 2012). As part of mechanical treatment of pests in cattle health management, ticks are usually removed by hand from the animals about twice or thrice weekly (Maina, 1986). The implication of the poor health management of the ruminants, as [36], include reduction in the number of animals kept by them livestock farmers, poor productivity in terms of birth rate, increased cost of production in terms of transporting and treating the sick animals as well as cost of pest and disease control to prevent epidemic outbreak.

On another note, ante-mortem and post-mortem inspection of the ruminants, particularly cattle, meant for slaughtering across the major abattoirs in the country further underline the poor state of ruminant, especially cattle, management in the country. The ante-mortem inspection of cattle to be slaughtered at a major abattoir in Ibadan, southwest Nigeria, between 1990 and 1994 showed that between 2.4% and 6.3% of the slaughtered cattle were pregnant (Dipeolu (2010). The implication of this, [37], was a tremendous loss of potential cattle offspring that would have contributed to the cattle population growth and meat supply profile of the country. A post-mortem study of another major abattoir based in Lagos, Nigeria, between 2004 and 2007 showed that the slaughtered cattle portends a health risk to beef consumers as about 1.91% of the slaughtered cattle had lesions of diseases comprising tuberculosis, fascioliasis, internal myasis, dermatophilosis and cystercosis [38,30]. Laboratory examination of some of the meat-borne diseases showed that the meats are tainted with bacteria pathogens such as Campylobacter spp., Clostridium spp., Escherichia coli, Salmonella serotypes, and

other enteric bacteria which may not cause clinical diseases in the animals but a potential threat to public health (Dipeolu, 2010).

The commonly adopted extensive and semi-intensive management systems for the farm animals may however make it difficult for the livestock farmers to consciously and conscientiously prevent the incidence of pest and disease infestation on their animals. This is based on the fact that, as the animals are allowed to freely roam the neighbourhood they readily contact infectious diseases or pests from other infected animals they mixed with in the course of fending for themselves, and may as well sustain injuries which in turn may eventually impair their health status and probably lead to their deaths (Lawal-Adebowale & Alarima, 2011).

6. Ruminant feeds and dynamics of utilization

Given the distinct nature of the ruminant’s stomach, the farm animals heavily depend on forage or raoughage as major feeds. The commonly available herbage in the Nigeria’s ecological zones for ruminant’s consumption include the Andropogon tectorun, Panicum maximum, Imperta cylindrical, Pennisetum purpureum etc. These grasses, which are fibrous in nature, are rich in cellulose and provide the ruminants a high level carbohydrate and some measures of vitamins and minerals. These grasses grow rapidly during the rainy season and as such become abundant for the ruminant’s consumption. The ruminant kept on free range thus feed freely on the naturally occurring forages. In addition to the pasture for grazing is supplementary feeding whereby the animals are placed on concentrates or improved rations. Supplementary feeding of cows significantly improve weights of the calves at birth (20.1kg) and at one year of age (107.9 kg) when compared with other animals not placed on supplements (with birth weight of 18.6 and 99.3 kg at one year). At 365 days of age, viability of calves from supplemented dams averaged 88% against 67% in calves from non-supplemented dams. Milk for calves and humans from dams on supplements averaged 128 and 179 litres/cow/year. Although, supplementary feeding did not improve calving intervals, it suggests that it every essential to place the ruminants on supplements for better productivity in term of milk and meat production.

Cost of supplementary feeding and non-availability of forage during the dry season greatly challenged efficient livestock feeding and management in Nigeria. Based on the need for adequate feeding, it is believed that about 85% of cost of livestock production is feeding, and given the poverty status of most livestock farmers and poor marketing system of farm animals, hardly could they take up supplementary feeding. This accounted for preference of extensive and semi-intensive systems of management. Forage on the on the other hand hardly become available during the dry season for consumption of the ruminant; and coupled with the declining grazing land as a result of the ever increasing land cultivation

for arable crop production, alternative feed sources for the animals becomes essential. Utilisation of fodder from crop residues compensates for non-availability of grasses during the off-season. Other alternative to mitigate the effect of dry season feeding was the establishment of fodder bank whereby legumes are established and properly managed in a concentrated unit [41]. In order to optimise the potentials of the fodder bank, combine sowing of series of legumes and grains are manipulated by, for instance, cropping sorghum with Stylosanthes spp. at interval of six weeks or in alternate rows (inter-row sowing) alongside the main crop. A study of the grazing behaviour of cattle among the settled Fulani pastoralists showed that the farm animals utilized a wide range of different feed resources, notably sorghum and millet residues, during the dry season. As further indicated, the residue accounted for 12.6% of annual grazing time in Abet- a farming area, and for 6.6% in Kurmin-Biri- a grazing reserve. Browsing accounted for 1.4% annual grazing time in Abet, and 11.2% in Kurmin-Biri.

The fodder bank alternative however mainly benefits selected animals as not all animals are allowed to graze the bank. Fodder banks are designed not to supply forage year-round for an entire herd but rather to be used strategically for limited periods with selected animals, thus only pregnant and lactating animals are allowed to graze the bank. This suggests that, only a few ruminants had access to grazing or foraging during the dry season, and thus portends that dry season feeding constitutes a major challenge to livestock production in Nigeria. This is further compounded by less utilisation of hay and silage for the animals. Since the reared animals cannot survive without food, the implications of dry season feed problem include straying or deliberate guiding of the animals into farms for grazing thus leading to conflicts and violent clash between the crop and livestock farmers.

7. Future of ruminant livestock development in Nigeria

Although, ecological categorisation of the Nigeria has varied over time arising from changing trends of the commonly used natural factors [12], critical examination of the country’s ecozones in relation to livestock distribution revealed that the ruminants are distributed throughout the three major ecozones in the country, namely the semi-arid, sub-humid and humid zones. The semi-arid region, characterised by average rainfall of 500 – 1000mm, prolonged dry season and sparsely distributed vegetations, is known to have greatly favoured livestock management in the country over the years. But with the changing climatic trends in the country, the sub-humid zone and its characteristics rainfall distribution range of 1000 – 1500mm, vegetative cover and moderately dry periods, now enclaves about 45% of the cattle in the country. In the same vein, studies have affirmed that the changing situation of tsetse flies infestation in the region, coupled with the prolonged rainfall period and good rainfall distribution range of more than 1500; has equally made the environment favourable to cattle and other small ruminants’ management. This observation suggests that Nigeria’s agro-ecologies have the potentials to favourably support livestock development in the country. This notwithstanding, there is need to consciously harness the environment to enhance the country’s livestock development through the following:

Efficient livestock feeding: exploration of the environment and the country’s breeds of ruminant potentials for livestock industry development are yet to be fully harnessed. The larger proportion of the ruminant livestock in Nigeria lies in the hands of herders who keep them under extensive and semi-intensive management systems, whereby the animals only rely on natural pasture and crop residue for survival. The ruminants may though have access to enough forage during the rainy season; it becomes a great deal of challenge to efficiently feed the animals during the dry season. In order to sustain the animals and ensure better productivity, there is need to explore the available natural pasture for silage and hay making such that the animals could be adequately fed during the dry season. In addition, there is need for paddock establishment, especially in the rural communities or reserved areas, for grazing by the ruminants. Although, forage constitutes the bulk of food needed by the ruminants, supplementary feeding is equally essential, especially for the lactating animals. In view of this, the farm animals’ diet needs to be supplemented with meals such as cottonseed cake, wheat bran, molasses, drugs and mineral salt licks etc. In view of the fact that the indigenous cattle can gain an average of 0.9 to 1.2 kg per day on silage and concentrate rations [22], it suggests that the local breeds of cattle have the potentials for efficient utilisation of feed for better production performance.

Veterinary services: pests and diseases portend a major risk to livestock development in Nigeria, as incidence of pests and diseases are common in the country’s livestock system. Although, prevention is known to be better than cure, it is invariably impossible to out rightly prevent the farm animals from being infested with either pests or diseases. This premise thus calls for establishment of sound veterinary services where infected animals could be taken care of. This requirement has been a great challenge in the Nigeria’s livestock management system. Apart from inadequate veterinary services in the country, current veterinary therapy in Nigeria is suffering from both scarcity and the high cost of drugs thereby making it impossible to save the livestock industry as it were in the country. Although, the livestock herders may take to ethno-veterinary treatment of their animals, this becomes possible only when the symptoms become manifested, and by then a serious internal damage or impairment of the animals’ health might have taken place. The implication of this is that, it may be impossible to adequately treat the animals or ensure proper clinical remedy. This situation thus calls for government and non-government organisations intervention for development of the veterinary services such that it becomes affordable to be patronised by the stock herders. The easiest and most rational solution to the problem of livestock health is to develop acceptably effective drugs from reasonably inexpensive sources for use as supplements to commercial drugs. The veterinary traditional medicine practices may still be of value in the animal health care, but should be subjected to scientific investigation for efficacy. In the light of this, it becomes important to have baseline data about traditional ethno-veterinary practices for ethno-veterinary medical information generation. Combination of the orthodox and ethno-veterinary care could thus save the animals of impaired health and enhance productivity.

Livestock breeding: livestock breeding is crucial to livestock development globally. Good system of management of the resulting breeds/offspring from the crosses – in terms of intensive keeping, good health care and feeding, is however crucial to better performance of the animals. Adopted poor management systems for farm animals in Nigeria and most other developing countries certainly accounted for the poor production performance of the local ruminant breeds. The same poor management system accounted for poor performance of the exotic breeds imported into the country in the 70 (Blench, 1999). Just as the exotic breeds are known to have performed excellently well in their countries of origin under good management practice, results from experimental stations results from stations and universities farms across Africa showed that productivity of the animals could be improved under more intensive management. Similarly, where crossing has been successful under good management practice, dairy cattle dairy cattle portrayed a linear increase in milk yield as the exotic gene is increased up to the 7/8 level. The F1 Friesian x Bunaji cow (50%) gives 1684 kg, the 3/4 (75%) gives 1850 kg and the 7/8 gives 2051 kg of milk in a lactation of about 260 days. This suggests that good practices and cross breeding with the exotic breeds of desirable quality stand the chance of enhancing the country’s livestock development.

Profitable livestock marketing system: among all other agricultural enterprise production, livestock management remains a delicate and expensive venture; it however has the potentials of profitable returns. The livestock is delicate in the sense that the animals need to be adequately fed, not just with any ration, but a balanced ration for productive performance. In the same vein, the health of the animals cannot be forgone as healthiness of the animals is not only a vital for production performance, but survival and sustenance of the livestock venture. Placement of the ruminant on a good ration is certainly at a great deal of cost or financial incurment, the poor economic status of the ruminant keepers in the country however makes it extremely difficult to build the livestock industry. This situation may however be reverted through efficient marketing system of livestock and its products and by-products. Poor marketing system is one of the bane livestock development in the country, whereby the animals are locally sold either directly as live animal or meat.

Livestock research development: development of the Nigeria’s livestock industry will not magically occur, but through conscientious efforts in livestock research. This calls for baseline data generation about the breeds of ruminants in the country, their production performance and marketing. Other information-base that must be established include the common livestock feeds (pasture and feed meal supplements) and common pests and diseases of livestock and their effects on the animals. This will harm the livestock research institutes with the salient information as bench mark for research work and generation of livestock innovation. Social scientists inclusion in livestock research development is crucial as this disciplines helps to ascertain the psychology of the ruminant keepers and their economic status to adopt and adapt generated livestock innovation. Similarly, the social scientist, especially the economists, will help to ascertain the economic implications of the innovations and the market driving force for ensuring efficient production and marketing of livestock and its products.

8. Livestock development in Nigerian: Policy recommendation

Over 90 percent of the ruminant livestock lies in the hands of rural livestock farmers, especially the pastoralists, in Nigeria. The animals though, are of considerable economic importance in Nigeria’s economy, poor management system of the stock has greatly hindered the development of the livestock. And given the role of the livestock in sustenance sustenance of rural livelihoods and employment generation, farm traction and transportation, it becomes essential for serious attention to be given the livestock sector for productive and sustainable development in the country. In this regard, the livestock research institutes, comprising National Animal Production Research Institute (NAPRI), National Veterinary Research Institute (NVRI), and Nigerian Institute for Trypanosomiasis Research (NITR), need to be strengthened in terms of qualified and adequate research personnel and equipment for quality research on livestock related issues. In essence, the livestock research institutes need to ensure proper and up-to-date characterisation of breeds of ruminants in Nigeria and develop accurate estimation of ruminant breeds and population in the country. In essence, the livestock research institutes need to ensure proper and up-to-date characterisation of breeds of ruminants occurring pests and diseases in livestock, and the lethal effects of ill-health causative agents on the animals.

To effectively achieve this, research in livestock development should go beyond the traditional field visit to animal sheds for physical livestock condition monitoring and data collection. The country needs to harness the emerging information and communication technology (ICT) devices that allow for remote and continuous monitoring of livestock conditions and collection of data on the animals without physically being in the animals’ sheds. With this, efficient data and information on farm animals’ health status, productivity, feeding regime and feed conversion could be readily monitored. Similarly, documentation of particular livestock pedigree, characterisation of breeds of farm animals and simulation of the animals’ characteristics and production performance could be enhanced for effective management and transformational development of the livestock sector. In addition to this is need for better development of better grazing system and management practices in the country’s livestock sector. Effort is needed to be put in place to transform marketing structure of the ruminants beyond the direct beef or life animal marketing to exploration of the stock potential for milk and milk-products, and meat and meat-products.

The option of settled lifestyle of the Fualani pastoralists in the southern region of Nigeria was largely informed by a number of changes in the ecological condition of the region. One of the changing conditions that made the southern/humid region of the country habitable for cattle rearing was the drastic reduction in the incidence of tsetse fly (Glossina spp) infestation- a vector of the cattle disease known as trypanosomoses or sleeping sickness, in the region. The reduced incidence of tsetse fly the

reduced incidence of tsetse flies was brought about by considerable transformation of the southern region’s forest-base to derived savanna arising from continuous and expanded land clearing for agriculture and human habitation; and the emerging incidence and severity of bush burning. These actions respectively lowered the region’s humidity and heightened its heat intensity, thereby making the environment less conducive for the tsetse flies’ survival or lifecycle completion. In the same vein, the successful settlement of the pastoralists in the southern region to the animal’s development of a level of tolerance or resistance to the trypanosomosis or sleeping sickness as a result of prolonged exposure to tsetse flies. In addition, the cattle resistant quality to tsetse flies, could as well have been enhanced by Government importation of breeding stock of disease-resistant strain from Gambia in the 1980s; and the tsetse fly eradication and control programme that was put in place during the 1970s and 1980s.

2. Breeds of ruminants’ characteristics and distribution in Nigeria

With the changing ecological condition of the southern Nigeria and its conduciveness to cattle survival, the animal have become common in the region, though with the Fulani and Hausa tribes that have chosen to settle in the southern region with their herds of cattle. Based on this cattle, sheep and goats, as commonly found in the northern region of Nigeria, are as well found in the southern part of the country, though in less proportion to that of the northern region. Most of the available ruminants in the country are however of indigenous breeds.

Cattle breeds: breeds of locally available cattle in Nigeria are basically indigenous and are grouped as the Zebu and Taurine. The zebus as locally recognised by the cattle rearers in northern part of Nigeria include Bunaji, Rahaji, Sokoto Gudali, Adamawa Gudali, Azawak and Wadara. The Taurines on other hand include Keteku, N’dama and Kuri [11, 12]. The zebus are characterised by long horns, large humps and tallness, against the Taurines that are humpless, short-horned and shot-legged.

Although, there are varying estimations of cattle population in Nigeria ranging between 10 and 15million [2,3,14] the mean average of the nation’s cattle population was put at 13.9 million as at 1990 [12]. While about 11.5 million of the cattle population was kept in pastoral systems, the remaining 2.4 million were kept in villages. Country-wide distribution of the cattle population however showed that the sub-humid region of Nigeria has about 4.5million heads[1] - [13], with the mean cattle density of about 15 per km2 or 6.6 hectare per head; and approximately 45% of the national herd could be readily found in the sub-humid zone of the country on year [12].

Production characteristics of surveyed cattle in the Kaduna plain of Nigeria, entails an average of 45.9 head, out of which 64.4% were females; 60months (5years) as first age of calving, 25months (about 2years) of calving intervals and calving percentage of 48%. Calf life-weight and mortality to 1 year of age averaged 103 kg and 22.4% respectively. Milk production by the cattle, after adjusting for length of calving intervals, for humans and calves averaged 112 and 169 litres/cow/year respectively.

Sheep: Nigeria has a population of about 8 to13.2million sheep out of which about 3.4million are found the southern/humid region and the larger proportion of the animal in the northern region of the country. Available breeds of sheep in the country are mainly indigenous and these are the West African Dwarf (WAD) sheep, Balami, Uda and Yankasa. Out of these four major of breeds of sheep in the country, the WAD breed is common to southern region against the widespread of Balami, Uda and Yakansa breeds in the northern region of the country. Characteristics analysis of sheep in the country, especially among the Fulani pastoralists showed that ewes had approximately 120% fertility rate, 12% rate of twinning and 25% lamb mortality rate at 3months old. Sheep productivity index puts lamb weight at 0.327 kg at a weaning age of 90 days, and 0.490 kg at a weaning age of 180days per ewe per year. Mature males of the local breeds of sheep have a live weight of about 30 to 65kg and their female counter parts often weigh between 30 and 45kg.

Goats: on the other hand has a population of about 22 to 26million in Nigeria with rough estimates of 6.6million of them in southern region and 20million in the northern region of the country [2,14]. The breeds of goats in Nigeria are largely indigenous; and the common ones [19] include the West African Dwarf (WAD) goat, Sahel/desert goat- known as West African Long-Legged goat; and Sokoto Red/Maradi. The Kalahari goat breed, which is of South Africa origin is gradually being adapted to the Nigeria’s ecological zones on experimental efforts. Distribution of the goat breeds in the country showed that the West African Dwarf (WAD) goat is common to southern Nigeria while the Sahel or desert goat and Sokoto Red are common to the northern region of the country. Production characteristic of the small ruminant showed that breeds of goats in the country had low fertility rate (below 100%), 40% twins and triplets birth rates, and low mortality rates of 22% for kids and 14.4% for adults. The productivity indices for 90 and 180 days weaning age were 0.259 kg and 0.437 kg kid/kg doe respectively. Milk production characteristic of the goats varies from breed to breed. [20,21] The Sokoto Red produces a daily milk yield of about 0.5 to 1.5kg and 100days of lactation; Sahel goats produce between 0.8 and 1.0kg of milk daily with lactation period of 120days; and the WAD breeds produce about 0.4kg milk per day on a lactation period of 126 days. It was further indicated that these local breeds of goat usually weighs between 18kg and 37kg.

3. Social and economic values of ruminants in Nigeria

The economic values: the ruminants play significant roles in the social and economic wellbeing of the Nigerians in various ways. Economically the animals serve as source of income earning to major ruminants’ dealers- sellers of live animals and butchers/meat sellers; generates employments and creates markets for larger number of people who explore the animals’ product and by-products for economic gains. Meat constitutes the foremost animal product that is highly explored by the Nigerian households, particularly for direct consumption and as such, the ruminants, especially cattle, constitute the major and cheapest source of meat consumption for most households in the country [22] about 1million cattle are annually slaughtered for meat in the country. This suggests heavy dependence on cattle for meat consumption by households in the country. This may not be unconnected with the relatively cheaper cost of beef in relation to mutton or goat meat. For instance, while a Kilogramme beef might cost about N400 (US$2.5)[2] - , the equivalent is about N1000 (US$6.25) for mutton or goat meat. In addition, the large size of cattle also makes it possible for daily meat demands of the Nigerians to be readily met. Although, the small ruminants, especially goat, are as well slaughtered for meat sale, the small size of the animals and high market price of their meats makes the animals less demanded for regular meat consumption.

However, live goats and sheep are much more easily acquired by individuals in relation to cattle owing to market price differentials between the small and large ruminants. For instance, a sizeable cow or bull sells for about N70, 000 (US$437.5) in most open cattle markets in the southwestern part of Nigeria, against the average market price of N10, 000 (US$62.5) for WAD sheep and goats, N18, 000 (US$112.5) for Sahel goats; and N20, 000 (US$125) for sheep (Uda and Balami)[3] - . This situation thus accounted for the widespread of sheep and goats among individuals in Nigeria either for consumption, though mostly on events celebration, or rearing for widespread sheep and goats as important animals of trade within humid West Africa though with different demand and consumption patterns in the region. For instance, while sheep are largely consumed during Muslim religious holidays, goats are used for all ceremonies throughout the year, especially for ceremonies such as births, deaths, marriages and festivals; thereby making the demand for goats consistently high. As a result of this, there is a clear price premium for male sheep during the festival period, and some early purchasing for fattening and re-sale takes place.

The market value of the ruminants not only creates employment and generates income for those that directly owned the animals, but indirectly for the butchers, foragers and government. For instance, cattle slaughtering and dressing cost N3, 000 per head per cow and the same services on sheep and goat cost N1, 000 per head per the animal. And to a lesser extent, the animals indirectly generate income for the Nigerian Government through licensing of abattoirs and taxation on every slaughtered animal at the registered abattoirs. Although, ruminants are generally kept on free range management system, conscientious feeding is provided the farm animals primarily kept for commercial purpose. Based on this, forages, either fresh or dry, are sought from the foragers for feeding the commercially-oriented farm animals. In the light of this, crop debris such as dried cowpea shafts and ground vines and husks

becomes additional source of income for farmers that cultivate cowpea and groundnuts. Valuation of the Nigerian livestock resources [23] puts the total livestock value at N60billion, based on mid-1991 market prices and as indicated by [22], account for as much as one third of the country's agricultural gross domestic product (GDP).

Social values: socio-cultural value of the ruminants varied across the country. While the sheep and goats are highly prized for cultural heritage in the southwest Nigeria, cattle is of much significance among the Hausa/Fulani in the northern region. Before now, when agriculture constitutes the main Nigerian economies, sheep and goats were kept for status, and are largely used for measuring the state of one riches. But with the relegation of agriculture from the economic fore, use of the number or size of farm animals as measuring tool of social status is no longer tenable, especially at rural level in southwest Nigeria where subsistence agriculture is the main practice. However, the small ruminants still found value in sacrificial offerings among the traditional worshippers in southwest Nigeria. Up till now, goat, specifically doe, constitutes traditional requirement as part of bride price and the animals are kept in memory of the enacted marital relationship between in-laws. Unlike beef and mutton, goat meat are generally considered and consumed as delicacy.

Unlike the devalued state of the socio-cultural value of the small ruminants in southwest Nigeria, cattle, sheep and goats remained relevant as measuring tools of social status and economic strength among the rural households in the northern region of the country. The size of cattle herds and flock of sheep owned by a particular individual or household determines the economic strength of such ones. In addition, a herder’s stock of animals constitutes his financial base thereby disposing the animals for income generation whenever it is necessary [24]. Cattle also serve as good means of transportation and animal traction among the livestock farmers in the northern region of the country, whereby the animals are used for land cultivation in preparation for crop cultivation, transportation of farm families to and from the farms and transportation of farm produce between farms and storage points. Given the volume and nature of excreta produce by cattle, the large ruminant have served as valuable source for manure for soil fertility and development of organic agriculture. [22] cattle produces manure outputs of 1368 kg DM/head/year and 248 kg DM/head/year by sheep for soil fertility.

4. Dynamics of ruminant livestock management system in Nigeria

In general, farm animals are poorly managed in Nigeria’s agricultural system owing to the fact that the animals are mostly managed on free range/extensive system and semi-intensive system. These management systems are basically influenced by cheap means of feeding the stock all year round. Based on this, the animals are thus allowed to roam the streets and neighbourhood to fend for themselves

with little or no special or conscientious provision of supplements for the animals. Although, commonly raised farm animals under the free range and semi-intensive systems include the monogastrics and ruminants, sheep and goats, alongside chicken constitutes the major farm animals largely raised in these systems of livestock management by the Nigerian rural households or livestock farmers.

Small ruminant management system: the small ruminants are however intensively managed on the free range/extensive system, especially in the southern part of Nigeria where crop farming dominates the agricultural practices and with farmers keeping an average of 10 sheep and/or goats. Under the free range system, the animals move about freely to feed on forages/grasses, which are abundantly available during the raining season, and on other feed source such as left over foods/ kitchen wastes and refuse dumps. Hardly are the animals provided supplementary feeds and even shelter by their keepers. The animals thus squat around corridors or available shades in the compounds. Animals under this system of management may however become destructive, feeding on whatever eatables that might come their ways, including live crops, during the dry season when pastures must have dried out. This implies that the free range system may be a healthy practice for ruminant management during the rainy seasons, at least for abundance of forage availability, and but unhealthy during the dry seasons as livestock infringement on the neighbourhood property often lead to conflicts.

Some households or livestock keepers on the other hand maintain semi-intensive management system whereby the animals are provided shelter and kept indoors for security purpose. The animals somehow have their movements regulated and as such are released to fend for themselves in the early and late hours of the day, after which they are kept indoors over the night. As it were in the extensive or free range system, the animals feed on natural pasture and kitchen wastes or by-products of processed foods/farm produce, especially during the rainy season. Although, hardly are the animals under semi-intensive management provided supplements or essential ration for consumption, efforts are made by their keepers to feed them with by-products from farm produce, especially during dry season when pasture are hardly available for free grazing.

The extensive management system is however largely applied for the WAD sheep and goats than for other breeds such as Balami, Uda and Yakansa breeds of sheep; and Sokoto Red goats in southwest Nigeria. This may not be unconnected with economic value of these breeds of small ruminants arising from their bigger body size and better market prices than the WAD breeds. In addition, these breeds of small ruminants are highly prized for social ceremonies and prestige; and are more tempting to be stolen than the WADs. The Balami, Uda, Yankasa; and Sokoto Red breeds of the small ruminants are thus kept on a ‘modified intensive management system’ whereby the animals are mostly tethered or kept in a guarded enclosure and fed on cut-and-feed forages and by-products of farm produce.

Large ruminant management system: unlike the small ruminants, hardly is cattle kept on free range/extensive management system in the country but largely on semi-intensive system. A level of modification is however applied to the semi-intensive management for cattle. Unlike the small ruminants that could be left to freely range about all alone, cattle are never left all alone to freely graze about or scavenge, but are conscientiously guided by the rearers in the search for pasture and water; and thereafter, are securely checked into the provided shelter. This may not unconnected with the social and economic value of the large ruminant, as the loss of a cattle, either in death or getting misplaced, is at great cost to the herder(s) and as such, the animals are jealously guided for survival, productivity and profitability. Socially, the size of the animal is highly intimidating to humans as appearance of unguided cattle in the public is known to cause commotions whereby people run helter-skelter. This farm animal is never neared as one would near sheep and goats. This situation thus accounted for the need to guide the cattle on grazing over a wide range of vegetations.

Nomadism/Exclusive pastoral system: in addition to the modified semi-intensive management of the cattle by herders, [12] other pastoral management systems commonly practised by cattle herders in the country include the exclusive, transhumant and agro pastoral systems. The exclusive pastoral practice or nomadism entails sole management of the ruminants, especially cattle for the socioeconomic wellbeing of the pastoral farmers. [12] The exclusive pastoralists do not grow crops but simply depend on sales of their ruminants and dairy products to meet their food needs. As a feeding practice, the exclusive pastoralists usually move their animals over long distances, usually through a set migration routes, in search of pasture for their animals or by going into advance arrangement with crop farmers for collection of crop residue for their animals.

Transhumance pastoral system: this entails rearing of ruminants in settlements with a low level of crop cultivation. The transhumant pastoralists [25], often have a permanent homestead and base at where the older members of the community remain throughout the year. The herds are however regularly moved in response to seasonal changes in the quality of grazing and the tsetse-fly challenge, or in an attempt to exploit seasonal availability of pasture. The herds are however regularly moved in response to seasonal changes in the quality of pasture and the tsetse-fly challenge, or in an attempt to exploit seasonal the availability of pasture. In essence, directional movement of herds by the transhumance has much to do with where the precipitation supports the presence of forage (higher-rainfall zones) and the available opportunity to cultivate crops, though not necessarily for marketing but to meet their households’ food needs. They however meet their other basic needs through the proceeds from sales of milk and other dairy products. While the women take care of the production and marketing of the dairy products in the local markets, the men take away majority of the herds in search of grazing, leaving the older members of the community with a nucleus of lactating females. The male herders however return at the start of the wet season to help with crop cultivation and where necessary, household income is supplemented with the sales of surplus male sheep or cattle.

Agro pastoral system: the agro-pastoralist practice entails conscious crop cultivation for both home consumption and marketing purposes alongside their reared cattle.[25] Agro-pastoralists hold land rights and cultivate acquired land for crops such as maize, sorghum, millet, yams and cassava, using family or hired labours. While cattle are still valued property, the size of herds are averagely smaller than that of other pastoral systems, usually about 30 head per household in southwest Nigeria [26], possibly because they no longer solely rely on cattle for their livelihood sustenance. In this case, the large ruminants are guided on grazing within a short distance range from their permanent place of abode while the women explored the lactating animals for milk and having it processed into local cheese (wara) and skimmed sour milk (nono) for consumption and local marketing. The Agropastoralists, [25], invest more in housing and other local infrastructure, and where their herds become large, they often send them away with more nomadic pastoralists. In addition, the agropastoralists often act as brokers in establishing cattle tracks and negotiation of “camping” of herds on farms, whereby crop residues can be exchanged for valuable manure, and as well for rearing of work animals, all of which add value to overall agricultural production.

Implications of the extensive and semi-intensive management systems: widespread adoption of extensive and semi-intensive systems of management for livestock in general. Ruminants, is believed to have been highly influenced by its relatively low cost of feeding the animals. Although, the animals may feed on freely available pasture and forages, these systems exposed the livestock to environmental dangers, ranging across stealing and death of the animals [27]. In addition, these systems of livestock management accounted for the generally observed poor production performance of the local breeds of ruminants in terms of meat, milk and litter production in Nigeria, and does not allow for proper recording keeping of the animals production performance [28]. On the same note, [24,29] stress that farm animals kept under the extensive and semi-intensive management systems are burdened with high incidence of diseases, parasites, low productivity and small contribution to household’s earnings.

5. Ruminants’ pests and diseases and dynamics of management

Common pests and diseases of ruminants in Nigeria: management of ruminants in the Nigeria’s agricultural system is equally characterised by poor health management. As a matter of fact, [30] maintenance and sustenance of healthiness of farm animals constitutes a major challenge to efficient livestock production among the Nigerian livestock entrepreneurs. Several surveys of ruminants kept by the rural farmers, and even in the markets, across the country revealed that the animals are mostly infected with one form of diseases/pests or the other [30-32]. According to Dipeolu (2010), most of the diagnosed livestock diseases in the country were identified to be bacteria, viral, fungi and parasitic-caused diseases. Specifically, the diseases include rinderpest, foot-and-mouth disease, and contagious

bovine pleuropneumonia to be the common diseases of cattle in Nigeria. In addition to these are small number of cases of dermatophilosis, lumpy skin disease, papillomatosis and keratoconjunctivitis. [33] on the other hand, indicated that infections such as pneumonia, helminthiasis, peste des petits and enterotoxaemia as common diseases of sheep and goats in Nigeria. Assessment of seasonal pattern of tick load on Bunaji cattle under the traditional management by [31] revealed the dominant tick species as Amblyomma variegatum; Boophilus decoloratus, Rhipicephalus (simus) senegalensis, R. tricuspis and Hyalomma spp.

Although, the incidence and intensity of pests and diseases infestation in the ruminant farm animals may vary between the rainy and dry seasons, and Across Nigeria’s ecological zones, the infestation portends a great danger for healthiness and productivity of the animals. According to Dipeolu (2010), livestock farmers may experience total loss of stock in death, or partial losses (through morbidity) in which the productivity of the animals becomes greatly reduced. Disease such as pneumonia, especially PPR, as the major causes of deaths in of ruminants; diarrhoea is mostly caused by parasitic gastroenteritis and PPR; and abortions and neonatal deaths are associated with starvation. In order to overcome these gruesome effects of pests and diseases on the ruminants, it becomes essential for the livestock farmers to either prevent or control the incidence of the diseases.

Pests and diseases control: in terms of control of livestock diseases, the livestock farmers hardly take up veterinary treatment of the affected animal(s), especially the small ruminant farmers, as they considered the veterinary treatment as too expensive to bear (Fabusoro, Lawal-Adebowale & Akinloye, 2007; Oluwafemi, 2009). In as much as the small ruminant farmers may which to save any diseased animals by taking to ethno-veterinary treatment, they may afford to lose the animal in death rather than expending their hard earned income on veterinary treatment of a diseased animal. The losses may be marginal in case of one or two of the animals are lost in death, but will be a great economic loss where about five or more of the animals are lost in quick succession as result of disease infestation (Dipeolu, 2010; Aina, 2012). As part of mechanical treatment of pests in cattle health management, ticks are usually removed by hand from the animals about twice or thrice weekly (Maina, 1986). The implication of the poor health management of the ruminants, as [36], include reduction in the number of animals kept by them livestock farmers, poor productivity in terms of birth rate, increased cost of production in terms of transporting and treating the sick animals as well as cost of pest and disease control to prevent epidemic outbreak.

On another note, ante-mortem and post-mortem inspection of the ruminants, particularly cattle, meant for slaughtering across the major abattoirs in the country further underline the poor state of ruminant, especially cattle, management in the country. The ante-mortem inspection of cattle to be slaughtered at a major abattoir in Ibadan, southwest Nigeria, between 1990 and 1994 showed that between 2.4% and 6.3% of the slaughtered cattle were pregnant (Dipeolu (2010). The implication of this, [37], was a

tremendous loss of potential cattle offspring that would have contributed to the cattle population growth and meat supply profile of the country. A post-mortem study of another major abattoir based in Lagos, Nigeria, between 2004 and 2007 showed that the slaughtered cattle portends a health risk to beef consumers as about 1.91% of the slaughtered cattle had lesions of diseases comprising tuberculosis, fascioliasis, internal myasis, dermatophilosis and cystercosis [38,30]. Laboratory examination of some of the meat-borne diseases showed that the meats are tainted with bacteria pathogens such as Campylobacter spp., Clostridium spp., Escherichia coli, Salmonella serotypes, and other enteric bacteria which may not cause clinical diseases in the animals but a potential threat to public health (Dipeolu, 2010).

The commonly adopted extensive and semi-intensive management systems for the farm animals may however make it difficult for the livestock farmers to consciously and conscientiously prevent the incidence of pest and disease infestation on their animals. This is based on the fact that, as the animals are allowed to freely roam the neighbourhood they readily contact infectious diseases or pests from other infected animals they mixed with in the course of fending for themselves, and may as well sustain injuries which in turn may eventually impair their health status and probably lead to their deaths (Lawal-Adebowale & Alarima, 2011).

6. Ruminant feeds and dynamics of utilization

Given the distinct nature of the ruminant’s stomach, the farm animals heavily depend on forage or raoughage as major feeds. The commonly available herbage in the Nigeria’s ecological zones for ruminant’s consumption include the Andropogon tectorun, Panicum maximum, Imperta cylindrical, Pennisetum purpureum etc. These grasses, which are fibrous in nature, are rich in cellulose and provide the ruminants a high level carbohydrate and some measures of vitamins and minerals. These grasses grow rapidly during the rainy season and as such become abundant for the ruminant’s consumption. The ruminant kept on free range thus feed freely on the naturally occurring forages. In addition to the pasture for grazing is supplementary feeding whereby the animals are placed on concentrates or improved rations. Supplementary feeding of cows significantly improve weights of the calves at birth (20.1kg) and at one year of age (107.9 kg) when compared with other animals not placed on supplements (with birth weight of 18.6 and 99.3 kg at one year). At 365 days of age, viability of calves from supplemented dams averaged 88% against 67% in calves from non-supplemented dams. Milk for calves and humans from dams on supplements averaged 128 and 179 litres/cow/year. Although, supplementary feeding did not improve calving intervals, it suggests that it every essential to place the ruminants on supplements for better productivity in term of milk and meat production.

Cost of supplementary feeding and non-availability of forage during the dry season greatly challenged efficient livestock feeding and management in Nigeria. Based on the need for adequate feeding, it is believed that about 85% of cost of livestock production is feeding, and given the poverty status of most livestock farmers and poor marketing system of farm animals, hardly could they take up supplementary feeding. This accounted for preference of extensive and semi-intensive systems of management. Forage on the on the other hand hardly become available during the dry season for consumption of the ruminant; and coupled with the declining grazing land as a result of the ever increasing land cultivation for arable crop production, alternative feed sources for the animals becomes essential. Utilisation of fodder from crop residues compensates for non-availability of grasses during the off-season. Other alternative to mitigate the effect of dry season feeding was the establishment of fodder bank whereby legumes are established and properly managed in a concentrated unit [41]. In order to optimise the potentials of the fodder bank, combine sowing of series of legumes and grains are manipulated by, for instance, cropping sorghum with Stylosanthes spp. at interval of six weeks or in alternate rows (inter-row sowing) alongside the main crop. A study of the grazing behaviour of cattle among the settled Fulani pastoralists showed that the farm animals utilized a wide range of different feed resources, notably sorghum and millet residues, during the dry season. As further indicated, the residue accounted for 12.6% of annual grazing time in Abet- a farming area, and for 6.6% in Kurmin-Biri- a grazing reserve. Browsing accounted for 1.4% annual grazing time in Abet, and 11.2% in Kurmin-Biri.

The fodder bank alternative however mainly benefits selected animals as not all animals are allowed to graze the bank. Fodder banks are designed not to supply forage year-round for an entire herd but rather to be used strategically for limited periods with selected animals, thus only pregnant and lactating animals are allowed to graze the bank. This suggests that, only a few ruminants had access to grazing or foraging during the dry season, and thus portends that dry season feeding constitutes a major challenge to livestock production in Nigeria. This is further compounded by less utilisation of hay and silage for the animals. Since the reared animals cannot survive without food, the implications of dry season feed problem include straying or deliberate guiding of the animals into farms for grazing thus leading to conflicts and violent clash between the crop and livestock farmers.

7. Future of ruminant livestock development in Nigeria

Although, ecological categorisation of the Nigeria has varied over time arising from changing trends of the commonly used natural factors [12], critical examination of the country’s ecozones in relation to livestock distribution revealed that the ruminants are distributed throughout the three major ecozones in the country, namely the semi-arid, sub-humid and humid zones. The semi-arid region, characterised by average rainfall of 500 – 1000mm, prolonged dry season and sparsely distributed vegetations, is known to have greatly favoured livestock management in the country over the years. But with the changing climatic trends in the country, the sub-humid zone and its characteristics rainfall distribution

range of 1000 – 1500mm, vegetative cover and moderately dry periods, now enclaves about 45% of the cattle in the country. In the same vein, studies have affirmed that the changing situation of tsetse flies infestation in the region, coupled with the prolonged rainfall period and good rainfall distribution range of more than 1500; has equally made the environment favourable to cattle and other small ruminants’ management. This observation suggests that Nigeria’s agro-ecologies have the potentials to favourably support livestock development in the country. This notwithstanding, there is need to consciously harness the environment to enhance the country’s livestock development through the following:

Efficient livestock feeding: exploration of the environment and the country’s breeds of ruminant potentials for livestock industry development are yet to be fully harnessed. The larger proportion of the ruminant livestock in Nigeria lies in the hands of herders who keep them under extensive and semi-intensive management systems, whereby the animals only rely on natural pasture and crop residue for survival. The ruminants may though have access to enough forage during the rainy season; it becomes a great deal of challenge to efficiently feed the animals during the dry season. In order to sustain the animals and ensure better productivity, there is need to explore the available natural pasture for silage and hay making such that the animals could be adequately fed during the dry season. In addition, there is need for paddock establishment, especially in the rural communities or reserved areas, for grazing by the ruminants. Although, forage constitutes the bulk of food needed by the ruminants, supplementary feeding is equally essential, especially for the lactating animals. In view of this, the farm animals’ diet needs to be supplemented with meals such as cottonseed cake, wheat bran, molasses, drugs and mineral salt licks etc. In view of the fact that the indigenous cattle can gain an average of 0.9 to 1.2 kg per day on silage and concentrate rations [22], it suggests that the local breeds of cattle have the potentials for efficient utilisation of feed for better production performance.

Veterinary services: pests and diseases portend a major risk to livestock development in Nigeria, as incidence of pests and diseases are common in the country’s livestock system. Although, prevention is known to be better than cure, it is invariably impossible to out rightly prevent the farm animals from being infested with either pests or diseases. This premise thus calls for establishment of sound veterinary services where infected animals could be taken care of. This requirement has been a great challenge in the Nigeria’s livestock management system. Apart from inadequate veterinary services in the country, current veterinary therapy in Nigeria is suffering from both scarcity and the high cost of drugs thereby making it impossible to save the livestock industry as it were in the country. Although, the livestock herders may take to ethno-veterinary treatment of their animals, this becomes possible only when the symptoms become manifested, and by then a serious internal damage or impairment of the animals’ health might have taken place. The implication of this is that, it may be impossible to adequately treat the animals or ensure proper clinical remedy. This situation thus calls for government and non-government organisations intervention for development of the veterinary services such that it becomes affordable to be patronised by the stock herders. The easiest and most rational solution to the problem of livestock health is to develop acceptably effective drugs from reasonably inexpensive

sources for use as supplements to commercial drugs. The veterinary traditional medicine practices may still be of value in the animal health care, but should be subjected to scientific investigation for efficacy. In the light of this, it becomes important to have baseline data about traditional ethno-veterinary practices for ethno-veterinary medical information generation. Combination of the orthodox and ethno-veterinary care could thus save the animals of impaired health and enhance productivity.

Livestock breeding: livestock breeding is crucial to livestock development globally. Good system of management of the resulting breeds/offspring from the crosses – in terms of intensive keeping, good health care and feeding, is however crucial to better performance of the animals. Adopted poor management systems for farm animals in Nigeria and most other developing countries certainly accounted for the poor production performance of the local ruminant breeds. The same poor management system accounted for poor performance of the exotic breeds imported into the country in the 70 (Blench, 1999). Just as the exotic breeds are known to have performed excellently well in their countries of origin under good management practice, results from experimental stations results from stations and universities farms across Africa showed that productivity of the animals could be improved under more intensive management. Similarly, where crossing has been successful under good management practice, dairy cattle dairy cattle portrayed a linear increase in milk yield as the exotic gene is increased up to the 7/8 level. The F1 Friesian x Bunaji cow (50%) gives 1684 kg, the 3/4 (75%) gives 1850 kg and the 7/8 gives 2051 kg of milk in a lactation of about 260 days. This suggests that good practices and cross breeding with the exotic breeds of desirable quality stand the chance of enhancing the country’s livestock development.

Profitable livestock marketing system: among all other agricultural enterprise production, livestock management remains a delicate and expensive venture; it however has the potentials of profitable returns. The livestock is delicate in the sense that the animals need to be adequately fed, not just with any ration, but a balanced ration for productive performance. In the same vein, the health of the animals cannot be forgone as healthiness of the animals is not only a vital for production performance, but survival and sustenance of the livestock venture. Placement of the ruminant on a good ration is certainly at a great deal of cost or financial incurment, the poor economic status of the ruminant keepers in the country however makes it extremely difficult to build the livestock industry. This situation may however be reverted through efficient marketing system of livestock and its products and by-products. Poor marketing system is one of the bane livestock development in the country, whereby the animals are locally sold either directly as live animal or meat.

Livestock research development: development of the Nigeria’s livestock industry will not magically occur, but through conscientious efforts in livestock research. This calls for baseline data generation about the breeds of ruminants in the country, their production performance and marketing. Other information-base that must be established include the common livestock feeds (pasture and feed meal

supplements) and common pests and diseases of livestock and their effects on the animals. This will harm the livestock research institutes with the salient information as bench mark for research work and generation of livestock innovation. Social scientists inclusion in livestock research development is crucial as this disciplines helps to ascertain the psychology of the ruminant keepers and their economic status to adopt and adapt generated livestock innovation. Similarly, the social scientist, especially the economists, will help to ascertain the economic implications of the innovations and the market driving force for ensuring efficient production and marketing of livestock and its products.

8. Livestock development in Nigerian: Policy recommendation

Over 90 percent of the ruminant livestock lies in the hands of rural livestock farmers, especially the pastoralists, in Nigeria. The animals though, are of considerable economic importance in Nigeria’s economy, poor management system of the stock has greatly hindered the development of the livestock. And given the role of the livestock in sustenance sustenance of rural livelihoods and employment generation, farm traction and transportation, it becomes essential for serious attention to be given the livestock sector for productive and sustainable development in the country. In this regard, the livestock research institutes, comprising National Animal Production Research Institute (NAPRI), National Veterinary Research Institute (NVRI), and Nigerian Institute for Trypanosomiasis Research (NITR), need to be strengthened in terms of qualified and adequate research personnel and equipment for quality research on livestock related issues. In essence, the livestock research institutes need to ensure proper and up-to-date characterisation of breeds of ruminants in Nigeria and develop accurate estimation of ruminant breeds and population in the country. In essence, the livestock research institutes need to ensure proper and up-to-date characterisation of breeds of ruminants occurring pests and diseases in livestock, and the lethal effects of ill-health causative agents on the animals.

To effectively achieve this, research in livestock development should go beyond the traditional field visit to animal sheds for physical livestock condition monitoring and data collection. The country needs to harness the emerging information and communication technology (ICT) devices that allow for remote and continuous monitoring of livestock conditions and collection of data on the animals without physically being in the animals’ sheds. With this, efficient data and information on farm animals’ health status, productivity, feeding regime and feed conversion could be readily monitored. Similarly, documentation of particular livestock pedigree, characterisation of breeds of farm animals and simulation of the animals’ characteristics and production performance could be enhanced for effective management and transformational development of the livestock sector. In addition to this is need for better development of better grazing system and management practices in the country’s livestock sector. Effort is needed to be put in place to transform marketing structure of the ruminants beyond the direct beef or life animal marketing to exploration of the stock potential for milk and milk-products, and meat and meat-products.

Dynamics of Ruminant Livestock Management in the Context of the Nigerian Agricultural System

In 2015, InTech marked its 10th anniversary since publishing the first book. In these 10 years we published some exceptional research, and to highlight this, we complied the Research Collection Books containing the leading chapters on a specific research topic.

The chapters have been selected following different criteria, among which are the number of downloads of a chapter, the number of views, readers feedback and citations.

In celebration of our 10th year anniversary, and to thank our authors for their contributions and acknowledge the specific merit of their work, their chapter has been included in one of our Research Collection Books.

Note: The Research Collection books are to be found in our Book Catalog in order to avoid duplicating chapters in our reading platform. By O.A. Lawal-Adebowale

DOI: 10.5772/52923

http://www.intechopen.com/books/livestock-production/dynamics-of-ruminant-livestock-management-in-the-context-of-the-nigerian-agricultural-system

Titer Testing Your Dog: Are You Wasting Your Money?

Vaccine Articles and News / By Will Falconer, DVM

m seeing a potentially dangerous trend among animal owners in pursuit of avoiding vaccinations, a laudable goal. That same trend can cost you needless money, so gather round, and let’s explore this.

Cheryl wrote in the comments to last week’s post:

One of my furbabies is a little Chihuahua named Ricco who has an enormous amount of skin issues and allergies. When I discovered he had been to about 4 different households in his life before me, I realized

that his issues are more than likely due to vaccinosis. He is now slowly on the mend and all my furbabies now get yearly titers. (italics mine)

As I alluded to in my Fallacies of Titer Tests page, titers have value, but using the information from them wrongly will:

Hurt your animal

Hurt your pocketbook

The Dangers of a Little Knowledge

You are part of a growing community of people seeking to provide the best natural care to your animals. You want them to be Vital Animals, those glowing, well-balanced, fully free animals that bring you joy not only today and this week, but for many happy healthy years into the future. And, when it’s time for them to shuffle off their mortal coil, Vital Animals can usually do this at home, with ease, naturally, and without ERs or euthanasia solutions in the equation.

A large part of getting this glorious outcome depends on you walking the Natural Path, and taking responsibility for the animals in your care. It’s no longer in your best interests to turn that responsibility over to Dr. WhiteCoat, as he’s not on the same path, especially in the most important piece of health care you must decide: vaccinations.

Many of you have, rightly, sought to reduce or eliminate vaccinations after reading in various places that the common practice of repeatedly vaccinating your animal throughout her life is neither useful nor safe. One alternative that’s been offered to you is titer testing.

Titers: What, Why, and When?

Titer tests are blood tests that measure the level of antibodies your animal has made. Your dog goes in, gets a needle poked into a vein, blood is pulled into a syringe and it gets tested, usually in a lab but now perhaps, in your vet’s clinic. You pay anywhere from $40 to $200 to get some numbers on a piece of paper.

Many view these numbers as their “get out of vaccination jail” card. But I submit misreading these numbers may get you and your animal into trouble. Let’s dig in and try to avoid that.

[icegram messages=”19010″]

The What: Numbers? I Don’ Need No Steenking Numbers!

The lab report comes back with numbers indicating the amount of antibodies your animal made against those diseases tested (usually canine distemper, parvo, rabies, or feline distemper).

The idea behind titer testing is that if your dog or cat or horse has antibodies against the viruses that threaten to cause disease, you can rest easy that protection exists.

That’s an immunologically sound thought. But only to a point.

The Why: Assessing Immunity

The reason these titers could be of interest is that the numbers on a titer test correlate pretty well with immunity. Immunity is resistance to disease. It’s what we’d like our animals to have, and it’s what we hope is the outcome of those much maligned things called vaccinations.

But:

Vaccination does not equal Immunization

Did you know this? It’s not common knowledge, even among many veterinarians. It’s often assumed that pumping the vaccine into your animal automatically means he’s now safe from the dreaded diseases that could kill him. Not so.

For example, if you vaccinate your pup at six weeks of age, or even younger, there’s about a 50:50 chance that no immunity will result to distemper or parvovirus. Why? Mom’s colostrum gave your pup

antibodies against both, and those antibodies are preventing the vaccine from stimulating his own immunity. Mom’s protection is temporary though, and we need long term protection.

Many also think that immunity “runs out” on day 364 since the last vaccine was pumped in. When those postcards come, saying, “Beau is due for his vaccinations! Please call for an appointment today!”, it sets some people into a bit of a panic.

The act of squirting more vaccine under Beau’s skin is somehow thought to be akin to filling an empty reservoir.

Nothing could be further from the truth.

A truth in immunology is this:

“Immunity to viruses persists for years or for the life of the animal.”

And another truth, from the same veterinary immunologists:

“Furthermore, revaccination…fails to stimulate…(further immunity)”

The When: Run a Titer When it Makes Sense. Save Your Money (and your pet!) by Not Running it When it Doesn’t!

It’s a given that titers have limits. Any immunologist knows this. They fail to measure a significant piece of immunity, called cell mediated immunity.

The most useful time to run a titer test is after your youngster has received her initial series of vaccinations. Especially if you’ve limited that series to just one or two vaccinations, the last being after 16 weeks of age. The odds are you’ve just conferred lifetime immunity to your youngster.

If you want to know how effective your vaccinations were in conferring immunity (i.e. did vaccination = immunization?), ask your vet to run a titer test a few weeks later.

Here’s what’s useful in assessing those numbers:

If there’s any measurable titer to the disease in question, your goal has been reached. Your youngster has actively made immunity to those viruses you had squirted in via vaccination. It doesn’t need to meet some standard of “protective” to be useful; it just has to be positive.

That indicates you are more than likely now the proud owner of an immune pet, and you can confidently say “No!” to more vaccines. For how long?

For life.

Falling Titers: Oh-oh or No Big Deal?

Testing yearly will eventually show titers that fall off. Does that mean immunity is gone and you’ve got to head in for a “topping up” of the immunity reservoir?

No!

(And stop thinking that a “reservoir” even exists. I actually hesitated writing this word, as I don’t want you to think this is in any way reality).

It only means the antibody levels are waning. And why wouldn’t they? It’s a waste to keep making more antibodies when there’s no exposure to more virus. In its wisdom, the vital force deems its work is done in this area, and stops pumping more antibodies into the blood.

But, the good news is this: cellular memory is still very likely present to the bad guy you vaccinated against and, should your buddy ever be exposed to this virus again, BOOM, the antibody production factory fires up and the titer rises once again, and rather quickly at that.

So, it’d be a mistake to equate a titer that’s fallen with a lack of protection, and a greater one to think you need more vaccinations to re-establish protection. Immunity is still there, quietly, watchfully alert.

[In the older guys, I like to add a nice immune boost in the form of transfer factors, just to be sure their immune systems are acting out of the greatest responsive intelligence. And perhaps that’s a subject for another post.]

Have you used titers? Does this info help? Maybe you’ve even seen this: your animal’s titers kept on increasing for years after you stopped vaccinating! That’s what happened to my colleague’s dog on testing rabies titers. Let us know in the comments.

About the Author Will Falconer, DVM

Dr Will Falconer is a Certified Veterinary Homeopath based in Austin, Texas with a global practice treating all species with the most holistic medicine ever. His latest thoughts and useful information can be found on his blog at VitalAnimal.com

http://www.dogsnaturallymagazine.com/titer-testing-dog/

Vaccine Titer Tests

153

These blood tests are the best way to determine whether your puppy or dog is protected against common infectious diseases.

By Nancy Kerns

It’s always been interesting to me that few people know why young puppies have to be vaccinated several times, a few weeks apart – and yet, few question the practice. There’s a term for it: puppy shots! The concept is widely accepted – and rarely explained. In my experience, when people ask why a puppy needs repeated vaccinations, they are told something vague and inaccurate, such as, “It takes a few shots to build the puppy’s immunity.”

The use of vaccine titer tests can help you decide whether or not your puppy is completely protected from disease after her “puppy shots,” or if your adult dog really needs any more core vaccines.

It’s a similar situation with annual or semi-annual so-called vaccine “boosters” – not many people know much about their dogs’ vaccination status, so they take their veterinarians’ word that their dogs are “due” for more vaccinations.

The truth is, there is no single vaccination protocol that will protect all dogs for all things, without over-vaccinating most of them. Vaccination really ought to be determined on a case-by-case basis, because each dog’s risk factors are unique, based on his age, genetic inheritance, current health, geographic location, and lifestyle.

That said, there is a very useful tool that can help an owner gain solid information about whether her dog is likely to be protected against the most common infectious diseases: the vaccine titer test. Positive test results can also give a dog owner some solid ammunition for countering those who blindly promote (or require, in the case of some boarding or training facilities) so-called “current” vaccinations, which can mean many different things to different people.

Core Vaccines

The closest thing that there is to a universal list of recommendations for canine vaccinations in North America is produced by the American Animal Hospital Association (AAHA). The veterinary medical experts who have contributed to the AAHA’s recommendations agree that there are a handful of infectious diseases that pose a threat to all dogs and that all dogs should receive vaccinations for those diseases; these are commonly referred to as the “core” vaccines.

Core vaccines include:

Canine distemper virus (CDV, commonly referred to as distemper)

Canine parvovirus (CPV, parvo)

Canine adenovirus (CAV, better known as canine hepatitis)

Rabies

Among healthy dogs, the first three “core” vaccines are expected to induce a protective immune response lasting at least five years. However, much longer protection from these vaccines has been demonstrated in dogs in many studies – sometimes, even as long as the dogs’ lifetime.

Rabies is a slightly different case. Because the disease poses a significant risk to human beings, it’s the only vaccine that is required by law to be administered to dogs. Each state has its own legal requirements for rabies vaccination. Some require annual rabies vaccinations; the rest require the vaccination be given every two or three years (depending on the state). There is ample evidence that rabies vaccines confer protection from rabies for longer than three years, but given the public health risk to humans, there is considerable pushback from public health officials to the idea of extending the legal requirement for rabies vaccines.

Noncore Vaccines

There are also a number of vaccines for infectious diseases that can pose a risk to some dogs, depending on individual risk factors and geographic location. These are called the “noncore” vaccines, and they include:

Bordetella bronchiseptica (Bb, kennel cough)

Borrelia burgdorferi (Lyme disease)

Canine coronavirus

Canine parainfluenza virus (CPiV, parainfluenza)

Leptospira spp. (leptospirosis)

Measles virus

Most of these vaccines are useful in certain circumstances, but the evidence falls short of proving that they are helpful to all dogs everywhere. Further, there is proof that some of the noncore vaccines can be harmful to certain dogs. For these reasons, the AAHA recommends that the administration of these vaccines should be decided on an individual basis by a veterinarian familiar with the puppy or dog and the local risks.

As just one example, Lyme disease is prevalent in some parts of the country, and quite rare in others, and it is transmitted by tick bites. Also, some dogs can suffer serious side effects from the vaccine. So if a dog lives in a part of the country where Lyme is not common, and/or if you have a dog who has very little exposure to environments where ticks are likely, the risks of vaccinating that dog for Lyme outweigh the potential benefit.

A Test of Protection

Let’s go back to the diseases that every dog should be protected from; these are the ones that are most likely to appear on the reminder postcards sent out by your veterinarian – and the ones that you will experience the most pressure (from your veterinarian’s staff) to repeat in order to keep “current.” Depending on your vet, “current” may be defined as annually, every three years, every five years, or longer. As little as 20 years ago, it was widely thought that annual vaccinations “couldn’t hurt, and might help,” and most veterinary practitioners recommended that their clients vaccinate every dog annually. But today, we understand that canine vaccines don’t “wear off” or “become due” in any standard amount of time. Also, it’s better understood today that randomly stimulating the immune system can

have negative consequences that we don’t fully understand, so we should be more discriminating about vaccinations.

Let’s put a fine point on it: The core vaccines are an important and life-saving component of responsible dog care when administered properly – neither too frequently nor inadequately. Which brings us back to the original question: How do you know when your dog is protected – or unprotected – against the core diseases?

The best tool at our disposal today is something called a vaccine titer test, and in our opinion, every dog should be tested at least once, and again every three years or so.

When we vaccinate a dog, we administer disease antigens (in a weakened, modified, or killed form that can’t cause disease) in order to stimulate the dog’s immune system to produce antibodies, molecules that are produced to recognize and neutralize that specific antigen, should they ever cross paths. A vaccine titer test checks for and quantifies the amount of antibodies to specific diseases that a dog has circulating in his blood.

The technology exists to detect any specific antibody for which we may have vaccinated a dog; we can test whether a dog possesses circulating antibodies for any disease. But as it turns out, that’s not necessary.

There are two types of antibodies that are highly predictive of the competence of a dog’s overall immune response to vaccines: distemper and parvo. If a dog has been vaccinated against distemper and parvo, and develops antibodies to these diseases, the odds are very good that he has developed antibodies for any other core disease for which he has been vaccinated.

In other words, a positive vaccine titer test for parvo and distemper can put your mind at ease – and should put your veterinarian’s mind at ease – that your dog is adequately immunized against the core disease vaccinations he has received.

The AAHA – and vaccine-savvy veterinarians – recommend that puppies receive a vaccine titer test about two weeks after they have been given their final puppy core vaccinations (which should occur when the puppy is about 14 to 16 weeks old). Again, a positive result for both distemper and parvo

antibodies indicates that the puppy is properly immunized. The AAHA’s recommendation is that adult dogs are tested about every three years, to ensure that they still possess circulating antibodies for the core diseases.

Continue to page 2 for more information on titer tests for your dog

Negative Results

What about when vaccine titer tests come back negative for distemper and/or parvo antibodies? The significance of this result depends on a few factors, including the dog’s age and vaccination status, and the vaccine used.

If the test was for a puppy who recently completed a series of core vaccines, he should be revaccinated promptly, and then a titer test run again about three weeks later. The most likely explanation is that something called “maternally derived antibodies” (MDA,antibodies he received via colostrum from his mother) were still active in his bloodstream when the vaccines were given, and they neutralized the antigens present in the vaccines.

Maternal antibodies don’t last forever, however; they “fade” at an unpredictable rate. The maternal antibodies can fade quickly (or may be absent) if a pup’s mother was unvaccinated, or he received very little or no colostrum from his mother. If his mother had an unusually high antibody titer herself (the highest levels result from surviving an infection with the disease itself), her pups’ MDAs might take longer than usual to fade. This would render all of the puppy’s early vaccinations useless; only vaccinations given after the MDA faded would stimulate the puppy’s own antibody production.

However, if the puppy was undoubtedly more than 20 weeks old when he was vaccinated the final time, and his vaccine antibody titer test results (from a sample taken three weeks after the last vaccination) were still negative, it could indicate that he was a “non-responder” – a dog who could not be properly immunized.

It’s been estimated that 1 in 1,000 dogs are not able to respond to the canine parvovirus vaccine; those dogs will be at a lifetime risk of contracting the disease (though the risk if greater when they are puppies; adults are more likely to pull through with prompt and dedicated care). Far more rare are dogs

who cannot respond properly to the distemper vaccine antigen; this is estimated to occur in about 1 in 10,000 dogs.

The third possibility for the dog’s failure to produce antibodies in response to vaccination: bad or improperly stored vaccine. In this case, a different vaccine should be used, and the dog re-tested a few weeks later. According to the AAHA guidelines, “If, after one or more attempts at revaccination with a product different than the one originally used, the dog fails to develop an antibody response” to distemper or parvo vaccines, the dog should be considered a nonresponder.

Canine vaccine experts agree that if a dog previously had a positive antibody titer for both distemper and parvo, and upon later titer testing is negative for one or both antibodies, he should be revaccinated with the core vaccines, and another titer test should be ordered about three weeks later.

There are people who disagree, however. The antibodies may no longer be in circulation, but if they had been present earlier in the dog’s life, the dog should have immune memory cells – that we can’t detect with lab tests – which should, if a dog is exposed to the disease antigen, recognize the antigen and re-start production of the appropriate antibodies.

It’s a valid theory . . . but the most-respected small-animal vaccine expert in the country, Ronald D. Schultz, PhD, of the University of Wisconsin-Madison, disavows the wisdom of the practice. Dr. Schultz has studied animal vaccines for decades, and as a consultant and researcher, has helped develop many of the ones on the market. “You have to consider a dog who has no detectable antibodies against disease to be unprotected for that disease,” he says firmly. “I would revaccinate the dog. The risks of contracting the disease are far greater than the risk posed by vaccines – particularly in a very infrequently vaccinated animal.”

Caveats

I can tell you from personal experience that it can be difficult to be the first in your veterinarian’s practice to ask for a vaccine titer test in lieu of automatic revaccinating. The staff may not understand which test to order; a practice manager once told me it would cost $500 – $100 for a test of each vaccine in the combination shot the vet wanted to give my dog Otto. I actually helped them find and order the appropriate test from their laboratory catalog, but switched veterinarians shortly afterward.

During my second visit to the next veterinary clinic I tried, one of the practice owners spent 20 minutes arguing with me about the value of titer tests. “There is no way to know what titer numbers are protective,” she stated, and added that “even dogs with positive titers can contract disease.”

Those statements are both technically true – but it’s very, very rare for a dog who has any circulating antibodies to a disease to become infected with that disease upon exposure. Practitioners who make statements like this are unlikely to add the corollary to this – that dogs who do not have detectable antibodies to a specific disease may be able to fend off a challenge (exposure) to that disease, again, thanks to as-yet immeasurable “cell-mediated immunity.”

I want a collaborative professional relationship with my dogs’ veterinarian. If we have very different opinions about something as basic as vaccination, the chances are we will butt heads over other treatments, too. I advise looking for a new doctor to work with if your vet is resistant to running a titer test in lieu of needless and potentially harmful overvaccination. In my experience, veterinarians who are either under 40 or interested in holistic medicine (or both) will readily and with professional curiosity order a titer test for your dog.

Nancy Kerns is the editor of WDJ.

Continue to page 3 for information on ordering a vaccine titer test, and a special story on two shelter dogs and vaccination.

Ordering vaccine titer tests & a tale of two shelter dogs and vaccination

The veterinary medical laboratories that provide vaccine titer tests all offer a combined canine distemper/parvo vaccine titer test that is less than the cost of running two separate tests. The price you pay will vary, depending on which lab your vet uses and how much your vet charges for taking a blood sample for your dog and sending it to a lab; your veterinarian may also mark up the cost of the test.

The labs operated by veterinary vaccine experts Jean Dodds, DVM (Hemopet) and Ronald Schultz, PhD (Dr. R.D. Shultz Laboratory at the University of Wisconsin-Madison) charge a flat fee for the tests, but

you still have to pay your veterinarian for taking and shipping the blood sample. Dr. Shultz’s lab has the lowest-cost test of $25; this price is partially underwritten by Maddie’s Fund, as the samples submitted become part of ongoing studies in vaccine research.

The large national labs charge different prices depending on the size of the local market and the volume of tests (all the lab tests, not just titers) ordered by your individual veterinarian.

Some vets now offer in-office vaccine titer tests, such as the Synbiotics TiterCHEK® CDV/CPV test. This can be run while you and your dog are in the clinic for an examination, making it possible for you to follow up on the spot with a vaccination if your dog has a negative result. Again, the price charged by your own veterinarian will vary for these tests.

Antech Diagnostics: $75 - $150

Irvine, CA

(888) 397-8378

Hemopet: $52

Garden Grove, CA

(714) 891-2022; hemopet.org

Idexx Laboratories: $75 - $150

Westbrook, ME

(888) 433- 9987; idexx.com

Dr. R. D. Schultz Laboratory: $25

School of Veterinary Medicine, University of Wisconsin-Madison. (608) 263-4648. To download an order form to submit a blood sample to the Dr. R.D. Schultz Lab, go to the link at: http://www.maddiesfund.org/Maddies_Institute/Videos/Maddies_Laboratory.html

A Tale of Two Shelter Dogs and Vaccination

I adopted my mixed-breed dog Otto from a local shelter in June 2008. He was estimated to be about 7 months old and had been turned into the shelter in early May, about six weeks before I adopted him. At the time I adopted him, he had been vaccinated five times already, with four combination vaccines and once for rabies.

Given his estimated age when I adopted him – at least 6 or 7 months old – I felt confident that no maternally derived antibody would interfere with any of those vaccines, and that Otto was more than adequately immunized. (In fact, it’s likely that he was overvaccinated, a practice that is typical in shelters.) Had he been younger, so that maternally derived antibodies could have nullified his vaccinations, I probably would have ordered a vaccine titer test at the time of adoption, to confirm his immunization status.

In May 2009, Otto was due for and received a (legally required) rabies vaccination. Standard practice calls for the use of a one-year vaccine when the dog is first vaccinated for rabies, and then vaccines that are approved for longer periods after that. In California, the longest period that a dog can legally go between rabies vaccinations is three years, so I asked for a three-year rabies vaccination at that time.

The veterinarian who saw Otto for that visit gently recommended another combination vaccine, but I demurred and this sufficed. However, the invoice I received for the visit indicated that Otto was “due” for a “DHLPP-C annual vaccine” and a “Bordetella annual vaccine” the following month – a year after his last combination vaccine. No one seemed very concerned about the vaccinations at this time, least of all me.

In April 2010, I made an appointment with the veterinarian who had seen Otto the previous spring; I needed to get a new prescription for heartworm preventatives for Otto. At this appointment, the vet (a gentleman who is probably in his late 60s or early 70s) pressed hard for Otto to receive another combination vaccine. We bantered a bit about vaccination schedules and overvaccination. I finally asked if he’d feel better if we had a titer test result that showed Otto still had circulating antibodies to parvovirus and distemper. He said he would, so I had him take a blood sample and send it off to IDEXX Laboratories. (Despite his age, this was probably a first for his clinic. The office manager first quoted me $500 for the titer test. When I insisted that was too much, she admitted that she was looking at a price book for the lab and wasn’t certain which of the tests she was supposed to order. I helped her locate the code for the correct test, which IDEXX called the “Vaccination Profile Canine (ELISA),” and paid $100 for the test.

I have ordered annual vaccine titer tests for Otto ever since, and every one has come back with strong positive results. He was vaccinated with another three-year rabies vaccine in 2012, and is next required by law in early 2015. I have no plans to vaccinate him for anything else unless one of his titers comes back negative.

In January of this year, my son adopted a puppy from the same shelter. Cole’s estimated age was 12 weeks. He had been vaccinated with a combination vaccine four times since he arrived at the shelter.

I brought him to see my veterinarian at the estimated age of 18 weeks for a titer test. The result came back positive for parvo, but negative for distemper! Oh no! Did we inadvertently adopt a non-responder, who would be at risk for distemper throughout his lifetime?

I had ordered the test from Dr. Shultz’s lab, and the results take a little longer than from the big commercial outfits, so it was two weeks before I took Cole back to the vet to discuss the results. We agreed we should revaccinate with a different product, and then run another titer test. During this consultation, the vet examined Cole thoroughly, and suddenly was struck by Cole’s teeth. “I don’t think he’s 20 weeks old,” she said. “I bet he’s more like 16 weeks today.” We surmised that “maternal interference” was to blame for his negative titer for distemper antibodies.

We revaccinated Cole and ran another titer two weeks later. This time, the results were a nice high positive. Whew! I can rest now, knowing he’s protected.

http://www.whole-dog-journal.com/issues/17_6/features/Vaccine-Titer-Tests_20988-1.html

Titer Testing

An alternative to annual "jabs"

By Mardi Richmond, MA, CPTD-KA

For most of us who share our lives with dogs, making sure they are vaccinated tops the list of preventive-care tasks. We mindfully take our puppies or newly adopted dogs for their recommended vaccines. We routinely return to our veterinarian or vaccine clinic when that postcard or email arrives, reminding us that our dogs are due for booster shots. We know vaccination offers critical protection from diseases such as canine parvovirus, canine distemper virus, rabies and more.

However, many of us question the concept of “routine” when it comes to vaccinations. While grateful for the protection that vaccines offer, we are increasingly aware of their possible unintended consequences. That’s where titer testing comes in.

Titer tests are among the tools that dog owners and veterinarians can use to help minimize the risks of both infectious diseases and unnecessary vaccinations. Simply put, these tests can tell you if a previous vaccine is still protecting your dog. If it’s still working, you don’t have to revaccinate.

Dr. Evelyn Sharp of My Personal Vet in Santa Cruz, Calif., has used titer tests with her own dogs since she began practicing veterinary medicine in the mid-1990s. The first dog she regularly tested was her Border Collie mix, Ace. Titers showed that the protection provided by Ace’s initial puppy series and one-year booster lasted the rest of his life. With the recent availability of in-practice titer-test kits—VacciCheck from Biogal Laboratories and TiterCHEK from Synbiotics Corporation—titer testing has become even easier to do.

Because the newer titer-test kits are affordable, accurate and can be run inhouse (rather than by a lab), Dr. Sharp now suggests titer testing as part of preventive care. With the information she gets from the titers, she can provide a customized vaccination protocol for each dog, keeping the dog well protected while minimizing the risks of over-vaccination.

The most recent American Animal Hospital Association (AAHA) Canine Vaccination Guidelines say that reported side effects from vaccines vary from injection-site reactions, lethargy, lack of appetite and fever to more serious adverse events, including allergic reactions, autoimmune problems and, rarely, sarcoma or other tumors. The decision about when to vaccinate requires a riskbenefit analysis. Most experts agree that vaccines are critical to the overall health and wellness of our dogs (and cats), but many also agree that giving a vaccine when it is not needed exposes animals to unnecessary hazards.

So what exactly is involved in titer testing? A “titer” is a method of measuring antibodies in a blood sample for specific diseases. Your vet will draw a small amount of blood and then run that blood through the test. Titers are usually expressed as a ratio; if the titer number is high, it means that your dog has enough antibodies to fight off that specific disease and is considered to have immunity from infection. For many of our dogs, that immunity is the result of a previous vaccine. However, immunity can also develop because a dog had the disease in the past. Either way, a high titer means your dog is protected.

If the test shows a low titer, your dog may not have immunity. The interesting and perhaps odd detail (odd, at least, from a layperson’s viewpoint) is that a low titer is not completely definitive. A dog may still have some protection. Still, the accepted standard with the in-house test kit is that a low titer means that you and your veterinarian should discuss revaccinating.

Just as vaccine prices vary, the price of a titer test can also vary from veterinary practice to veterinary practice. According to Dr. Sharp, the VacciCheck tests three diseases—parvovirus, distemper and adenovirus (canine hepatitis)— and generally runs between $45 and $80, which is a little more than most vaccines, but not unreasonably high.

AAHA vaccine guidelines say that titer testing is an appropriate way to check for immunity to parvovirus, distemper and adenovirus. However, it is not recommended for canine leptospirosis, bordetella or Lyme disease, because these vaccines only provide short-term protection.

http://thebark.com/content/titer-testing